Auto-inducible promoter engineering

Abstract

A bacterial expression construct for expressing a protein of interest (POI) in a host cell comprising in operable linkage: a) an auto-inducible promoter; b) a Shine-Dalgarno (SD) sequence that is heterologous to the promoter; and c) a gene of interest (GOI) which encodes the POI; wherein the promoter is auto-inducible in response to carbon-depletion and the SD sequence modulates the auto-inducible promoter strength, and an auto-inducible promoter comprising a heterologous Shine-Dalgarno (SD) sequence which modulates the expression level of a protein of interest (POI), wherein the promoter is auto-inducible in response to carbon-depletion, and expression systems comprising the same.

Description

[0001] LO018P

[0002] -1-

[0003] AUTO-INDUCIBLE PROMOTER ENGINEERING

[0004] FIELD OF THE INVENTION

[0005] The invention refers to engineering auto-inducible promoters to control the level of protein expression in response to carbon-depletion, such as under carbon-limit conditions. Promoters are engineered to either increase or decrease the protein expression levels.

[0006] BACKGROUND

[0007] E. coli represents the most important production strain of the bacterial expression systems. Due to its well-characterized genome, its rapid growth, the simple culture medium and fermentation process, the high product yields which are virus-free and the ease of producing a lot of genetically modified strains, the bacterium stays very attractive for production of recombinant therapeutic proteins. In many fields, E. coli is used for the recombinant protein production of therapeutic proteins for example insulin or interleukin, intermediate products, enzymes, vaccines, growth hormones, antibodies and complex proteins.

[0008] For large scale productions E. coli fed-batch cultures with an inducible expression system are typically used today. A frequently used strategy to control the growth rate of cells in a fed-batch culture is carbon, in particular glucose limitation. During such a carbon or glucose limitation, cellular responses occur, in which the cell upregulates essential genes to ensure survival during starvation.

[0009] Franchini and Egli (2006) have identified genes that are differentially expressed during the adaptation of an E. coli cell culture to low glucose concentration in glucose- limited continuous culture as compared to growth with excess glucose during cultivation in batch culture, by determining the respective mRNA levels using microarray technology, among them the cstA, glpF, rbsD and aldA.

[0010] Carbon starvation peptide transporter protein promoter (PcstA)

[0011] CstA is a transporter that is responsible for the transport of peptides. In the cstA gene, transcription is activated by the cAMP / CRP complex (Blum et al., 1990). LO018P

[0012] -2-

[0013] Glycerol facilitator promoter (PglpF)

[0014] The expression of glpF occurs using glpFK operon. The expression of glpF is regulated with the glycerol-3-phosphate regulon repressor (GIpR), and with the CRP- cAMP-complex (Weissenborn et al. 1992). The promoter sequence contains two sites for CRP-cAMP (activating) and 4 sites for glycerol-3-phosphate regulon repressor GIpR (repressing).

[0015] D-Ribose pyranase promoter (PrbsD)

[0016] Transcription of the rbsD gene is positively regulated by the cAMP / CRP complex (Zheng et al., 2004). Transcription is negatively regulated by the repressor RbsR. If this repressor binds to the DNA, the expression of rbsD is prevented. Once ribose is present, it binds to the repressor and prevents it from binding to the DNA. Thus, ribose serves as an inducer of the rbs operon (Shimada et al., 2013).

[0017] Lactaldehyde dehydrogenase promoter (PaldA)

[0018] AldA is responsible for the oxidation of aldehydes and is involved in the breakdown of fucose, rhamnose, arabinose and lyxose. As with the previous genes, there is also a positive regulation of transcription by the cAMP / CRP complex (Limon et al., 1997).

[0019] In prokaryotes, a ribosome binding site known as the Shine-Dalgarno (SD) sequence assists with the binding and positioning of the 30S ribosome component relative to the start codon on the mRNA through interaction with a pyrimidine-rich region of the 16S ribosomal RNA. The SD sequence is located on the mRNA downstream from the start of transcription and upstream from the start of translation, typically from 4-14 nucleotides upstream of the start codon e.g., 8-10 nucleotides upstream of the start codon. Because of the role of the SD sequence in translation, there is a direct relationship between the efficiency of translation and the efficiency (or strength) of the SD sequence.

[0020] WO2022243307A1 and WO2022243312A1 disclose expression systems for producing fucosylated human milk oligosaccharides in E. coli. Among the exemplary promoters, there is the PglpF promoter or variants of PglpF with a desired strength e.g., high, middle or low strength. Promoter variants are described with different untranslated regions and / or SD sequences.

[0021] Decoupling of protein production from bacterial cell growth can be of advantage for a fermentation process in the industry. This approach enables the accumulation of biomass without product formation in the first phase and the realization of high biomass LO018P

[0022] -3- productivity with minimal bacterial growth in the second phase. The decoupling is performed by using inducible promoters. Among the commonly used inducible promoters is the phage T7 promoter. Further well-known inducible promoters are the E. coli promoters of the operons lacZYA, araBAD and rhaBAD which are responsible for the sugar metabolism. Some inducer molecules are relatively expensive and their use in fermentations leads to a more complex process.

[0023] Hirooka Kazutake et al. (Bioscience, Biotechnology, and Biochemistry 2018, 82(11): 1942-1954) describe Bacillus subtilis protein expression systems that are chromosomally integrated and controllable by glucose and rhamnose. Promoters of B. subtilis cdd and ylbP genes and the regulatory region (PrhaEW) of B. subtilis rhaEWRBMA operon were assembled, whose transcription is induced by rhamnose and repressed by glucose.

[0024] Heinze Simon et al. (Applied Microbiology and Biotechnology 2018, 102(23): 10147-10159) describe promoter sequences from Bacillus subtilis and Bacillus megaterium for the secretory production of a Clostridium thermocellum cellulase in Paenibacillus polymyxa.

[0025] Isticato et al. (Journal of Bacteriology 2010, 192(4): 949-954) describe CotE, a morphogenic protein that controls assembly of the coat of B. subtilis spores.

[0026] WO2014098767A1 discloses a programmable synthetic lysis system for controlled release of macromolecules.

[0027] De Baets et al. (Microbial Cell Factories 2024, 23: 249) describe prokaryotic inducible expression systems. (1): 14775-2859

[0028] Marschall et al. (Journal of Molecular Biology 1998, 276(2):339-353) describe regulation of csiD, a carbon-starvation-inducible gene in Escherichia coli.

[0029] There is a need for novel auto-inducible expression systems.

[0030] SUMMARY OF THE INVENTION

[0031] This summary is provided to introduce a selection of concepts that are further described herein and is not intended to identify key or essential features of the claimed subject matter, nor is it intended to be used as an aid in limiting the scope of the claimed subject matter.

[0032] It is the object of the invention to engineer auto-inducible promoters for inducing modulated induction properties according to the needs of specific expression systems. LO018P

[0033] -4-

[0034] In particular, the object of the invention refers to engineer auto-inducible promoters which can operate in response to carbon-depletion with a desired strength, and to upregulate or downregulate protein expression levels.

[0035] The object of the invention is solved by the subject matter as claimed, and as further described herein.

[0036] The invention is based on the surprising finding that auto-inducible promoters and respective expression constructs can be engineered to incorporate a SD sequence that is heterologous to the promoter sequence, which modulates expression properties of the promoter. Inducible promoters which comprise a binding site for the cAMP / CRP complex, in particular a Cyclic AMP receptor protein (CRP) binding site, for example PcstA, PglpF, PrbsD, or PaldA, do have auto-inducible properties under conditions of carbon-depletion or carbon starvation. It has been found that expression levels of autoinduction on carbon-depletion can be modulated by engineering the promoters and expression constructs to incorporate heterologous SD sequences. In particular, by selecting a suitable heterologous SD sequence, product expression levels (translation levels or levels of transcription and translation) can be modulated or controlled, such as for an increased or reduced efficiency of mRNA translation in bacterial expression systems, in particular for an improved space-time yield of producing expression products in recombinant bacterial host cells (for example E. coli). Whereas transcription is particularly impacted by CRP binding to the promoter, the heterologous SD sequence particularly modulates translation. Specifically, the heterologous SD sequence modulates the efficiency whereby the mRNA is translated to proteins.

[0037] The combination of a promoter with a heterologous SD such as an exchange of a wild type (wt) SD sequence in a bacterial promoter by a heterologous one was found to lead to a strong increase (or alternatively decrease) of the protein expression levels that can be induced by carbon-depletion or carbon starvation. A library of engineered promoter variants and different SD sequence has been produced for a series of autoinducible promoters each comprising at least one or multiple cAMP / CRP binding sites. The promoter variants were tested for their auto-inducible expression levels under carbon-limiting conditions, and suitable SD sequences have been characterized. In particular, novel combinations of auto-inducible promoter and SD-sequences have been produced which are optimized for a favorable space-time yield of expression products. LO018P

[0038] -5-

[0039] The invention specifically provides a carbon-regulatory auto-inducible promoter comprising a heterologous SD sequence which modulates the protein expression levels, by modulating translation of an mRNA transcribed from a coding gene of interest (GOI) that is operationally linked to the promoter.

[0040] Specifically, the heterologous SD sequence is herein understood as a SD sequence that is heterologous to the promoter such as a SD sequence that is not naturally linked to the promoter sequence.

[0041] Specifically, the promoter is auto-inducible in response to carbon-depletion, in particular under carbon-limit conditions, upon consumption of a carbon source, or under carbon-starving conditions. In particular, the promoter is auto-inducible by carbon- depletion.

[0042] Specifically, the expression level is modulated to increase the POI yield, preferably the total of produced protein mass or the space-time yield.

[0043] Increase of the POI yield or any other function (or activity) of the promoter as described herein can be compared to a reference promoter, preferably wherein the reference promoter is the promoter that has not been engineered to comprise the heterologous SD sequence (in particular wherein the reference promoter comprises the endogenous i.e., wild-type SD sequence), or wherein the reference promoter is a comparable promoter such as an L-rhamnose-inducible rhaBAD promoter (P RhaBAD), in particular the promoter comprising or consisting of SEQ ID NO:33. Specifically, the GOI encodes a protein of interest (POI). Specifically, the expression product is a POI that is encoded by the GOI.

[0044] According to a specific aspect, the promoter is comprised in a bacterial expression construct.

[0045] The invention further provides for a bacterial expression construct for expressing a protein of interest (POI) in a host cell comprising in operable linkage: a) an auto-inducible promoter; b) a Shine-Dalgarno (SD) sequence that is heterologous to the promoter; and c) a gene of interest (GOI) which encodes the POI; wherein the promoter is auto-inducible in response to carbon-depletion and the SD sequence modulates the auto-inducible promoter strength.

[0046] According to a specific aspect, the heterologous SD sequence modulates the level of POI expression in a bacterial expression system, wherein the POI expression level is increased or decreased compared to a reference expression construct which LO018P

[0047] -6- does not comprise the heterologous SD sequence, or which comprises a comparable promoter such as a rhamnose-inducible rhaBAD promoter comprising or consisting of SEQ ID NO:33.

[0048] Specifically, the auto-inducible promoter strength is modulated by the heterologous SD sequence to control the POI yield, the produced POI mass or the space-time yield in the bacterial expression system.

[0049] Specifically, the heterologous SD sequence is selected from any one of SEQ ID NOs:1-13.

[0050] Specifically, the heterologous SD sequence comprises or consists of SEQ ID NO:2 or 10.

[0051] More specifically, the heterologous SD sequence comprises or consists of SEQ ID NO:2.

[0052] More specifically, the heterologous SD sequence comprises or consists of SEQ ID NO:10.

[0053] According to a specific aspect, the heterologous SD sequence is combined or assembled) with the promoter sequence, such as to allow operable linkage in an expression construct as described herein. Specifically, the heterologous SD sequence can be added to or incorporated into the promoter sequence (e.g., by replacing a wildtype SD sequence), both is herein understood to result in an engineered promoter (or promoter variant) which comprises the heterologous SD sequence.

[0054] Specifically, the SD sequence is linked or coupled to the 3’-end of the promoter sequence. In such a case, the promoter comprises the heterologous SD sequence that is linked or coupled to the promoter sequence, in particular added to the original promoter sequence such as added to the 3’end of the original promoter sequence.

[0055] According to a specific aspect, the heterologous SD sequence substitutes an SD sequence that is endogenous to the promoter ( / .e., the wild-type SD sequence). In such a case, the promoter comprises the heterologous SD sequence as part of the original promoter sequence.

[0056] According to a specific aspect, the heterologous SD sequence modulates the translation efficiency of the transcribed mRNA, wherein transcription is under control of the auto-inducible promoter. Translation efficiencies can be compared to the product expression level which is under the control of a reference promoter, in particular the promoter without such SD sequence engineering, or a comparable promoter. LO018P

[0057] -7-

[0058] Specifically, a heterologous SD sequence is used for engineering the promoter described herein for an increased or decreased auto-inducible promoter strength or protein expression level in response to carbon-depletion. The auto-inducible protein expression level is herein specifically understood as the protein level that is expressed from an expression construct comprising the promoter operably linked to a coding gene (e.g. a gene of interest (GOI), such as a GOI that is heterologous or endogenous to the expression construct or host cell comprising the expression construct), wherein expression is induced in response to carbon-depletion or carbon starvation. According to specific examples, expression is from a bacterial expression system, such as by a recombinant E. coli host cell comprising the expression construct.

[0059] Specifically, the auto-inducible promoter strength or expression level is about the same, or higher or lower than the level of the reference promoter. For example, the promoter strength or auto-inducible expression level: a) is increased by at least any one of about 1.1 -fold, 1.2-fold, 1.3-fold, 1.4-fold,

[0060] 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.1 -fold, 2.2-fold, 2.3-fold, 2.4-fold,

[0061] 2.5-fold, 2.6-fold, 2.7-fold, 2.8-fold, 2.9-fold, 3-fold, 3.3-fold, 3.5-fold, 3.8-fold, 4-fold, 4.5- fold, 5-fold, 5.5-fold, or at least about 6-fold, when in the fully-induced state; or b) is decreased by at least any one of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% decreased, when in the fully-induced state.

[0062] Typically, the fully-induced promoter shows an increased promoter strength or expression level that is at least 10% increased, more preferred at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% and at least 100%, or at least 150%, or at least 200% increased, as compared to a reference promoter.

[0063] Specifically, the promoter is considered fully-induced, if achieving at least about 80%, or at least 90%, or at least about 95%, or up to 100% of the maximum promoter strength or of the maximum expression level achieved in an appropriate test system, in particular a test system of carbon-depletion to induce the promoter to the maximum extent in response to carbon-depletion.

[0064] Specifically, the promoter described herein is considered as fully-induced, if the culture conditions provide for at least about 80%, or at least 90%, or at least about 95%, or up to 100% of the maximum induction, e.g. at a carbon source (e.g., glucose or glycerol) concentration of less than any one of 0.4. 0.3, 0.2, or 0.1 g / L.

[0065] Specifically, the promoter strength is the transcription or translation strength to produce an expression product under control of the promoter. The promoter strength LO018P

[0066] -8- can be determined by measuring the level of transcripts (such as the transcriptome or mRNA), or by determining the expression level of products in a suitable expression system.

[0067] Transcription is herein specifically understood as the transcription of a DNA sequence, and optionally further translation and / or expression of an expression product. The transcription level is typically determined as a measure of the transcription strength of the promoter (which is commonly understood as the promoter strength) and specifically refers to the amount of mRNA transcripts obtained upon fully inducing said promoter. Transcript abundance may be determined by the transcription strength in the fully induced state, which is e.g., obtained under conditions of glucose-limited chemostat cultivations and expressed relative to the transcription rate of a reference promoter.

[0068] The transcription level / strength may, for example, be determined by the amount of mRNA transcripts of a reporter gene upon cultivating a clone in liquid culture. Alternatively, the transcription rate may be determined by the transcription strength of the natively controlled gene on a microarray, where microarray data show the difference of expression level between repressed and de-repressed state and a high signal intensity in the fully induced state as compared to a control. As the latest omics technology is readily available the, promoter strength can be also determined by whole- transcriptome RNA-sequencing whereby the number of reads generated by the process are in correlation with transcriptional activity of investigated promoters.

[0069] For example, the promoter strength can be determined in a test system as herein described in the Examples section.

[0070] Specifically, the promoter strength can also be determined by the protein expression level such as to produce an expression product e.g., a reporter or model protein, or a POL Expression levels can be determined by translation and / or by transcription analysis. Preferably, the transcription analysis is quantitative or semi- quantitative, preferably employing qRT-PCR, transcriptome analysis via RNA sequencing. Likewise, translation can be determined by methods well-known in the art, which determine the efficacy of an expression system to produce proteins.

[0071] According to a specific aspect, the heterologous SD sequence modulates the translational efficiency of the mRNA produced by the promoter in response to carbon- depletion. Specifically, a POI expression level on carbon-depletion that is controlled by the promoter described herein can be modulated by SD sequence engineering as LO018P

[0072] -9- compared to a reference, in particular wherein the reference is a reference SD, or a comparable promoter.

[0073] In particular, auto-inducibility of the promoter is herein understood as the autoinduction ratio (also referred to as auto-induction factor) or auto-induction profile of the promoter. Specifically, the auto-inducibility (such as the auto-induction factor or autoinduction profile) can be compared to a reference promoter, or a comparable promoter.

[0074] Specifically, a heterologous SD sequence is used for engineering the promoter described herein for fine-tuning translational efficiency of transcribed mRNA on carbon- depletion, wherein fine-tuning refers to modulating an expression profile.

[0075] Specifically, the auto-induction ratio is the ratio of the expression level when fully induced (e.g., in the absence of starvation signals such as during a production phase of a recombinant host cell culture under carbon-limiting conditions), to the expression level in the uninduced state (e.g., the basal promoter strength in the presence of an excess amount of a carbon source such as during the growth phase of a recombinant host cell culture).

[0076] The induction ratio is a key parameter to determine the carbon regulation of the promoter, and sets the promoter activity or strength in the induced state in relation to the promoter activity or strength in the non-induced state. For example, the expression level of a reporter protein in the non-induced state is determined upon the lack of starvation signals (e.g., cAMP) which is for example in the presence of an excess amount of a carbon source (e.g., wherein the carbon source is glucose or glycerol), and the expression level of the reporter protein is likewise determined in the induced state upon induction by limiting the carbon source and thereby elevating starvation signals (e.g., cAMP).

[0077] Specifically, the promoter described herein is characterized by an induction ratio or auto-induction ratio, which is characterized by a high promoter strength (in particular high transcription and / or translation strength) in the fully-induced state, compared to a low level in the non-induced (or repressed) state.

[0078] Specifically, the promoter described herein has a promoter strength in the fully- induced state, which is at least any one of 1.5, 2.0, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10-fold higher than in the repressed state. Therefore, the respective auto-induction rate can be at least any one of 1.5, 2.0, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10. LO018P

[0079] -10-

[0080] Specifically, the auto-induction ratio on carbon-depletion is modulated by the heterologous SD sequence, preferably for a change (in particular, increase) by at least + / - 1-30%, or at least + / - 5% or at least + / - 10%, or at least + / - 20%, or at least + / - 30%.

[0081] Specifically, the auto-induction profile of the promoter is improved by a certain onset of auto-induction and / or the duration of auto-induction. Such improved autoinduction profile can contribute to an improved space-time yield (STY) of producing an expression product (in particular a POI) in a recombinant host cell culture, wherein expression is controlled by the promoter described herein.

[0082] The space-time yield is typically understood as the volume specific product formation rate, also called volumetric productivity, in mg (L h)-1.

[0083] Specifically, the STY of producing an expression product (such as a POI) under operational control of a promoter as described herein, in particular using an expression construct as described herein, is increased as compared to a reference promoter or reference expression construct that comprises such reference promoter and the GOI in operable linkage, preferably wherein the reference promoter is the promoter which has not been engineered to comprise (or be combined with) the heterologous SD sequence (in particular wherein the reference promoter comprises the endogenous i.e., wild-type SD sequence), or wherein the reference promoter is a comparable promoter such as an L-rhamnose-inducible rhaBAD promoter (P RhaBAD), in particular the promoter comprising or consisting of SEQ ID NO:33.

[0084] Specifically, the STY is increased by at least any one of about 1.1 -fold, 1.2-fold,

[0085] 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.1 -fold, 2.2-fold,

[0086] 2.3-fold, 2.4-fold, 2.5-fold, 2.6-fold, 2.7-fold, 2.8-fold, 2.9-fold, 3-fold, 3.3-fold, 3.5-fold, 3.8-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, or at least about 6-fold.

[0087] Specific auto-inducible promoters described herein are characterized by an autoinduction profile comprising a short onset of auto-induction e.g., about 1 to 20 hours preferably 10 to 20 hours.

[0088] Specific auto-inducible promoters described herein are characterized by an autoinduction profile comprising a long duration of auto-induction, such as at least for the duration of a fermentation batch, for example for 30-80 hours e.g., 40-70 hours of fermentation.

