Directed evolution of AAV9 for efficient gene expression in cardiomyocytes

Optimized AAV9 capsid variants with specific peptide insertions improve transduction and gene expression in cardiomyocytes, addressing efficiency limitations of existing AAV9 vectors and streamlining preclinical cardiac gene therapy.

WO2026084593A1PCT designated stage Publication Date: 2026-04-23STICHTING AMSTERDAM UMC +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/NL2025/050519
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-16
Filing Date
2025-10-16
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Existing AAV9 vectors exhibit low transduction efficiency in neonatal rat ventricular cardiomyocytes (NRVCMs) and human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs), limiting their effectiveness in preclinical in vitro studies, and there is a need for improved specificity and efficiency in gene transfer to cardiomyocytes.

Method used

Development of AAV9-based viral particles with variant capsid proteins containing specific peptide insertions in variable regions, optimized for cardiomyocyte transduction, using a directed evolution approach that enhances both in vitro and in vivo gene expression in cardiomyocytes.

Benefits of technology

The optimized AAV9 variants demonstrate significantly higher transduction and gene expression efficiency in cardiomyocytes compared to wild-type AAV9, predicting high in vivo transduction efficiency and reducing the need for multiple AAV serotypes in preclinical studies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000048_0000
    Figure 00000048_0000
  • Figure 00000048_0001
    Figure 00000048_0001
  • Figure 00000049_0000
    Figure 00000049_0000
Patent Text Reader

