Cardiac function improving agent

The cardiac function improver with FGFR inhibitors addresses the inadequacies of current heart failure treatments by suppressing cardiac fibrosis and improving cardiac function, enhancing prognosis and quality of life through FGFR inhibition and NPR1 signaling activation.

WO2026083624A1PCT designated stage Publication Date: 2026-04-23KYOTO UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
KYOTO UNIV
Filing Date
2025-05-19
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Current treatments for heart failure, particularly those targeting myocardial fibrosis, are inadequate, and there is a need for effective methods to improve cardiac function and prevent or treat cardiac fibrosis.

Method used

A cardiac function improver containing a fibroblast growth factor receptor (FGFR) inhibitor is developed, which inhibits cardiac fibrosis and activates the NPR1 signaling pathway between cardiomyocytes and endothelial cells, using FGFR inhibitors such as AZD4547 and PD166866, identified through gene expression analysis and cell interaction studies.

Benefits of technology

The FGFR inhibitor effectively suppresses cardiac fibrosis, improves cardiac function, and enhances the prognosis and quality of life by reducing left ventricular dimensions and improving contractile and diastolic functions, as demonstrated in cardiac fibrosis models and mouse models.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JP2025018121_23042026_PF_FP_ABST
    Figure JP2025018121_23042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides: a cardiac function improving agent comprising a fibroblast growth factor receptor (FGFR) inhibitor; and a cardiac function improving agent screening method involving (1) a step for bringing cells into contact with a test substance, (2) a step for measuring activity of a fibroblast growth factor receptor (FGFR) in the cells, and (3) a step for selecting the test substance as a candidate substance for a cardiac function improving agent when the activity of the FGFR in the cells has decreased due to contact with the test substance.
Need to check novelty before this filing date? Find Prior Art

Description

Cardiac function improver

[0001] The present invention relates to a cardiac function improver. More specifically, it relates to a cardiac function improver containing a fibroblast growth factor receptor (FGFR) inhibitor and the like.

[0002] Heart failure is caused by ischemic heart diseases such as myocardial infarction and non-ischemic heart diseases such as cardiomyopathy. Once the pathological condition of heart failure is completed, effective treatments for suppressing the progression of myocardial abnormalities based on the etiology have not yet been found, and there are significant unmet needs regarding heart failure. In particular, myocardial fibrosis is known to be a factor that worsens the prognosis of heart diseases. For example, in Non-Patent Document 1, it has been reported that the presence and extent of Midwall replacement fibrosis can be predictors of mortality and sudden cardiac death (SCD) in dilated cardiomyopathy. Also, Non-Patent Document 2 reports that myocardial fibrosis is a characteristic of hypertrophic cardiomyopathy. Therefore, the development of treatments for controlling myocardial fibrosis has been demanded.

[0003] Gulati A. et al., AMA, 309(9):896-908 (2013)Ho C.Y. et al., N Engl J Med, 363(6):552-563 (2010)

[0004] Therefore, an object of the present invention is to provide a method and a medicament for improving cardiac function by controlling cardiac fibrosis and the like. Another object is to provide a method for screening a medicament capable of treating or preventing cardiac fibrosis.

[0005] The inventors attempted to elucidate the mechanism of cardiac fibrosis. As a result of diligent research, the inventors conceived of combining comprehensive gene expression analysis of myocardial biopsy tissue with a quantitative evaluation method of fibrosis using machine learning of myocardial biopsy pathological tissue. As a result of analysis using this method, they succeeded in identifying a network of genes highly correlated with cardiac fibrosis and further identifying FSTL3 as a hub gene. Furthermore, they identified FGFR1 and MMP2 as genes highly correlated with the proportion of cardiac fibrosis regions. Based on these findings, further research revealed that FSTL3 and MMP2 can serve as markers of cardiac fibrosis in a cardiac fibrosis model using iPS cell cardiac organoids, and that fibroblast growth factor receptor (FGFR) inhibitors exert an inhibitory effect on cardiac fibrosis using cardiac fibrosis models and cardiac fibrosis model mice.

[0006] The inventors also demonstrated that different types of FGFR inhibitors similarly exert anti-fibrotic effects on the heart in an in vitro cardiac fibrosis model. Furthermore, using a cardiac fibrosis model mouse, they performed cell-cell interaction analysis to visualize changes in gene expression of various cell types within the heart after treatment, and found that activation of the NPR1 signaling pathway occurred between cardiomyocytes and endothelial cells (CM-EC). This finding suggests that a cardioprotective effect is also exerted by the activation of the NPR1 signaling pathway, and the inventors concluded that FGFR inhibitors have not only anti-fibrotic effects but also cardioprotective effects. Based on these findings, the inventors conducted further research and completed the present invention.

[0007] In other words, the present invention is as follows: [1] A cardiac function improving agent comprising a fibroblast growth factor receptor (FGFR) inhibitor. [2] The agent according to [1] for improving the contraction or diastolic function of the heart. [3-1] The agent according to [1] or [2] for the treatment or prevention of cardiac fibrosis. [3-2] A therapeutic or prophylactic agent for cardiac fibrosis comprising a fibroblast growth factor receptor (FGFR) inhibitor. [3-3] A cardiac fibrosis inhibitor comprising a fibroblast growth factor receptor (FGFR) inhibitor. [4-1] The agent according to any one of [3-1] to [3-3], wherein the cardiac fibrosis is non-ischemic cardiac fibrosis. [4-2] The agent according to any one of [3-1] to [3-3], wherein the cardiac fibrosis is an ischemic heart disease other than myocardial infarction. [5] The agent according to any one of [1] to [4-2] for the treatment or prevention of dilated cardiomyopathy. [6-1] The agent according to [5] wherein dilated cardiomyopathy is hereditary. [6-2] The agent according to [6-1] wherein dilated cardiomyopathy is caused by a mutation in the tropomyosin 1 (TPM1) gene. [7-1] The agent according to any one of [1] to [6-2] for activating the NPR1 signaling pathway between cardiomyocytes and endothelial cells. [7-2] An NPR1 signaling pathway activator between cardiomyocytes and endothelial cells, comprising a fibroblast growth factor receptor (FGFR) inhibitor. [8] The agent according to any one of [1] to [7-2] wherein the FGFR inhibitor has inhibitory activity against at least FGFR1. [9] The agent according to any one of [1] to [8] wherein the FGFR inhibitor is an inhibitor of an FGFR-specific receptor kinase.

[10] The agent according to any one of [1] to [9] wherein at least one of the FGFR inhibitors is AZD4547 or PD166866.

[11] The agent according to any one of [1] to

[10] , wherein at least one of the FGFR inhibitors is AZD4547. [12-1] A method for screening cardiac function improving agents, comprising: (1) a step of bringing cells into contact with a test substance; (2) a step of measuring the activity of fibroblast growth factor receptor (FGFR) in the cells; and (3) a step of selecting the test substance as a candidate substance for cardiac function improving agent if the activity of FGFR in the cells decreases upon contact with the test substance.[12-2] A method for screening for a treatment or preventive agent for cardiac fibrosis, comprising: (1) a step of bringing cells into contact with a test substance; (2) a step of measuring the activity of fibroblast growth factor receptor (FGFR) in the cells; and (3) a step of selecting the test substance as a candidate substance for a treatment or preventive agent for cardiac fibrosis if the activity of FGFR in the cells decreases upon contact with the test substance.

[13] The method according to [12-1] or [12-2], wherein the step of measuring the activity of FGFR in step (2) comprises a step of measuring the expression level of FGFR and / or the degree of phosphorylation of FGFR.

[14] The method according to any one of [12-1] to

[13] , wherein the cardiac function improving agent or the treatment or preventive agent for cardiac fibrosis is a cardiac contraction or diastolic function improving agent.

[15] The method according to any one of [12-1] to

[14] , wherein the cells are cardiac organoids or cells constituting the heart.

[16] The method according to

[15] , wherein the heart is a living heart. [17-1] A method for improving cardiac function, comprising the step of administering an effective amount of a fibroblast growth factor receptor (FGFR) inhibitor to a mammal. [17-2] The method according to [17-1] for improving cardiac contraction or diastolic function. [17-3] A method for treating or preventing cardiac fibrosis, comprising the step of administering an effective amount of a fibroblast growth factor receptor (FGFR) inhibitor to a mammal. [17-4] A method for suppressing cardiac fibrosis, comprising the step of administering an effective amount of a fibroblast growth factor receptor (FGFR) inhibitor to a subject (e.g., a mammal or cells). [17-5] The method according to any one of [17-1] to [17-4] for the treatment or prevention of dilated cardiomyopathy. [17-6] The method according to [17-5], wherein dilated cardiomyopathy is hereditary. [17-7] The method according to [17-6], wherein dilated cardiomyopathy is caused by a mutation in the TPM1 gene. [17-8] A method for activating the NPR1 signaling pathway between cardiomyocytes and endothelial cells, comprising the step of administering an effective dose of a fibroblast growth factor receptor (FGFR) inhibitor to a subject (e.g., a mammal or cells). [18-1] A fibroblast growth factor receptor (FGFR) inhibitor for use in improving cardiac function. [18-2] The FGFR inhibitor according to [18-1] for use in improving cardiac contraction or diastolic function.[18-3] A fibroblast growth factor receptor (FGFR) inhibitor for use in the treatment or prevention of cardiac fibrosis. [18-4] A fibroblast growth factor receptor (FGFR) inhibitor for use in the suppression of cardiac fibrosis. [18-5] An FGFR inhibitor according to any one of [18-1] to [18-4] for use in the treatment or prevention of dilated cardiomyopathy. [18-6] An FGFR inhibitor according to [18-5] in which dilated cardiomyopathy is hereditary. [18-7] An FGFR inhibitor according to [18-6] in which dilated cardiomyopathy is caused by a mutation in the TPM1 gene. [18-8] A fibroblast growth factor receptor (FGFR) inhibitor for use in activating the NPR1 signaling pathway between cardiomyocytes and endothelial cells. [19-1] Use of a fibroblast growth factor receptor (FGFR) inhibitor in the manufacture of a cardiac function improving agent. [19-2] Use of the FGFR inhibitor described in [19-1] in the manufacture of an agent for improving cardiac contraction or diastolic function. [19-3] Use of a fibroblast growth factor receptor (FGFR) inhibitor in the manufacture of an agent for treating or preventing cardiac fibrosis. [19-4] Use of a fibroblast growth factor receptor (FGFR) inhibitor in the manufacture of an agent for suppressing cardiac fibrosis. [19-5] Use of any one of [19-1] to [19-4] for use in the treatment or prevention of dilated cardiomyopathy. [19-6] Use of the FGFR inhibitor described in [19-5] in dilated cardiomyopathy being hereditary. [19-7] Use of the FGFR inhibitor described in [19-6] in dilated cardiomyopathy resulting from a mutation in the TPM1 gene. [19-8] Use of a fibroblast growth factor receptor (FGFR) inhibitor in the manufacture of an NPR1 signaling pathway activator between cardiomyocytes and endothelial cells.