[0089] Specifically, the reference promoter can be the same promoter as the engineered promoter, however, without such engineering to comprise the heterologous SD sequence, or a comparable promoter. LO018P

[0090] -11-

[0091] The comparable promoter can be a standard promoter i.e., a promoter that is used as a positive control. An exemplary standard promoter is a rhamnose inducible promoter e.g., an L-rhamnose-inducible rhaBAD promoter (P RhaBAD) such as the promoter comprising or consisting of SEQ ID NO:33.

[0092] The reference promoter may be used in parallel control experiments using the same host cell and expression system, or as internal control within the same host cell culture. Such control experiments to qualify the promoter function as compared to the reference promoter are preferably carried out in E. coli host cell cultures, in particular recombinant E. coli expressing a model protein, such as a reporter protein for cytoplasmic expression (e.g., mTurquoise, eGFP), or other model proteins such as antibody fragments e.g., Fabs, scFvs, or sfmTurquoise. Proteins can be expressed by cytoplasmic or periplasmic expression.

[0093] Promoter strength, expression levels, auto-induction factor or profile can be compared to the reference promoter using standard assays, such as an assay system of expressing a reporter protein in a recombinant E. coli expression system e.g., as follows. E. coli strains expressing the reporter protein under the control of the promoter to be tested are screened in 24- deep well plates at 25°C with shaking at 280 rpm with 2 mL culture per well. Glucose feed beads (6mm, Kuhner, CH) can be used to generate glucose-limiting growth conditions. Cells can be analyzed for reporter expression in the induced state (YP + 1 feed bead, for 20-28 hours).

[0094] According to a specific aspect, the promoter comprises at least one Cyclic AMP receptor protein (CRP)-binding site.

[0095] Specifically, there is at least one CRP-binding site comprised in the wt promoter, and at least one CRP-binding site comprised in the engineered promoter, preferably wherein the CRP-binding site comprised in the wt promoter is the same (or unchanged) as the one in the engineered promoter.

[0096] The CRP-binding site and respective CRP binding sequences of a promoter can be predicted and / or identified by commonly available methods such as bioinformatic tools to predict and recognize binding sequences based on sequence similarities and experimental evidence via functional genetic assays (e.g., deletion of the said CRP-site abolishes starvation regulation), or DNAse protection assays.

[0097] For example, a) the CRP-binding site of the exemplary PcstA, or in particular PcstAIO, comprises or consists of a single operator of CGGAGTGATCGAGTTAACATTG (SEQ LO018P

[0098] -12-

[0099] ID NO:34) e.g., (-100)CGGAGTGATCGAGTTAACATTG(-79) relative to the transcriptional start site (+1) (Shultz et al., J Mol Biol 1991 ;218(1): 129-40); b) the CRP-binding site of the exemplary PglpF, or in particular PglpF3, comprises or consists of a dual CRP binding site of TTAAGTTCGATATTTCTCGTTT (SEQ ID NO:35) e.g., (-48)TTAAGTTCGATATTTCTCGTTT(-27), and

[0100] TTTTATGACGAGGCACACACAT (SEQ ID NO:36) e.g., (-

[0101] 71)TTTTATGACGAGGCACACACAT(-50) respectively, and relative to the transcriptional start site (+1) (Weissenborn et al. J Biol Chem 1992;267(9):6122-31); c) the CRP-binding site of the exemplary PrbsD, or in particular PrbsD3, comprises or consists of a single site of CGTTTCGAGGTTGATCACATTT (SEQ ID NO:37) e.g., (-73)CGTTTCGAGGTTGATCACATTT(-52) relative to the transcriptional start site (+) (Bell et al. J Biol Chem. 1986;261 (17):7652-8.) d) the CRP-binding site of the exemplary PaldA, or in particular PaldA2, comprises or consists of a single CRP binding site of TTTTATGAAGCCCTTCACAGAA (SEQ ID NO:38) e.g., (-70)TTTTATGAAGCCCTTCACAGAA(-49) relative to the transcriptional start site (+1) (Limon et al. Microbiology (Reading) 1997:143 (Pt 6):2085- 2095).

[0102] Specifically, the promoter comprises (or originates from) a promoter of a bacterium, in particular a wild-type promoter, preferably a promoter of any one of the genes glpF, cstA, rbsD, aldA, glpK, znuA, aceB, gatZ, ahpC, zinT, acs, gatY, bsmA, rbsD, ychN, tnaC, IsrR, IsrA, sra, prpB, cspD, aldB, rmf, yjcH, soxS, yftj, yfiN, ydcS or variants of any of the foregoing genes, preferably wherein the bacterium is E. coli.

[0103] Specifically, the promoter is a bacterial promoter which is a wild-type or promoter or a naturally-occurring variant thereof, preferably comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the wild-type promoter, or an artificial variant thereof comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the respective wild-type promoter or naturally-occurring variant thereof.

[0104] Specifically, the promoter comprises a promoter of a bacterium, preferably E. coli, preferably a promoter of any one of the genes glpF, cstA, rbsD, aldA, glpK, znuA, aceB, gatZ, ahpC, zinT, acs, gatY, bsmA, rbsD, ychN, tnaC, IsrR, IsrA, sra, prpB, cspD, aldB, rmf, yjcH, soxS, yftj, yfiN, ydcS or variants of any of the foregoing, preferably wherein the variants are naturally-occurring variants, or artificial variants comprising at least any LO018P

[0105] -13- one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the respective wild-type or naturally-occurring variant sequence.

[0106] Specifically, the promoter comprises (or originates from) any one of the following E. coli genes: glpF e.g., POAEROof E. coli, strain K12; cstA e.g., P15078 of E. coli, strain K12; rbsD e.g., P04982 of E. coli, strain K12; aldA e.g., P25553 of E coli, strain K12.

[0107] Specific preferred examples are promoter variants which comprise E. coli promoters, like PcstAIO, PglpF3, PrbsD3, PaldA2, or originate from E. coli promoters, like PcstAIO, PglpF3, PrbsD3, or PaldA2.

[0108] Specifically, the engineered promoter which comprises the heterologous SD sequence comprises at least any one of 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99 sequence identity to the promoter from which the engineered promoter originates, in particular as compared to the wt promoter.

[0109] Specifically, the engineered promoter comprises or consists of the respective wt promoter or a fragment thereof comprising at least any one of 50%, 60%, 70%, 80%, 90%, or 95% of the full-length promoter sequence. Specifically, the promoter comprises at least the 3’-part of the promoter which comprises at least any one of 50%, 60%, 70%, 80%, 90%, or 95% of the full-length promoter sequence, or a major part (e.g., at least any one of 50%, 60%, 70%, 80%, 90%, or 95%) of the of the full-length promoter sequence) which comprises at least a 3’-terminal sequence of the respective wt promoter which 3’-terminal sequence has a length of at least 10nt, 15nt, 20 nt, 30nt, 40nt, 50nt, 60nt, 70nt, 80nt, 90nt, or 100nt and comprises the 3’-terminus of the promoter, with or without a start codon.

[0110] Specifically, the promoter comprises or originates from any one of a cstA, glpF, rbsD, or aldA, promoter of E. coli, or from any one of a cstA10, glpF3, rbsD3, or aldA2 promoter of E. coli, and the heterologous SD sequence a) increases the auto-inducible expression level or increases the autoinducible promoter strength, preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NO:2, 3, 4, 10, or LO018P

[0111] -14- b) decreases the expression level or decreases the auto-inducible promoter strength, preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NO:5, 6, 7, 8, 9, 11 , or 12.

[0112] According to a specific aspect, the heterologous SD sequence does not consist of SEQ ID NO:7 or 8.

[0113] According to a specific aspect, the promoter comprises or consists of any one of SEQ ID NO:21-32.

[0114] Specifically, the SD sequence comprises or consists of SEQ ID NO:2, and the promoter comprises or consists of any one of SEQ ID NO:29-32.

[0115] The invention further provides for a bacterial expression construct comprising a Shine-Dalgarno (SD) sequence comprising or consisting of SEQ ID NO:2, wherein the SD sequence is operable linkage with an auto-inducible promoter, wherein the SD sequence and promoter are not being naturally associated, or wherein the SD sequence and promoter are not naturally linked.

[0116] The invention further provides for an expression construct comprising the promoter described herein.

[0117] Specifically, the expression construct described herein comprises or consists of, or is comprised in or composed of an expression cassette.

[0118] Specifically, the expression construct described herein comprises a gene of interest (GOI) to express such GOI under the control of the promoter.

[0119] Specifically, the expression construct described herein comprises an open reading frame (ORF) to express the GOI.

[0120] According to a specific aspect, the promoter is operably linked to an ORF comprising the GOI.

[0121] Specifically, the expression cassette described herein comprises the promoter described herein and a GOI in operable linkage, wherein the promoter and GOI are heterologous to each other i.e., not occurring in such combination in nature e.g., wherein either one (or only one) of the promoter and GOI is artificial or heterologous to the other and / or to the host cell described herein; the promoter is an endogenous promoter and the GOI is a heterologous GOI; or the promoter is an artificial or heterologous promoter and the GOI is an endogenous GOI; wherein both, the promoter and GOI, are artificial, heterologous or from different origin, such as from a different species or type (strain) of cells compared to the host cell described herein. LO018P

[0122] -15-

[0123] Specifically, the expression construct comprises a spacer in particular of 5-15 nt between the SD sequence and the start codon of the GOI, for example a spacer comprising or consisting of SEQ ID NO:14, such as an SD-ATACAT-START spacer (SEQ ID NO:14).

[0124] Specifically, the spacer consists of a number of consecutive nucleotides which are independently selected from A, C, G, or T.

[0125] The spacer length is preferably 5-15 nt, preferably at least any one of 5 or 6 nt, up to at any one of 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, or 5 nt.

[0126] Specifically, the spacer is composed of at least 50% of A and / or T nucleotides.

[0127] The expression construct described herein may or may not comprise additional elements suitable to regulate expression of the GOI, such as a ribosomal binding site, transcriptional or translational start and terminator sequences, or an enhancer or activator sequence.

[0128] Specifically, the expression construct described herein comprises the promoter operably linked to the GOI, and optionally further comprises signal or leader sequences.

[0129] According to a specific aspect, the expression construct described herein is comprised in an autonomously replicating vector or plasmid, or integrated within a chromosome of a host cell.

[0130] Specifically, the invention provides for an expression construct, vector or plasmid comprising the promoter described herein, which is expressible in prokaryotic host cells.

[0131] Specifically, the engineered promoters described herein are used in cytoplasmic expression constructs, or used for cytoplasmic expression in prokaryotic host cells.

[0132] Specifically, the invention provides for a bacterial expression construct, vector or plasmid comprising the promoter described herein, which is expressible in bacterial host cells, such as E. coli.

[0133] A preferred bacterial expression vector (which is preferably used for expression in bacteria) is selected from the group consisting of plasmids which are suitably used in E. coli expression systems.

[0134] The expression construct described herein may be introduced into a host cell and integrated into the host cell genome (or any of its chromosomes) as intrachromosomal element e.g., at a specific site of integration or randomly integrated, whereupon a high producer host cell line is selected.

[0135] Alternatively, the expression construct described herein may be integrated within an extrachromosomal genetic element, such as a plasmid or an artificial chromosome. LO018P

[0136] -16-

[0137] According to a specific example, the expression construct described herein is introduced into the host cell by a vector, in particular an expression vector, which is introduced into the host cell by a suitable transformation technique. For this purpose, the GOI may be ligated into an expression vector.

[0138] Techniques for transfecting or transforming bacterial host cells for introducing a vector or plasmid are well known in the art. These can include electroporation, chemical transformation, bacteriophage infection (transduction), and particularly using modified bacteriophages such as, for example, P1 -phage.

[0139] Transformants as described herein can be obtained by introducing the expression construct, vector or plasmid DNA into a host and selecting transformants which express the relevant expression product or a selection marker.

[0140] According to a specific aspect, the transformed host cell is a recombinant host cell which maintains the GOI on an episomal genetic element such as circular plasmid DNA in a well-regulated copy number. For example, a bacterial cell such as E. coli may comprise 15-20 copies of a plasmid. Each of the copies may comprise or consist of the same or different sequences, yet includes the promoter described herein in operable linkage to the GOI.

[0141] The invention further provides for a bacterial host cell comprising a) the promoter described herein, and / or b) the expression construct described herein.

[0142] The invention further provides for a bacterial host cell comprising the bacterial expression construct described herein, preferably wherein the host cell is E. coli.

[0143] The invention further provides for a promoter comprising a specific Shine- Dalgarno (SD) sequence which comprises or consists of SEQ ID NO:2, preferably wherein the SD sequence is comprised in the promoter as a heterologous SD sequence, an expression construct comprising said promoter, and a bacterial host cell comprising a) said promoter, and / or b) said expression construct comprising said promoter; preferably wherein the host cell is a E. coli.

[0144] Specifically, the SD sequence which comprises or consists of SEQ ID NO:2 is derived from a standard promoter of pET vectors such as pET28a, or pET22a, and can be the same SD sequence of the standard promoter, or may differ in only one pointmutation. LO018P

[0145] -17-

[0146] Specifically, the SD sequence which comprises or consists of SEQ ID NO:2 is heterologous to the promoter, and / or heterologous to the expression construct and / or the host cell.

[0147] According to a specific aspect, the invention provides for engineering a promoter comprising the SD sequence which comprises or consists of SEQ ID NO:2 as heterologous SD sequence.

[0148] Specifically, the engineered promoter comprising the SD sequence which comprises or consists of SEQ ID NO:2 as heterologous SD sequence is characterized by one or more features as described herein generally for the engineered promoters and SD sequences described herein.

[0149] Specifically, the engineered promoter comprising the SD sequence which comprises or consists of SEQ ID NO:2 as heterologous SD sequence is characterized by one or more of the following features: a) the heterologous SD sequence is linked to the promoter and / or substitutes an SD sequence that is endogenous to the promoter; b) the heterologous SD sequence increases the auto-inducible expression level or increases the auto-inducible promoter strength; c) the promoter comprises one or more Cyclic AMP receptor protein (CRP)- binding sites; d) the promoter comprises or originates from a promoter (e.g., a wild-type promoter) of a bacterium (such as E. coli), preferably a promoter of any one of the genes glpF, cstA, rbsD, aldA, glpK, znuA, aceB, gatZ, ahpC, zinT, acs, gatY, bsmA, rbsD, ychN, tnaC, IsrR, IsrA, sra, prpB, cspD, aldB, rmf, yjcH, soxS, yftj, yfiN, ydcS or variants of any of the foregoing genes, preferably wherein the variants are naturally-occurring variants, preferably comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the wild-type promoter, or artificial variants comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the respective wild-type promoter or naturally-occurring variants thereof; e) the promoter is a bacterial promoter which is a wild-type promoter or a naturally-occurring variant thereof, preferably comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the wild-type promoter, or an artificial variant thereof comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the respective wildtype promoter or naturally-occurring variant thereof. f) the promoter comprises a promoter of a bacterium, preferably E. coli, preferably a promoter of any one of the genes glpF, cstA, rbsD, aldA, glpK, znuA, aceB, gatZ, ahpC, zinT, acs, gatY, bsmA, rbsD, ychN, tnaC, IsrR, IsrA, sra, prpB, cspD, aldB, rmf, yjcH, soxS, yftj, yfiN, ydcS or variants of any of the foregoing, preferably wherein the variants are naturally-occurring variants, or artificial variants comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the respective wild-type or naturally- occurring variant sequence; g) the promoter comprises or originates from any one of the E. coli promoters PcstA, PglpF, PrbsD, or PaldA, or variants of any of the foregoing, in particular any one of PcstAIO, PglpF3, PrbsD3, or PaldA2.

[0150] According to a specific aspect, the invention further provides for a recombinant protein expression construct comprising an auto-inducible promoter and a heterologous Shine-Dalgarno (SD) sequence wherein the promoter is auto-inducible in response to carbon-depletion and controls transcription of a gene of interest (GOI) that encodes a recombinant protein of interest (POI) in a bacterial host cell.

[0151] Specifically, transcription is controlled to increase the POI yield, such as the total of produced protein mass or the space-time yield, as compared to a reference expression construct which does not comprise the heterologous SD sequence, or which comprises a comparable promoter such as a rhamnose-inducible rhaBAD promoter comprising or consisting of SEQ ID NO:33. Specifically, a reference promoter is used which is the promoter that has not been engineered to comprise the heterologous SD sequence (in particular wherein the reference promoter comprises the endogenous i.e., wild-type SD sequence), or wherein the reference promoter is a comparable promoter such as an L-rhamnose-inducible rhaBAD promoter (P RhaBAD), in particular the promoter comprising or consisting of SEQ ID NO:33.

[0152] Specifically, the heterologous SD sequence comprises a motif “AGGAGA” (SEQ ID NO:1), preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NO:2, 10, or 13, or is selected from a heterologous SD sequence comprising or consisting of any one of SEQ ID Nos: 1-13, preferably wherein the heterologous SD comprises or consists of SEQ ID NO:2 or 10. -19-

[0153] According to a preferred aspect, the heterologous SD does not consist of SEQ ID NO: 7 or 8.

[0154] Specifically, the heterologous SD sequence is characterized by one or more of the following features: a) the heterologous SD sequence is linked to the promoter and / or substitutes an SD sequence that is endogenous to the promoter; b) the heterologous SD sequence increases or decreases the auto-inducible expression level or auto-inducible promoter strength; c) the promoter comprises one or more Cyclic AMP receptor protein (CRP)- binding sites; d) the heterologous SD sequence is combined with a promoter which comprises or originates from a promoter (e.g., a wild-type promoter) of a bacterium (such as E. coli), preferably a promoter of any one of the genes glpF, cstA, rbsD, aid A, glpK, znuA, aceB, gatZ, ahpC, zinT, acs, gatY, bsmA, rbsD, ychN, tnaC, IsrR, IsrA, sra, prpB, cspD, aldB, rmf, yjcH, soxS, yftj, yfiN, ydcS or variants of any of the foregoing genes, preferably wherein the variants are naturally- occurring variants, preferably comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the wild-type promoter, or artificial variants comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the respective wild-type promoter or naturally-occurring variants thereof; e) the heterologous SD sequence is combined with a bacterial promoter which is a wild-type promoter or a naturally-occurring variant thereof, preferably comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the wild-type promoter, or an artificial variant thereof comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the respective wild-type promoter or naturally-occurring variant thereof. f) the heterologous SD sequence is combined with a promoter which comprises a promoter of a bacterium, preferably E. coli, preferably a promoter of any one of the genes glpF, cstA, rbsD, aldA, glpK, znuA, aceB, gatZ, ahpC, zinT, acs, gatY, bsmA, rbsD, ychN, tnaC, IsrR, IsrA, sra, prpB, cspD, aldB, rmf, yjcH, soxS, yftj, yfiN, ydcS or variants of any of the foregoing, preferably wherein the variants are naturally-occurring variants, or artificial variants comprising at LO018P

[0155] -20- least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the respective wild-type or naturally-occurring variant sequence; g) the heterologous SD sequence is combined with a promoter which comprises or originates from any one of the E. coli promoters PcstA, PglpF, PrbsD, or PaldA, or variants of any of the foregoing, in particular any one of PcstAIO, PglpF3, PrbsD3, or PaldA2.

[0156] Specifically, the heterologous SD sequence comprises or consists of any one of SEQ ID NO:1-13, preferably SEQ ID NO:2 or 10.

[0157] Specifically, carbon-depletion occurs under carbon-limit conditions, upon consumption of a carbon source in the cell culture medium of a bacterial host cell culture, or upon carbon-starvation, preferably wherein the carbon source is glucose or glycerol.

[0158] Specifically, host cells described herein are prokaryotic cells e.g. bacterial cells.

[0159] According to a specific aspect, the host cell is a Gram-negative cell, such as Salmonella spp. or E. coli, such as e.g., TG1 , TG2, W3110, DH1 , DHB4, DH5a, HMS 174, HMS174 (DE3), NM533, C600, HB101 , JM109, MC4100, XL1-Blue and Origami, as well as those derived from E. coli B-strains, such as for example BL-21 or BL21 (DE3), all of which are commercially available.

[0160] According to a specific aspect, the bacterial host cell comprising the expression construct described herein is preferably an E. coli host cell.

[0161] According to another specific aspect, the host cell is a Gram-positive cell such as Bacillus, Streptomyces Streptococcus, Staphylococcus or Lactobacillus. Bacillus that can be used is, e.g. the B.subtilis, B.amyloliquefaciens, B.licheniformis, B.natto, or B.megaterium. In embodiments, the cell is B.subtilis, such as B.subtilis 3NA and B.subtilis 168. Bacillus is obtainable from, e.g., the Bacillus Genetic Stock Center, Biological Sciences 556, 484 West 12thAvenue, Columbus OH 43210-1214.

[0162] Specifically, the bacterial cell is selected from the group consisting of E. coli, B. subtilis, and Pseudomonas, preferably E. coli.

[0163] Suitable host cells are commercially available, for example, from culture collections such as the DSMZ (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Braunschweig, Germany) or the American Type Culture Collection (ATCC).