Abstract

The invention relates to an adenovirus associated virus 9 (AAV9)-based viral particle, for use in a method of treatment of a heart disease, whereby said viral particle is administered to the heart. The invention further relates to a pharmaceutical composition comprising the AAV9-based viral particle, and to methods of producing the AAV9-based viral particle.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] P137875PC00 Title: Directed evolution of AAV9 for efficient gene expression in cardiomyocytes FIELD The invention relates to the field of in vivo gene therapy and more specifically, gene therapy for treatment of a cardiomyopathy or arrhythmia via an adeno-associated virus. INTRODUCTION Adeno-associated viral (AAV) vectors are well-established tools for gene delivery, and so far, seven AAV-based gene therapies were clinically approved by the FDA or EMA to treat monogenic disorders (Kok et al., 2023. Mol Ther Methods Clin Dev 30: 459-473; Issa et al., 2023. Cells 12: 785). However, the broad application of AAVs is still limited by known challenges such as immunity due to high levels of neutralizing antibodies, species-dependent differences regarding the efficiency, and low organ specificity potentially resulting in dose-dependent toxicity when applied in vivo (Asokan et al., 2012. Front Physiol 10: 168). Cardiac gene transfer in small and large animal models is efficient with AAV9 vectors in particular for gene transfer into cardiomyocytes. However, limitations of AAV9 vectors are low transduction efficiencies in neonatal rat ventricular cardiomyocytes (NRVCMs) and human induced pluripotent stem cell- derived cardiomyocytes (hiPSC-CMs) (Lovric et al., 2012. Mol Ther 20: 2087-97; Ambrosi et al., 2019. Front Physiol 10: 168). Thus, preclinical in vitro studies frequently rely on the application of AAV6 vectors (Neuber et al., 2014. J Pharmacol Exp Ther 349: 39-46; Remes et al., 2019. Basic Res Cardiol 116: 38). The issue of efficiency and specificity has been addressed by many groups in recent years using different methods to generate recombinant AAV capsids with novel features. These methods include rational design (such as domain swapping, generation of capsid chimeras, peptide or protein insertions, and others; further reviewed in Pupo et al., 2022. Mol Ther 30: 3515-3541) as well as directed evolution approaches. To accomplish the latter, large libraries of randomized capsids are created, for example, by using error-prone PCRs (Perabo et al., 2006. J Gene Med 8: 155-62), DNA family shuffling of various AAV wild-type capsid domains (Grimm et al., 2008. J Virol 82: 5887-911, Li et al., 2008. Mol Ther 16: 1252–1260), or by displaying random peptide sequences on the AAV capsids surface (Müller et al., 2003. Nat Biotechnol 21: 1040-6; Perabo et al., 2003. Mol Ther 8: 151-7). These libraries are then selected through multiple rounds based on their ability to target distinct cell types, tissues, or their ability to evade neutralizing antibodies. Such directed evolution approaches have resulted in various prominent AAV capsid variants with selected benefits. AAV2-ESGHGYF selectively expresses in the murine lung after selecting a peptide library in vivo (Körbelin et al., 2016. Mol Ther 24: 1050-1061). The shuffled capsid AAV-DJ exhibits strong liver tropism being found in selections on human hepatocytes (Grimm et al., 2008. J Virol 82: 5887-911). AAV-PHP.B is capable to penetrate the blood-brain barrier and transduces astrocytes and neurons in the murine central nervous system (Deverman et al., 2016. Nat Biotechnol 34: 204-9). Further novel capsid variants have been reported and reviewed elsewhere (Büning and Srivastava, 2019. Mol Ther Methods Clin Dev 12: 248–265; Becker et al., 2022. Pathogens 11: 756). In the early stages of AAV capsid library screening, selections were performed using helper virus co-infection. Later, the focus shifted to selecting AAV capsid variants based on their ability to transduce cells using PCR amplification of vector genomes (Becker et al., 2022. Pathogens 11: 756). However, the efficacy of the AAV capsid depends not only on high cellular uptake through targeting specific receptors, but also on efficient intracellular trafficking to the nucleus and capsid uncoating (Büning and Srivastava, 2019. Mol Ther Methods Clin Dev 12: 248–265; Rossi et al., 2019. Sci Rep 9: 3631; Szumska and Grimm 2023. Cytotherapy 25: 254- 260). The development of RNA-based selection systems such as TRACER (Nonnenmacher et al., 2020. Mol Ther Methods Clin Dev 20: 366-378) and DELIVER (Tabebordbar et al., 2021.Cell 184: 4919-4938) has allowed for a greater emphasis on the expression of transgenes in AAV capsid engineering. However, there remains a need to obtain AAV-based viral particles that are well suited for the in vitro and in vivo transduction of cardiomyocytes, including NRVCMs and hiPSC-CMs. BRIEF DESCRIPTION OF THE INVENTION In this study, we aimed to systematically compare the directed evolution on the transduction and gene expression levels by performing separated DNA and RNA selections. To do this, we generated an AAV9 random peptide library and selected it on NRVCMs as the most frequently used preclinical cardiac cell culture model. AAV9 has been shown to mediate the strongest transgene expression in the murine heart after intravenous delivery compared to the other naturally occurring serotypes (Inagaki et al., 2006. Mol Ther 14: 45-53; Zincarelli et al., 2008. Mol Ther 16: 1073-80; Asokan et al., 2013. Mol Ther 20: 699-708). However, its efficiency in vitro is low (Ambrosi et al., 2019. Front Physiol 10: 168). Therefore, we chose AAV9 as library scaffold to obtain capsid variants with improved in vitro gene transfer capability. The invention provides an adenovirus associated virus 9 (AAV9)-based viral particle, said viral particle comprising in