[0008] According to the present invention, a method can be provided that can suppress cardiac fibrosis or improve cardiac function through the suppression of fibrosis, and it is expected that the patient's prognosis and quality of life (QOL) will be improved by the improvement of cardiac function.

[0009] Gene modules highly associated with myocardial tissue fibrosis. (A) Enrichment analysis by DisGeNET. (B) Identification of hub genes in fibrosis-related modules. Identification of fibrotic regions by HALO AI. (A) Identification of fibrotic regions by deep learning. (B) Significant correlation between fibrotic regions and the expression of fibrosis-related genes. (C) MMP2 and FGFR1 show a high correlation with myocardial tissue fibrosis. Cardiac fibrosis model using cardiac organoids. (A) Cardiac fibrosis induction protocol. (B) Shows that fibrotic tissue in organoids increases upon fibrosis induction. Error bar: 50 μm. (C) Shows that fibrosis induction increases the expression of fibronectin 1 (FN1). n=16 (Healthy), n=14 (Fibrosis); t-test, *** p<0.001; Error bar: standard deviation. Gene expression analysis in a cardiac fibrosis model using cardiac organoids. (A) Shows increased expression of FSTL3 and MMP2 in cardiac fibrotic organoids. n=12 (Healthy), n=12 (Fibrosis); t-test, ** p<0.01, *** p<0.001; error bars: standard deviation. (B) Shows that fibrosis-inducing stimulation increases the expression of FSTL3 and MMP2. Hypoxia means hypoxic conditions, and TGFB1 0.3, TGFB1 1.0, and TGFB1 3.0 mean conditions where the culture medium concentrations of TGFB1 (TGFβ1) are 0.3 μg / ml, 1.0 μg / ml, and 3.0 μg / ml, respectively. n=3; one-way ANOVA with Tukey's multiple comparisons, * p<0.05, ** p<0.01, **** p<0.0001; error bars: standard deviation. (C) ELISA confirmed increased protein expression of MMP2 in the culture supernatant. n=5; t-test, ** p<0.01; error bars: standard deviation. The inhibitory effect of FGFR inhibitors on cardiac fibrosis. (A,B) Shows increased FGFR1 expression and phosphorylation in biopsy tissue with advanced fibrosis. n=3; t-test, ** p<0.01; error bars: standard deviation. (C) Shows that the expression of fibrosis-related genes is suppressed by the FGFR inhibitor (AZD4547). n=6; t-test, ** p<0.01, ****p<0.0001; Error bar: standard deviation. (D) Shows that FGFR inhibitors reduce FN1 protein. n=19 (Healthy), n=32 (+DMSO), n=32 (+AZD4547); one-way ANOVA with Tukey's multiple comparisons, * p<0.05, ** p<0.01; Error bar: standard deviation. (E) Shows that FGFR inhibitors suppress cardiac fibrosis in cardiac organoids. Error bar: 50 μm. Suppressive effect of FGFR inhibitors on cardiac fibrosis in mice. (A) Method for evaluating the effect of FGFR inhibitor (AZD4547) in a phenylephrine-angiotensin II (PE / AngII) administered cardiac fibrosis model mouse. (B,C) Shows that FGFR inhibitor administration improves cardiac function. LVDd is left ventricular end-diastolic diameter, LVDs is left ventricular end-systolic diameter, and FS is left ventricular diameter shortening. n=6; one-way ANOVA with Tukey's post hoc test, *** p<0.001; error bars: standard error. (D,E) Shows that cardiac fibrosis is suppressed by FGFR inhibitors. n=3; one-way ANOVA with Tukey's post hoc test, *** p<0.001; error bars: standard error. In Figure 6, NS is normal physiological saline solution, and AZD is AZD4547. Effects of the selective FGFR1 inhibitor PD166866 on fibrosis-related gene expression in an in vitro cardiac fibrosis organoid model. Treatment with PD166866 significantly downregulated fibrosis-related genes and the identified biomarker MMP2. This result suggests that selective FGFR1 inhibition may be an effective treatment for cardiac fibrosis. PD-166866 is a synthetic molecule that inhibits the tyrosine kinase activity of FGFR1, exhibiting very high selectivity for FGFR1 and inhibiting its autophosphorylation activity. n=8; t-test, * p<0.05, ** p<0.01;Error bars: standard deviation. Overall figure of scRNAseq analysis. This analysis showed that NPR1 signaling may be a potential factor in improving cardiac function in hearts treated with AZD4547. Overall figure of scRNAseq analysis. This analysis showed that NPR1 signaling may be a potential factor in improving cardiac function in hearts treated with AZD4547. scRNAseq results. Quality controls confirmed that cells were well integrated and distributed within clusters (A). Analysis of the entire transcript per cell and identification of potential doublets confirmed that both datasets were of high quality and successfully integrated (B,C). scRNAseq results. (D) Dot plot of selected genes. scRNAseq results. Representative gene expression patterns of CM (cardiomyocyte) and FB (fibroblast) clusters. (E) Expression of characteristic marker genes allowed for the identification of cell populations such as cardiomyocytes expressing Myh6, Myl2, and Tnni3. scRNAseq results. (F) We were able to identify cell populations such as fibroblasts expressing Col1a1, Col1a2, and Dcn. Representative gene expression patterns after reclustering of FB population. Representative gene expression patterns after reclustering of CM population. This shows that interactions within the FGF signaling pathway network between cardiomyocytes and fibroblasts in cardiac cardiac cells treated with AZD4547 were reduced. Downregulation of Fgf1-Fgfr1 transmission from cardiomyocytes to macrophages was confirmed in cardiac cells treated with AZD4547. These results demonstrate the direct efficacy of FGFR1 inhibition in specific cell types such as cardiomyocytes and fibroblasts. The horizontal axis of the graph, from left to right, represents: Endothelial -> Endothelial (AZD), Endothelial -> Endothelial (NS), Endothelial -> Fibroblast (AZD), Endothelial -> Fibroblast (NS), Endothelial -> Macrophage (AZD), Endothelial -> Macrophage (NS), Endothelial-> Ventricular CM (AZD), Endothelial -> Ventricular CM (NS), Fibroblast -> Endothelial (AZD), Fibroblast -> Endothelial (NS), Fibroblast -> Fibroblast (AZD), Fibroblast -> Fibroblast (NS), Fibroblast -> Macrophage (AZD), Fibroblast -> Macrophage (NS), Fibroblast -> Ventricular CM (AZD), Fibroblast -> Ventricular CM (NS), Macrophage -> Endothelial (AZD), Macrophage -> Endothelial (NS), Macrophage -> Fibroblast (AZD), Macrophage -> Fibroblast (NS), Macrophage -> Macrophage (AZD), Macrophage -> Macrophage (NS), Macrophage -> Ventricular CM (AZD), Macrophage -> Ventricular CM (NS), Ventricular CM -> Endothelial (AZD), Ventricular CM -> Endothelial (NS), Ventricular CM -> Fibroblast (AZD), Ventricular CM -> Fibroblast (NS), Ventricular CM -> Macrophage (AZD), Ventricular CM -> Macrophage (NS), Ventricular CM -> Ventricular CM (AZD), Ventricular CM -> Ventricular CM (NS). Therapeutic effect of AZD4547 on dilated cardiomyopathy (TPM1-transgenic mouse) model mice. (A) Outline of the experiment. (B) Echocardiography results in 4 and 6 week old mice. FS: Fractional shortening (percentage of left ventricular diameter shortening), Dd: DiastolicDimension (left ventricular end-diastolic diameter) (mm), Ds; Systolic dimension (left ventricular end-systolic diameter) (mm). Healthy n=7, DCM n=5, DCM+AZD n=5; One-way Anova test followed by Tukey multiple comparisons, ns; not significant, * p<0.05, ** p<0.01, *** p<0.001; Error bars: standard deviation. (C) Cardiac tissue staining images (Mason's trichrome staining) from 6-week-old mice. In the figure, WT shows the results for wild-type mice, DCM shows the results for dilated cardiomyopathy mice, and DCM+AZD shows the results for dilated cardiomyopathy mice that were administered AZD4547 daily from 4 weeks to 6 weeks of age.

[0010] 1. Cardiac Function Improving Agents The present invention provides a cardiac function improving agent (hereinafter sometimes referred to as "the cardiac function improving agent of the present invention") comprising a fibroblast growth factor receptor (FGFR) inhibitor. In this specification, "improvement of cardiac function" may be an improvement in cardiac contractile function or an improvement in cardiac diastolic function. In one embodiment, improvement of cardiac function is an improvement in at least cardiac contractile or diastolic function (particularly cardiac contractile function). "Improvement in cardiac contractile or diastolic function" also includes improving both cardiac contractile and diastolic function. When an FGFR inhibitor is administered to a subject, if at least one of the following is observed, the inhibitor can be evaluated as improving cardiac function: a decrease in LVDd (left ventricular end-diastolic diameter), a decrease in LVDs (left ventricular end-systolic diameter), and an increase in FS (Fractional Shortening). If at least FS increases, the cardiac contractile function can be evaluated as improving. Furthermore, improvement in cardiac diastolic function can be evaluated by normalization of the E / A ratio in echocardiography, an increase in e' (early diastolic mitral annular velocity) by the TDI method, a decrease in the E / e' ratio, and a reduction in left atrial diameter. If any of these findings are observed, it can be determined that cardiac diastolic function has improved due to the inhibitor. Moreover, agents that stop or slow the rate of decline in cardiac function, even if they do not improve cardiac function, are also included in the cardiac function improving agents of the present invention. FS (%) can be calculated as 100 x (LVDd - LVDs) / LVDd.

