Synthesis of thiolated oligonucleotides without capping and without recirculation of the thiolating agent

Abstract

The invention relates to a novel process for the production of a linear P-linked oligonucleotide which is characterized by a sulfurization step which requires no recirculation of the sulfurizing agent and which does not involve a separate capping step in the stepwise addition of nucleoside residues to the 5'-terminus of the growing chain. The novel process allows for shorter times for each reaction cycle in the oligonucleotide assembly which amounts in a substantial time saving for the manufacture of longer oligonucleotides.

Description

[0001] Case P39706

[0002] Synthesis of thiolated oligonucleotides without capping and without recirculation of the thiolating agent

[0003] The invention relates to a process for the production of a linear P-linked oligonucleotide containing at least one phosphorothioate intemucleoside linkage, comprising the step of sulfurizing a tricoordinated phosphite triester of the formula I wherein

[0004] R1is a hydroxy protecting group;

[0005] R2is independently selected from hydrogen, halogen, Ci-6-alkoxy or 2 ’ O- (2-C i -6-alkoxy-C i -6- alkyl) ;

[0006] R3is a solid support or an oligonucleotide moiety bound to a solid support;

[0007] R4is hydrogen or

[0008] R4is methylene or Ci-4-alkyl substituted methylene connected to R2, which is oxygen; with a sulfurizing agent to form a tetracoordinated phosphorothioate of the formula

[0009] II

[0010] RAU 02.06.2025 Nucleobase

[0011] II wherein R1, R2and R3are as above, characterized in that no recirculation of the sulfurizing agent is taking place and that the process does not involve a separate capping step in the stepwise addition of nucleoside residues to the 5'-terminus of the growing chain.

[0012] The oligonucleotide synthesis in principle is a stepwise addition of nucleoside residues to the 5'-terminus of the growing chain until the desired sequence is assembled.

[0013] As a rule, each addition is referred to as a synthetic cycle and in principle consists of the following chemical reaction pathway: ai) de-blocking the 5’ DMT-protected hydroxyl group on the solid support (first cycle) or on the previously coupled DMT-protected nucleotide, ai) coupling the first nucleoside as activated phosphoramidite with the free hydroxyl group on the solid support, as) oxidizing or sulfurizing the respective P-linked nucleoside to form the respective phosphodiester (P=O) or the respective phosphorothioate (P=S);

[0014] 34) optionally, capping any unreacted hydroxyl groups on the solid support, as) repeating the previous steps ai to a4 until the desired sequence is assembled.

[0015] Finally, the assembled oligonucleotide is optionally subjected to deblocking conditions after the last cycle, backbone deprotection using amine reagents and is then cleaved from the solid support and subsequent downstream processing and purification methods provide the desired pure oligonucleotide. In a variant of oligonucleotide synthesis known as the DMT-on procedure, the hydroxy protecting group, typically dimethoxytrityl (DMT), is left on the 5' end after the assembly of the oligonucleotide chain. This approach allows for further purification of the oligonucleotide after cleavage from the solid support. The DMT group's hydrophobic nature enables selective retention of full-length sequences during purification steps. The final removal of the DMT group is typically achieved through an acidic treatment, often using acetic acid or acetic acid derivatives (e.g. trifluoroacetic acid (TFA)).

[0016] The sulfurization process and the sulfurizing agents are well known in the art (see e.g. Volk, David E., and Ganesh LR Lokesh. "Development of phosphorothioate DNA and DNA thioaptamers." Biomedicines 5, no. 3 (2017): 41.)

[0017] A particular method for sulfurization without capping is described in The PCT International Publication WO 2017 / 223258. In this method, it is disclosed that by-products from various sulfurizing agents enable the capping of unreacted chains through a reaction of by-products generated from the sulfurization step with unreacted 5 -OH groups.

[0018] The object of the present invention was to find a process which utilizes the advantages of eliminating the capping step, without relying on a capping function of the sulfurizing agent, or of byproducts thereof and at the same time makes a recirculation of the sulfurizing agent unnecessary. In addition, the improved method does not have a substantial negative impact on the formation of N-l impurities.

[0019] It was found that the object could be achieved with the process for the production of a linear P-linked oligonucleotide containing at least one phosphorothioate intemucleoside linkage, which comprises the step of sulfurizing a tricoordinated phosphite triester of the formula I

[0020] I wherein

[0021] R1is a hydroxy protecting group;

[0022] R2is independently selected from hydrogen, halogen, Ci-6-alkoxy or

[0023] 2 ’ O- (2-C i -6-alkoxy-C i -6- alkyl) ;

[0024] R3is a solid support or an oligonucleotide moiety bound to a solid support;

[0025] R4is hydrogen or

[0026] R4is methylene or Ci-4-alkyl substituted methylene connected to R2, which is oxygen; with a sulfurizing agent to form a tetracoordinated phosphorothioate of the formula

[0027] II

[0028] Nucleobase

[0029] II wherein R1, R2, R3and R4are as above, and which is characterized in that no recirculation of the sulfurizing agent is taking place and that the process does not involve a separate capping step in the stepwise addition of nucleoside residues to the 5'-terminus of the growing chain.