[0164] Specifically, the promoter described herein is auto-inducible on carbon-depletion i.e., depletion of a carbon source, which is herein also understood as carbon source regulatable, such as repressed in the presence of amounts higher than any one of 1 , LO018P

[0165] -21-

[0166] 1.5, 2, 2.5, or 3 g / L of a carbon source in a cell culture (herein also referred to as a promoter-repressing amount), and induced (in particular, de-repressed and / or fully- induced) in the presence of no detectable carbon source or amounts up to any one of 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 .0 g / L carbon source in the cell culture (herein also referred to as a promoter-inducing amount). Such amounts in the cell culture are particularly understood as the amounts which, upon feeding of the host cell and consumption by the host cell, may be detectable. Typically, when producing an expression product under growth-limiting conditions, the cell culture is fed by adding a supplemental carbon source, yet in an amount that is immediately consumed by the cells during production, thus, leaving no or only a low remaining amount in the cell culture medium or supernatant, e.g. an amount up to any one of 1 .0 g / L, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 g / L.

[0167] Specifically, the carbon source regulating the promoter described herein is suitable to grow the respective host cell and / or produce an expression product in a culture of the host cell.

[0168] Specifically, the carbon source regulating the promoter described herein is a carbohydrate, such as selected from saccharides, polyols, alcohols, or mixtures of any one or more of the foregoing.

[0169] Specifically, the saccharides may be any one or more of monosaccharides, such as a hexose, e.g. glucose, fructose, galactose or mannose, or a disaccharide, such as saccharose; or an alcohol or polyol e.g., ethanol, or any diol, or triol, e.g., glycerol, or a mixture of any of the foregoing. Preferably, the promoter is regulated by glucose as a carbon source. In particular, the promoter is repressed by glucose and induced by glucose depletion.

[0170] The invention further provides for a method for screening and selecting a Shine- Dalgarno (SD) sequence to engineer an inducible target promoter for modulated autoinducible promoter strength on carbon-depletion, which method comprises: a) providing an expression construct comprising the target promoter and an open reading frame (ORF) comprising a gene of interest (GOI) under the control of the target promoter, which GOI encodes an expression product such as a protein of interest (POI); b) engineering the expression construct to introduce a repertoire of heterologous SD sequences operably linked to the target promoter, thereby producing a variety of expression constructs; LO018P

[0171] -22- c) transforming a bacterial host cell line with the variety of expression constructs, thereby producing a repertoire of host cells; d) culturing the repertoire of host cells using a growth medium comprising a basal carbon source to grow biomass, thereby depleting the basal carbon source which autoinduces the engineered target promoter to express the GOI; followed by culturing the host cell in a feeding phase of the cell culture and producing the expression product (the POI) under carbon-limit conditions; and e) screening the repertoire of host cells for a differential yield of the expression product (of the POI, a differential POI yield), and f) selecting one or more host cells from the repertoire according to the differential yield which indicates a modulated auto-inducible promoter strength, and identifying the respective SD sequence that confers the modulated auto-inducible promoter strength on carbon-depletion in the selected one or more host cells.

[0172] Specifically, carbon-depletion occurs under carbon-limit conditions or upon consumption of the basal carbon source in the growth medium of the bacterial host cell culture, preferably wherein the carbon source is glucose or glycerol, or upon carbon- starvation.

[0173] Specifically, the SD sequence is heterologous to the target promoter.

[0174] Specifically, the modulated auto-inducible promoter strength leads to differential gene expression and a differential a differential yield of the expression product (of the POI, a differential POI yield).

[0175] Specifically, the differential yield is determined as compared to the comparable host cell expressing said GOI, which comprises a reference promoter such as described herein.

[0176] Specifically, a reference expression construct or respective reference host cell culture can be used to determine the differential yield a differential yield of the expression product, e.g., wherein the reference expression construct of host cell comprises the target promoter without engineering to introduce the heterologous SD sequence, or comprises a reference promoter such as a reference promoter described herein.

[0177] The invention further provides for a method for controlling production of an expression product (e.g., a POI) in a cell culture of a bacterial host cell, comprising the steps of: a) transforming a bacterial host cell with an expression construct, which comprises an open reading frame (ORF) comprising a gene of interest (GOI) that LO018P

[0178] -23- encodes an expression product (e.g., a POI) under the control of a promoter that is autoinducible on carbon-depletion; b) culturing the host cell in a batch phase of the cell culture using a basal carbon source to grow biomass, thereby depleting the basal carbon source which auto-induces the promoter; followed by c) culturing the host cell in a feeding phase of the cell culture under carbon-limit conditions and producing the expression product (e.g., the POI); and d) optionally recovering the expression product (e.g., the POI) from the cell culture; wherein the expression construct is an expression as further described herein, in particular comprising an auto-inducible promoter and a heterologous SD sequence which modulates the auto-inducible promoter strength on carbon-depletion, as further described herein.

[0179] Specifically, the method for controlling production of an expression product (e.g., a POI) is a method for increasing the yield of production.

[0180] According to a specific aspect, the invention provides for a method of increasing the yield of an expression product (e.g., a POI) produced by a host cell expressing a gene of interest (GOI) encoding said expression product (e.g., said POI) under the control of the promoter described herein, in particular using an expression construct as described herein, which comprises an auto-inducible promoter and a heterologous SD sequence which modulates the auto-inducible promoter strength on carbon-depletion, as further described herein.

[0181] According to a specific aspect, there is provided a method of increasing the yield of a protein of interest (POI) that is encoded by a gene of interest (GOI) which is expressed from an expression construct under control of a promoter in a bacterial host cell culture, wherein the expression construct is any one described herein, preferably wherein the host cell is E. coli.

[0182] Specifically, the yield is the POI yield.

[0183] Specifically, the yield is the yield of protein mass, or the space-time yield, such as provided in mg (L.h)'1. Specifically, the yield (in particular the protein mass, or the STY) is increased by of at least any one of 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold,

[0184] 1. 6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2.0-fold, 2.1 -fold, 2.2-fold, 2.3-fold, 2.4-fold, 2.5-fold,

[0185] 2.6-fold, 2.7-fold, 2.8-fold, 2.9-fold, 3-fold, 3.5-fold, 4-fold, 5-fold, 5.5-fold, 6-fold, 6.5- fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold, 10.5-fold, 11 -fold, 11.5-fold, LO018P

[0186] -24- or 12-fold, as compared to the comparable host cell expressing said GOI, which comprises a reference promoter such as described herein.

[0187] Specifically, the method of increasing the yield of production described herein employs a recombinant host cell as further described herein.

[0188] Specifically, a reference expression construct or respective reference host cell culture can be used to determine the increase of the yield e.g., wherein the reference expression construct of host cell comprises the target promoter without engineering to introduce the heterologous SD sequence, or comprises a reference promoter such as a reference promoter described herein.

[0189] The invention further provides a method of producing a protein of interest (POI) by culturing a bacterial host cell, preferably an E. coli host cell, which method comprises an expression construct comprising a carbon-source regulatable promoter and a gene of interest (GOI) encoding said POI under transcriptional control of said promoter, comprising the steps: a) cultivating a cell line of the bacterial host cell with a carbon source repressing the promoter; and b) cultivating the cell line with a limited amount of a supplemental carbon source de-repressing the promoter to induce production of the POI; and c) producing and recovering the POI, preferably wherein the POI is heterologous to the bacterial cell.

[0190] Specifically, the expression construct is any one described herein.

[0191] Specifically, step a) cultivating is performed during a batch phase of the cell culture; and step b) cultivating is performed during a fed-batch phase of the cell culture.

[0192] Specifically, the production of the POI is induced by an induction factor of at least 1 , or at least any one of 1 , 1.1 , 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6, 7, 8, 9, or 10.

[0193] Specifically, the production of the POI is induced by carbon-depletion, preferably wherein carbon-depletion occurs under carbon-limit conditions, upon consumption of a carbon source in the cell culture medium of the bacterial host cell culture, or upon carbon-starvation.

[0194] According to a further specific aspect, the invention provides for a method for producing an expression product (e.g., a POI) that is encoded by a gene of interest (GOI) LO018P

[0195] -25- by culturing the recombinant host cell as further described herein under conditions to produce said expression product (e.g., said POI).

[0196] Specifically, the invention provides for a method of producing a protein of interest (POI) that is encoded by a gene of interest (GOI) by culturing the bacterial host cell described herein under conditions to produce said POI.

[0197] Specifically, the expression product can be produced by culturing the host cell in an appropriate medium, isolating the expressed expression product from the cell culture, in particular from the cell culture supernatant or medium upon separating the cells, and purifying it by a method appropriate for the expressed product, in particular upon separating the expression product from the cell and purifying by suitable means. Thereby, a purified expression product preparation can be produced.

[0198] According to a further specific embodiment, the invention provides for the use of the host cell described herein for the production of an expression product (e.g., a POI).

[0199] Specifically, the host cell is a cell line cultured in a cell culture, in particular a production host cell line.

[0200] According to a specific embodiment, the cell line is cultured under batch, fed- batch or continuous culture conditions. The culture may be performed in microtiter plates, shake-flasks, or a bioreactor, and optionally starting with a batch phase as the first step, followed by a fed-batch phase or a continuous culture phase as the second step.

[0201] Specifically, the production method comprises the steps: a) growth phase culturing the host cell under growing conditions, such as in the presence of a first carbon source; b) production phase culturing the host cell under carbon-limit conditions, such as in the presence of up to 1 g / L of a second carbon source, resulting in expression of said GOI to produce said expression product (e.g., a POI).

[0202] Specifically, the second step b) follows the first step a).

[0203] Specifically, the carbon-limit conditions in step b) are auto-inducing conditions which auto-induce the promoter described herein.

[0204] Specifically, the first carbon source is depleted from the cell culture during the growth phase, thereby the growth phase a) ends and the production phase b) starts autonomously, i.e., without adding an inducer of GOI expression.

[0205] Specifically, the first carbon source is a basal carbon source. LO018P

[0206] -26-

[0207] Specifically, the host cell is cultured in the first step under growing conditions in a cell culture medium comprising the first carbon source, e.g. in an amount sufficient to enable growth of the host cell in cell culture, optionally until the amount of the carbon source is consumed, and further culturing can be under carbon-limiting conditions.

[0208] Specifically, the second carbon source is a supplemental carbon source.

[0209] Specifically, said first and second carbon sources can be identical or differ from each other.

[0210] According to a specific aspect, the basal carbon source is different from the supplemental carbon source, e.g. quantitatively and / or qualitatively different. The quantitative difference typically provides for the different conditions to repress or derepress the promoter activity.

[0211] According to a further specific aspect, the basal and the supplemental carbon sources comprise the same type of molecules or carbohydrates, preferably in different concentrations. According to a further specific aspect, the carbon source is a mixture of two or more different carbon sources.

[0212] Any type of organic carbon source may be used, in particular those typically used for host cell culture. Specifically, the carbon source is selected from saccharides, polyols, alcohols, or mixtures of any one or more of the foregoing, as further described herein. Specifically, carbon source is a hexose, such as glucose, fructose, galactose or mannose, a disaccharide, such as saccharose, an alcohol, such as glycerol or ethanol, or a mixture of any of the foregoing.

[0213] According to a specific aspect, the basal carbon source is selected from the group consisting of glucose, glycerol, ethanol, or mixtures thereof.

[0214] According to a specific aspect, the supplemental carbon source is a hexose such as glucose, fructose, galactose and mannose, a disaccharide, such as saccharose, an alcohol, such as glycerol or ethanol, or a mixture thereof.

[0215] Specifically, a) the basal carbon source is selected from the group consisting of glucose, glycerol, ethanol, a mixture thereof; and b) the supplemental carbon source is a hexose such as glucose, fructose, galactose or mannose, a disaccharide, such as saccharose, an alcohol, such as glycerol or ethanol, or a mixture of any of the foregoing.

[0216] Both of said growth phase and production phase culturing steps are characterized by a specific selection and amounts of said carbon sources. In particular, said growth LO018P

[0217] -27- phase culturing (step a) is carried out using a basal carbon source; and said production phase culturing under carbon-limit conditions (step b) is carried out using a supplemental carbon source, e.g. in a limited amount such that the cell culture medium comprises no, or up to 1 g / L, in particular no detectable amount, of the supplemental carbon source in the cell culture medium or supernatant during the culturing (step b).

[0218] The auto-inducing conditions suitably may be achieved by specific means. The production phase culturing (step b) optionally employs a feed medium that provides for no or the supplemental carbon source in a limited amount in the cell culture medium or supernatant. Specifically, the feed medium is chemically defined.

[0219] Specifically, the production phase culturing (step b) employs a feed medium that provides for the supplemental carbon source in a growth limiting amount to keep the specific growth rate within the range of 0.0001 IT1to 0.2 h’1, preferably 0.005 IT1to 0.15 h-1, preferably less than any of 0.2, 0.15, 0.1 tr1or 0.15 IT1.

[0220] The feed medium may be added to the culture medium in the liquid form or else in an alternative form, such as a solid, e.g. as a tablet or other sustained release means, or a gas. Yet, according to a preferred embodiment the limited amount of a supplemental carbon source added to the cell culture medium, may even be zero. Preferably, under conditions of a limited carbon substrate, the detectable concentration of a supplemental carbon source in the culture medium is 0-1 g / L, preferably less than any one of 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1 g / L, preferably less than any one of 90, 80, 70, 60, 50, 40, 30, 20, or 10 mg / L, or even less than 9, 8, 7, 6, 5, 4, 3, 2, or 1 mg / L, or specifically 1-50 mg / L, or 1-10 mg / L, specifically preferred 1 mg / L or even below, such as below the detection limit as measured with a suitable standard assay, e.g. determined as a residual concentration in the culture medium upon consumption by the growing cell culture.

[0221] In a preferred method, the carbon-limit amount of the supplemental source provides for a residual amount in the cell culture which is below the detection limit as determined in the fermentation broth at the end of a production phase or in the output of a fermentation process, preferably upon harvesting the fermentation product. For example, the amount of the supplemental carbon source is comprised in a feed medium that is added to a host cell culture and consumed during the production phase to below the detection limit.

[0222] Specifically, said growth phase culturing (step a) is performed in a batch phase; and said production phase culturing (step b) is performed in fed-batch or a continuous cultivation phase. LO018P

[0223] -28-

[0224] Specifically, during said growth phase culturing (step a), the host cells are grown at a high growth rate e.g., at least 50%, or at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or up to the maximum growth rate.

[0225] Specifically, during said production phase culturing (step b), the host cells are grown at low growth rate e.g., less than 90%, preferably less than 80%, less than 70%, less than 60%, less than 50%, or less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, less than 3%, less than 2%, less than 1 %, less than 0.5%, less than 0.4%, less than 0.3%, or less than 0.2% of the maximum growth rate.

[0226] Specifically, the POI is expressed under said growth-limiting conditions, e.g. by cultivating the cell line at a growth rate of less than the maximal growth rate, typically less than 90%, preferably less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, less than 3%, less than 2%, less than 1 %, less than 0.5%, less than 0.4%, less than 0.3%, or less than 0.2% of the maximum growth rate of the cells. Typically, the maximum growth rate is individually determined for each type of host cell.

[0227] Specifically, carbon-depletion occurs upon a) limiting the carbon source, i.e. under carbon-limit conditions, such as occurring when feeding a cell culture with no carbon source, or with only a limited amount of carbon source such as a limited amount which is up to any one of 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 g / L carbon source in the cell culture, or an amount which results in a limited amount of carbon source in the cell culture during the production phase, wherein the limited amount of carbon source can be zero or less than the detection limit, or can be up to any one of 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 .0 g / L carbon source; b) reducing the carbon source by consuming the carbon source in the cell culture medium of a bacterial host cell culture to a limited amount of carbon source, such as a limited amount of carbon source which can be zero or less than the detection limit, or can be up to any one of 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 .0 g / L carbon source in the cell culture; c) carbon starvation in a cell culture such as occurring after cultivation of cells in media without any carbon source or after complete consumption of a carbon source.

[0228] Specifically, carbon-consumption, carbon-limit conditions and carbon depletion can be measured by a dissolved oxygen (DO) spike method. LO018P

[0229] -29-

[0230] According to a specific aspect, the growth phase culturing (step a) is characterized by a continuous decrease in oxygen partial pressure (pCb) signal, and the end of the growth phase is characterized by an increase of pO2. Without adding further carbon sources as typical for batch phases, the pO2 signal will continuously decrease until for example below 65% saturation, such as for example to about 30%. Upon consumption of the basal carbon source, the pO2 typically increases to above 65% saturation (or above any of 70%, 75%, 80%, or 85% saturation), which indicates the time point for the autonomous start of the production phase, and to start adding a further carbon source under carbon-limit conditions.

[0231] Specifically, the growth phase is performed for around 10 to 36h.

[0232] According to a specific example, the batch phase is performed using 40 to 50 g / L glycerol, specifically 45 g / L glycerol as a basal carbon source in batch media, and cultivation is performed at 25°C for around 27 to 30h, or at 30°C for around 23 to 36h, or at any temperature between 25°C and 30°C during a cultivation time of 23 to 36h. Lowering the glycerol concentration in the batch medium would decrease the length of the batch phase, while increasing the glycerol in the batch medium would even prolong the batch phase. As an alternative to glycerol, glucose can be used, e.g. in about the same amounts.

[0233] In a typical system of cell culture and expression of an expression product (e.g., a POI), wherein a batch phase is followed by a fed-batch phase, the cultivation in the fed-batch phase is performed for any one of around 15 to 80h, around 15 to 70h, around 15 to 60h, around 15 to 50h, around 15 to 45h, around 15 to 40h, around 15 to 35h, around 15 to 30h, around 15 to 35h, around 15 to 25h, or around 15 to 20h; preferably around 20 to 40h. Specifically, the cultivation in the fed-batch phase is performed for any one of around 80h, around 70h, around 60h, around 55h, around 50h, around 45h, around 40h, around 35h, around 33h, around 30h, around 25h, around 20h, or around 15h.

[0234] Specifically, the volume specific product formation rate (rP) is the amount of product (mg) formed per Unit Volume (L) and Unit time (h) (mg (L h)-1). Volume specific product formation rate is also called space time yield (STY) or volumetric productivity.

[0235] Specifically, the fed-batch cultivation of the method described herein is performed with an STY of around 30 mg (L h)-1(meaning 30 mg (L h)-1+ / -5% or + / -10%). Specifically, an STY of around 27-33 mg (L h)-1is achieved within around 25-33h fed batch time, specifically at least any of 27, 28, 29, 30, 31 , 32, or 33 mg (L h)-1within less LO018P

[0236] -30- than any one of 33h, 32h, 31 h, 30h, 29h, 28h, 27h, 26h, or 25h fed batch time can be achieved.

[0237] Specifically, the expression constructs and host cells described herein are characterized by one or more features of the promoters, as described herein.

[0238] Specifically, the methods described herein are characterized by one or more features of promoters, expression constructs and host cells, as described herein.

[0239] FIGURES

[0240] Figure 1 shows mTurquoise expression profile in E. coli strain fermentation samples engineered where mTurquoise expression is under the control of carbon- depletion auto-inducible promoters coupled to RBS / SD-00. Testing was repeated three times. (1) Control E. coli strain without mTurquoise gene, auto inducible promoter and RBS / SD-00 [black line] (2) auto-inducible promoter P-cstA10 coupled to RBS / SD-00 [lower dash line] (3) auto-inducible promoter P-glpF3 coupled to RBS / SD-00 [upper dash line]. Average of P-cstA10: 3 lower curves; Average of P-glpF3: 4 upper curves; control: 1 baseline.

[0241] Figure 2: Ranking auto-inducible promoter variants P_glpF3 (grey bars) and P_cstA10 (white bars) coupled to different RBS / SD-sequences to assess end of fermentation (EoF) biomass normalized fluorescent readouts of mTurquoise in BioLector / Robolector fermentor. Each error bar is constructed using 95% confidence interval.

[0242] Figure 3: Benchmarking carbon-limitation auto-inducible promoters P_glpF3 and P cstAIO against reference promoters P RhaBAD under fermentation conditions. RBS / SD -00. Auto-inducible promoters show profound increase in space-time-yield (Titer divided by time).

[0243] Figure 4: Sequences described herein; promoter sequences are provided with an ATG start codon, or without an ATG start codon at the 3’-end. LO018P

[0244] -31-

[0245] DETAILED DESCRIPTION OF THE INVENTION

[0246] Unless indicated or defined otherwise, all terms used herein have their usual meaning in the art, which will be clear to the skilled person. Reference is for example made to the standard handbooks, such as Sambrook et aL, 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY); Lewin, "Genes IV", Oxford University Press, New York, (1990), and Janeway et aL, "Immunobiology" (5th Ed., or more recent editions), Garland Science, New York, 2001 , Ausubel et aL, Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Vega et aL, Gene Targeting, CRC Press, Ann Arbor Mich. (1995), and Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988).

[0247] As used herein, the terms “a”, “an” and “the” are used herein to refer to one or more than one i.e., to at least one. The terms “comprise”, “contain”, “have” and “include” as used herein can be used synonymously and shall be understood as an open definition, allowing further members or parts or elements. “Consisting” is considered as a closest definition without further elements of the consisting definition feature. Thus “comprising” is broader and contains the “consisting” definition.