[0011] The cardiac function improving agent of the present invention can also be used for the treatment or prevention of dilated cardiomyopathy (in other words, as a therapeutic or preventive agent for dilated cardiomyopathy). Dilated cardiomyopathy is a condition in which the left ventricle or both ventricles enlarge, making it difficult to effectively pump blood to the rest of the body, and is typically accompanied by a decrease in systolic function. Causes of dilated cardiomyopathy include hereditary factors, viral or bacterial infections, chronic endocrine disorders such as diabetes and thyroid disease, obesity, tachycardia, alcohol consumption, cocaine use, and complications from pregnancy, but any of these may be present. In one embodiment, the cause of dilated cardiomyopathy is hereditary.

[0012] Causes of hereditary dilated cardiomyopathy include, but are not limited to, mutations in the TTN (titin) gene, LMNA (lamin A / C) gene, MYH7 (myosin heavy chain 7) gene, TPM1 (tropomyosin 1) gene, TNNT2 (cardiac troponin T) gene, DSP (desmoplakin) gene, and PKP2 (placophyllin 2) gene. In one embodiment, the cardiac function improving agent of the present invention is used for the treatment or prevention of dilated cardiomyopathy caused by a TPM1 gene mutation.

[0013] Since cardiac fibrosis leads to a decline in cardiac function, suppressing, treating, or preventing cardiac fibrosis is also included in improving cardiac function. Therefore, the cardiac function improving agent of the present invention can be used for the treatment or prevention of cardiac fibrosis, but the cardiac function improving agent may not have therapeutic or preventive effects on cardiac fibrosis. In another embodiment of the present invention, an agent that suppresses cardiac fibrosis, or an agent that treats or prevents cardiac fibrosis, including an FGFR inhibitor (hereinafter, the term "fibrosis inhibitor of the present invention" may be used to refer to these agents collectively). Furthermore, unless otherwise specified, a drug (or method) for the treatment or prevention of cardiac fibrosis also includes a medicine (or method) that can treat and prevent the disease.

[0014] In this specification, "cardiac fibrosis" refers to a condition in which fibrosis is observed at least in the myocardium (in other words, a condition in which fibrous tissue accumulates excessively), but fibrosis may also be observed in areas other than the myocardium, such as the pericardium and endocardium. Cardiac fibrosis can typically be evaluated using the expression levels of fibrosis-related genes (e.g., TGFB1, FN1, TNC, COL1A1, FAP, POSTN, etc.) as indicators, but it is particularly preferable to compare the mRNA level or protein amount of FN1. Alternatively, the expression levels of the FSTL3 or MMP2 genes, which are biomarkers identified in the examples described below, may be used as indicators.

[0015] In this specification, unless otherwise specified, “gene expression” means at least “production of a functional protein,” but preferably also means “production of a transcript.” In this specification, the transcript typically includes mRNA and pre-mRNA, but preferably mRNA.

[0016] In this specification, "cardiac fibrosis" may also mean the process of fibrosis in context. Therefore, inhibitors of cardiac fibrosis include not only those aimed at reducing the area of ​​cardiac fibrosis, but also those aimed at inhibiting the progression of cardiac fibrosis. Furthermore, therapeutic agents (or methods of treatment) for cardiac fibrosis include not only medicines aimed at curing cardiac fibrosis, but also, for example, medicines (or methods) aimed at inhibiting the progression of cardiac fibrosis, medicines (or methods) aimed at alleviating symptoms (e.g., improvement to minimal manifestations MM, where symptoms do not interfere with daily life or work), or medicines (or methods) aimed at reducing sequelae. For example, since cardiac fibrosis is a disease that progresses over a long period (usually years), initiating treatment early can prevent the progression of symptoms.

[0017] Cardiac fibrosis occurs in response to various types of damage and stress on the heart, resulting in the loss of normal cardiomyocytes and the excessive accumulation of fibrous tissue. The fibrosis inhibitor of the present invention can be used for the treatment or prevention of cardiac fibrosis of any cause. Specific causes of cardiac fibrosis include, but are not limited to, hypertension, myocardial infarction, heart failure (e.g., HFrEF (Heart Failure with Reduced Ejection Fraction), HFpEF (Heart Failure with Preserved Ejection Fraction), right-sided heart failure, left-sided heart failure, acute heart failure, chronic heart failure, high-output heart failure, etc.), aging, inflammatory diseases (e.g., myocarditis, sarcoidosis, collagen disease, etc.), diabetes, cardiomyopathy (dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, etc.), genetically-derived heart disease, and radiation therapy. These diseases may be ischemic or non-ischemic cardiac fibrosis, but in one embodiment they are non-ischemic cardiac fibrosis (e.g., dilated cardiomyopathy, hypertrophic cardiomyopathy, etc.), and in another embodiment they are ischemic heart diseases other than myocardial infarction (e.g., cardiac fibrosis due to chronic myocardial ischemia, etc.).

[0018] As shown in the examples described below, the cardiac function improving agent of the present invention has been shown to induce activation of the NPR1 signaling pathway between cardiomyocytes and endothelial cells. Since activation of the NPR1 signaling pathway in the heart is known to maintain cardiac function and function in cardioprotection, the cardiac function improving agent of the present invention can also be used to activate the NPR1 signaling pathway between cardiomyocytes and endothelial cells. In another embodiment of the present invention, an NPR1 signaling pathway activator between cardiomyocytes and endothelial cells (hereinafter sometimes referred to as "the NPR1 signaling pathway activator of the present invention") is also provided, which includes an FGFR inhibitor. Hereinafter, the term "agent of the present invention" may be used as a general term to refer to the cardiac function improving agent of the present invention, the fibrosis inhibitor of the present invention, and the NPR1 signaling pathway activator of the present invention.

[0019] The NPR1 (Natriuretic Peptide Receptor 1) signaling pathway is one of the signaling pathways that occur between cardiomyocytes and endothelial cells, and is involved in regulating cardiac function, vasodilation, and blood pressure. NPR1 is mainly activated by atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP), hormones secreted by the heart, and plays a major role in maintaining the health of the heart and blood vessels. When ANP and BNP bind to NPR1 receptors present on the surface of vascular endothelial cells and cardiomyocytes, NPR1 guanylate cyclase activity is induced, and cyclic GMP (cGMP) is produced within the cell. cGMP acts as a secondary messenger and triggers various physiological responses. Therefore, the activation of the NPR1 signaling pathway between cardiomyocytes and endothelial cells can be evaluated by measuring the secretion levels of ANP and BNP, the expression level of NPR1, and the amount of cGMP present in cells. Alternatively, as shown in the examples described later, bioinformatics tools such as CellChat24 can be used to evaluate the activation of the NPR1 signaling pathway between cardiomyocytes and endothelial cells.

[0020] In this specification, an FGFR inhibitor is not particularly limited to any substance that can suppress signal transduction mediated by FGF and FGFR, and may be a protein, nucleic acid, or small molecule compound. Human FGF forms a family consisting of at least 23 types. In addition, FGFR1, FGFR2, FGFR3, and FGFR4 are known as human FGFRs, and an FGFR inhibitor means a substance that inhibits one, two, three, or four of these receptors. Examples of such substances include substances that directly act on FGFR or FGF (e.g., antibodies, aptamers, etc.), substances that inhibit the binding of FGFR to FGF (e.g., soluble FGFR, FGF antagonists, etc.), and substances that inhibit physiological activity resulting from FGFR-mediated signal transduction [e.g., AZD4547 (Fexagratinib) (rel-N-[5-[2-(3,5-Dimethoxyphenyl)ethyl]-1H-pyrazol-3-yl]-4-[(3R,5S)-3,5-dimethyl-1-piperazinyl]benzamide) and PD166866 (1-(2-Amino-6-(3,5-dimethoxyphenyl)pyrido[2,3-d]pyrimidin-7-yl)-3-tert-butyl]. Examples include, but are not limited to, low molecular weight compounds such as urea, PD173074 (N-[2-[[4-(Diethylamino)butyl]amino]-6-(3,5-dimethoxyphenyl)pyrido[2,3-d]pyrimidin-7-yl]-N'-(1,1-dimethylethyl)urea), and SU5402 (2-[(1,2-Dihydro-2-oxo-3H-indol-3-ylidene)methyl]-4-methyl-1H-pyrrole-3-propanoic acid, SU 6668).Other FGFR inhibitors include Dovitinib, Danusertib, R1530, FIIN-2, FIIN-3, Lucitanib hydrochloride, Sulfatinib, ODM-203, Futibatinib, ASP5878, Derazantinib, PRN1371, S49076, ON123300, Zoligratinib, and LY2874455. These substances may be used individually or in combination of two or more. Preferred FGFR inhibitors include AZD4547 and PD166866 (especially AZD4547).

[0021] In the case of a low molecular weight compound used in the present invention, the compound shall include not only the free form but also its pharmacokinetically acceptable salts and hydrates. Pharmacokinetically acceptable salts vary depending on the type of compound, but examples include inorganic base salts such as alkali metal salts (sodium salts, potassium salts, etc.), alkaline earth metal salts (calcium salts, magnesium salts, etc.), aluminum salts, and ammonium salts, as well as base addition salts such as organic base salts such as trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, and N,N'-dibenzylethylenediamine; or acid addition salts such as inorganic acid salts such as hydrochloride, hydrobromide, sulfate, hydroiodide, nitrate, and phosphate; and organic acid salts such as citrate, oxalate, acetate, formate, propionate, benzoate, trifluoroacetate, maleate, tartrate, methanesulfonate, benzenesulfonate, and p-toluenesulfonate.