[0030] The following definitions are set forth to illustrate and define the meaning and scope of the various terms used to describe the invention herein.

[0031] The term Ci-6-alkyl stands for a linear or branched alkyl group of 1 to 6 C-atoms. Representatives are methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, i-butyl or t-butyl, pentyl and its isomers and hexyl and its isomers. The term Ci-4-alkyl, likewise, stands for a linear or branched alkyl group of 1 to 4 C-atoms. Representatives are methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl or t-butyl.

[0032] The term Ci-6-alkoxy stands for a linear or branched alkyl group of 1 to 6 C-atoms attached to an oxygen atom. Representatives are methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, i-butoxy, s-butoxy or t-butoxy, pentoxy and its isomers and hexoxy and its isomers. In the context of the present invention methoxy and ethoxy is preferred.

[0033] The term 2’O-(2-Ci-6-alkoxy-Ci-6-alkyl) stands for a Ci-6-alkoxy-Ci-6-alkyl group which is connected via an oxygen atom to the sugar moiety. In the context of the present invention 2’-O-(2-methoxyethy) is preferred.

[0034] The term halogen stands for fluoro, chloro, bromo or iodo, preferably for fluoro and chloro.

[0035] The term oligonucleotide as used herein is defined as a molecule comprising two or more covalently linked nucleotides.

[0036] For use as a therapeutically valuable oligonucleotide, oligonucleotides are typically synthesized as 10 to 40 nucleotides, preferably 10 to 25 nucleotides in length.

[0037] The oligonucleotides may consist of optionally modified DNA, RNA or LNA nucleoside monomers or combinations thereof.

[0038] The LNA nucleoside monomers are modified nucleosides which comprise a -CHR- O- linker between the C2’ and the C4’ of the ribose sugar ring of a nucleotide, wherein R is hydrogen or a lower alkyl group, typically methyl-CH(CH)3-O- modified LNA nucleosides are known as constrained ethyl (cEt) nucleosides.

[0039] The LNA structure can be illustrated with the formula

[0040] Nucleobase wherein R is hydrogen or Ci-4-alkyl, preferably hydrogen or methyl. Optionally modified as used herein refers to nucleosides modified as compared to the equivalent DNA, RNA or LNA nucleoside by the introduction of one or more modifications of the sugar moiety or the nucleobase moiety. In a preferred embodiment the modified nucleoside comprises a modified sugar moiety and may for example comprise one or more 2’ substituted nucleosides and / or one or more LNA nucleosides. The term modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”.

[0041] The DNA, RNA or LNA nucleosides are as a rule linked by a phosphodiester (P=O) and at least one phosphorothioate (P=S) intemucleoside linkage which covalently couples two nucleosides together.

[0042] The nucleobase moieties are indicated by the letter code A (adenine), C (cytosine), T (thymine) and G (guanine). Each letter code may optionally include modified nucleobases of equivalent function. For example, the letter code E stands for the modified cytosine 5-methyl cytosine. Modified nucleobases include but are not limited to nucleobases carrying protecting groups such as tert-butylphenoxyacetyl, phenoxyacetyl, benzoyl, acetyl, isobutyryl or dimethylformamidino.

[0043] The described principles of the oligonucleotide synthesis are well known in the art (see Catani, Martina, et al. "Oligonucleotides: current trends and innovative applications in the synthesis, characterization, and purification." Biotechnology Journal 15.8 (2020): 1900226.

[0044] Larger scale oligonucleotide synthesis is typically carried out in an automated fashion using computer-controlled synthesizers.

[0045] As a rule, oligonucleotide synthesis is a solid-phase synthesis, wherein the oligonucleotide being assembled is covalently bound, via its 3'-terminal hydroxy group, to a solid support material and remains attached to it over the entire course of the chain assembly. Typically, the solid support materials are modified with e.g. non-nucleosidic linkers for making them universal for oligonucleotide synthesis. Suitable supports are the commercially available macroporous polystyrene supports, like the Primer support 5G from GE Healthcare or the NittoPhaseOHL or NittoPhaseOUnyLinker support from Kinovate, or controlled pore glass supports like the nucleobase pre-loaded support from LGC.