[0248] The term “about” or “around” as used herein refers to the same value or a value differing by + / -10% or + / -5% of the given value.

[0249] Specific terms as used throughout the specification have the following meaning.

[0250] The term “carbon source” (also referred as “carbon” in the context of “carbon- depletion” or “carbon-limit”) as used herein shall mean a fermentable carbon substrate, typically a source carbohydrate, suitable as an energy source for microorganisms, such as those capable of being metabolized by host organisms or production cell lines. Cell culture media which are used with recombinant host cells must contain suitable carbon sources or substrates for both growth and production stages. Suitable carbon sources may include, but are not limited to, sources selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, alcohols including glycerol, in the purified form, in minimal media or provided in raw materials, such as a complex nutrient material. The carbon source may be used as described herein as a single carbon source or as a mixture of different carbon sources.

[0251] Specifically, carbon-depletion occurs upon under carbon-limit conditions, upon consumption of a carbon source in the cell culture medium of a bacterial host cell culture LO018P

[0252] -32- in particular consumption of a basal carbon source, or under carbon-starving conditions, preferably wherein the source of carbon is glucose or glycerol.

[0253] Methods for measuring the content of a carbon source such as glucose or glycerol in a cell culture are well-known, and include colorimetric or fluorometric methods. Suitable kits for measuring the content of a carbon source such as glucose or glycerol are commercially available.

[0254] A “basal carbon source” such as described herein typically is a carbon source suitable for cell growth, such as a nutrient for host cells. The basal carbon source may be provided in a medium, such as a basal medium or complex medium, but also in a chemically defined medium containing a purified carbon source. The basal carbon source is typically provided in an amount to provide for cell growth, in particular during the growth phase in a cultivation process, for example to obtain cell densities of at least 5 g / L cell dry mass, preferably at least 10 g / L cell dry mass, or at least 15 g / L cell dry mass, e.g. exhibiting viabilities of more than 90% during standard sub-culture steps, preferably more than 95%.

[0255] The basal carbon source is typically used in an excess or surplus amount, which is understood as an excess providing energy to increase the biomass e.g., during the cultivation of a cell line with a high specific growth rate, such as during the growth phase of a cell line in a batch or fed-batch cultivation process. This surplus amount is particularly higher than the limited amount of a supplemental carbon source (as used under growth-limited conditions) to achieve a residual concentration in the fermentation broth that is measurable and typically at least 10-fold higher, preferably at least 50-fold or at least 100-fold higher than the limited amount of the supplemental carbon source as used during carbon-limited conditions.

[0256] The term “carbon-depletion” as used herein shall refer to a condition where the amount of a carbon source is less than a certain limit such as less than an amount of carbon source which is required for optimal or maximum growth, or less than the detection limit. Specifically, the depletion of a carbon source is indicated by a rapid decrease in oxygen uptake measured by dissolved oxygen. The phrase “auto-induction on carbon-depletion” is specifically meant to refer to the time of carbon-depletion where a promoter gets induced because of the consumption of the carbon source during growth of a host cell culture, and / or because of a limited feed or limited availability (in particular availability for consumption) of a carbon-source during the POI production phase. The LO018P

[0257] -33- term “carbon-depletion” shall also include (without limitation) “carbon-limit”, “carbon- starvation” or “starvation”.

[0258] The term “carbon-starvation” or “starvation” as used herein shall refer to a condition where carbon-depletion conditions are kept during a prolonged period of cell culturing. Specifically, carbon-starvation refers to cultivation in media without any carbon source or after complete consumption of a carbon source. Carbon-starvation particularly occurs when there is no added carbon source or no available (for consumption) carbon source during cell culturing. Carbon-source starvation can e.g., be determined by growth rate measurements or by quantification of carbon-source molecules in the media and culture supernatant (e.g., HPLC).

[0259] A “supplemental carbon source” such as described herein typically is a supplemental substrate facilitating the production of fermentation products by production cell lines, in particular in the production phase of a cultivation process. The production phase specifically follows a growth phase e.g., in batch, fed-batch and continuous cultivation process. The supplemental carbon source specifically may be contained in the feed of a fed-batch process. The supplemental carbon source is typically employed in a cell culture under carbon-limited conditions i.e., conditions using the carbon source in a limited amount such as to allow producing expression products in a host cell culture, but to control the growth of the host cells such that there is substantially no further increase of biomass, or a controlled increase of biomass to allow an increase of biomass which is less than e.g., any one of 50%, 40%, 30%, 20%, 10%, or 5% increase of biomass.

[0260] The term “carbon-limit” or “carbon-limited” as used herein shall refer to a condition where carbon-depletion conditions of a cell culture are achieved by limiting the amount of carbon source in the cell culture to less than an upper limit (threshold). While the lower limit can be zero, the upper limit can be an amount which is less than the amount as used for optimal or maximum growth of the cells, or even less than the detection limit. For example, the upper limit can be any one of 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 .0 g / L carbon source in the cell culture.

[0261] Specifically, the limit can be set by using a feed medium with a limited amount of carbon source, or using a carbon source that is slowly released to the cell culture medium such as to limit the amount of carbon source that is available for consumption. Specifically, the cell culture can be regulated by such limited amount of carbon source. For example, the cell culture can switch from a growth phase to a production phase by LO018P

[0262] -34- employing carbon-limit conditions, in particular when POI production is controlled by a carbon-regulatable promoter such as a promoter described herein.

[0263] A “limited amount” of a carbon source or a “limited carbon source” under carbon- limited conditions is herein particularly understood to refer to the type and amount of a carbon substrate facilitating the production of fermentation products by production cell lines, in particular in a cultivation process with controlled growth rates of less than the maximum growth rate. The production phase specifically follows a growth phase e.g., in batch, fed-batch and continuous cultivation process. Also, in chemostat or continuous culture as described herein, the growth rate can be tightly controlled.

[0264] Batch culture is a culture process by which a small amount of a seed culture solution is added to a medium and cells are grown without adding an additional medium or discharging a culture solution during culture. Continuous culture is a culture process by which a medium is continuously added and discharged during culture. The continuous culture also includes perfusion culture. Fed-batch culture, which is an intermediate between the batch culture and the continuous culture and also referred to as semi-batch culture, is a culture process by which a medium is continuously or sequentially added during culture but, unlike the continuous culture, a culture solution is not continuously discharged.

[0265] Specifically preferred is a fed-batch process which is based on feeding of a growth limiting nutrient substrate to a culture using a feed medium. The fed-batch strategy, including single fed-batch or repeated fed-batch fermentation, is typically used in bio-industrial processes to reach a high cell density in the bioreactor. The controlled addition of the carbon substrate directly affects the growth rate of the culture and helps to avoid overflow metabolism or the formation of unwanted metabolic byproducts. Under carbon source limited conditions, the carbon source specifically may be contained in the feed of a fed-batch process. Thereby, the carbon substrate can be provided in a limited amount.

[0266] The limited amount of a carbon source is herein particularly understood as the amount of a carbon source necessary to keep a production cell line under growth-limited conditions e.g., in a production phase or production mode. Such a limited amount may be employed in a fed-batch process, where the carbon source is contained in a feed medium and supplied to the culture at low feed rates for sustained energy delivery e.g., to produce an expression product such as a POI, while keeping the biomass at low specific growth rates. LO018P

[0267] -35-

[0268] The limited amount of a carbon source may, for example, be determined by the residual amount of the carbon source in the cell culture broth, which is below a predetermined threshold or even below the detection limit as measured in a standard (carbohydrate) assay. The residual amount typically can be determined in the fermentation broth upon harvesting a fermentation product.

[0269] The limited amount of a carbon source may as well be determined by defining the average feed rate of the carbon source to the fermenter e.g., as determined by the amount added over the full cultivation process e.g., the fed-batch phase, per cultivation time, to determine a calculated average amount per time. This average feed rate is kept low to ensure complete usage of the supplemental carbon source by the cell culture, e.g., between 0.6 g L-1tr1(g carbon source per L initial fermentation volume and h time) and 25 g L-1h’1, preferably between 1.6 g L-1tr1and 20 g L-1h’1.

[0270] The limited amount of a carbon source may also be determined by measuring the specific growth rate, which specific growth rate is kept low e.g., lower than the maximum specific growth rate, during the production phase e.g., within a predetermined range, such as in the range of 0.001 IT1to 0.20 h’1, or 0.005 IT1to 0.20 h’1, preferably between 0.01 h’1and 0.15 IT1.

[0271] Specifically, a feed medium is used which is chemically defined.

[0272] The term “chemically defined” with respect to cell culture medium, such as a minimal medium or feed medium in a fed-batch process, shall mean a cultivation medium suitable for the in vitro cell culture of a production cell line, in which all of the chemical components and (poly)peptides are known. Typically, chemically defined components are used as a source of nutrients in a cell culture. The defined medium may contain various chemically defined nutrient sources selected from the group consisting of a chemically defined hydrogen source, a chemically defined oxygen source, a chemically defined carbon source, a chemically defined nitrogen source, a chemically defined sulfur source, a chemically defined phosphorus source, a chemically defined magnesium source, a chemically defined sodium source, a chemically defined potassium source, a chemically defined trace element source, and a chemically defined vitamin source. Specifically, a chemically defined medium is entirely free of animal- derived components and represents a pure and consistent cell culture environment.

[0273] The term “cell” with respect to a “host cell” as used herein shall refer to a single cell, a single cell clone, or a cell line of a host cell. LO018P

[0274] -36-

[0275] The term “cell line” as used herein refers to an established clone of a particular cell type that has acquired the ability to proliferate over a prolonged period of time. A cell line is typically used for expressing an endogenous or recombinant nucleic acid molecule or gene, or products of a metabolic pathway to produce polypeptides or cell metabolites mediated by such polypeptides. A “production host cell line” or “production cell line” is commonly understood to be a cell line ready-to-use for cell culture in a bioreactor to obtain the product of a production process, such as an expression product, in particular a POL

[0276] The term “host cell” as used herein shall particularly apply to any cell, which is suitably used for recombination purposes or as a recombinant host cell, to produce an expression product e.g., a POL It is well understood that the term “host cell” does not include human beings. Specifically, recombinant host cells as described herein are artificial organisms and derivatives of native (wild-type) host cells. It is well understood that the host cells, methods and uses described herein, e.g., specifically referring to those comprising one or more genetic modifications, promoter comprising a heterologous SD sequence, expression cassettes comprising such promoter, or artificial expression constructs, transfected or transformed host cells and recombinant expression products, are non-naturally occurring, are “man-made” or synthetic, and are therefore not considered as a result of “law of nature”. Genetic modifications described herein may employ tools, methods and techniques known in the art, such as described by Sambrook et aL, 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY).

[0277] The term “cell culture” or “culturing” or “cultivation” as used herein with respect to a host cell refers to the maintenance of cells in an artificial, in particular an in vitro environment, under conditions favoring growth, differentiation or continued viability, in an active or quiescent state, of the cells, specifically in a controlled bioreactor according to methods known in the industry.

[0278] Cell culture media provide the nutrients necessary to maintain and grow cells in a controlled, artificial and in vitro environment. Characteristics and compositions of the cell culture media vary depending on the particular cellular requirements. Important parameters include osmolality, pH, and nutrient formulations. Feeding of nutrients may be done in a continuous or discontinuous mode according to methods known in the art.

[0279] In addition to an appropriate carbon source, such as selected from one of the herein-disclosed types, cell culture media typically contain suitable minerals, salts, LO018P

[0280] -37- cofactors, buffers and other components, known to those skilled in the art, suitable for the growth of the cultures and promotion of protein production under the present disclosure.

[0281] Whereas a batch process is a cell culture mode in which all the nutrients necessary for culturing the cells are contained in the initial culture medium, without additional supply of further nutrients during fermentation, in a fed-batch or continuous process, after a batch phase, a feeding phase takes place in which one or more nutrients are supplied to the culture by feeding. Although in most processes the mode of feeding is critical and important, the host cell and methods described herein are not restricted with regard to a certain mode of cell culture.

[0282] When culturing a cell culture using appropriate culture media, the cells are brought into contact with the media in a culture vessel or with substrate under conditions suitable to support culturing the cells in the cell culture. Standard cell culture media and techniques are well-known in the art.

[0283] The cell cultures as described herein particularly employ techniques which provide for the production of an expression product. An expression product can be obtained in the cell culture medium, which is separable from the cellular biomass, herein referred to as “cell culture supernatant”. The cell culture supernatant may comprise expression products which are produced into the cell culture medium. Where expression products are produced in cellular compartments, the expression products or cells can be processed for producing the expression products into the cell culture supernatant.

[0284] To produce proteins that contain disulfide bonds in procaryotic host cells such as E. coli on a large scale, the host cell can be engineered or treated to comprise a specific folding apparatus, as well as an oxidizing environment for the formation of disulfide bonds. Proteins can be produced in various cellular compartments. For example, proteins that require an oxidizing environment, for disulfide bond formation, can e.g., be secreted into the oxidizing periplasmic compartment in soluble and active forms.

[0285] High level expression of recombinant proteins in the cytoplasm which is a reducing redox environment often leads to accumulation of proteins as insoluble aggregates as inclusion bodies. Inclusion bodies are dense aggregates of misfolded polypeptides devoid of bioactivity. The host cells can be engineered or treated to solubilize or refold proteins to achieve a native conformation. The treatment may involve solubilizing the inclusion bodies in denaturing conditions followed by refolding of the proteins. LO018P

[0286] -38-

[0287] There are methods to treat or engineer host cells which provide for expressing a recombinant protein in the cytoplasm of a prokaryotic cell and disulfide formation of the protein. For example, engineered host cells can be used with a more oxidizing environment in the cytoplasm to enable the production of disulfide-bonded proteins. To this end, E. coli Origami™ strains can be used which have mutations in glutathione reducatase (gor) and thioredoxin reductase (trxB), facilitating proper disulfide bond formation (e.g., Origami™ 2(DE3)pLysS Competent Cells - Novagen, Merck KGaA, Darmstadt, Germany). Likewise, a SHuffle® strain can be used, which is a mutant E. coli strain lacking the two reductases (trxB and gor) with an additional suppressor mutation (ahpC) which restores viability, allowing the formation of stable disulfide bonds in the cytoplasm. Under these conditions thioredoxins are in their oxidized state, converting them from reductases to oxidases. Additionally, a SHuffle strain expresses the disulfide bond isomerase DsbC within the cytoplasm. For example, SHuffle Express strains can be used to express correctly folded proteins comprising disulfide bonds (New England Biolabs, Inc., Ipswich, MA, USA).

[0288] An expression product can be produced using the host cell and the respective cell line described herein, by culturing in an appropriate medium, isolating the expressed product from the culture, and optionally purifying it by a suitable method.

[0289] Specifically, an expression product can be harvested from the cell culture supernatant or a cellular fraction and optionally be purified to obtain the expression product at a higher degree of purity.

[0290] Methods for recovering and / or purifying an expression product such as a POI are well-established in the art. Specifically, a physical or chemical or physical-chemical method is used. The physical or chemical or physical-chemical method can be a filtering method, a centrifugation method, an ultracentrifugation method, an extraction method, a lyophilization method, a precipitation method, a chromatography method or a combination of two or more of any such methods. Specifically, the chromatography method comprises one or more of size-exclusion chromatography (or gel filtration), ion exchange chromatography, e.g., anion or cation exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, and / or multimodal chromatography.

[0291] Several different approaches for the production of an expression product as described herein are preferred. An expression product may be expressed, processed and optionally secreted by transforming or transfecting a host cell with an expression LO018P

[0292] -39- vector harboring recombinant DNA encoding the expression product, preparing a culture of the transformed or transfected cell, growing the culture, inducing transcription and expression product production, and recovering the expression product.

[0293] Host cells described herein may be cultured continuously or discontinuously; in a batch process, a fed-batch process or a repeated fed-batch process. According to a specific aspect, the cell culture process is a fed-batch process. Specifically, a host cell transfected with a nucleic acid construct encoding a desired expression product, is cultured in a growth phase and transitioned to a production phase in order to produce the expression product.

[0294] According to a specific aspect, host cells described herein are cultured in a continuous mode e.g., employing a chemostat. A continuous fermentation process is characterized by a defined, constant and continuous rate of feeding of fresh culture medium into a bioreactor, whereby culture broth is at the same time removed from the bioreactor at the same defined, constant and continuous removal rate. By keeping culture medium, feeding rate and removal rate at the same constant level, the cell culture parameters and conditions in the bioreactor remain constant.

[0295] According to a specific aspect, host cells described herein are cultured in a perfusion mode e.g., culturing cells within a device while supplying fresh medium and removing the supernatant.

[0296] A stable cell culture as described herein is specifically understood to refer to a cell culture maintaining the genetic properties, specifically keeping the production level high e.g., at least at a pg level (e.g., pg POI level) even after about 20 generations of cultivation, preferably at least 30 generations, more preferably at least 40 generations, most preferred of at least 50 generations. Specifically, a stable recombinant host cell line is provided which is considered a great advantage when used for industrial scale production. Specifically, the host cell is suitable for a cell culture in a bioreactor or is capable of being cultured or grown in a bioreactor.

[0297] The cell culture described herein is particularly advantageous for use in a method of producing expression products on an industrial manufacturing scale e.g., with respect to both the volume and the technical system, in combination with a cultivation mode that is based on feeding of nutrients, in particular a fed-batch or batch process, or a continuous or semi-continuous process (e.g., chemostat).

[0298] The host cell described herein is typically tested for its capacity to express a GOI for producing an expression product, and / or tested for its yield and / or titer by any of the LO018P

[0299] -40- following tests: ELISA, activity assay, capillary electrophoresis, HPLC, or other suitable tests, such as SDS-PAGE and Western Blotting techniques, or mass spectrometry.

[0300] The expression product which is a POI is preferably expressed employing conditions to produce yields of at least 1 mg / L, preferably at least 10 mg / L, preferably at least 100 mg / L, most preferred at least 1 g / L.

[0301] The production method described herein specifically allows for the fermentation on a pilot or industrial scale. The industrial process scale would preferably employ volumes of at least 10 L, specifically at least 50 L, preferably at least 1 m3, preferably at least 10 m3, most preferably at least 100 m3.

[0302] Production conditions in industrial scale are preferred, which refer to e.g., fed batch culture in reactor volumes of 100 L to 10 m3or larger, employing typical process times of several days, or continuous processes in fermenter volumes of approximately 50 - 1000 L or larger, with dilution rates of approximately 0.001 - 0.15 IT1.

[0303] The devices, facilities and methods used for the purpose described herein are specifically suitable for use in and with culturing any desired cell line. Further, the devices, facilities and methods are suitable for culturing any eukaryotic host cell type, and are particularly suitable for production operations configured for production of expression products such as pharmaceutical and biopharmaceutical products, in particular polypeptide or protein products (POI), nucleic acid products (for example DNA, pDNA, or RNA), or cells and / or viruses such as those used in cellular and / or viral therapies. Unless stated otherwise herein, the devices, facilities, and methods can include any desired volume or production capacity including but not limited to benchscale, pilot-scale, and full production scale capacities.

[0304] Moreover, the devices, facilities, and methods can include any suitable reactor(s) including but not limited to stirred tank, airlift, fiber, microfiber, hollow fiber, ceramic matrix, fluidized bed, fixed bed, and / or spouted bed bioreactors. As used herein, “reactor” can include a fermenter or fermentation unit, or any other reaction vessel and the term “reactor” is used interchangeably with “fermenter.” For example, in some aspects, an example bioreactor unit can perform one or more, or all, of the following: feeding of nutrients and / or carbon sources, injection of suitable gas (e.g., oxygen), inlet and outlet flow of fermentation or cell culture medium, separation of gas and liquid phases, maintenance of temperature, maintenance of oxygen and CO2 levels, maintenance of pH level, agitation (e.g., stirring), and / or cleaning / sterilizing. Example reactor units, such as a fermentation unit, may contain multiple reactors within the unit, LO018P

[0305] -41- for example the unit can have 1 , 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100, or more bioreactors in each unit and / or a facility may contain multiple units having a single or multiple reactors within the facility. In various aspects, the bioreactor can be suitable for batch, semi fed-batch, fed-batch, perfusion, and / or a continuous fermentation process. Any suitable reactor diameter can be used. In certain aspects, the bioreactor can have a volume between about 100 mL and about 50,000 L. Non-limiting examples include a volume of 100 mL, 250 mL, 500 mL, 750 mL, 1 liter, 2 liters, 3 liters, 4 liters, 5 liters, 6 liters, 7 liters, 8 liters, 9 liters, 10 liters, 15 liters, 20 liters, 25 liters, 30 liters, 40 liters, 50 liters, 60 liters, 70 liters, 80 liters, 90 liters, 100 liters, 150 liters, 200 liters, 250 liters, 300 liters, 350 liters, 400 liters, 450 liters, 500 liters, 550 liters, 600 liters, 650 liters, 700 liters, 750 liters, 800 liters, 850 liters, 900 liters, 950 liters, 1000 liters, 1500 liters, 2000 liters, 2500 liters, 3000 liters, 3500 liters, 4000 liters, 4500 liters, 5000 liters, 6000 liters, 7000 liters, 8000 liters, 9000 liters, 10,000 liters, 15,000 liters, 20,000 liters, and / or 50,000 liters. Additionally, suitable reactors can be multi-use, single-use, disposable, or non-disposable and can be formed of any suitable material including metal alloys such as stainless steel (e.g., 316L or any other suitable stainless steel) and Inconel, plastics, and / or glass.