[0022] The FGFR inhibitor used in the present invention may have inhibitory activity against any of FGFR1, FGFR2, FGFR3, or FGFR4, but it is preferable that it has inhibitory activity against at least FGFR1. AZD4547 is a selective FGFR inhibitor that targets FGFR1, 2, and 3 (particularly FGFR1), and has a weak inhibitory effect on FGFR4. Therefore, the FGFR inhibitor used in the present invention may not have inhibitory activity against FGFR4, or its inhibitory activity against FGFR4 may be weaker than its inhibitory activity against FGFR1. Accordingly, FGFR4 inhibitors (typically FGFR4-specific inhibitors such as anti-FGFR4 antibodies) may be excluded from the FGFR inhibitor used in the present invention. In one embodiment, anti-FGFR4 antibodies are excluded from the FGFR inhibitor of the present invention. Furthermore, the FGFR inhibitor used in the present invention may be an inhibitor of an FGFR-nonspecific receptor kinase, or an inhibitor of an FGFR-specific (selective) receptor kinase. Here, an FGFR-specific receptor kinase inhibitor means one that has substantially no inhibitory activity against receptor kinases other than FGFR, but may have inhibitory activity against VEGFR.

[0023] Furthermore, an FGFR inhibitor may also be a substance that suppresses the expression of a gene encoding FGFR or FGF (hereinafter sometimes referred to as "FGFR or FGF expression inhibitor"). An FGFR or FGF expression inhibitor is not limited to any substance that can suppress the expression of the FGFR or FGF gene, but is typically a nucleic acid or a complex containing a nucleic acid. Examples of such nucleic acids or complexes containing a nucleic acid include antisense nucleic acids (e.g., antisense oligonucleotides (ASOs), etc.) (including nucleic acids that encode such nucleic acids), siRNA (including nucleic acids that encode such siRNA), heteroduplex oligonucleotides (HDOs), shRNA (including nucleic acids that encode such shRNAs), miRNA (microRNAs) (including nucleic acids that encode such miRNAs), antigenic nucleic acids, and the CRISPR-Cas system. Hereinafter, when the FGFR or FGF expression inhibitor is a nucleic acid, such nucleic acid may be referred to as "the nucleic acid of the present invention." If the FGFR or FGF expression inhibitor is a CRISPR-Cas system, then the nucleic acids encoding the system (i.e., nucleic acids encoding Cas (typically, Cas with inactivated DNA cleavage activity (dCas)), nucleic acids encoding guide RNA, and nucleic acids encoding both guide RNA and Cas) and guide RNA are also included in "the nucleic acids of the present invention." The agent of the present invention may contain only one FGFR or FGF expression inhibitor, or it may contain two or more. If it contains two or more, they may be of the same type (e.g., multiple siRNAs with different target sequences) or of different types (e.g., siRNA and antisense nucleic acid).

[0024] When multiple isoforms exist for an FGFR or FGF protein, an FGFR or FGF expression inhibitor typically suppresses the expression of the FGFR or FGF transcript encoding the full-length protein. Therefore, in one embodiment, the expression inhibitor includes a nucleotide sequence complementary to the partial sequence of the transcript encoding the full-length FGFR or FGF protein (hereinafter referred to as the target RNA sequence). Such a nucleotide sequence can be designed, for example, based on cDNA sequences registered in GenBank. Furthermore, when an FGFR or FGF gene expression inhibitor targets the FGFR or FGF gene using an antigenic nucleic acid, a CRISPR / Cas system, etc., the expression inhibitor (or, in the case of the CRISPR / Cas system, the guide RNA constituting the system) includes a nucleotide sequence complementary to the partial sequence of the FGFR or FGF gene (hereinafter referred to as the target DNA sequence).

[0025] The length of the target RNA sequence or target DNA sequence is not particularly limited, as long as the FGFR or FGF gene expression inhibitor can specifically recognize and bind to the sequence, but is preferably 12 nucleotides or longer, more preferably 15 nucleotides or longer, and even more preferably 17 nucleotides or longer. The upper limit of the length is also not particularly limited, but is, for example, 30 nucleotides or less, preferably 25 nucleotides or less, and more preferably 22 nucleotides or less. Therefore, the length range of the target region is, for example, 12 to 30 nucleotides, preferably 15 to 25 nucleotides, and more preferably 17 to 22 nucleotides.

[0026] The nucleic acids of the present invention can be prepared by determining their sequence and synthesizing a complementary sequence using a commercially available automated DNA / RNA synthesizer (e.g., Applied Biosystems, Beckman). Alternatively, they can be prepared using genetic engineering technology.

[0027] The agent of the present invention can be administered orally or parenterally as a pharmaceutical composition in a suitable dosage form, either alone as the active ingredient, an FGFR inhibitor, or mixed with a pharmacologically acceptable carrier, excipient, diluent, etc. The agent of the present invention can also be administered to mammals (e.g., humans, rats, mice, guinea pigs, rabbits, sheep, horses, pigs, cattle, dogs, cattle, monkeys). Accordingly, in another embodiment, a method for improving cardiac function, improving cardiac contraction or diastolic function, suppressing cardiac fibrosis, treating or preventing cardiac fibrosis, or activating the NPR1 signaling pathway between cardiomyocytes and endothelial cells in a mammal, characterized by administering an effective amount of an FGFR inhibitor to the mammal, is also provided (the term "method of the present invention" may be used as a general term for these methods).

[0028] The agent of the present invention can be administered to mammals orally or parenterally (e.g., by subcutaneous injection, intramuscular injection, local injection, intraperitoneal administration, etc.), but parenteral administration is preferred.

[0029] Compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups, emulsions, suspensions, etc. On the other hand, compositions for parenteral administration include, for example, injections and suppositories, and injections may include dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, and drip infusions. These preparations contain excipients (e.g., sugar derivatives such as lactose, sucrose, glucose, mannitol, and sorbitol; starch derivatives such as corn starch, potato starch, α-starch, and dextrin; cellulose derivatives such as crystalline cellulose; organic excipients such as gum arabic, dextran, and pullulan; and inorganic excipients such as light anhydrous silicic acid, synthetic aluminum silicate, calcium silicate, and magnesium aluminometasilicate; phosphates such as calcium hydrogen phosphate; carbonates such as calcium carbonate; and sulfates such as calcium sulfate), lubricants (e.g., metal stearates such as stearic acid, calcium stearate, and magnesium stearate; talc; colloidal silica; waxes such as beeswax and gypsum wax; boric acid; adipic acid; sulfates such as sodium sulfate; glycols; fumaric acid; sodium benzoate; DL-leucine; and sodium lauryl sulfate). , lauryl sulfates such as magnesium lauryl sulfate; silicic acids such as anhydrous silicic acid and silicic acid hydrate; and starch derivatives of the above), binders (e.g., hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinylpyrrolidone, macrogol, and compounds similar to the above excipients), disintegrants (e.g., cellulose derivatives such as low-substituted hydroxypropyl cellulose, carboxymethyl cellulose, carboxymethylcellulose calcium, and internally crosslinked carboxymethylcellulose sodium; chemically modified starch celluloses such as carboxymethyl starch, carboxymethyl starch sodium, and crosslinked polyvinylpyrrolidone), emulsifiers (e.g., colloidal clays such as bentonite and beegum; metal hydroxides such as magnesium hydroxide and aluminum hydroxide; anionic surfactants such as sodium lauryl sulfate and calcium stearate;It is manufactured by a well-known method using additives such as cationic surfactants like benzalkonium chloride; and nonionic surfactants like polyoxyethylene alkyl ethers, polyoxyethylene sorbitan fatty acid esters, and sucrose fatty acid esters), stabilizers (para-hydroxybenzoic acid esters such as methylparaben and propylparaben; alcohols such as chlorobutanol, benzyl alcohol, and phenylethyl alcohol; benzalkonium chloride; phenols such as phenol and cresol; thimerosal; dehydroacetic acid; and sorbic acid), flavoring and deodorizing agents (e.g., commonly used sweeteners, acidulants, flavorings, etc.), and diluents.

[0030] Examples of pharmaceutically acceptable carriers include, but are not limited to, excipients such as sucrose and starch, binders such as cellulose and methylcellulose, disintegrants such as starch and carboxymethylcellulose, lubricants such as magnesium stearate and aerosil, fragrances such as citric acid and menthol, preservatives such as sodium benzoate and sodium bisulfite, stabilizers such as citric acid and sodium citrate, suspending agents such as methylcellulose and polyvinylpyrrolide, dispersants such as surfactants, diluents such as water and physiological saline, and base waxes.

[0031] When the FGFR inhibitor is in the form of a nucleic acid, the agent of the present invention may further contain a nucleic acid delivery reagent to promote the delivery of the nucleic acid into target cells. Examples of such nucleic acid delivery reagents include calcium chloride, calcium enrichment reagents, atelocollagen, liposomes, nanoparticles, lipofectin, lipofectamine, DOGS (transfectam), DOPE, DOTAP, DDAB, DHDEAB, HDEAB, polybren, or cationic lipids such as poly(ethyleneimine) (PEI).

[0032] The dosage of the FGFR inhibitor, which is the active ingredient of the agent of the present invention, may vary depending on various conditions such as the type of compound, the symptoms of the patient, age, body weight, and drug tolerance. However, for oral administration, a minimum of 0.1 mg (preferably 0.5 mg) and a maximum of 1000 mg (preferably 500 mg) can be administered per dose, and for parenteral administration, a minimum of 0.01 mg (preferably 0.05 mg) and a maximum of 100 mg (preferably 50 mg) can be administered per dose, 1 to 6 times per day to an adult. The dosage may be increased or decreased depending on the symptoms. In particular, if the compounds of the present invention are already on the market as pharmaceuticals for diseases other than cardiac fibrosis, the appropriate dosage can be selected for each compound within the range in which safety has been confirmed.