[0046] As outlined above, the oligonucleotide synthesis in principle is a stepwise addition of nucleoside residues to the 5'-terminus of the growing chain until the desired sequence is assembled as outlined above. The subsequent cleavage from the resin can be performed with concentrated aqueous ammonia. The protecting groups on the phosphate and the nucleobase are also removed within this cleavage procedure.

[0047] As outlined above the process of the present invention relates to the transformation of a tricoordinated phosphite triester of the formula I

[0048] Nucleobase

[0049] I wherein

[0050] R1is a hydroxy protecting group;

[0051] R2is independently selected from hydrogen, halogen, Ci-6-alkoxy or 2’0-(2-CI-6 alkoxy Ci-6 alkyl);

[0052] R3is a solid support or an oligonucleotide moiety bound to a solid support;

[0053] R4is hydrogen or

[0054] R4is methylene or Ci-4-alkyl substituted methylene connected to R2, which is oxygen; with a sulfurizing agent into a tetracoordinated phosphorothioate of the formula II wherein R1, R2, R3and R4are as above, characterized in that no recirculation of the sulfurizing agent is taking place and that the process does not involve a separate capping step in the stepwise addition of nucleoside residues to the 5'-terminus of the growing chain.

[0055] The tricoordinated phosphite triester of the formula I typically is the intermediate resulting from the previous coupling step. R3accordingly stands for the growing oligonucleotide chain which is bound to the solid support as described above.

[0056] R1signifies the acid labile 5’ hydroxy protecting group selected from 4,4’- dimethoxytrityl (DMT), 4-methoxytrityl, trityl, 9-phenyl-xanthen-9-yl, 9-(p-tolyl)- xanthen-9-yl or from tert-butyldimethylsilyl, preferably 4,4’-dimethoxytrityl (DMT), 4- methoxytrityl or trityl, even more preferably 4,4’-dimethoxytrityl (DMT).

[0057] R2stands preferably for hydrogen, fluoro, chloro, 2’-O-(2-methoxyethyl), methoxy or ethoxy, more preferably for hydrogen and 2’-O-(2-methoxyethyl).

[0058] R3is a solid support or preferably is an oligonucleotide moiety of 10 to 40, more preferably 10 to 25 nucleotides in length bound to a solid support.

[0059] R4preferably is hydrogen or

[0060] R4is methylene or Ci-4-alkyl substituted methylene connected to R2, which is oxygen.

[0061] The process of the present invention is characterized in that it does not involve a separate capping step in the stepwise addition of nucleoside residues to the 5'-terminus of the growing chain. Particularly, the process does not involve a separate capping step by the sulfurizing agent, or by byproducts thereof, formed during sulfurization. In fact, the process of the present invention does not rely on capping activity or a capping function of the sulfurization agent or of any byproducts thereof, which may be formed, in the course of the sulfurization process.

[0062] However, it should be clarified that in the first cycle, i.e. when the first nucleoside is coupled to the solid support, a capping step with dedicated capping reagents is preferably applied.

[0063] The sulfurizing agent is selected from 5-ethoxy-3H-l,2,4-dithiazole-2-one (EDIT), 3-((Dimethylamino-methylidene)amino), 3H-l,2,4-dithiazole-3-thione (DDTT) or Xanthanehydride. (XH). Preferably Xanthanehydride (XH) is used.

[0064] As a rule, the sulfurization agent is applied dissolved in an organic solvent. Suitable solvents are pyridine, 3-picoline, acetonitrile or mixtures thereof. Particularly preferred is a mixture of pyridine and acetonitrile.

[0065] The v / v ratio pyridine to acetonitrile is typically in the range of 100:0 to 50:50, preferably 80:20 to 60:40 and most preferably 70:30.

[0066] Typically, the sulfurizing agent is provided in a concentration of 0.02 mol to 2.0 mol, preferably in a concentration of 0.05 mol to 0.5 mol.

[0067] Typically, the sulfurizing agent is provided in an amount of 0.5 to 4.0 CV, preferably 1.0 to 3.5 CV.

[0068] The flow rate of the sulfurizing agent can be set in the range of O.ICV / min to 1.0 CV / min, preferably of 0.3 CV / min to 0.6 CV / min.

[0069] In a further aspect of the invention, the previous coupling step, is performed with nucleoside phosphoramidites, which have been dried and therefore are substantially free from water. This also ensures that no unwanted hydrolysis and loss of phosphoramidite occurs. Loss of phosphoramidite would result in a sub stoichiometric reaction with the hydroxy groups of the oligonucleotide fragment on the solid support, leaving unreacted hydroxy groups, which would require capping. Failure to cap would inevitably lead to N-l impurities.