[0306] In certain aspects and unless stated otherwise herein, the devices, facilities, and methods described herein can also include any suitable unit operation and / or equipment not otherwise mentioned, such as operations and / or equipment for separation, purification, and isolation of such products. Any suitable facility and environment can be used, such as traditional stick-built facilities, modular, mobile and temporary facilities, or any other suitable construction, facility, and / or layout. For example, in some aspects modular clean-rooms can be used. Additionally, and unless otherwise stated, the devices, systems, and methods described herein can be housed and / or performed in a single location or facility or alternatively be housed and / or performed at separate or multiple locations and / or facilities.

[0307] Suitable techniques may encompass culturing in a bioreactor starting with a batch phase, followed by a short exponential fed batch phase at high specific growth rate, further followed by a fed batch phase at a low specific growth rate. Another suitable culture technique may encompass a batch phase followed by a fed-batch phase at any suitable specific growth rate or combinations of specific growth rates such as going from high to low growth rate over production time, or from low to high growth rate over LO018P

[0308] -42- production time. Another suitable culture technique may encompass a batch phase followed by a continuous culturing phase at a low dilution rate.

[0309] A preferred aspect includes a batch culture to provide biomass followed by a fed- batch culture for high yield production.

[0310] It is preferred to culture a host cell as described herein in a bioreactor under growth conditions to obtain a cell density of at least 1 g / L cell dry weight, more preferably at least 10 g / L cell dry weight, preferably at least 20 g / L cell dry weight, preferably at least any one of 30, 40, 50, 60, 70, or 80 g / L cell dry weight. It is advantageous to provide for such yields of biomass production on a pilot or industrial scale.

[0311] A growth medium allowing the accumulation of biomass, specifically a basal growth medium, typically comprises a carbon source, a nitrogen source, a source for sulphur and a source for phosphate. Typically, such a medium comprises furthermore trace elements and vitamins, and may further comprise amino acids, peptone or yeast extract.

[0312] Preferred nitrogen sources include NH4H2PO4, or NHs or (NH4)2SO4;

[0313] Preferred sulphur sources include MgSC , or (NH4)2SO4 or K2SO4;

[0314] Preferred phosphate sources include NH4H2PO4, or H3PO4, or NahbPC , KH2PO4, Na2HPC>4 or K2HPO4;

[0315] Further typical medium components include KCI, CaCh, and Trace elements such as: Fe, Co, Cu, Ni, Zn, Mo, Mn, I, B;

[0316] Preferably the medium is supplemented with vitamins essential for growth, e.g., B vitamins such as B7;

[0317] A typical growth medium for P. pastoris comprises glycerol, sorbitol or glucose, NH4H2PO4, MgSC , KCI, CaCh, biotin, and trace elements.

[0318] In the production phase a production medium is specifically used with only a limited amount of a supplemental carbon source.

[0319] Preferably, the host cell line is cultured in a mineral medium with a suitable carbon source, thereby further simplifying the isolation process significantly. An example of a preferred mineral medium is one containing a utilizable carbon source (e.g., glucose, glycerol, sorbitol, methanol, ethanol, or combinations thereof), salts containing the macro elements (potassium, magnesium, calcium, ammonium, chloride, sulphate, phosphate) and trace elements (copper, iodide, manganese, molybdate, cobalt, zinc, and iron salts, and boric acid), and optionally vitamins or amino acids, e.g., to complement auxotrophies. LO018P

[0320] -43-

[0321] Specifically, the cells are cultured under conditions suitable to effect expression of the desired expression product, which can be purified from the cells or culture medium, depending on the nature of the expression system and the expressed product or protein, e.g., whether a protein is fused to a signal peptide and whether a protein is soluble or membrane-bound. As will be understood by the skilled artisan, culture conditions will vary according to factors that include the type of host cell and particular expression vector employed.

[0322] A typical production medium comprises a supplemental carbon source, and further NH4H2PO4, MgSC , KCI, CaCh, biotin, and trace elements.

[0323] For example, the feed of the supplemental carbon source added to the fermentation may comprise a carbon source with up to 50 wt % utilizable sugars, or up to 100% utilizable alcohols.

[0324] The fermentation preferably is carried out at a pH ranging from 3 to 8.

[0325] Typical fermentation times are about 24 to 120 hours with temperatures in the range of 20 °C to 35°C, preferably 22-30°C.

[0326] The term "expression” or “expression cassette” is herein understood to refer to nucleic acid molecules (herein also referred to as polynucleotides), which contain a desired coding sequence (herein referred to as a gene), and control sequences in operable linkage, so that hosts transformed or transfected with these molecules incorporate the respective sequences and are capable of producing the encoded expression products. The term “expression” as used herein refers to expression of the transcribed polynucleotide or gene, or to the expression of the respective translated polypeptide or protein.

[0327] One or more expression cassettes are herein also understood as “expression system”. The expression system may be included in an expression construct, such as a vector; however, the relevant DNA may also be integrated into a host cell chromosome. Expression may refer to secreted or non-secreted expression products, including polypeptides or polynucleotides.

[0328] Expression constructs are conveniently provided as expression cassettes e.g., in the form of “vectors” or “plasmids”, which are typically DNA sequences that are required for the transcription of cloned recombinant nucleotide sequences i.e., of recombinant genes and the translation of their mRNA in a suitable host organism. Expression vectors or plasmids usually comprise an origin for autonomous replication or a locus for genome integration in the host cells, selectable markers (e.g., an amino acid synthesis gene or LO018P

[0329] -44- a gene conferring resistance to antibiotics such as zeocin, kanamycin, G418 or hygromycin, nourseothricin), a number of restriction enzyme cleavage sites, a suitable promoter sequence and a transcription terminator, which components are operably linked together. The terms “plasmid” and “vector” as used herein include autonomously replicating nucleotide sequences as well as genome integrating nucleotide sequences, such as artificial chromosomes.

[0330] An “expression vector” is herein understood as a polynucleic acid construct, generated recombinantly or synthetically, with a series of specified polynucleic acid elements that permit transcription of a particular nucleic acid sequence (in particular a GOI) in a host cell. Typically, this vector includes a transcriptional unit comprising the particular nucleic acid sequence to be transcribed operably linked to a promoter. A vector expressible in a host can be e.g. an autonomously or self-replicating plasmid,

[0331] A vector as described herein specifically may include autonomously replicating nucleotide sequences or genome integrating nucleotide sequences. Vectors include, but are not limited to, plasmids, minicircles, integrative plasmids, episomal plasmids, centromere plasmids, artificial chromosomes, cosmids, phages, viral genomes or viruses. Available commercial vectors are known to those of skill in the art. Commercial vectors are available from Life Technologies Corporation (a Thermo Fisher Scientific Inc. company), the European Molecular Biology Laboratory (EMBL, Germany) or Atum (DNA TwoPointO, Inc, Newark, CA, U.S.A.), for example.

[0332] Expression vectors may include but are not limited to cloning vectors, modified cloning vectors and specifically designed plasmids. Preferred expression vectors described herein are expression vectors suitable for expressing of a recombinant gene in a procaryotic or bacterial host cell and are selected depending on the host organism. Appropriate expression vectors typically comprise regulatory sequences suitable for expressing DNA in a procaryotic or bacterial host cell. Examples of regulatory sequences include promoter, operators, enhancers, ribosomal binding sites, and sequences that control transcription and translation initiation and termination. The regulatory sequences are typically operably linked to the DNA sequence to be expressed.

[0333] To allow expression of a recombinant DNA in a host cell, a promoter sequence is typically regulating and initiating transcription of the downstream nucleotide sequence, with which it is operably linked. An expression cassette or vector typically comprises a promoter nucleotide sequence which is adjacent to the 5’ end of a coding sequence, LO018P

[0334] -45- e.g., upstream from and adjacent to the coding sequence, or if a signal or leader sequence is used, upstream from and adjacent to said signal and leader sequence, respectively, to facilitate translation initiation and expression of coding sequences to obtain the expression product (e.g., a POI).

[0335] Specific expression constructs described herein comprise a promoter operably linked to a heterologous SD sequence and a coding nucleotide sequence (e.g., a GOI) under the transcriptional control of said promoter. Specifically, the promoter is not natively associated with said coding sequence.

[0336] Specific expression constructs described herein comprise a polynucleotide encoding a POI linked with a leader sequence (e.g., a secretion signal peptide sequence (pre-sequence), or a pro-sequence). A secretion leader causes transport of the POI into the secretory pathway and / or secretion of the POI from the host cell. The presence of such leader sequence in the expression vector is typically required when the POI intended for recombinant expression and secretion is a protein which is not naturally secreted and therefore lacks a natural secretion leader sequence, or its nucleotide sequence has been cloned without its natural secretion leader sequence. In general, any secretion leader sequence effective to cause secretion of the POI from the host cell may be used.

[0337] According to a specific aspect, multicloning vectors may be used, which are vectors having a multicloning site. Specifically, a desired heterologous polynucleotide can be integrated or incorporated at a multicloning site to prepare an expression vector. In the case of multicloning vectors, a promoter is typically placed upstream of the multicloning site.

[0338] The term "gene expression", or “expressing a polynucleotide” or “expressing a nucleic acid molecule” as used herein, is meant to encompass at least one step selected from the group consisting of DNA transcription into mRNA, mRNA translation and processing, mRNA maturation, mRNA export, protein folding and / or protein transport.

[0339] As described herein expression under the control of a promoter described herein can be modulated by incorporating an SD sequence into the promoter which SD sequence changes the properties of the promoter with respect to the promoter strength on carbon-limit conditions. Specifically, the promoter is engineered to incorporate an SD sequence that confers a change of the expression level, such as an increase or decrease of expression. LO018P

[0340] -46-

[0341] The term “increase expression” typically refer to "overexpressing" and generally refers to any amount or level more or higher than an expression level exhibited by a reference or standard, such as the same host cell without engineering to increase expression (which can be used as a negative control), or which is otherwise expressed in a host cell of a comparable type or species (which can be used as a benchmark or positive control).

[0342] Increase of expression as described herein specifically refers to GOI expression under the control of a promoter which is engineered to comprise a heterologous SD sequence that increases the transcription and / or translation efficacy of the expression construct or system on certain (in particular, carbon-limit) conditions. Upon engineering the host cell by genetic modification to increase expression of a GOI, the expression of an expression product is at a level which is more or higher than the expression of the expression product prior to a genetic modification of the host cell or in a comparable host cell. “More than” includes e.g., an amount that is increased by a certain percentage e.g., a percentage of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80, 90%, 95%, or higher.

[0343] The term “decrease expression” (herein also referred to as ’’reduce expression” which terms are interchangeably used) typically refers to "underexpressing" and generally refers to any amount or level more or lower than an expression level exhibited by a reference or standard, such as the same host cell without engineering to reduce expression (which can be used as a negative control), or which is otherwise expressed in a host cell of a comparable type or species (which can be used as a benchmark or positive control).

[0344] A decreased expression as described herein specifically refers to GOI expression under the control of a promoter which is engineered to comprise a heterologous SD sequence that decreases the transcription and / or translation efficacy of the expression construct or system on certain (in particular, carbon-limit) conditions. Upon engineering the host cell by genetic modification to decrease expression of a GOI, the expression of an expression product is at a level which is less or lower higher than the expression of the expression product prior to a genetic modification of the host cell or in a comparable host cell. “Less than” includes e.g., an amount that is reduced by a certain percentage e.g., a percentage of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80, 90%, 95%, or higher. No expression of the gene product or a polypeptide is also encompassed by the term “decreased expression”. LO018P

[0345] -47-

[0346] The term “endogenous” as used herein is meant to include those molecules and sequences, in particular polynucleotides (such as a gene, promoter or promoter element e.g., an SD sequence) or proteins, which are present in a wild-type (native) expression construct (or an element thereof, such as a promoter) or host cell, prior to any genetic modification thereof.

[0347] For example, an SD sequence that does occur in (and can be obtained from) a particular promoter as it is found in nature ( / .e., is naturally-occurring), is understood to be “endogenous to the promoter”. Even if an endogenous SD sequence is no more comprised in an engineered promoter, such as in a promoter wherein an endogenous SD sequences has been substituted for a heterologous one, the SD sequence is herein still referred to as “endogenous” to the promoter.

[0348] According to another example, a polynucleotide or protein that does occur in (and can be obtained from) a particular host cell as it is found in nature ( / .e., is naturally- occurring), is understood to be “host cell endogenous” or “endogenous to the host cell”. Even if an endogenous polynucleotide or protein is no more comprised or expressed from in an engineered host cell, the respective polynucleotide or protein is herein still referred to as “endogenous” to the host cell.

[0349] The term “heterologous” as used herein is meant to include molecules and sequences, in particular polynucleotides (such as a gene, promoter or promoter element e.g., an SD sequence) or proteins, which are either foreign to a wild-type (native) expression construct (or an element thereof, such as a promoter) or host cell, prior to any modification thereof i.e. “exogenous”, or not found in nature in said expression construct or host cell; or that is naturally found in a given expression construct or host cell e.g., is “endogenous”, however, incorporated in a heterologous construct, and therefore an artificial construct which is per se heterologous. According to a specific example, an artificial construct may comprise a heterologous compound that is fused or in conjunction with an endogenous nucleic acid, thereby rendering the construct heterologous. Any recombinant or artificial nucleotide sequence is herein understood to be heterologous.

[0350] Specifically, a heterologous nucleotide sequence is not found in the same relationship to an endogenous expression construct (or an element thereof, such as a promoter) or host cell, as naturally-occurring. An example of a heterologous polynucleotide is a nucleotide sequence not natively associated with a promoter e.g., to obtain an engineered promoter, such as described herein. A further example of a LO018P

[0351] -48- heterologous compound is an expression product encoding polynucleotide operably linked to a transcriptional control element e.g., a promoter, to which an endogenous, naturally-occurring expression product coding sequence is not normally operably linked.

[0352] A heterologous nucleotide sequence, or a nucleic acid molecule comprising the heterologous nucleotide sequence, may differ in sequence from the endogenous one but has the same function. For example, an engineered promoter described herein still has promoter activity, yet to a different extent or in a different mode. Specifically, the engineered promoter has a certain sequence identity compared to the endogenous one.

[0353] The term "operably linked" as used herein refers to the association of nucleotide sequences on a single nucleic acid molecule, e.g., an expression construct, expression cassette or vector, in a way such that the function of one or more nucleotide sequences is affected by at least one other nucleotide sequence present on said nucleic acid molecule. By operably linking, a nucleic acid sequence is placed into a functional relationship with another nucleic acid sequence on the same nucleic acid molecule. For example, a promoter is operably linked with a coding sequence of a recombinant gene, when it is capable of effecting the expression of that coding sequence. For example, a promoter is operably linked with an SD sequence and a coding sequence of a recombinant gene, when it is capable of effecting the expression of that coding sequence in a bacterial expression system. Specifically, nucleic acid sequences operably linked to each other may be immediately linked i.e., without further elements or nucleic acid sequences in between such operably linked nucleic acid sequences. Alternatively, a suitable linking sequence e.g., a spacer or cloning site, can be used. Linking can e.g., be accomplished by ligation at convenient restriction sites.

[0354] Specifically, operably linked nucleic acid sequences are placed into a functional relationship with each other. For example, a promotor is operably linked to a coding sequence if it affects the transcription of the sequence. According to another example, an SD sequence is operably linked to a promoter sequence if it is positioned so as to facilitate translation of a coding sequence that is expressed under operable control of the promoter.

[0355] The term “expression product” as used herein shall refer to compounds produced upon expressing a GOL Such compound can be a polynucleotide or nucleic acid molecule, or be a polypeptide or protein e.g., a POL An expression product that is produced by expressing a recombinant nucleic acid or a recombinant nucleic acid sequence is herein also referred to as a recombinant expression product. Exemplary LO018P

[0356] -49- expression products are pharmaceutical or biopharmaceutical products, in particular polypeptide or protein products (e.g., a POI), or nucleic acid products such as comprising a polynucleotide or a nucleic acid molecule (for example DNA, pDNA, or RNA), or cells and / or viruses such as those used in cellular and / or viral therapies.

[0357] The term “polynucleotide”, “nucleic acid molecule(s)” or “nucleic acid sequence(s)” (which are herein also interchangeably used), refers to nucleotides, either ribonucleotides or deoxyribonucleotides or a combination of both, in a polymeric unbranched form of any length. Preferably, a polynucleotide refers to deoxyribonucleotides in a polymeric unbranched form of any length. Here, nucleotides consist of a pentose sugar (deoxyribose), a nitrogenous base (adenine, guanine, cytosine or thymine) and a phosphate group.

[0358] The term “gene of interest” abbreviated GOI as used herein, shall mean a polynucleotide comprising or consisting of a coding nucleic acid sequence, such as a polynucleotide sequence, which encodes an expression product.

[0359] As used herein, the terms "polypeptide", "peptide", "protein", "polypeptide" and "peptidic" are used interchangeably to designate a series of amino acid residues connected to the other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.

[0360] The term "protein of interest”, abbreviated (POI), as used herein refers to a polypeptide or a protein that is produced by means of recombinant technology in a host cell. More specifically, the protein may either be a polypeptide not naturally-occurring in the host cell i.e., a heterologous protein, or else may be native to the host cell i.e., an endogenous protein (also referred to as homologous protein) to the host cell, but can be produced, for example, by transformation or transfection with a vector containing a nucleic acid sequence encoding the POI, or upon integration by recombinant techniques of one or more copies of the nucleic acid sequence encoding the POI into the genome of the host cell, or by recombinant modification of one or more regulatory sequences controlling the expression of the gene encoding the POI, e.g., of the promoter sequence.