[0033] Furthermore, when FGFR inhibitors are administered systemically to adults in the form of nucleic acids, the usual single dose of the nucleic acid is 2 nmol / kg to 50 nmol / kg, and when administered topically, 1 pmol / kg to 10 nmol / kg is preferable. It is desirable to administer such a dose 1 to 10 times, more preferably 5 to 10 times. The dose may be increased or decreased depending on the symptoms.

[0034] FGFR inhibitors can also be used in combination with other cardiac function improving agents or agents for the prevention or treatment of cardiac fibrosis (hereinafter sometimes referred to as "existing drugs") (e.g., enalapril, lisinopril, losartan, candesartan, spironolactone, eplerenone, carvedilol, bisoprolol, metoprolol, sacubitril, pirfenidone, neintedanib, etc.).

[0035] When used as a concomitant agent, such concomitant agent may be formulated together with the FGFR inhibitor and administered as a single formulation, or it may be formulated separately from the FGFR inhibitor (for example, as a kit) and administered simultaneously or with a time delay via the same or a different route as the agent of the present invention. Furthermore, the dosage of these concomitant agents may be the amount normally used when the agent is administered alone, or it may be reduced from the amount normally used.

[0036] Furthermore, FGFR inhibitors may be used in cell culture systems, for example, to suppress fibrosis in cultured tissue or to activate the NPR1 signaling pathway between cardiomyocytes and endothelial cells. When using FGFR inhibitors in a cell culture system, the concentration of the FGFR inhibitor in the culture medium is not particularly limited and can be appropriately set by those skilled in the art depending on the type of FGFR inhibitor. Other culture conditions, such as the culture period and culture temperature, can also be appropriately set.

[0037] 2. Screening Method As described above, FGFR inhibitors may exert therapeutic or preventive effects on cardiac fibrosis. Therefore, substances that reduce (inhibit) the activity of FGFR in cells may be candidate substances for therapeutic or preventive drugs for cardiac fibrosis, or candidate substances for inhibitors of cardiac fibrosis. Accordingly, in another embodiment of the present invention, a screening method for therapeutic or preventive drugs for cardiac fibrosis (hereinafter sometimes referred to as "the screening method of the present invention") is provided, which includes (1) a step of contacting cells with a test substance, (2) a step of measuring the activity of fibroblast growth factor receptor (FGFR) in cells, and (3) a step of selecting the test substance as a candidate substance for therapeutic or preventive drugs for cardiac fibrosis if the activity of FGFR in cells is reduced upon contact with the test substance.

[0038] The target cardiac fibrosis in the screening method of the present invention includes the same types as those listed in "1. Cardiac function improving agents" above. Furthermore, "therapeutic or prophylactic agent for cardiac fibrosis" can be appropriately replaced with "inhibitor for cardiac fibrosis." In addition, FGFR inhibitors can be used to activate the NPR1 signaling pathway between cardiomyocytes and endothelial cells or to improve cardiac function. Therefore, in the screening method of the present invention, "therapeutic or prophylactic agent for cardiac fibrosis" can be appropriately replaced with "NPR1 signaling pathway activator between cardiomyocytes and endothelial cells" or "cardiac function improving agent."

[0039] Therefore, in one embodiment of the screening method of the present invention, a screening method for cardiac function improving agents (in one embodiment, cardiac contraction or diastolic function improving agents (particularly cardiac contraction function improving agents)) is provided, comprising the steps of: (1) bringing cells into contact with a test substance; (2) measuring the activity of fibroblast growth factor receptor (FGFR) in the cells; and (3') selecting the test substance as a candidate substance for cardiac function improving agents (in one embodiment, cardiac contraction or diastolic function improving agents) if the activity of FGFR in the cells decreases upon contact with the test substance.

[0040] In step (1) of the screening method of the present invention, contact between cells and the test substance can typically be performed by culturing the cells in a culture medium containing the test substance. The period of contact between cells and the test substance is not particularly limited, but is typically 1 minute to 10 days, preferably 1 hour to 9 days, and more preferably 6 hours to 7 days.

[0041] Alternatively, the screening method of the present invention may be performed using animals. In this case, contact between cells and the test substance can typically be achieved by administering the test substance to the animal orally or parenterally. The administration may be once or multiple times (for example, daily). Typically, after a certain period has elapsed since the initial administration (typically 1 to 60 days, preferably 10 to 50 days, and more preferably 20 to 40 days (in one embodiment, 35 days)), tissue or organs (e.g., heart) can be extracted, and these tissues or organs, or cells isolated therefrom, can be subjected to steps (2), (3), and (3') of the screening method of the present invention. Thus, in one embodiment, the cells used in the present invention are cells that constitute tissues or organs (e.g., heart) in a living organism.

[0042] In this specification, unless otherwise specified, "cells" shall include "cell populations". Also, unless otherwise specified, "cells" refer to those obtained by cell culture. A cell population may be composed of one type of cell or two or more types of cells. Furthermore, unless otherwise specified, "cell populations" also include "organoids" such as "cell aggregates" and "artificial tissues".

[0043] The cells used in the present invention may be single cells, cell populations, or organoids. The type of cells is not particularly limited, but preferably, they are cardiac organoids or cells that make up the heart. Examples of such cells include, but are not limited to, cardiomyocytes, endocardial cells, pacemaker cells, endothelial cells, fibroblasts, etc. Among them, cardiomyocytes or cardiac organoids are preferred. Also, the cells or heart used in the present invention may be model cells of cardiac fibrosis or the heart of a model animal of cardiac fibrosis.

[0044] Cardiomyocytes are cells that make up the myocardium of an animal and are typically cells that repeat contraction and relaxation (pulsatile activity is observed). Cardiomyocytes are typically cells that express at least one selected from TNNI3, CD36, CAV3, and S100A1 (particularly, they express TNNI3 and / or S100A1). The cardiomyocytes used in the present invention can be obtained by known methods. For example, methods of isolating from the heart by known techniques, methods of inducing differentiation of pluripotent stem cells, methods of obtaining from companies such as ATCC, etc. can be mentioned. From the heart, for example, using surface antigens (such as CD172a, etc.) as indicators, methods using flow cytometry or mass cytometry, magnetic cell separation methods, affinity columns immobilized with the desired antigen, etc. can be used to isolate cardiomyocytes.

[0045] As used herein, "organoid" means a structure (typically a spheroid) containing multiple types of cells. Also, "artificial tissue" typically means a structure having a structure and / or function similar to that of tissue in a living body. Whether a certain structure is an organoid or artificial tissue can be determined, for example, by microscopic observation of a sample subjected to staining (e.g., immunostaining, hematoxylin and eosin (HE) staining, etc.) as needed, to confirm the localization of cells and the presence or absence of layer structure formation.

[0046] As used herein, "cardiac organoid" means an organoid containing cardiomyocytes, and the organoid also includes artificial cardiac tissue. "Artificial cardiac tissue" means artificial tissue containing cardiomyocytes. Hereinafter, unless otherwise specified, artificial cardiac tissue is simply referred to as "cardiac tissue". Cardiac organoids may typically contain at least one of epicardial cells, endothelial cells, and endocardial cells, and cardiac fibroblasts.

[0047] The origin of the cells used in the present invention is not particularly limited, and may be, for example, cells of rodents such as rats, mice, hamsters, guinea pigs, rabbits of the order Lagomorpha, ungulates such as pigs, cows, goats, sheep, carnivores such as dogs, cats, primates such as humans, monkeys, rhesus monkeys, marmosets, orangutans, chimpanzees, etc. When performing the screening method of the present invention using cultured cells, the cells are preferably human-derived cells. When performing the screening method of the present invention using an animal, the animal is preferably a rodent (especially a mouse).

[0048] As a method for inducing differentiation of pluripotent stem cells into cardiomyocytes, known methods can be used. Examples of such methods include the methods described in Laflamme MA & Murry CE, Nature 2011, May 19;473(7347):326-35 Review, the methods described in Funakoshi, S. et al. Sci Rep 8, 19111 (2016), the methods described in Miki, K. et al. Cell Stem Cell. 2015 Jun 4;16(6):699-711, etc.

[0049] Other examples, though not specifically identified, include methods for producing cardiomyocytes by forming cell aggregates (embryoid bodies) from pluripotent stem cells in suspension culture (WO2016 / 104614), methods for producing cardiomyocytes in the presence of a substance that suppresses bone morphogenic protein (BMP) signaling (WO2005 / 033298), methods for producing cardiomyocytes by sequentially adding Activin A and BMP (WO2007 / 002136), methods for producing cardiomyocytes in the presence of a substance that promotes activation of the canonical Wnt signaling pathway (WO2007 / 126077), and methods for isolating FLk / KDR-positive cells from induced pluripotent stem cells and producing cardiomyocytes in the presence of cyclosporine A (WO2009 / 118928).

[0050] A "pluripotent stem cell" refers to a stem cell that can differentiate into various tissues and cells with different forms and functions in the living body, and has the ability to differentiate into any of the three germ layers (endoderm, mesoderm, and ectoderm). Examples of pluripotent stem cells used in this invention include induced pluripotent stem cells (iPS cells), embryonic stem cells (ES cells), nuclear transfer embryonic stem cells (ntES cells) derived from cloned embryos obtained by nuclear transfer, multipotent germline stem cells ("mGS cells"), and embryonic germline stem cells (EG cells), but iPS cells are preferred (more preferably human iPS cells). When the above-mentioned pluripotent stem cells are ES cells or any cells derived from a human embryo, the cells may be cells produced by destroying the embryo or cells produced without destroying the embryo, but from an ethical standpoint, cells produced without destroying the embryo are preferred.

[0051] Cardiac organoids can be produced, for example, by inducing ventricular cardiomyocytes and epicardial cells from pluripotent stem cells, as shown in the examples below, mixing these cells, and then culturing them in suspension, but this method is not limited to this method. Fibrosis of cardiac organoids can also be induced by stimulating fibrosis in the cardiac organoids (for example, by culturing them in the presence of isoproterenol and TGFB1 under hypoxic conditions).