[0070] The nucleoside phosphoramidite can be provided with a concentration of 0.05 mol / L to 0.3 mol / L, preferably in a concentration of 0.1 mol / L to 0.2 mol / L. The nucleoside phosphoramidite can be dissolved in anhydrous acetonitrile, or a combination of anhydrous acetonitrile and a co- solvent, preferably anhydrous toluene or anhydrous DMF. The prepared nucleoside phosphoramidite solution may be further dried by adding molecular sieves (4A) in the range of 5 g / L to 100 g / L, preferably 10-50 g / L.

[0071] The activator is typically selected from a solution in anhydrous acetonitrile of ethyl thiotetrazole (ETT), benzylthiotetrazole (BTT), dicyanoimidazole (DO), a mixture of dicyanoimidazole (DO) and / V-mcthyl imidazole (NMI), pyridinium chloride, pyridinium trifluoroacetate. Preferably a mixture of DCI and NMI in anhydrous acetonitrile is used, more preferably a mixture of 1.0 mol / L DCI and 0.1 mol / L NMI in anhydrous acetonitrile. The prepared activator solution may be further dried by adding molecular sieves (4A) in the range of 5 g / L to 100 g / L, preferably 10-50 g / L.

[0072] The column packing (required column volume per synthesis scale) is typically selected in the range of 10 mL / mmol to 60 mL / mmol, preferably of 20 mL / mmol to 50 mL / mmol.

[0073] The process of the present invention proved that sulfurization can successfully be performed without the need of a capping step and a recirculation of the sulfurizing agent. This results in a several minutes saving of time for each cycle, which can amount to a substantial total time saving for the manufacture of longer oligonucleotides. At the same time it could be shown that no negative impact on yield and N-l impurity formation occurred.

[0074] By way of illustration the oligonucleotide can be selected from:

[0075] Lo.eAs.eTs.eEs.eEs.eEs.dAs.dEs.dGs.dEs.dEs.dEs.dEs.dTs.dGs.dTs.eEs.eEs.eAs.eGs. eE

[0076] The symbols have the following meaning:

[0077] Sequence information is provided from 5'-end (left) to 3'-end (right). Each nucleotide is described by three-letters: Eirst letter: Sugar (d = 2’-deoxyribose / DNA, e = 2'-O-(2-methoxyethyl) ribose / MOE); Second letter: Nucleobase (A = adenine, E = 5- methylcytosine, G = guanine, L = hexylaminolinker , T = thymine); Third letter: Backbone (o = phosphate, s = thiophosphate).

[0078] The compounds disclosed herein have the following nucleobase sequences

[0079] SEQ ID No. 1: atcccacgccccctgtccagc Examples

[0080] Abbreviations:

[0081] AciO = acetic acid anhydride

[0082] Bz = benzyl

[0083] DCA = dichloroacetic acid

[0084] DO = dicyanoimidazole

[0085] DEA = diethylamine

[0086] DNA = 2’-deoxyribonuleotide

[0087] DMT = 4,4’-dimethoxytrityl

[0088] CV = column volume

[0089] MeCN = acetonitrile

[0090] NA = not applicable

[0091] NMI = N-methyl imidazole

[0092] PhMe = Toluene

[0093] Oligo synthesis Example

[0094] Lo.eAs.eTs.eEs.eEs.eEs.dAs.dEs.dGs.dEs.dEs.dEs.dEs.dTs.dGs.dTs.eEs.eEs.eAs.eGs. eE

[0095] Sequence information is provided from 5'-end (left) to 3'-end (right). Each nucleotide is described by three-letters: First letter: Sugar (d = 2 ’-deoxyribose / DNA, e = 2'-O-(2- methoxyethyl) ribose / MOE); Second letter: Nucleobase (A = adenine, E = 5- methylcytosine, G = guanine, L = hexylaminolinker , T = thymine); Third letter: Backbone (o = phosphate, s = thiophosphate).

[0096] The title compound was produced by standard phosphoramidite chemistry on solid phase at a scale of 2.6 mmol using an AKTA Oligopilot 100 and Primer Support Unylinker (NittoPhase HL Unylinker 400).