[0361] As referred to herein, a POI may be specifically selected from the following: BOTOX, Myobloc, Neurobloc, Dysport (or other serotypes of botulinum neurotoxins), alglucosidase alpha, daptomycin, YH-16, choriogonadotropin alpha, filgrastim, cetrorelix, interleukin-2, aldesleukin, teceleulin, denileukin diftitox, interferon alpha-n3 (injection), interferon alpha-nl, DL-8234, interferon, Suntory (gamma-1 a), interferon gamma, thymosin alpha 1 , tasonermin, DigiFab, ViperaTAb, EchiTAb, CroFab, LO018P

[0362] -50- nesiritide, abatacept, alefacept, Rebif, eptoterminalfa, teriparatide (osteoporosis), calcitonin injectable (bone disease), calcitonin (nasal, osteoporosis), etanercept, hemoglobin glutamer 250 (bovine), drotrecogin alpha, collagenase, carperitide, recombinant human epidermal growth factor (topical gel, wound healing), DWP401 , darbepoetin alpha, epoetin omega, epoetin beta, epoetin alpha, desirudin, lepirudin, bivalirudin, nonacog alpha, Mononine, eptacog alpha (activated), recombinant Factor VIII+VWF, Recombinate, recombinant Factor VIII, Factor VIII (recombinant), Alphnmate, octocog alpha, Factor VIII, palifermin, indikinase, tenecteplase, alteplase, pamiteplase, reteplase, nateplase, monteplase, follitropin alpha, rFSH, hpFSH, micafungin, pegfilgrastim, lenograstim, nartograstim, sermorelin, glucagon, exenatide, pramlintide, iniglucerase, galsulfase, Leucotropin, molgramostirn, triptorelin acetate, histrelin (subcutaneous implant, Hydron), deslorelin, histrelin, nafarelin, leuprolide sustained release depot (ATRIGEL), leuprolide implant (DUROS), goserelin, Eutropin, KP-102 program, somatropin, mecasermin (growth failure), enlfavirtide, Org-33408, insulin glargine, insulin glulisine, insulin (inhaled), insulin lispro, insulin deternir, insulin (buccal, RapidMist), mecasermin rinfabate, anakinra, celmoleukin, 99 mTc-apcitide injection, myelopid, Betaseron, glatiramer acetate, Gepon, sargramostim, oprelvekin, human leukocyte-derived alpha interferons, Bilive, insulin (recombinant), recombinant human insulin, insulin aspart, mecasenin, Roferon-A, interferon-alpha 2, Alfaferone, interferon alfacon-1 , interferon alpha, Avonex' recombinant human luteinizing hormone, dornase alpha, trafermin, ziconotide, taltirelin, diboterminalfa, atosiban, becaplermin, eptifibatide, Zemaira, CTC-111 , Shanvac-B, HPV vaccine (quadrivalent), octreotide, lanreotide, ancestirn, agalsidase beta, agalsidase alpha, laronidase, prezatide copper acetate (topical gel), rasburicase, ranibizumab, Actimmune, PEG-lntron, Tricomin, recombinant house dust mite allergy desensitization injection, recombinant human parathyroid hormone (PTH) 1-84 (sc, osteoporosis), epoetin delta, transgenic antithrombin III, Granditropin, Vitrase, recombinant insulin, interferon-alpha (oral lozenge), GEM-21 S, vapreotide, idursulfase, omnapatrilat, recombinant serum albumin, certolizumab pegol, glucarpidase, human recombinant C1 esterase inhibitor (angioedema), lanoteplase, recombinant human growth hormone, enfuvirtide (needle-free injection, Biojector 2000), VGV-1 , interferon (alpha), lucinactant, aviptadil (inhaled, pulmonary disease), icatibant, ecallantide, omiganan, Aurograb, pexigananacetate, ADI-PEG-20, LDI-200, degarelix, cintredelinbesudotox, Favld, MDX-1379, ISAtx-247, liraglutide, teriparatide (osteoporosis), tifacogin, AA4500, T4N5 liposome lotion, catumaxomab, DWP413, ART- LO018P

[0363] -51-

[0364] 123, Chrysalin, desmoteplase, amediplase, corifollitropinalpha, TH-9507, teduglutide, Diamyd, DWP-412, growth hormone (sustained release injection), recombinant G-CSF, insulin (inhaled, AIR), insulin (inhaled, Technosphere), insulin (inhaled, AERx), RGN- 303, DiaPep277, interferon beta (hepatitis C viral infection (HCV)), interferon alpha-n3 (oral), belatacept, transdermal insulin patches, AMG-531 , MBP-8298, Xerecept, opebacan, AIDSVAX, GV-1001 , LymphoScan, ranpirnase, Lipoxysan, lusupultide, MP52 (beta-tricalciumphosphate carrier, bone regeneration), melanoma vaccine, sipuleucel-T, CTP-37, Insegia, vitespen, human thrombin (frozen, surgical bleeding), thrombin, TransMID, alfimeprase, Puricase, terlipressin (intravenous, hepatorenal syndrome), EUR-1008M, recombinant FGF-I (injectable, vascular disease), BDM-E, rotigaptide, ETC-216, P-113, MBI-594AN, duramycin (inhaled, cystic fibrosis), SCV-07, OPI-45, Endostatin, Angiostatin, ABT-510, Bowman Birk Inhibitor Concentrate, XMP- 629, 99 mTc-Hynic-Annexin V, kahalalide F, CTCE-9908, teverelix (extended release), ozarelix, rornidepsin, BAY-504798, interleukin4, PRX-321 , Pepscan, iboctadekin, rhlactoferrin, TRU-015, IL-21 , ATN-161 , cilengitide, Albuferon, Biphasix, IRX-2, omega interferon, PCK-3145, CAP-232, pasireotide, huN901-DMI, ovarian cancer immunotherapeutic vaccine, SB-249553, Oncovax-CL, OncoVax-P, BLP-25, CerVax- 16, multi-epitope peptide melanoma vaccine (MART-1 , gp100, tyrosinase), nemifitide, rAAT (inhaled), rAAT (dermatological), CGRP (inhaled, asthma), pegsunercept, thymosinbeta4, plitidepsin, GTP-200, ramoplanin, GRASPA, OBI-1 , AC-100, salmon calcitonin (oral, eligen), calcitonin (oral, osteoporosis), examorelin, capromorelin, Cardeva, velafermin, 131 I-TM-601 , KK-220, T-10, ularitide, depelestat, hematide, Chrysalin (topical), rNAPc2, recombinant Factor V111 (PEGylated liposomal), bFGF, PEGylated recombinant staphylokinase variant, V-10153, SonoLysis Prolyse, NeuroVax, CZEN-002, islet cell neogenesis therapy, rGLP-1 , BIM-51077, LY-548806, exenatide (controlled release, Medisorb), AVE-0010, GA-GCB, avorelin, ACM-9604, linaclotid eacetate, CETi-1 , Hemospan, VAL (injectable), fast-acting insulin (injectable, Viadel), intranasal insulin, insulin (inhaled), insulin (oral, eligen), recombinant methionyl human leptin, pitrakinra subcutaneous injection, eczema), pitrakinra (inhaled dry powder, asthma), Multikine, RG-1068, MM-093, NBI-6024, AT-001 , PI-0824, Org- 39141 , Cpn10 (autoimmune diseases / inflammation), talactoferrin (topical), rEV-131 (ophthalmic), rEV-131 (respiratory disease), oral recombinant human insulin (diabetes), RPI-78M, oprelvekin (oral), CYT-99007 CTLA4-lg, DTY-001 , valategrast, interferon alpha-n3 (topical), IRX-3, RDP-58, Tauferon, bile salt stimulated lipase, Merispase, LO018P

[0365] -52- alaline phosphatase, EP-2104R, Melanotan-ll, bremelanotide, ATL-104, recombinant human microplasmin, AX-200, SEMAX, ACV-1 , Xen-2174, CJC-1008, dynorphin A, SI- 6603, l_AB GHRH, AER-002, BGC-728, malaria vaccine (virosomes, PeviPRO), ALTU- 135, parvovirus B19 vaccine, influenza vaccine (recombinant neuraminidase), malaria / HBV vaccine, anthrax vaccine, Vacc-5q, Vacc-4x, HIV vaccine (oral), HPV vaccine, Tat Toxoid, YSPSL, CHS-13340, PTH(1-34) liposomal cream (Novasome), Ostabolin-C, PTH analog (topical, psoriasis), MBRI-93.02, MTB72F vaccine (tuberculosis), MVA-Ag85A vaccine (tuberculosis), FARA04, BA-210, recombinant plague FIV vaccine, AG-702, OxSODrol, rBetVI , Der-p1 / Der-p2 / Der-p7 allergentargeting vaccine (dust mite allergy), PR1 peptide antigen (leukemia), mutant ras vaccine, HPV-16 E7 lipopeptide vaccine, labyrinthin vaccine (adenocarcinoma), CML vaccine, WT1 -peptide vaccine (cancer), IDD-5, CDX-110, Pentrys, Norelin, CytoFab, P- 9808, VT-111 , icrocaptide, telbermin (dermatological, diabetic foot ulcer), rupintrivir, reticulose, rGRF, HA, alpha-galactosidase A, ACE-011 , ALTU-140, CGX-1160, angiotensin therapeutic vaccine, D-4F, ETC-642, APP-018, rhMBL, SCV-07 (oral, tuberculosis), DRF-7295, ABT-828, ErbB2-specific immunotoxin (anticancer), DT3SSIL- 3, TST-10088, PRO-1762, Combotox, cholecystokinin-B / gastrin-receptor binding peptides, 111 ln-hEGF, AE-37, trasnizumab-DM1 , Antagonist G, IL-12 (recombinant), PM-02734, IMP-321 , rhlGF-BP3, BLX-883, CUV-1647 (topical), L-19 based radioimmunotherapeutics (cancer), Re-188-P-2045, AMG-386, DC / 1540 / KLH vaccine (cancer), VX-001 , AVE-9633, AC-9301 , NY-ESO-1 vaccine (peptides), NA17.A2 peptides, melanoma vaccine (pulsed antigen therapeutic), prostate cancer vaccine, CBP-501 , recombinant human lactoferrin (dry eye), FX-06, AP-214, WAP-8294A (injectable), ACP-HIP, SUN-11031 , peptide YY [3-36] (obesity, intranasal), FGLL, atacicept, BR3-Fc, BN-003, BA-058, human parathyroid hormone 1-34 (nasal, osteoporosis), F-18-CCR1 , AT-1100 (celiac disease / diabetes), JPD-003, PTH(7-34) liposomal cream (Novasome), duramycin (ophthalmic, dry eye), CAB-2, CTCE-0214, GlycoPEGylated erythropoietin, EPO-Fc, CNTO-528, AMG-114, JR-013, Factor XIII, aminocandin, PN-951 , 716155, SUN-E7001 , TH-0318, BAY-73-7977, teverelix (immediate release), EP-51216, hGH (controlled release, Biosphere), OGP-I, sifuvirtide, TV4710, ALG-889, Org-41259, rhCCIO, F-991 , thymopentin (pulmonary diseases), r(m)CRP, hepatoselective insulin, subalin, L19-IL-2 fusion protein, elafin, NMK-150, ALTU-139, EN-122004, rhTPO, thrombopoietin receptor agonist (thrombocytopenic disorders), AL-108, AL-208, nerve growth factor antagonists (pain), SLV-317, CGX- LO018P

[0366] -53-

[0367] 1007, INNO-105, oral teriparatide (eligen), GEM-OS1 , AC-162352, PRX-302, LFn-p24 fusion vaccine (Therapore), EP-1043, S pneumoniae pediatric vaccine, malaria vaccine, Neisseria meningitidis Group B vaccine, neonatal group B streptococcal vaccine, anthrax vaccine, HCV vaccine (gpE1+gpE2+MF-59), otitis media therapy, HCV vaccine (core antigen+ISCOMATRIX), hPTH(1-34) (transdermal, ViaDerm), 768974, SYN-101 , PGN-0052, aviscumnine, BIM-23190, tuberculosis vaccine, multi-epitope tyrosinase peptide, cancer vaccine, enkastim, APC-8024, GI-5005, ACC-001 , TTS-CD3, vascular- targeted TNF (solid tumors), desmopressin (buccal controlled-release), onercept, or TP- 9201 , adalimumab (HUMIRA), infliximab (REMICADE™), rituximab (RITUXAN™ / MAB THERA™), etanercept (ENBREL™), bevacizumab (AVASTIN™), trastuzumab (HERCEPTIN™), pegrilgrastim (NEUI-ASTA™), or any other suitable POI including biosimilars and biobetters.

[0368] The term "promoter" as used herein refers to a nucleic acid sequence that controls expression of a transcriptional unit. A promoter sequence is typically as a noncoding regulatory sequence which, when operably linked to a coding sequence, controls the transcription of the coding sequence. A promoter comprises a regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (in the 3'-direction) coding sequence. Within the promoter there are protein binding domains responsible for the binding of RNA polymerase, a transcription start site, a transcription initiation region and binding sites for regulatory proteins. A transcription initiation region is commonly understood as a signal region which promotes transcription initiation which normally consist of a -35, -10 region (the actual RNA-polymerase binding site) and may contain several binding sites of transcription factors and one or more transcriptional start sites. These regions are essential for the initiation of transcription and to produce the mRNA transcript in bacteria. Downstream from this region towards the protein coding sequence there are motifs encode necessary sequences for translation initiation including ribosome binding sites that are called Shine Dalgarno (SD) sequences. Typically, the translation initiation region is located downstream to the transcription initiation site and is operably linked to the genes to be expressed but are not essential components of transcription (mRNA production). These SD sequences are interchangeable in nature and can be combined with suitable transcription initiation sequences (promoters) to create a functional unit of protein expression.

[0369] A promoter is herein described to initiate, regulate, or otherwise mediate or control the expression of a coding polynucleotide (DNA), such as a POI coding DNA, to LO018P

[0370] -54- produce an expression product. Promoter DNA and coding DNA may be or be derived from the same gene or from different genes, and may be derived from the same or different organisms. A promoter can be a full-length promoter or a naturally-occurring variant or an engineered (artificial variant) of a promoter, or a fragment of a full-length promoter, as long as the variant or fragment has promoter activity.

[0371] Either the promoter or the coding sequence, or both, can be heterologous to a cell expressing the coding sequence. A promoter may or may not be natively associated with the coding sequence. Any one or both of the promoter and the coding sequence can be endogenous and are herein also understood to be not natively associated in a cell, if comprised in a heterologous expression cassette.

[0372] A promoter may be natively associated with the coding sequence, such as in a native (wild-type) cell for endogenous protein expression.

[0373] A heterologous promoter may be heterologous to elements of an expression construct, or an element thereof e.g., a coding sequence to be expressed. A heterologous promoter can be a recombinant promoter and / or an artificial promoter, or else a promoter that is originating from the wild-type host cell, but positioned in the host cell genome within a heterologous expression cassette or positioned at a location where it is not naturally-occurring in the wild-type host cell. An SD sequence combined with and / or comprised in a promoter can be heterologous to the promoter, as further described herein.

[0374] A promoter that is selected for SD sequence engineering is herein also referred to a target promoter.

[0375] The strength of a promoter specifically typically refers to its transcription strength, represented by the efficiency of initiation of transcription occurring at that promoter with high or low frequency. The higher the transcription strength, the more frequently transcription will occur at that promoter. Promoter strength is a typical feature of a promoter, because it determines how often a given mRNA sequence is transcribed, effectively giving higher priority for transcription to some genes over others, leading to a higher concentration of the transcript. A gene that codes for a protein that is required in large quantities, for example, typically requires a relatively strong promoter. The RNA polymerase can only perform one transcription task at a time and so must prioritize its work to be efficient. Differences in promoter strength are selected to allow for this prioritization. LO018P

[0376] -55-

[0377] The promoter strength may also refer to the frequency of transcription which is commonly understood as the transcription rate e.g., as determined by the amount of a transcript in a suitable assay e.g., RT-PCR or Northern blotting.

[0378] The term “regulatable” with respect to a regulatory element which is an inducible (in particular auto-inducible), inducible or repressible promoter, shall refer to an element that is induced in a host cell in the presence of an excess amount of a substance (such as a carbon starvation signal molecule like cAMP) e.g., in the growth phase of a batch culture, and induce strong activity e.g., in the production phase of a cell culture (such as upon reducing the amount of a nutrient, in particular a carbon source, or upon feeding a supplemental substrate that is consumed during the production phase), according to a fed-batch strategy. A promoter can as well be regulatable, such that the element is inactive without addition of a cell culture additive, and active in the presence of such additive. Thus, expression of a GOI under the control of such regulatory element can be induced upon addition of such additive.

[0379] An auto-inducible promoter as described herein can regulate expression according to the level of a nutrient such as a carbon-source. Upon consumption of the carbon source, the promoter gets auto-induced because of early onset of carbon- depletion and the accumulation of starvation signals.

[0380] Advantages of autoinduction over inducer-based expression include the following:

[0381] • Unsupervised automatic induction of expression based on intracellular metabolic signals;

[0382] • No addition of chemical inducers; no toxicity; cost reduction;

[0383] • Population heterogeneity is reduced; there are only "intrinsic" factors remaining during fermentation which can cause population heterogeneity;

[0384] • Simplified Fermentation process is more resistant to stochastic variations due to reduced number of variables.

[0385] Specific promoters which are auto-inducible on carbon-depletion are those comprising at least one CRP-binding site, such as bacterial promoters of the genes glpF, cstA, rbsD, aldA, glpK, znuA, aceB, gatZ, ahpC, zinT, acs, gatY, bsmA, rbsD, ychN, tnaC, IsrR, IsrA, sra, prpB, cspD, aldB, rmf, yjcH, soxS, yftj, yfiN, ydcS or naturally- occurring variants of any of the foregoing genes.

[0386] Specifically, the promoter is of bacterial origin, in particular of E. coli origin. Specifically, the promoter is of any one of the E. coli genes glpF, cstA, rbsD, aldA, glpK, LO018P

[0387] -56- znuA, aceB, gatZ, ahpC, zinT, acs, gatY, bsmA, rbsD, ychN, tnaC, IsrR, IsrA, sra, prpB, cspD, aldB, rmf, yjcH, soxS, yftj, yfiN, ydcS or variants of any of the foregoing, such as naturally-occurring variants or artificial variants, such as further described herein.

[0388] A promoter described herein may be auto-inducible on carbon-depletion before SD engineering, in particular before engineering to incorporate the heterologous SD sequence, and its maximum expression level may be increased by such engineering.

[0389] It can be that any of the promoters described herein originates from a promoter that is not auto-inducible in carbon-depletion before SD engineering, in particular before engineering to incorporate the heterologous SD sequence, and the promoter is engineered for auto-inducibility not only by SD engineering, but also by one or more further genetic modifications, such as e.g., to incorporate a CRP-binding site.

[0390] The auto-inducible promoter described herein may have more than one regulatable feature. For example, the promoter is auto-inducible on carbon-depletion, and in addition, may be inducible by adding an exogenous inducer. The auto-inducible promoter strength may be different from the otherwise promoter strength that is induced by adding an exogenous inducer. Engineering the promoter as described herein specifically modulates the auto-inducible properties of the promoter, but may or may not modulate the otherwise inducible properties of the promoter which are induced by adding an exogenous inducer.

[0391] The term "repression," or "repressed," as used herein e.g., to characterize a carbon-source regulatable promoter described herein, refers to the interference of transcription of a GOI that is under transcriptional control of a promoter that is understood to be repressible, resulting in decreased expression of an expression product by the cell(s).

[0392] Repression of a carbon-source regulatable promoter as described herein is specifically occurring when the carbon-source that is used as a repressing agent is in the cell culture medium. A repressing agent can be a certain carbon-source or a repressing amount of a carbon-source e.g., above a certain threshold amount. Expression of a coding sequence is said to be "de-repressed," when, the repressing agent is removed from the medium, or reduced to below a threshold amount that is no more repressing. Upon de-repressing, the promoter is understood to be fully induced, and expression of the expression product is typically at least 1.5-fold over the basal levels of expression by the cell(s) under promoter-repressing conditions, which means that the (auto-)induction factor is at least 1 .5. LO018P

[0393] -57-

[0394] Specifically, transcription of a GOI under the control of a carbon-source regulatable promoter described herein may be repressed by at least any one of 10, 20, 30, 40, 50, 60, 70, 80, 85%, 90%, or 95%, or completely repressed (100% repressed) compared to transcription of said gene upon de-repressing or fully inducing the promoter.

[0395] The differential promoter strength comparing the promoter strength under repressed and induced (or de-repressed) condition, determines the regulatable properties of a promoter and the respective induction ratio also referred to as “induction factor”, or in the present case where induction is by carbon-depletion, the auto-induction ratio. According to certain aspects, the (auto-)induction ratio is understood as a differential promoter strength which is determined by the initiation of producing an expression product upon switching to inducing conditions below a predetermined carbon source threshold, and compared to the strength in the repressed state. The transcription strength commonly is understood as the strength in the fully induced state i.e., showing about maximum activities under de-repressing conditions. The differential promoter strength is e.g., determined according to the efficiency or yield and / or titer of an expression product in a recombinant host cell line under de-repressing conditions as compared to repressing conditions, or else by the amount or level of a transcript.

[0396] Specifically, the induction ratio (or induction factor) of a promoter described herein is at least 1 , or at least any one of 1 , 1.1 , 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6, 7, 8, 9, or 10, or even higher.

[0397] The regulatable promoter as described herein has a preferred differential promoter strength (induction ratio or auto-induction ratio), which is at least 1.5-fold or at least 2-fold, more preferably at least 5-fold, even more preferred at least 10-fold, more preferred at least 20-fold, more preferably at least 30, 40, 50, or 100-fold in the derepressed (fully induced) state compared to the repressed state, also understood as fold induction.

[0398] The term “sequence identity” of a variant, including without limitation homologues or orthologues, as compared to a parent nucleotide or amino acid sequence indicates the degree of identity of two or more sequences. Two or more amino acid sequences may have the same or conserved amino acid residues at a corresponding position, to a certain degree, up to 100%. Two or more nucleotide sequences may have the same or conserved base pairs at a corresponding position, to a certain degree, up to 100%. The compared molecules may comprise sequences of different lengths. LO018P

[0399] -58-

[0400] The degree of sequence identity can be determined by comparing similar overlapping sequences, wherein the similar overlapping sequences may have a certain degree of sequence identity. The overlapping sequences may comprise a part or the full-length of one of the compared sequences e.g., the shorter one of the compared sequences, wherein the part is e.g., at least any one of 50%, 60%, 70%, 80%, 90%, or 95% of said one the compared sequences. In particular, sequence identity refers to comparing the full-length sequence of one of the compared sequences e.g., the shorter one of the compared sequences.

[0401] The term “comprising or consisting of’ with respect to a certain sequence identified herein, shall particularly mean the respective sequence identity to the part or the full-length of one of the compared sequences e.g., the shorter one of the compared sequences, wherein the part is e.g., at least any one of 50%, 60%, 70%, 80%, 90%, or 95% of said one the compared sequences.

[0402] In particular, where a molecule comprises a certain sequence identity to a compared molecule, the sequence identity is determined for at least part of said compared molecule e.g., at least any one of 50%, 60%, 70%, 80%, 90%, 95%, or 100% of said compared sequence. Where a molecule consists of a certain sequence identity to a compared molecule, the sequence identity is determined for the full-length of said compared molecule i.e., 100% of said compared sequence.

[0403] Sequence similarity searching is an effective and reliable strategy for identifying homologs with excess (e.g., at least 50%) sequence identity. Sequence similarity search tools frequently used are e.g., BLAST, FASTA, and HMMER.

[0404] Sequence similarity searches can identify such homologous proteins or genes by detecting excess similarity, and statistically significant similarity that reflects common ancestry. Homologues may encompass orthologues, which are herein understood as the same protein in different organisms, e.g., variants of such protein in different organisms or species.