[0052] Step (2) of the screening method of the present invention can be carried out, for example, by measuring the expression level of FGFR or by measuring the degree of phosphorylation of FGFR. Therefore, in one embodiment, step (2) of the screening method of the present invention includes a step of measuring the expression level of FGFR and / or the degree of phosphorylation of FGFR. Alternatively, step (2) can be carried out by measuring the expression level of genes involved downstream of FGFR signaling (e.g., FOS, MYC, etc.), measuring the expression level of the FGF gene, or measuring the inhibitory activity of FGF-FGFR binding.

[0053] In step (2) above, the expression level of the target gene can be measured by known methods, such as measuring the amount of mRNA or protein in the cell or culture medium (e.g., RT-qPCR, Western blotting, ELISA, etc.). Alternatively, the expression level of a reporter gene that reflects the expression level of the target gene may be used. The expression level of the reporter gene can be measured by a method appropriate to the type of reporter gene. For example, if the reporter gene is a luciferase gene, it can be measured by its luminescence intensity. If the reporter gene is a fluorescent protein gene, it can be measured by its fluorescence intensity. If the reporter gene is a chromogenic enzyme gene, it can be measured by its color intensity. Furthermore, the expression of the reporter gene can also be detected or measured using a fluorescence imaging system or a luminescence imaging system.

[0054] Furthermore, the degree of FGFR phosphorylation can be measured (evaluated) using methods such as ELISA, immunoprecipitation, and Western blotting with antibodies specific to phosphorylated FGFR. Alternatively, the degree of FGFR phosphorylation can be evaluated by measuring the expression levels of genes involved in downstream FGFR signaling. The inhibitory activity of FGF-FGFR binding can be measured using methods such as surface plasmon resonance and competitive ELISA.

[0055] In step (3) or (3'), if the activity of FGFR decreases as a result of step (2) (for example, if the expression level of FGFR decreases, or if the degree of phosphorylation of FGFR decreases), then the activity of FGFR can be evaluated as having decreased. The control in step (2) may be cells from before step (2) was performed, or it may be cells or animals cultured or raised under similar conditions in the absence of the test substance (in other words, without using the test substance). Here, "absence of the test substance" may mean, for example, the presence of a substance different from the test substance that is known not to have a therapeutic or preventive effect on cardiac fibrosis or an effect on improving cardiac function.

[0056] Examples of test substances used in the present invention include cell extracts, cell culture supernatants, microbial fermentation products, extracts derived from marine organisms, plant extracts, purified proteins or crude proteins, peptides, non-peptide compounds, synthetic low molecular weight compounds, and natural compounds.

[0057] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0058] Materials and Methods <Cell Culture and Induction of Human Cardiac Organoids> Cell Differentiation; For ventricular differentiation, the hiPSC population (1390C1) was dissociated as follows: Dissociated into single cells and re-aggregated in StemPro-34 medium (ThermoFisher) to form EBs. These cells were cultured for 24 hours with L-glutamine (2 mM, Invitrogen), ascorbic acid (50 mg / ml, Sigma), transferrin (150 mg / ml, Wako), monothioglycerol (50 mg / ml, Sigma), ROCK inhibitor Y-27632 (10 μM, Wako), BMP4 (1 ng / ml, R&D), and 0.5% Matrigel (Corning). BMP-4 (final concentration 10 ng / mL, R&D), activin A (final concentration 6 ng / mL, R&D), and bFGF (final concentration 5 ng / mL, R&D) were added to the resulting EBs. On day 3, the culture medium was changed to one supplemented with IWP-3 (1 μM, Stemgent), Dorsomorphin (0.6 μM, Sigma), SB431542 (5.4 μM, Sigma), and VEGF (10 ng / mL, R&D) for 3 days. The cells were maintained in StemPro-34-based medium supplemented with VEGF until day 10. EB cells were cultured under hypoxic conditions (5% O2, 5% CO2, 37°C) for the first 10 days, and then under normal oxygen conditions (5% O2, 5% CO2, 37°C).

[0059] For epicardial differentiation, hiPSCs (1390C1-GFP) were used, and different concentrations of BMP4 (3 ng / ml) and Activin A (4 ng / ml) were varied from day 1 to day 4. On day 4, EB cells were dissociated into single cells and replicated on gelatin-coated plates. Retinol (2 μM, Sigma), BMP4 (10 ng / ml), SB431542 (6 μM, Sigma), and CHIR (1 μM, Sigma) were added for 2 days. From day 6 to day 8, the cells were cultured in StemPro-34 medium supplemented with SB431542. On day 8, the cells were isolated into single cells and cultured for 6 days in StemPro-34 medium supplemented with SB431542 (6 μM, Sigma).

[0060] Preparation of cardiac organoids: Epicardial cells (GFP+) derived from hiPSCs on day 14 and ventricular cardiomyocytes derived from hiPSCs on day 14 were dissociated into single cells and mixed in a 1:1 ratio. A total of 20,000 cells were mixed in a 1:1 ratio in 96-well polyhem-coated round-bottom plates. These aggregates were named cardiac organoids. These organoids were cultured for 10 days in a StemPro-34-based medium containing retinol. From day 10 onward, the organoids were cultured in mature medium (DMEM). The organoids were cultured for 11 days in maturation medium (DMEM containing low glucose (2 g / L) with palmitic acid (200 μM), dexamethasone (100 ng / ml, Sigma), T3 hormone (4 nM, Sigma), and GW7647 (PPARA agonist, 1 μM, Merck)), followed by a further 3 days in DMEM containing low glucose (2 g / L) with palmitic acid (200 μM) alone. To induce myocardial injury and fibrous changes, the matured organoids were cultured as follows: cultured in DMEM containing low glucose (2 g / L) supplemented with palmitic acid (200 μM); and cultured for 1 week under hypoxic conditions (O2, 5% CO2, 37°C) in DMEM supplemented with isoproterenol (100 μM, Sigma) and TGFB1 (3 ng / ml, Sigma). For compound therapy, organoids were treated with 5 μM AZD4547 (Selleck Chemicals, cat.No.S2801) dissolved in DMSO for 6 days during fibrosis stimulation.

[0061] <Dilated cardiomyopathy (tropomyosin 1 mutation) model mouse> We purchased FVB / N-Tg(Myh6-Tpm1*E54K)67Dfw / MskfJ from Jackson Laboratory.

[0062] <Enrichment Analysis> Biopsy transcriptome data from dilated cardiomyopathy (DCM) were compared to non-heart failure left ventricular samples (n=12) published in the NCBI Gene Expression Omnibus (GEO) database (GSE11625). The GSE11625 dataset is based on non-heart failure left ventricular heart samples obtained from organ donors at the University of Colorado Hospital, specifically from hearts unsuitable for transplantation. Donors had no significant cardiac history, and left ventricular echocardiography showed a systolic rate of ≥25%. Samples were processed with adapter sequencing (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA; SEQ ID NO: 1). Each sample generated approximately 48 million reads on average.

[0063] Counts generated by HTSeq-count were normalized using DESeq2. This normalization used a size factor derived from count data for all 58 DCM samples and 12 controls. Genes with a median read count of less than 10 in each sample, or genes with a correlation greater than 0.5 to the β-globin component of hemoglobin, were excluded. Outliers were identified based on the default Cook distance cutoff (95%). Gene expression normalization was performed using DESeq2's median ratio normalization method. Differentially expressed genes were identified using a 5% false-find threshold determined by the Benjamini-Hochberg method. Covariate adjustment was performed using a generalized linear model within DESeq2. Comprehensive analysis of detected genes was performed using principal component analysis (PCA) and unsupervised hierarchical clustering analysis. Clustering analysis used a combination of low-read variance stabilization transformation and Pearson correlation-based hierarchical clustering. PCA was performed in R using the DESeq2 function plotPCA, starting with variance stabilization transformation of read counts. Enrichment analysis of gene ontology (biological processes) was performed using the clusterProfiler package in R. Metascape (https: / / metascape.org / gp / index.html# / main / step1) was used to explore enriched pathways and gene ontologies within each module, and the analysis was performed using the latest version of the database last updated on May 1, 2023, with the H. sapiens Entrez gene ID. Weighted Gene Co-expression Network Analysis (WGCNA) was used in R to unsupervised cluster genes from the DCM sample cohort based on expression correlations. Using 25234 transcripts of DCM expression data after removing low counts, correlation matrices were constructed and transformed into topological overlap matrices using a directed network with the blockwiseModules function (parameters: power 3, SoftThreshold cutoff 0.90, minMuduleSize 100).Sixteen gene modules, comprising genes 105–9145, were identified. Clinical features were then associated with each of these modules, and Pearson correlations with module-specific genes were calculated using the moduleEigengenes function. For each module, pathway summarization and enrichment analysis were performed based on the latest database (as of May 1, 2023), and a summary of enrichment analysis using DisGeNET was also performed. Modules were specifically selected for enrichment of genes associated with DCM pathogenesis. Topological properties of DCM-related modules were calculated, and each network was exported to Cytoscape using the exportNetworkToCytoscape function of the WGCNA package. Hub genes with high connectivity within a module were identified using connectivity metrics within the module.

[0064] <Analysis using HALO AI> Quantitative fibrosis analysis detected by Elastica Masson staining was performed using the Area Quantification FL Algorithm in HALO, designed by Indica Laboratory. First, whole slide images (WSI) of slides stained with Elastica Masson were generated. AI-powered pathological evaluation was applied to the labeled WSI at a resolution of 2.0 μm / pixel using HALO software (version 3.5, Indica Laboratory). Tissue sections on the glass slides were divided, and fibrotic areas were identified using the HALO AI v3.5 deep convolutional network. The HALO classifier was trained using the DenseNetV2 model, and approximately 1000 images annotated with various regions such as "blank areas" and "fibrotic areas" were used as training input. The percentage of fibrosis was measured in the myocardial region (mm²). 2 ) fibrosis area (mm 2 This was determined as a relative proportion of ).