[0097] The following phosphoramidites have been used in each cycle:

[0098] In general, 1.4 equiv. of the phosphoramidites were employed. All reagents were used as received from commercially available sources and reagent solutions at the appropriate concentration were prepared (see details below). Cleavage and deprotection was achieved using ammonium hydroxide to give the crude oligonucleotide. Standard Reagent Solutions

[0099] The crude solution from the cleavage & deprotection step was concentrated in vacuo to remove excess ammonia. The concentrated solution was lyophilized to provide the crude oligonucleotide as a solid. The pale-yellow solid was sampled and submitted to LC-UV- MS analysis. Impurities were grouped according to their assigned structure. Sulfurization examples

[0100] Sulfurization was performed applying no sulfurization agent recycle in comparison with experiments comprising sulfurization agent recycle in the table below.

[0101] Comparison example (A) (with sulfurization agent recycle, capping in the 1stcycle only): Comparison example (B) (with sulfurization agent recycle, capping in the 1stcycle only):

[0102] Comparison example (C) (sub-stoichiometric phosphoramidite (0.7 eq. amidite instead of 1.4 eq.) in cycle 19; with sulfurization agent recycling and capping in the 1stcycle only, 4 equiv. xanthane hydride):

[0103] Example 1 (without sulfurization agent recycling; capping in the 1stcycle only, 4 equiv. xanthane hydride):

[0104] Example 2 (without sulfurization agent recycling; capping in the 1stcycle only, 8 equiv. xanthane hydride): Example 3 (without sulfurization agent recycling; capping in the 1stcycle only, 4 equiv. xanthane hydride):

[0105] Results

[0106] The examples illustrate that the recycling of the sulfurization agent has no measurable effect on N-l impurity and therefore can be avoided. Comparison example (C), wherein a coupling failure was intentionally induced in cycle 19 by means of sub-stoichiometric amidite equivalents (0.7 eq.), demonstrates that the sulfurizing agent or byproducts thereof show no capping function. In fact, the induced coupling failure led to a large increase in the N-l impurity.

Claims

Claims:

1. Process for the production of a linear P-linked oligonucleotide containing at least one phosphorothioate intemucleoside linkage, comprising the step of sulfurizing a tricoordinated phosphite triester of the formula IwhereinR1is a hydroxy protecting group;R2is independently selected from hydrogen, halogen, Ci-6-alkoxy or2 ’ O-(2-C i -6-alkoxy-C i -6-alkyl ; R3is a solid support or an oligonucleotide moiety bound to a solid support;R4is hydrogen orR4is methylene or Ci-4-alkyl substituted methylene connected to R2, which is oxygen; with a sulfurizing agent to form a tetracoordinated phosphorothioate of the formula IIII wherein R1, R2, R3and R4are as above, characterized in that no recirculation of the sulfurizing agent is taking place and that the process does not involve a separate capping step in the stepwise addition of nucleoside residues to the 5'-terminus of the growing chain.

2. Process of claim 1, characterized in that the process does not involve a separate capping step by the sulfurizing agent, or by byproducts formed thereof during sulfurization.

3. Process of claim 1 or 2, wherein the sulfurizing agent is selected from 5-ethoxy- 3H-l,2,4-dithiazole-2-one (EDIT), 3-((Dimethylamino-methylidene)amino), 3H- 1,2,4- dithiazole-3-thione (DDTT) or Xanthanehydride.

4. Process of any one of claims 1 to 3, wherein the sulfurization takes place in the presence of an organic solvent selected from pyridine, 3-picoline, 2,6,-lutidine, acetonitrile or mixtures thereof.

5. Process of claim 4, wherein the organic solvent is a mixture of pyridine and acetonitrile.

6. Process of any one of claims 1 to 5, wherein the sulfurizing agent is provided in a concentration of 0.02 mol / L to 2.0 mol / L.

7. Process of any one of claims 1 to 6, wherein the sulfurizing agent is provided in an amount of 1.0 to 3.0 CV.

8. Process of any one of claims 1 to 7, wherein the flow rate of the sulfurizing agent is set in the range of O.ICV / min to 1.0 CV / min.

9. Process of any one of claims 1 to 8, wherein column packing is in the range of 10 mL / mmol to 60 mL / mmol.

10. Process of any one of claims 1 to 9, wherein R1is an acid labile 5’ hydroxy protecting group selected from 4,4’-dimethoxytrityl, 4-methoxytrityl, trityl, 9-phenyl- xanthen-9-yl, 9-(p-tolyl)-xanthen-9-yl or from tert-butyldimethylsilyl.

11. Process of any one of claims 1 to 10, wherein R2is hydrogen, fluoro, chloro, methoxy, ethoxy or 2’-O-(2-methoxyethyl).

12. Process of any one of claims 1 to 11, wherein R3is an oligonucleotide moiety of 10 to 40 nucleotides in length, bound to a solid support.

13. Process of any one of claims 1 to 12, wherein R4is methylene or methyl substituted methylene connected to R2, which is oxygen.

Images