[0405] “Percent (%) amino acid sequence identity” with respect to an amino acid sequence, homologs and orthologues described herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific polypeptide sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Those skilled in the art can determine appropriate parameters for measuring alignment, LO018P

[0406] -59- including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0407] For purposes described herein, the sequence identity between two amino acid sequences is determined using the NCBI BLAST program version BLASTP 2.8.1 with the following exemplary parameters: Program: blastp, Word size: 6, Expect value: 10, Hitlist size: 100, Gapcosts: 11.1 , Matrix: BLOSUM62, Filter string: F, Compositional adjustment: Conditional compositional score matrix adjustment.

[0408] For pairwise protein sequence alignment of two amino acid sequences along their entire length the EMBOSS Needle webserver (https: / / www.ebi.ac.uk / Tools / psa / emboss_needle / ) was used with default settings (Matrix: EBLOSUM62; Gap open: 10; Gap extend: 0.5; End Gap Penalty: false; End Gap Open: 10; End Gap Extend: 0.5). EMBOSS Needle uses the Needleman-Wunsch alignment algorithm to find the optimum alignment (including gaps) of the two input sequences and writes their optimal global sequence alignment to file.

[0409] "Percent (%) identity" with respect to a nucleotide sequence e.g., of a promoter or a gene, is defined as the percentage of nucleotides in a candidate DNA sequence that is identical with the nucleotides in the DNA sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent nucleotide sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0410] For purposes described herein (unless indicated otherwise), the sequence identity between two amino acid sequences is determined using the NCBI BLAST program version BLASTN 2.8.1 with the following exemplary parameters: Program: blastn, Word size: 11 , Expect threshold: 10, Hitlist size: 100, Gap Costs: 5.2, Match / Mismatch Scores: 2,-3, Filter string: Low complexity regions, Mark for lookup table only.

[0411] The term “isolated” or “isolation” as used herein with respect to an expression product such as a POI or a nucleic acid molecule shall refer to such compound that has been sufficiently separated from the environment with which it would naturally be associated, in particular a cell culture supernatant, so as to exist in “purified” or LO018P

[0412] -60-

[0413] “substantially pure” form. Yet, “isolated” does not necessarily mean the exclusion of artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification. Isolated compounds can be further formulated to produce preparations thereof, and still for practical purposes be isolated.

[0414] With reference to nucleic acids or genes described herein, the term “isolated nucleic acid” is sometimes used. This term, when applied to DNA, refers to a DNA molecule that is separated from sequences with which it is immediately contiguous in the naturally occurring genome of the organism in which it originated. For example, an “isolated nucleic acid” may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a cell or host organism. When applied to RNA, the term “isolated nucleic acid” refers primarily to an RNA molecule encoded by an isolated DNA molecule as defined above. Alternatively, the term may refer to an RNA molecule that has been sufficiently separated from other nucleic acids with which it would be associated in its natural state ( / .e., in cells or tissues). An “isolated nucleic acid” (either DNA or RNA) may further represent a molecule produced directly by biological or synthetic means and separated from other components present during its production.

[0415] Specifically, a promoter described herein, or an expression construct described herein such as an expression cassette or a vector is provided as an isolated nucleic acid molecule. Specifically, the nucleic acid molecule comprises or consists of, or is comprised or composed of a promoter described herein, or an expression construct described herein such as an expression cassette or a vector.

[0416] With reference to polypeptides or proteins, such as POI, the term “isolated” shall specifically refer to compounds that are free or substantially free of material with which they are naturally associated such as other compounds with which they are found in their natural environment, or the environment in which they are prepared (e g. cell culture) when such preparation is by recombinant DNA technology practiced in vitro or in vivo. Isolated compounds can be formulated with diluents or adjuvants and still for practical purposes be isolated - for example, the polypeptides or polynucleotides can be mixed with pharmaceutically acceptable carriers or excipients when used in diagnosis or therapy.

[0417] The term “purified” as used herein shall refer to a preparation comprising at least 50% (mol / mol), preferably at least 60%, 70%, 80%, 90% or 95% of a compound (e.g., a LO018P

[0418] -61-

[0419] POI). Purity is measured by methods appropriate for the compound (e.g., chromatographic methods, polyacrylamide gel electrophoresis, HPLC analysis, and the like). An isolated, purified expression product or POI as described herein may be obtained by purifying the cell culture supernatants to reduce impurities.

[0420] As isolation and purification methods for obtaining a recombinant expression product, methods, such as methods utilizing difference in solubility, such as salting out and solvent precipitation, methods utilizing difference in molecular weight, such as ultrafiltration and gel electrophoresis, methods utilizing difference in electric charge, such as ion-exchange chromatography, methods utilizing specific affinity, such as affinity chromatography, methods utilizing difference in hydrophobicity, such as reverse phase high performance liquid chromatography, and methods utilizing difference in isoelectric point, such as isoelectric focusing may be used.

[0421] The following standard methods are preferred: cell (debris) separation and washing by Microfiltration or Tangential Flow Filter (TFF) or centrifugation, POI purification by precipitation or heat treatment, POI activation by enzymatic digest, POI purification by chromatography, such as ion exchange (IEX), hydrophobic interaction chromatography (HIC), affinity chromatography, size exclusion (SEC) or HPLC chromatography, POI precipitation, concentration and washing, such as by ultrafiltration steps.

[0422] A highly purified product is essentially free from contaminating proteins, and preferably has a purity of at least 90%, more preferred at least 95%, or even at least 98%, up to 100%. The purified products may be obtained by purification of the cell culture supernatant or else from cellular debris.

[0423] An isolated and purified POI can be identified by conventional methods such as Western blot, HPLC, activity assay, or ELISA.

[0424] The term “recombinant” as used herein shall mean “being prepared by or the result of genetic engineering. A “recombinant cell” or “recombinant host cell” is herein understood as a cell or host cell that has been genetically engineered or modified to comprise a nucleic acid sequence which is not native to said cell. A recombinant host can be engineered to delete and / or inactivate one or more nucleotides or nucleotide sequences, and may specifically comprise an expression vector or cloning vector containing a recombinant nucleic acid sequence, in particular employing nucleotide sequence foreign to the host. A recombinant protein is produced by expressing a respective recombinant nucleic acid in a host. The term “recombinant” with respect to LO018P

[0425] -62- an expression product as used herein, includes an expression product that is prepared, expressed, created or isolated by recombinant means, such as an expression product isolated from a host cell transformed or transfected to express the expression product. In accordance with the present invention conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art may be employed. Such techniques are explained fully in the literature. See, e.g., Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY).

[0426] Certain recombinant promoters, expression constructs or host cells are “engineered” ones which are understood as respective promoters, expression constructs and host cells, which have been manipulated using genetic engineering i.e., by human intervention. Promoters, expression constructs and host cells, which are not engineered by any recombinant means or techniques, are generally understood as being naturally-occurring or wild-type.

[0427] Therefore, the present invention provides for engineered constructs, host cells and methods to decouple production of expression products from biomass growth in a host cell culture. It was surprisingly found that inducible wt promoters which comprise a CRP-binding site can be engineered by a heterologous SD sequence and thereby improve auto-inducibility properties in response to carbon-depletion.

[0428] According to specific examples, it has been proven that expression constructs comprising engineered promoters as described herein improve recombinant protein production by limitation of carbon source of the host cell which auto-induces the promoter of the expression construct, with sufficient auto-inducible promoter strength and stability of expression. Specific examples have proven that RBS-tuning by combining PglpF3 (herein also referred to as P_glpF3) or PcstAIO (herein also referred to as P_stA10) with selected SD (RBS) sequences display comparable or increased expression levels. A set of 10 engineered promoters (5X P_cstA10 and 5X P_glpF3) has been produced to modulate the auto-inducible promoter strength on carbon-depletion, representing a range of 30-120% of the promoter strength of a benchmark promoter, as measured by fluorescent reporter expression assays. A promoter can be chosen from the set of engineered promoters as appropriate for various expression systems which require low or high expression levels, during a short or prolonged culture period. For example, the P_glpF3 is the stronger base promoter, however, P_cstA10 has a more favorable expression profile during the early onset of the carbon-limited feed phase.

[0429] By the present Examples it has been proven that LO018P

[0430] -63-

[0431] • the engineered C-depletion auto-inducible promoters possess comparable biomass specific titres relative to the reference promoter P Rha (SEQ ID NO:33).

[0432] • They have better space-time yield properties, reaching similar titres earlier as tested with E. coli expressions systems to produce a variety of POIs compared to the P Rha and reference.

[0433] • Robustness and reproducibility are comparable to the expression systems comprising a reference promoter.

[0434] It has further proven that the engineered promoters have significant advantages because of a higher auto-inducible induction ratio (i.e., stronger activation) and a higher space-time yield compared to a reference, because of a short onset of expression which allows a shorter fermentation time to produce the same amount of expression products, or higher amounts of expression products during fermentation.

[0435] The invention is particularly characterized by one or more of the following items:

[0436] 1. An auto-inducible promoter comprising a heterologous Shine-Dalgarno (SD) sequence which modulates the expression level of a protein of interest (POI), wherein the promoter is auto-inducible in response to carbon-depletion.

[0437] 2. The promoter of item 1 , wherein the expression level results from a modulated transcription or translation of a nucleotide sequence that encodes the POI, preferably wherein the nucleotide sequence is an mRNA transcribed from a coding gene of interest (GOI) that is operationally linked to the promoter.

[0438] 3. The promoter of item 1 or 2, wherein the expression level is modulated to increase the POI yield, such as the total of produced protein mass or the space-time yield, as compared to a reference promoter, preferably wherein the reference promoter is the promoter that has not been engineered to comprise the heterologous SD sequence (in particular wherein the reference promoter comprises the endogenous i.e., wild-type SD sequence), or wherein the reference promoter is a comparable promoter such as an L-rhamnose-inducible rhaBAD promoter (P RhaBAD), in particular the promoter comprising or consisting of SEQ ID NO:33.

[0439] 4. The promoter of any one of items 1 to 3, wherein the heterologous SD sequence is selected from any one of SEQ ID Nos: 1-13.

[0440] 5. The promoter of any one of items 1 to 4, wherein the heterologous SD sequence substitutes an SD sequence that is endogenous to the promoter.

[0441] 6. The promoter of any one of items 1 to 5, wherein: LO018P

[0442] -64- a) the heterologous SD sequence increases the auto-inducible expression level, preferably wherein the heterologous SD sequence comprises a motif “AGGAGA” (SEQ ID NO:1), preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NO:2, 3, 4, 10, or 13; or b) the heterologous SD sequence decreases the auto-inducible expression level, preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NO:5, 6, 7, 8, 9, 11 , or 12.

[0443] 7. The promoter of any one of items 1 to 6, which comprises an auto-induction ratio on carbon-depletion that is modulated by the heterologous SD sequence, preferably by at least + / - 1-30%.

[0444] 8. The promoter of any one of items 1 to 7, which comprises a Cyclic AMP receptor protein (CRP)-binding site.

[0445] 9. The promoter of any one of items 1 to 8, which originates from a wild-type promoter of a bacterium, preferably a promoter of any one of the genes glpF, cstA, rbsD, aid A, glpK, znuA, aceB, gatZ, ahpC, zinT, acs, gatY, bsmA, rbsD, ychN, tnaC, IsrR, IsrA, sra, prpB, cspD, aldB, rmf, yjcH, soxS, yftj, yfiN, ydcS or variants of any of the foregoing genes, preferably wherein the bacterium is E. coll.

[0446] 10. The promoter of any one of items 1 to 9, wherein the variants are naturally- occurring variants, or artificial variants comprising at least 85% sequence identity to the respective wild-type promoter or naturally-occurring variants thereof.

[0447] 11 . The promoter of any one of items 1 to 10, wherein: i) the promoter originates from a cstA promoter of E. coll, preferably cstA10, and the heterologous SD sequence a) increases the auto-inducible expression level, preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NOs: 2, 3, 4, 10, or 13; or b) decreases the expression level, preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NOs: 5, 6, 7, 8, 9, 11 , or 12; or ii) the promoter originates from the wild-type glpF promoter of E. coll, preferably glpF3, and the heterologous SD sequence a) increases the auto-inducible expression level, preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NOs: 2, 3, 4, 10, or 13; or LO018P

[0448] -65- b) decreases the expression level, preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NOs: 5, 6, 7, 8, 9, 11 , or 12; or iii) the promoter originates from the wild-type rbsD promoter of E. coli, preferably rbsD3, and the heterologous SD sequence a) increases the auto-inducible expression level, preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NOs: 2, 3, 4, 10, or 13; or b) decreases the expression level, preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NOs: 5, 6, 7, 8, 9, 11 , or 12; or iv) the promoter originates from the wild-type aldA promoter of E. coli, preferably aldA2, and the heterologous SD sequence a) increases the auto-inducible expression level, preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NOs: 2, 3, 4, 10, or 13; or b) decreases the expression level, preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NOs: 5, 6, 7, 8, 9, 11 , or 12.

[0449] 12. The promoter of any one of items 1 to 11 , which originates from the wild-type promoter of any of item 8 and any variants thereof, preferably wherein the promoter originates from the promoter of the cstA10, glpF3, rbsD3, aldA2 genes.

[0450] 13. The promoter of any one of items 1 to 12, which comprises any one of SEQ ID NO:20-31.

[0451] 14. An expression construct comprising the promoter of any one of items 1 to 13.

[0452] 15. The construct of item 14, wherein the promoter is operably linked to an open reading frame (ORF) for expressing a gene of interest (GOI), preferably wherein the construct comprises a spacer of 5-15 nt between the SD sequence and the start codon of the GOI.

[0453] 16. A bacterial host cell comprising a) the promoter of any one of items 1 to 13, and / or b) the expression construct of item 14 or 15, preferably wherein the host cell is an E. coli host cell. LO018P

[0454] -66-

[0455] 17. A promoter comprising the Shine-Dalgarno (SD) sequence comprising or consisting of SEQ ID NO:2, preferably wherein the SD sequence is comprised in the promoter as a heterologous SD sequence.

[0456] 18. An expression construct comprising the promoter of item 17.

[0457] 19. A bacterial host cell comprising a) the promoter of item 17, and / or b) the expression construct of item 18, preferably wherein the host cell is E. coli.

[0458] 20. A recombinant protein expression construct comprising an auto-inducible promoter and a heterologous Shine-Dalgarno (SD) sequence wherein the promoter is auto-inducible in response to carbon-depletion and controls transcription of a gene of interest (GOI) that encodes a recombinant protein of interest (POI) in a bacterial host cell.

[0459] 21. The expression construct of item 20, wherein transcription is controlled to increase the POI yield, such as the total of produced protein mass or the space-time yield, as compared to a reference promoter, preferably wherein the reference promoter is the promoter that has not been engineered to comprise the heterologous SD sequence (in particular wherein the reference promoter comprises the endogenous i.e., wild-type SD sequence), or wherein the reference promoter is a comparable promoter such as an L-rhamnose-inducible rhaBAD promoter (P RhaBAD), in particular the promoter comprising or consisting of SEQ ID NO:33.

[0460] 22. The expression construct of item 20 or 21 , wherein the heterologous SD sequence the heterologous SD sequence comprises a motif “AGGAGA” (SEQ ID NO:1), or is selected from a heterologous SD sequence comprising or consisting of any one of SEQ ID NOs:1-13, preferably wherein the heterologous SD comprises or consists of SEQ ID NO:2.

[0461] 23. The expression construct of any one of items 20 to 22, wherein the heterologous SD sequence is characterized by one or more of the following features: a) the heterologous SD sequence substitutes an SD sequence that is endogenous to the promoter; b) the heterologous SD sequence increases or decreases the auto-inducible expression level or auto-inducible promoter strength; c) the promoter comprises one or more Cyclic AMP receptor protein (CRP)- binding sites; LO018P

[0462] -67- d) the promoter originates from a wild-type promoter of a bacterium (such as E. coli), preferably a promoter of any one of the genes glpF, cstA, rbsD, aldA, glpK, znuA, aceB, gatZ, ahpC, zinT, acs, gatY, bsmA, rbsD, ychN, tnaC, IsrR, IsrA, sra, prpB, cspD, aldB, rmf, yjcH, soxS, yftj, yfiN, ydcS or variants of any of the foregoing genes, preferably wherein the variants are naturally-occurring variants, preferably comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the wild-type promoter, or artificial variants comprising at least any one of 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the respective wild-type promoter or naturally- occurring variants thereof; e) the promoter originates from any one of the E. coli promoters PcstA, PglpF, PrbsD, or PaldA, or variants of any of the foregoing, in particular any one of PcstAIO, PglpF3, PrbsD3, or PaldA2.

[0463] 24. The expression construct of any one of items 20 to 23, wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NO: 1-13, preferably SEQ ID NO:2.

[0464] 25. The expression construct of any one of items 20 to 24, wherein carbon- depletion occurs under carbon-limit conditions, upon consumption of a carbon source in the cell culture medium of a bacterial host cell culture, or upon carbon-starvation, preferably wherein the carbon source is glucose or glycerol.

[0465] 26. A bacterial host cell comprising the expression construct of any one of items 20 to 25, preferably wherein the host cell is E. coli.

[0466] 27. A method of producing a protein of interest (POI) that is encoded by a gene of interest (GOI) by culturing the bacterial host cell of item 16, 19 or 2619 under conditions to produce said POI.

[0467] 28. A method of increasing the yield of a protein of interest (POI) that is encoded by a gene of interest (GOI) which is expressed from an expression construct under control of a promoter in a bacterial host cell culture, wherein a) the promoter is any one of items 1 to 13, or 17, and / or b) the expression construct is of items 14, 15, 18, or 20 to 25; preferably wherein the host cell is E. coli.

[0468] 29. The method of item 28, wherein the yield is the yield of POI mass or the yield of total protein mass, or the space-time yield. LO018P

[0469] -68-

[0470] 30. A method for screening and selecting a Shine-Dalgarno (SD) sequence to engineer an inducible target promoter for modulated auto-inducible expression level on carbon-depletion, which method comprises: a) providing an expression construct comprising the target promoter and an open reading frame (ORF) for expressing a gene of interest (GOI) under the control of the target promoter, which GOI encodes an expression product; b) engineering the expression construct to introduce a repertoire of heterologous SD sequences operably linked to the target promoter, thereby producing a variety of expression constructs; c) transforming a bacterial host cell line with the variety of expression constructs, thereby producing a repertoire of host cells; d) culturing the repertoire of host cells using a growth medium comprising a basal carbon source to grow biomass, thereby depleting the basal carbon source which autoinduces the engineered target promoter to express the GOI; followed by culturing the host cell in a feeding phase of the cell culture and producing the expression product under carbon-limit conditions; and e) screening the repertoire of host cells for a differential expression product yield, and f) selecting one or more host cells from the repertoire according to the differential expression product yield which indicates a modulated auto-inducible expression level, and identifying the respective SD sequence that confers the modulated auto-inducible expression level on carbon-depletion in the selected one or more host cells, preferably wherein the expression product is a protein of interest (POI) that is encoded by the GOI.

[0471] 31 . The method of item 30, wherein the host cell is an E. coli host cell.

[0472] 32. The method of item 30 or 31 , wherein the differential expression product yield is determined as compared to a reference expression construct which comprises the target promoter without engineering to introduce a heterologous SD sequence.

[0473] 33. A method for controlling production of an expression product in a cell culture of a bacterial host cell, comprising the steps of: a) transforming a bacterial host cell with an expression construct, which comprises an open reading frame (ORF) for expressing a gene of interest (GOI) that encodes an expression product under the control of a promoter that is auto-inducible on carbon-depletion; LO018P

[0474] -69- b) culturing the host cell in a batch phase of the cell culture using a basal carbon source to grow biomass, thereby depleting the basal carbon source which auto-induces the promoter; followed by c) culturing the host cell in a feeding phase of the cell culture under carbon-limit conditions and producing the expression product; and d) optionally recovering the expression product from the cell culture; preferably wherein i) the promoter is any one of items 1 to 13, or 17; and / or ii) the expression construct is of items 14, 15, 18, or 20 to 25; preferably wherein the expression product is a protein of interest (POI) that is encoded by the GOL

[0475] 34. The method of item 33, wherein the host cell is an E. coli host cell.

[0476] 35. A method of producing a protein of interest (POI) by culturing a bacterial host cell, preferably an E. coli host cell, which method comprises an expression construct comprising a carbon-source regulatable promoter and a gene of interest (GOI) encoding said POI under transcriptional control of said promoter, comprising the steps a) cultivating a cell line of the bacterial host cell with a carbon source repressing the promoter; and b) cultivating the cell line with a limited amount of a supplemental carbon source de-repressing the promoter to induce production of the POI; and c) producing and recovering the POI, preferably wherein the POI is heterologous to the bacterial cell.

[0477] 36. The method of item 35, wherein step a) cultivating is performed during a batch phase of the cell culture; and step b) cultivating is performed during a fed-batch phase of the cell culture.

[0478] 37. The method of item 35 or 36, wherein the production of the POI is induced by an induction factor of at least 1 , or at least any one of 1 , 1.1 , 1.2, 1.3, 1.4, 1 .5, 1 .6, 1 .7, 1.8, 1.9, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6, 7, 8, 9, or 10.