[0065] <RT-PCR> RT-PCR was performed using the Taqman probe method with the following probes (ThermoFisher). The probe names and probe IDs are shown below. TGFB1; Hs00998133_m1 FN1; Hs01549976_m1 TNC; Hs01115665_m1 COL1A1; Hs00164004_m1 FAP; Hs00990791_m1 POSTN; Hs01566750_m1 MMP2; Hs01548727_m1

[0066] <ELISA> MMP2 concentration was measured using a human MMP2 ELISA kit (Proteintech). The measurement was performed according to the specified procedure. 100 μL of sample and control group were added to the wells of a microplate. The microplate was sealed and incubated at 37°C for 2 hours. The sample was washed four times with washing buffer and then incubated with 100 μL of detection antibody solution at 37°C for 1 hour. The sample was washed again and incubated with 100 μL of streptavidin-HRP solution at 37°C for 40 minutes. The sample was washed again and 100 μL of TMB substrate solution was added, followed by 100 μL of stop solution to stop the reaction. The signal was measured with a microplate reader immediately after adding the stop solution.

[0067] <Immunostaining> Paraffin-embedded tissue sections were immunohistochemically stained using the conventional ABC method. After deparaffinization and antigen retrieval, endogenous peroxidase activity was inhibited with 0.3% H2O2 methanol solution for 30 minutes. Subsequently, the sections were washed with PBS and blocked with PBS containing 1% normal serum for 30 minutes. Primary antibodies at a 1:100 dilution against pFGFR1 (CST: #9740) and FGFR1 (abcam: ab59194) were applied and incubated overnight at 4°C. These sections were treated with biomolecular-derived secondary antibodies at a 1:100 dilution in PBS for 40 minutes. After several washes with PBS, avidin-biotin peroxidase complex (ABC-Elite, Vector Laboratories, Burlingame, CA) was applied at a 1:100 dilution in BSA for 50 minutes. Visualization was performed with DAB chromogenic agent, and the nuclei were counterstained with hematoxylin.

[0068] For in vitro immunohistochemical staining of cardiac organoids, whole-body immunostaining was performed using the SCALEVIEW-Trial Kit (Fujifilm). Cardiac organoids were fixed with 4% paraformaldehyde (PFA) and washed with PBS. Samples were acclimatized with Sca / eS0, then permeabilized with Sca / eS1-3, and washed again with PBS. Samples were blocked with 0.125% Triton-X and 1% Donkey serum and stained with primary antibody in AbSca / e solution for 24 hours. Samples were washed three times and stained with secondary antibody and DAPI for 24 hours. Samples were again fixed with 4% PFA, cleared with Sca / eS4 solution for 2 hours, and mounted with Sca / eS4 solution. The primary antibodies were as follows: anti-human cardiac TNT antibody (1:200, #MS-295-P, ThermoFisher), anti-fibronectin antibody (1:100, #ab2413, Abcam), and anti-GFP antibody (1:200, #ab6673, Abcam). The secondary antibodies were as follows: Alexa647-donkey anti-mouse antibody (1:500, #A31571, Invitrogen), Alexa546-donkey anti-rabbit antibody (1:500, #A10040, Invitrogen), and Alexa488-donkey anti-goat antibody (1:500, #A11055, Invitrogen).

[0069] <Sirius Red Staining> The tissue was stained using the standard Sirius Red staining method.

[0070] <Masson's Trichrome Staining> The tissue was stained using the standard Masson's trichrome staining method. The nuclei were stained with hematoxylin (purple), the cytoplasm with acid fuchsin (red), and collagen fibers with aniline blue (blue) to visualize the areas of fibrosis.

[0071] <In vitro analysis of FGFR inhibitors> Epicardial cells (GFP+) derived from hiPSCs on day 14 and ventricular cardiomyocytes derived from hiPSCs on day 14 were dissociated into single cells, and a total of 20,000 cells were mixed in a 1:1 ratio in a 96-well polyhem-coated round-bottom plate. These aggregates were called cardiac organoids. These organoids were cultured for 10 days in StemPro-34-based medium containing retinol (2 μM, Sigma). From day 10, the organoids were cultured for 11 days in a maturation medium (DMEM containing low glucose (2 g / L) supplemented with palmitic acid (200 μM, Sigma), dexamethasone (100 ng / ml, Sigma), T3 hormone (4 nM, Sigma), and GW7647 (PPARA agonist, 1 μM, Merck)), followed by a further 3 days of culture in DMEM containing low glucose (2 g / L) and palmitic acid (200 μM) alone to generate mature ventricular organoids. To induce cardiac injury and fibrotic changes, the mature organoids were supplemented with palmitic acid (200 μM), isoproterenol (100 μM, Sigma), and TGFB1 (3 ng / ml, Sigma) in DMEM containing low glucose (2 g / L) and cultured for 1 week under hypoxic conditions (5% oxygen, 5% carbon dioxide, 37°C). Simultaneously, from day 24 to day 31, the organoids were treated with AZD4547 (Selleck Chemicals, S2801) dissolved in DMSO at a final concentration of 5 μM.

[0072] <In vivo analysis of FGFR inhibitors> Osmotic pumps (Alzet, 200 μL, catalog number 2004) were used to administer angiotensin II (ANG II, A9525, Sigma-Aldrich, 1.5 μg / g / day) and phenylephrine HCl (PE, P6126, Sigma-Aldrich, 50 μg / g / day). These pumps were implanted in 8-10 week old C57BL / 6 mice, and continuous subcutaneous administration of ANG II / PE was performed for 35 days. The mice were randomly divided into three groups: a control group (n=5) that received pumps filled with physiological saline, a group that received pumps filled with ANG II / PE and oral administration of AZD4547 at 25 mg / kg per day (AngII / PE + AZD, n=5), and a group that received normal physiological saline (AngII / PE + NS, n=5).

[0073] <Measurement of Cardiac Function> Transthoracic echocardiography was used to evaluate cardiac function. Before imaging, animals were anesthetized with inhaled isoflurane (Abbott Japan, Japan) to maintain a heart rate within the range of approximately 400–550 beats / min during the procedure. Cardiac function parameters, including left ventricular end-diastolic and end-systolic dimensions (LVDd / LVDs) and left ventricular diameter shortening (FS), were measured. Left ventricular diameter shortening was calculated as FS = 100 x (LVDd - LVDs) / LVDd (%).

[0074] <scRNAseq Analysis> Cells isolated from mouse hearts were prepared according to the 10x Genomics protocol. Hearts were collected seven days after pump transplantation from three groups: a control group, an AngII / PE + AZD-treated group, and an AngII / PE + NS-treated group. The left ventricle (LV) was dissected, and the tissue was rapidly frozen in liquid nitrogen. The collected LV tissue was chopped into small pieces in a glass petri dish and then incubated in a fixation buffer containing 4% formaldehyde at 4°C for 16 hours. The fixed tissue was dissociated using Miltenyi Biotec's gentleMACS Dissociator according to the manufacturer's instructions. Probe hybridization was then performed using the Fixed RNA Mouse Transcriptome Probe Kit (10x Genomics). The cells were then processed using the 10x Genomics Chromium Next GEM Single Cell Fixed RNA Sample Preparation Kit. 10,000 cells per sample were loaded into Chip Q for GEM generation. Reverse transcription, barcoding, complementary DNA amplification, and library preparation were performed according to the protocols described in CG000527_Chromium_FixedRNAProfiling_MultiplexedSamples_UserGuide_Rev_E. Sequencing was performed on a NovaSeq 6000 platform (Illumina).

[0075] <Analysis of Intercellular Interactions> This was performed using CellRanger version 8.0.1 software (10x Genomics) and following the usage instructions provided by 10X Genomics.

[0076] <Statistical Analysis> Categorical variables were presented as numerical values ​​and proportions and compared using the chi-squared test or Fisher's exact test. Continuous variables were expressed as mean and standard deviation, or median and interquartile range, and comparisons of continuous variables were performed using randomized Student's t-test or Mann-Whitney U test, depending on the distribution. The significance level was determined with a 5% false discovery rate adjusted for multiple comparisons by the Benjamini-Hochberg method. Randomized raw data were subjected to agnostic clustering using PCA and unsupervised hierarchical methods. Clinical features associated with each gene cluster were confirmed through Pearson correlations. After one-way ANOVA, Tukey's multiple comparison method was used.

[0077] Example 1: Searching for gene groups showing a high correlation with myocardial tissue fibrosis By performing transcriptome analysis and weighted correlation network analysis using myocardial biopsy tissue, we succeeded in identifying gene modules and their hub genes (FSTL3, etc.) that are strongly associated with myocardial tissue fibrosis (Figure 1A, B). In addition, deep learning using HALO AI with myocardial biopsy tissue identified fibrotic regions in the tissue (Figure 2A). When the correlation between the percentage of fibrotic regions and the expression levels of fibrosis-related genes was analyzed, they showed a significant correlation (Figure 2B). When the degree to which the average expression level of each gene correlated with the percentage of fibrotic regions in the heart was visualized, the expression levels of MMP2 and FGFR1 showed a high correlation with myocardial tissue fibrosis (Figure 2C).

[0078] Example 2: Analysis of the mechanism of cardiac fibrosis using a cardiac fibrosis model To analyze the mechanism of cardiac fibrosis, a cardiac fibrosis model was created. First, cardiac organoids were induced from human iPS cells, and cardiac fibrosis was induced by continuously stimulating these organoids with hypoxia, isoproterenol, and TGFB1 (Figure 3A). It was confirmed that the fibrotic tissue of the cardiac organoids increased and the expression of fibronectin 1 (FN1) increased as a result of fibrosis induction (Figures 3B, C).

[0079] In a cardiac fibrosis model, genetic analysis of FSTL3 and MMP2, identified in Example 1, revealed that these genes were expressed more rapidly in fibrotic cardiac organoids compared to normal cardiac organoids (Figure 4A). It was also confirmed that the expression levels of FSTL3 and MMP2 increased in a TGFB1 concentration (i.e., the intensity of the fibrosis-inducing stimulus) (Figure 4B), and that MMP2 expression was elevated at the protein level in fibrotic cardiac organoids compared to normal cardiac organoids (Figure 4C). Furthermore, the relationship between the degree of fibrosis progression and FGFR1 activity was investigated in myocardial biopsy tissue. The results showed that FGFR1 expression and phosphorylation were enhanced in tissues with advanced fibrosis (Figures 5A, B).

[0080] Example 3: Verification of the effect of FGFR inhibitors on suppressing cardiac fibrosis Based on the above, a relationship between cardiac fibrosis and FGFR activation was demonstrated. Next, we investigated whether cardiac fibrosis could be suppressed by FGFR inhibitors. When AZD4547, an FGFR inhibitor, was administered to a cardiac fibrosis model, the expression of fibrosis-related genes was suppressed (Figure 5C), and FN1 protein levels decreased (Figure 5D), indicating that cardiac fibrosis in the cardiac fibrosis model was suppressed (Figure 5E).

[0081] Next, the effect of the FGFR inhibitor (AZD4547) was evaluated in mice in which cardiac fibrosis was induced by phenylephrine-angiotensin II (PE / AngII) administration (cardiac fibrosis model mice). A schematic diagram of the experimental method is shown in Figure 5A. In mice with induced cardiac fibrosis, simultaneous administration of AZD4547 suppressed the increase in LVDd (left ventricular end-diastolic diameter) and LVDs (left ventricular end-systolic diameter) (Figure 6B), and improved cardiac contractility (Figure 6C). In other words, AZD4547 was shown to exert an effect of improving cardiac function in vivo. Furthermore, in mice with induced cardiac fibrosis, simultaneous administration of AZD4547 was shown to significantly suppress cardiac fibrosis (Figures 6D, E).

[0082] We investigated whether a similar inhibitory effect on cardiac fibrosis could be observed using PD166866, a selective FGFR1 inhibitor. Treatment of a cardiac fibrosis model with PD166866 significantly downregulated fibrosis-related genes (TGFβ1, FN1, TNC, COL1A1, FAP, and POSTN) and the identified biomarker MMP2 (Figure 7). These results suggest that selective FGFR1 inhibition is effective in suppressing cardiac fibrosis, similar to AZD4547, and that FGFR1 inhibitors in general may be effective in treating cardiac fibrosis.

[0083] Example 4: Exploring a Novel Mechanism for Improving Cardiac Function by FGFR Inhibition To explore a novel mechanism for improving cardiac function by FGFR inhibition, single-cell RNA sequencing (scRNAseq) analysis was performed on the hearts of cardiac vascularization model mice treated with AZD4547. Quality control measures ensured that cells were properly integrated and dispersed within clusters (Figure 8A). Analysis of total transcripts per cell and identification of potential doublets confirmed the high quality and successful integration of both datasets (Figure 9B,C).

[0084] Using established cell type-specific genetic markers, seven major cell types were annotated: cardiomyocytes (CM, 3 clusters), endothelial cells (EC, 7 clusters), fibroblasts (FB, 2 clusters), pericytes (PC, 1 cluster), smooth muscle cells (SM, 1 cluster), and immune cells (lymphocytes (LC, 4 clusters) and macrophages (Macro, 3 clusters)) (Figures 8A, 9D). Three clusters expressed established markers but also co-expressed markers for other cell types. These clusters were annotated as EC-FB (endothelial-fibroblast-like cluster), CM-FB (cardiomyocyte-fibroblast-like cluster), and CM-Peri (cardiomyocyte-pericyte-like cluster). Two clusters (lowQC-CM1, lowQC-CM2, i.e., clusters 8 and 12) were classified as low-quality due to their very high transcription levels and were excluded from downstream analysis.

[0085] To clarify the effects of AZD treatment on fibroblasts, detailed subclustering analysis was performed, and eight distinct clusters were identified (Figure 8B). In mice exposed to PE / AngII, the proportion of clusters 5 and 6 increased regardless of whether or not AZD treatment was performed (Figure 8C). Of the eight subclusters, clusters 5 and 6 showed high expression of Postn, indicating a high proportion of activated fibroblasts (Figure 10A). Fibrosis-related genes such as Col1a1, Col1a2, and Mmp2 were significantly increased in untreated AngII / PE-exposed hearts compared to control hearts, and significantly decreased in AZD-treated AngII / PE-exposed hearts compared to untreated AngII / PE-exposed hearts (Figure 8D). These results suggest that exposure to AngII / PE induces cardiac fibrosis through the recruitment of activated fibroblasts, and that AZD treatment exerts an anti-fibrotic effect by reducing the expression of fibrosis-related genes.

[0086] Furthermore, to understand the effects of AZD treatment on cardiomyocytes, detailed subclustering analysis was performed, yielding nine distinct clusters (Figure 8E). In mice exposed to PE / AngII, the proportion of cluster 5 increased regardless of whether or not AZD treatment was performed (Figure 8F). Of the nine subclusters, cluster 5 showed high expression of Myh7 and Ankrd1, indicating a myocardial stress response (Figure 8E, Figure 9B). In contrast, cluster 2 showed high expression of cardiomyocyte proteins such as Myl2 and Tnni3, and since it comprised the majority of the control heart population, it is suggested to represent a normal cardiomyocyte population. In particular, the cardiomyocytes of AZD-treated AngII / PE-exposed hearts had a higher proportion of cluster 2 than untreated hearts. These results suggest that AZD treatment provides a protective effect on cardiomyocytes in terms of gene expression.

[0087] Next, we evaluated intercellular communication between cell types, particularly between cardiomyocytes, fibroblasts, and endothelial cells. We utilized CellChat24, a bioinformatics tool, to infer intercellular communication networks and enable extensive data exploration, analysis, and visualization. CellChat analysis revealed significant changes in cell interactions in AngII / PE-exposed hearts treated with AZD compared to untreated hearts. Overall, the number and intensity of inferred interactions decreased (Figure 8G). Specifically, reduced interactions within the FGF signaling pathway network between cardiomyocytes and fibroblasts were observed in AZD-treated hearts (Figure 8H, Figure 11). Based on the overall information flow differences within the inferred network between AZD and NS (normal saline solution) treatment, we ranked all important signaling pathways (Figure 8I). Interestingly, NPR1 signaling interactions increased in both cardiomyocytes and fibroblasts (Figure 8J). This increase was particularly pronounced within the NPR1 signaling pathway network, known to maintain cardiac function and provide cardioprotection, especially between cardiomyocytes and endothelial cells in AZD-treated hearts. Figure 8k shows the expression patterns of Nppa, Nppb, and Npr1 in each cell type. Furthermore, downregulation of Fgf1-Fgfr1 signaling from cardiomyocytes to macrophages was observed in hearts treated with AZD4547 (Figure 12). These results demonstrate the direct efficacy of FGFR1 inhibition in specific cell types, such as cardiomyocytes and fibroblasts.

[0088] Example 5: Verification of the therapeutic effect of AZD4547 on a dilated cardiomyopathy model mouse. The dilated cardiomyopathy (tropomyosin 1 mutation) mice used in this example already showed cardiac dysfunction at 4 weeks of age, and cardiac function further deteriorated between 4 and 6 weeks of age. While the cardiac contractility function of normal mice (wild-type mice) was FS=50-60%, in dilated cardiomyopathy mice, cardiac contractility decreased to approximately FS=40% at 4 weeks of age and to approximately FS=25% at 6 weeks of age. In this model mouse, AZD4547 (25 mg / kg, once a day) was administered orally between 4 and 6 weeks of age, and cardiac function was evaluated by echocardiography and tissue staining at 6 weeks of age.

[0089] As a result, a significant suppression of cardiac function decline was observed on echocardiography in the AZD-treated group (Figure 13B). Furthermore, maintenance of wall thickness and muscle structure was observed on cardiac tissue staining (Figure 13C). At 6 weeks of age, no clear cardiac fibrosis changes were observed in the untreated group, suggesting that the therapeutic effect of AZD is due to its direct myocardial protective effect rather than its suppression of cardiac fibrosis.

[0090] According to the present invention, a method for suppressing cardiac fibrosis and a method for improving cardiac function through the suppression of fibrosis can be provided, and it is expected that the patient's prognosis and quality of life will be improved by the improvement of cardiac function. Furthermore, a screening method for novel pharmaceuticals that can treat or prevent cardiac fibrosis can also be provided.

[0091] This application is based on Japanese Patent Application No. 2024-180369 (filing date: October 15, 2024), the contents of which are fully incorporated herein.

Claims

1. Cardiac function improving agents, including fibroblast growth factor receptor (FGFR) inhibitors.

2. The agent according to claim 1 for improving the contraction or diastolic function of the heart.

3. The agent according to claim 1 or 2 for the treatment or prevention of cardiac fibrosis.

4. The agent according to claim 3, wherein the cardiac fibrosis is non-ischemic cardiac fibrosis.

5. An agent according to any one of claims 1 to 4 for the treatment or prevention of dilated cardiomyopathy.

6. The agent according to claim 5, wherein dilated cardiomyopathy is hereditary.

7. An agent according to any one of claims 1 to 6 for activating the NPR1 signaling pathway between cardiomyocytes and endothelial cells.

8. The agent according to any one of claims 1 to 7, wherein the FGFR inhibitor has inhibitory activity against at least FGFR1.

9. The agent according to any one of claims 1 to 8, wherein the FGFR inhibitor is an inhibitor of an FGFR-specific receptor kinase.

10. The agent according to any one of claims 1 to 9, wherein at least one of the FGFR inhibitors is AZD4547 or PD166866.

11. The agent according to any one of claims 1 to 10, wherein at least one of the FGFR inhibitors is AZD4547.

12. A method for screening for cardiac function improving drugs, comprising: (1) a step of bringing cells into contact with a test substance; (2) a step of measuring the activity of fibroblast growth factor receptor (FGFR) in the cells; and (3) a step of selecting the test substance as a candidate substance for cardiac function improving drug if the activity of FGFR in the cells decreases upon contact with the test substance.

13. The method according to claim 12, wherein the step of measuring the activity of FGFR in step (2) includes a step of measuring the expression level of FGFR and / or the degree of phosphorylation of FGFR.

14. The method according to claim 12 or 13, wherein the cardiac function improving agent is a cardiac contraction or diastolic function improving agent.

15. The method according to any one of claims 12 to 14, wherein the cells are cardiac organoids or cells constituting the heart.