[0479] 38. The method of any one of items 35 to 37, wherein the production of the POI is induced by carbon-depletion, preferably wherein carbon-depletion occurs under carbon-limit conditions, upon consumption of the basal carbon source, or under carbon- starving conditions.

[0480] 39. The method of any one of items 35 to 38, wherein i) the promoter is any one of items 1 to 13, or 17; and / or LO018P

[0481] -70- ii) the expression construct is of item 14, 15, 18, or 20 to 25.

[0482] The foregoing description will be more fully understood with reference to the following examples. Such examples are, however, merely representative of methods of practicing one or more embodiments of the present invention and should not be read as limiting the scope of invention.

[0483] EXAMPLES

[0484] Example 1 : Auto-inducible promoters activated under carbon-depletion / limiting fermentation conditions

[0485] Auto-inducible promoters, E. coli samples subject to genome-wide RNA sequencing are cultivated and harvested under carbon-limiting fermentation conditions wherein the engineered coding sequence is mTurquoise gene under the control or not of auto-inducible promoter P-csta10 or P-glpF3 coupled to RBS / SD-00. The fermentation process is comprised of batch- and fed-batch phases and last between 55 to 80 hours. In the batch phase, a fixed amount of carbon-source in 21.5g / L glucose or 20g / L glycerol is provided in the cultivation media. The starting volume of fermentation is 135 ml. At the end of the batch phase, the feed start is triggered by 20% CER-drop and / or a DO-spike. During the fed-batch phase, a mild carbon-limiting condition is created by supplementing 70% glycerol (W / V) or 42% glucose (W / V) at a constant feed rate of 1.7 ml / h. Across the fermentation process, the cultivation temperature is maintained at 35°C. The pH is regulated at 7.0 using ammonia as the base and sulfuric- acid and the acid. Dissolved oxygen (DO) is maintained at 30%.

[0486] The analysis was explicitly focusing on gene expression changes on the mTurquoise gene expression levels were flagged in Figure 1.

[0487] Example 2: Measuring expression levels of candidate promoters by using reporter gene constructs under near-fermentation conditions

[0488] Selected candidate promoters were cloned into expression vectors to drive reporter gene-expression of mTurquoise fluorescent proteins. These plasmids were maintained in chosen E. coli host strains and were subjected to characterization under near fermentation conditions using BioLector micro-bioreactors (Beckman Coulter). BioLector cultivation was carried out in conditions mimicking fed-batch fermentation conditions in Example 1. The process is comprised of a batch phase (5 g / L glucose or LO018P

[0489] -71- glycerol, starting volume 1000uL) and a fed-batch phase supplemented by 400g / L glucose + 0.1 g / L NH4CI +10g / L (NH^SC at a rate of 3.8 pL / h. The feed start, i.e. induction of auto-inducible promoters, is timed by carbon-limiting conditions at the end of batch phase. Across the cultivation process, the temperature is maintained at 30°C. The pH is regulated at 7.0 using NaOH as the base. Dissolved oxygen (DO) is maintained at 30%. The typical expression profiles of two candidate promoters of P_glpF3 and P_cstA10 is depicted in Figure 1. The expression levels of candidate promoters are continuously monitored by measurement of the fluorescent intensity and biomass values along the growth curves

[0490] Example 3: Method of engineering promoters comprising a heterologous SD seguence

[0491] Engineering of SD-seguences were carried out by restriction enzyme cloning. The promoter seguences and their corresponding regulatory elements including -35 / -10, transcriptional start sites (T_start) were mapped using published information. Native SD- seguences were predicted according to the position of the cognate Gol start codon and via bioinformatic tools (RBS-predictors). Once RBS-seguences were identified they were also replaced to a reference, strong RBS (designated as RBS-00). Modified promoters comprising heterologous SD seguence were tested under near-fermentation conditions as it was described in Example 2.

[0492] Example 4: Determine the strength of engineered promoters comparing a heterologous SD seguence

[0493] Using the method described in Example 2, modified candidate promoters P_glpF3 and P_cstA10 from Example 3 were further characterized in order to fine tune final expression levels of the engineered promoters. Using similar growth conditions, a full set of heterologous SD-seguences were tested and expression profiles were recorded. Benchmarking of promoter variants comprising different SD-seguences (SD / RBS SEQ ID NOs:2 to 14 and SEQ ID NOs:15 and 17) were carried out by calculating end of fermentation (EoF) biomass normalized fluorescent readouts of mTurguoise expressing clones under near-fermentation conditions. Based on these normalized values, all promoter variants were ranked against the internal standard (RBS-00, SEQ ID NO:2). The ranked promoter variants are depicted in Fehler! Verweisquelle konnte nicht gefunden werden.. LO018P

[0494] -72-

[0495] Example 5: Auto-inducibilitv on carbon-depletion of engineered promoters as compared to the respective standard promoters.

[0496] Benchmarking of selected carbon-limitation auto-inducible promoters against internal standard expression examples was carried out by fermentation. All fermentation conditions were similar as described in Example 1. The reference inducible promoter of P RhaBAD was characterized under optimal fed-batch conditions with a two-phase feeding regime. The batch phase is supplemented by 20 g / L glycerol, followed by fed- batch phase which is accommodated with an exponential feed at a rate of 0.4492exp(0.15*t) and constant feed at 1 .105 ml / h using 70% glycerol (W / V). The switch to constant feed is triggered by 20% CER-drop and / or a DO-spike and the last until 70 hours post-inoculation. The P RhaBAD promoter was induced at the beginning of fed- batch phase using 0.1 % D-rhamnose. The P_STAT1 promoter was induced at the beginning of fed-batch phase by a phosphate-limiting condition by supplementing only 47.5 mM phosphate in the batch medium. Other fermentation parameters remain the same as described in Example 1 . In the example depicted in Figure 3, clones expressing mTurquoise were benchmarked. During the fermentation process, 7 samples were taken and analyzed to determine the Pol titer based on fluorescence measurements. Calculated values of fluorescence units / hrs were plotted in Figure 3. Auto-inducible promoters show better space-time characteristics compared to reference promoters, hence an accelerated fermentation speed as opposed to the reference solutions.

[0497] Example 6: Auto-induction by carbon-limitation to improve space-time-yields of recombinant protein production in E. coli

[0498] Speed of bioprocessing is a main cost driver for pharmaceutical manufacturing. Applying promoter screening and translational fine-tuning to primary carbon sourcelimiting conditions, we have developed an E. coli promoter panel to achieve superior space-time-yields without addition of inducers. Using the promotor panel, we can achieve different auto-induction profiles during fermentations, allowing us to select the optimal production profile for a given protein of interest.

[0499] Regulating the Speed of bioprocessing can be achieved by applying autoinducible promoters. An E. coli promoter panel has been developed by promoter screening followed by translational fine-tuning to primary carbon-source limiting conditions. This promoter panel offers superior space-time-yields with a variety of auto- LO018P

[0500] -73- induction profiles, that allows the user to select the optimal production profile for a given protein of interest.

[0501] Introduction

[0502] Inducer-based expression

[0503] • Production triggered by inducer

[0504] • Need continuous monitoring of the fermentation process

[0505] • Local, toxic concentrations of inducer

[0506] • Extrinsic population heterogeneity

[0507] • Multiparameter and complex fermentation process

[0508] • Less robust against stochastic perturbations

[0509] Auto-induction

[0510] • Production triggered by intracellular metabolic signal

[0511] • Unsupervised fermentation process

[0512] • No toxicity concern of inducer

[0513] • No extrinsic population heterogeneity

[0514] • Simplified fermentation process

[0515] • Robust process against stochastic perturbations

[0516] Methodology

[0517] Identification of promoter candidates

[0518] • Promoters activated under carbon-depletion conditions

[0519] • Two RNA-Seq analyses of samples collected under carbon-depletion fermentation conditions

[0520] • Literature search focusing on carbon-source depletion stress responses

[0521] Results

[0522] Profiling of auto-inducible promoters, see Figure 1:

[0523] • P_glpF3 (green; upper 4 curves) shows a bi-phasic expression profile with early activation in the batch-phase

[0524] • P_cstA10 (red, lower three curves) shows a more single-phase induction profile, but with lower expression maximum;

[0525] • Control: baseline (blue)

[0526] Construction of auto-inducible promoter libraries, see Figure 2:

[0527] • Promoter strength measured at the end of fermentation in BioLector ®

[0528] • Fine-tune of promoter strength is achieved by switching RBSs LO018P

[0529] -74-

[0530] Benchmark the auto-inducible promoters with conventional promoters, see Figure 3:

[0531] • Reproduced and robust performance of auto-inducible promoters under fermentation conditions (Ambr® 250)

[0532] • Auto-inducible promoters show profound increase in space-time-yield

[0533] Conclusions

[0534] • Identification of novel auto-inducible promoters that activate under carbon- depletion conditions

[0535] • Reproduced and robust performance auto-inducible promoters from deep-well- plate to fermentation scale

[0536] • Library of promoter variants constructed by fine-tuning promoter strength with RBS

[0537] • Profound increase in space-time-yield when using auto-inducible promoters at fermentation scale.

[0538] Example 7: Promoter screening from E. coli in the BioLector™ I

[0539] The BioLector™ I (m2p-labs GmbH, Germany) is a microbioreactor to perform high- throughput screenings with online monitoring of DO, pH, biomass and fluorescent molecules, and offers a wide spectrum of applications. In this example, the BioLector I is used for the screening of E. coli strains which possess different auto-inducible promoters.

[0540] In the following tables, the results of the promoter screening and the modifications of the single variants of PaldA, PrbsD and PglpF are listed. The individual factors biomass, eGFP production, productivity, induction factor (factor by which the promoter is up-regulated under glucose limitation, from Pinduction start to P20h), promoter strength (rise of productivity from Psh to Pi2h) and basal expression (gene expression at induction start, Pinduction start) were considered. LO018P

[0541] -75-

[0542] Table 1 : Overview of the screening results and changes in the promoter sequences of PaldA variants. The table shows the screening results for the biomass at the EOF (LSUEOF), eGFP production at the EOF (RFUEOF), productivity after 20 h(P20h), induction factor (carbon depletion), promoter strength and basal expression. SD = Shine- Dalgarno, CRP = Cyclic AMP receptor protein, wt = wild type. LO018P

[0543] -76-

[0544] Table 2: Overview of the screening results and changes in the promoter sequences of PrbsD variants. The table shows the screening results for the biomass at the EOF (LSUEOF), eGFP production at the EOF (RFUEOF), productivity after 20 h(P20h), induction factor (carbon depletion), promoter strength and basal expression. SD = Shine-Dalgarno, CRP = Cyclic AMP receptor protein, wt = wild type.

[0545] LO018P

[0546] -77-

[0547] Table 3: Overview of the screening results and changes in the promoter sequences of PglpF variants. The table shows the screening results for the biomass at the EOF (LSUEOF), eGFP production at the EOF (RFUEOF), productivity after 20 h(P20h), induction factor (carbon depletion), promoter strength and basal expression. The strongest PglpF is highlighted in grey (PglpF3). SD = Shine-Dalgarno, CRP = Cyclic AMP receptor protein, wt = wild type. LO018P

[0548] -78-

[0549] Table 4: Allocation of symbolic representation of screening results in Tables 1-3 to precise data

[0550] Biomass at the EOF = LSUEOF, eGFP production at the EOF = RFUEOF, productivity after 20 h = P20h, rise of productivity = Prise

[0551] LO018P

[0552] -79-

[0553] LO018P

[0554] -80-

[0555] Table 5: Summary of all divers promoters investigated in Biolector experiments on E. coli clones. The table provides information about the maximum biomass achieved (LSUmax), the maximum GFP production (RFUmax) and the maximum specific product value (Pmax) of the cultures. It also provides information about induction under glucose limitation, i.e. by which factor the promoter was upregulated under glucose limitation. The basal expression of the promoter is also recorded and provides information about the permeability of the promoters in which there was no glucose deficiency. The table below shows the legend for the summary. LO018P

[0556] -81-

[0557] High cell densities were obtained with the clones containing the cstA promoter variants. Depending on the promoter variant, there was an induction of the promoter under glucose limitation (cstA2p, cstA3p, cstAOp and cstA10p). When comparing the cstAp variants, the clone with the cstAIO promoter had certain advantages. The maximum GFP production is higher than for the other cstAp variants. This applies to the specific product value P and the induction in the fed-batch phase.

[0558] LO018P

[0559] -82-

[0560] REFERENCES

[0561] Blum, P. H., S. B. Jovanovich, M. P. McCann, J. E. Schultz, S. A. Lesley, R. R. Burgess, and A. Matin (1990): Cloning and in vivo and in vitro regulation of cyclic AMP- dependent carbon starvation genes from E. coli. J Bacteriol, v. 172, p. 3813-20.

[0562] Franchini, Alessandro G.; Egli, Thomas (2006): Global gene expression in E. coli K-12 during short-term and long-term adaptation to glucose-limited continuous culture conditions. In Journal of Microbiology 152 (7), pp. 2111-2127. DOI: 10.1099 / mic.0.28939-0.

[0563] Limon, A., E. Hidalgo, and J. Aguilar (1997): The aldA gene of E. coli is under the control of at least three transcriptional regulators. Microbiology, v. 143 ( Pt 6), p. 2085- 95.

[0564] Weissenborn, Deborah L.; Wittekindt, Nicola; Larson, Timothy J. (1992): Structure and Regulation of the glpFK Operon Encoding Glycerol Diffusion Facilitator and Glycerol Kinase of E. coli K-12. In Journal of Biological Chemistry 267 (9), pp. 6122- 6131.

[0565] Shimada, T., A. Koh, and A. Ishihama (2013): Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in E. coli. FEMS Microbiol Lett, v. 344, p. 159-65.

[0566] Zheng, D., C. Constantinidou, J. L. Hobman, and S. D. Minchin (2004): Identification of the CRP regulon using in vitro and in vivo transcriptional profiling. Nucleic Acids Res, v. 32, p. 5874-93.

Claims

LO018P-83-CLAIMS1 . A bacterial expression construct for expressing a protein of interest (POI) in a host cell comprising in operable linkage: a) an auto-inducible promoter; b) a Shine-Dalgarno (SD) sequence that is heterologous to the promoter; and c) a gene of interest (GOI) which encodes the POI; wherein the promoter is auto-inducible in response to carbon-depletion and the SD sequence modulates the auto-inducible promoter strength.

2. The expression construct of claim 1 , wherein the heterologous SD sequence modulates the level of POI expression in a bacterial expression system, wherein the POI expression level is increased or decreased compared to a reference expression construct which does not comprise the heterologous SD sequence, or which comprises a comparable promoter such as a rhamnose-inducible rhaBAD promoter comprising or consisting of SEQ ID NO:33.

3. The expression construct of claim 1 or 2, wherein the auto-inducible promoter strength is modulated by the heterologous SD sequence to control the POI yield, the produced POI mass or the space-time yield in the bacterial expression system.

4. The expression construct of any one of claims 1 to 3, wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NOs:1-13.

5. The expression construct of any one of claims 1 to 4, wherein the heterologous SD sequence comprises or consists of SEQ ID NO:2 or 10, preferably SEQ ID NO:10.

6. The expression construct of any one of claims 1 to 5, wherein: a) the heterologous SD sequence increases the auto-inducible promoter strength, preferably wherein the heterologous SD sequence comprises a motif “AGGAGA” (SEQ ID NO:1), preferably wherein the heterologous SD sequence comprises or consists of any one of SEQ ID NO:2, 10, or 13; orLO018P-84- b) the heterologous SD sequence decreases the auto-inducible promoter strength, preferably wherein the heterologous SD sequence is selected from any one of SEQ ID NO:5, 6, 7, 8, 9, 11 , or 12.

7. The expression construct of any one of claims 1 to 6, which is characterized by one or more of the following features: a) the promoter comprises an auto-induction ratio on carbon-depletion that is modulated by the heterologous SD sequence, preferably by at least + / - 1-30%; b) the promoter comprises a Cyclic AMP receptor protein (CRP)-binding site; c) the promoter comprises a promoter of a bacterium, preferably E. coli, preferably a promoter of any one of the genes glpF, cstA, rbsD, aldA, glpK, znuA, aceB, gatZ, ahpC, zinT, acs, gatY, bsmA, rbsD, ychN, tnaC, IsrR, IsrA, sra, prpB, cspD, aldB, rmf, yjcH, soxS, yftj, yfiN, ydcS or variants of any of the foregoing, preferably wherein the variants are naturally-occurring variants, or artificial variants comprising at least 85% sequence identity to the respective wild-type promoter or naturally-occurring variants thereof; d) i) the promoter comprises a cstA promoter of E. coli, preferably cstAIO, and the heterologous SD sequence a) increases the auto-inducible expression level, preferably wherein the heterologous SD sequence is selected from any one of SEQ ID NOs: 2, 3, 4, 10, or 13; or b) decreases the expression level, preferably wherein the heterologous SD sequence is selected from any one of SEQ ID NOs: 5, 6, 7, 8, 9, 11 , or 12; or ii) the promoter comprises a glpF promoter of E. coli, preferably glpF3, and the heterologous SD sequence a) increases the auto-inducible expression level, preferably wherein the heterologous SD sequence is selected from any one of SEQ ID NOs: 2, 3, 4, 10, or 13; or b) decreases the expression level, preferably wherein the heterologous SD sequence is selected from any one of SEQ ID NOs: 5, 6, 7, 8, 9, 11 , or 12; orLO018P-85- iii) the promoter comprises a rbsD promoter of E. coli, preferably rbsD3, and the heterologous SD sequence a) increases the auto-inducible expression level, preferably wherein the heterologous SD sequence is selected from any one of SEQ ID NOs: 2, 3, 4, 10, or 13; or b) decreases the expression level, preferably wherein the heterologous SD sequence is selected from any one of SEQ ID NOs: 5, 6, 7, 8, 9, 11 , or 12; or iv) the promoter comprises an aldA promoter of E. coli, preferably aldA2, and the heterologous SD sequence a) increases the auto-inducible expression level, preferably wherein the heterologous SD sequence is selected from any one of SEQ ID NOs: 2, 3, 4, 10, or 13; or b) decreases the expression level, preferably wherein the heterologous SD sequence is selected from any one of SEQ ID NOs: 5, 6, 7, 8, 9, 11 , or 12; e) the promoter comprises a promoter of the cstA10, glpF3, rbsD3, aldA2 genes of E. coli; f) the promoter comprises any one of SEQ ID NOs:21-32.

8. An expression construct of any one of claims 1 to 7, wherein the promoter is operably linked to an open reading frame (ORF) comprising the GOI, preferably wherein the construct comprises a spacer of 5-15 nt between the SD sequence and the start codon of the GOI.

9. A bacterial expression construct comprising a Shine-Dalgarno (SD) sequence comprising or consisting of SEQ ID NO:2, wherein the SD sequence is operable linkage with an auto-inducible promoter, wherein the SD sequence and promoter are not being naturally associated.

10. A bacterial host cell comprising the bacterial expression construct of any one of claims 1 to 9, preferably wherein the host cell is E. coli.LO018P-86-11 . A method of producing a protein of interest (POI) that is encoded by a gene of interest (GOI) by culturing the bacterial host cell of claim 10 under conditions to produce said POI.

12. A method of increasing the yield of a protein of interest (POI) that is encoded by a gene of interest (GOI) which is expressed from an expression construct under control of a promoter in a bacterial host cell culture, preferably an E. coli host cell culture, wherein the expression construct is of any one of claims 1 to 9, preferably wherein the yield is the yield of POI mass, or the space-time yield.

13. A method for controlling production of an expression product in a cell culture of a bacterial host cell, preferably an E. coli host cell, comprising the steps of: a) transforming a bacterial host cell with an expression construct, which comprises an open reading frame (ORF) comprising a gene of interest (GOI) that encodes an expression product under the control of a promoter that is auto-inducible on carbon-depletion; b) culturing the host cell in a batch phase of the cell culture using a basal carbon source to grow biomass, thereby depleting the basal carbon source which auto-induces the promoter; followed by c) culturing the host cell in a feeding phase of the cell culture under carbon-limit conditions and producing the expression product; and d) optionally recovering the expression product from the cell culture; wherein the expression construct is of any one of claims 1 to 9.LO018P-87-14. A method of producing a protein of interest (POI) by culturing a bacterial host cell, preferably an E. coli host cell, which method comprises an expression construct comprising a carbon-source regulatable promoter and a gene of interest (GOI) encoding said POI under transcriptional control of said promoter, comprising the steps a) cultivating a cell line of the bacterial host cell with a carbon source repressing the promoter; and b) cultivating the cell line with a limited amount of a supplemental carbon source de-repressing the promoter to induce production of the POI; and c) producing and recovering the POI, wherein the expression construct is of any one of claims 1 to 9.

15. The method of claim 14, wherein the production of the POI is induced by carbon-depletion, preferably wherein carbon-depletion occurs under carbon-limit conditions, upon consumption of the basal carbon source, or under carbon-starving conditions.

16. An auto-inducible promoter comprising a heterologous Shine-Dalgarno (SD) sequence which modulates the expression level of a protein of interest (POI), wherein the promoter is auto-inducible in response to carbon-depletion.

Images