its genome an expression cassette for transduction of a coding sequence of a gene of interest into a cardiomyocyte, said AAV9-based viral particle comprising a variant capsid protein comprising an insertion of 1-10 amino acid residues, preferably 6-8 amino acid residues, in one or more variable regions selected from VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, and VR-VII. In embodiments, said variant capsid protein comprises an insertion of AERYTKY, NRVAVRP, PDRFGRP and / or RGDFRAS in one or more of VR-I, VR- II, VR-III, VR-IV, VR-V, VR-VI, and / or VR-VII. In embodiments, said variant capsid protein comprises an insertion of AERYTKY, NRVAVRP, PDRFGRP, RGDFRAS, or a combination thereof in two or more variable regions selected from VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, and VR-VII, preferably VR-II and VR-VI, whereby only one of the indicated peptides is inserted in each variable region. In embodiments, said variant capsid protein comprises an insertion of AERYTKY, NRVAVRP, PDRFGRP, or RGDFRAS in VR-VI. The invention further provides an AAV9-based viral particle according to the invention, for use in a method of treatment of a heart disease, preferably whereby said viral particle is locally administered to the heart. In embodiments, said viral particle is injected or infused into the myocardium, into a coronary artery, into the coronary venous system, or a combination thereof. In embodiments, said AAV9- based viral particle is administered by direct intramyocardial injection. In embodiments, the expression cassette of an AAV9-based viral particle according to the invention comprises a promoter sequence, a transcribed region and, optionally, a 3' untranslated region and / or one or more posttranscriptional regulatory elements. In embodiments, expression cassette is optimized for expression in human cardiomyocytes. In embodiments, the said expression cassette comprises a cardiomyocyte-specific promoter, such as a cardiac troponin C promoter, a cardiac troponin I promoter, a cardiac troponin T2 (TNNT2) promoter, a cardiomyocyte-specific Na(+)-Ca(2+) exchange promoter such as NCX1, or a cardiac myosin light chain 2 promoter. The invention further provides a pharmaceutical composition, comprising the AAV9-based viral particle according to the invention, and a pharmacologically acceptable excipient. In embodiments, the pharmaceutical composition is for use in a method of treatment of an individual suffering from a heart disease. The invention further provides a method of producing an AAV9-based viral particle according to the invention, the method comprising a) transfecting a producer cell line with a transfer plasmid, comprising at least an AAV-based genome comprising an expression cassette that is flanked on both sides by ITR sequences, whereby said producer cell line expresses AAV9-based rep and cap open reading frames, and adenovirus E4, E2A and, preferably E1A proteins and adenovirus viral-associated (VA) RNA; b) culturing said transfected producer cell, whereby the producer cell produces said AAV9-based viral particle; and c) harvesting said AAV9-based viral particle and, optionally, purifying said AAV9- based viral particle. In embodiments, the adenovirus E4, E2A and, preferably E1A proteins, and adenovirus viral-associated (VA) RNA, are provided by a second plasmid. In embodiments, the producer cell is an eukaryotic cell, preferably a mammalian cell such as a human cell. FIGURE LEGENDS Figure 1: Selection of AAV9 peptide libraries on the DNA and RNA levels results in enrichment of distinct variants. (A) The AAV9 peptide library was initially selected on neonatal rat ventricular cardiomyocytes (NRVCMs) in three rounds. After a first round of DNA selection and subcloning of the heptapeptide insertion fragment, the DNA and RNA of the second round were separately used to create secondary AAV9 libraries for the third rounds of selection. (B) Next, gDNAs and cDNAs were analyzed using next generation sequencing (NGS), and the top 50 motifs from each selection are presented based on their total number of reads as percentage. (C) The relative proportions of the top 20 motifs at the DNA-selected gDNA level and RNA-selected cDNA level are shown in the pie charts. All top 10 motifs are listed in Table 2. Figure 2: Parallel characterization of newly identified capsid variants at the levels of transduction and gene expression using NGS of barcoded libraries. (A) The best ten capsids from each level of selection were individually produced as AAV9 variants carrying a CMV promoter-driven eYFP reporter and a unique barcode(BC) in the 3’-untranslated region. After pooling various variants in equalamounts, these barcoded AAV libraries were used to infect neonatal rat ventricular cardiomyocytes (NRVCMs) at an MOI of 1×105. Three days after infection, DNA and RNA was isolated, the frequency of individual barcodes was determined using NGS, normalized for differences in abundance in the input library, and presented as transduction (B, white) and expression efficiency (C, gray), for each variant. AAV capsid variants identified in the DNA and RNA selection are underlined in black and gray, respectively. The data represent individual data points from three technical replicates with SD using the same barcoded AAV library. Figure 3: Characterization of individual AAV capsid variants in vitro. (A) The AAV capsids that demonstrated the highest potential in terms of improved transduction and / or expression efficiency in the validation of barcoded variants were individually examined. These capsids were used to infect neonatal rat ventricular cardiomyocytes (NRVCMs) with an MOI of 1×104. Three days after infection, the number of eYFP positive cells was measured using flow cytometry (dark gray), and the mean fluorescent intensity (MFI, light gray) per well was calculated. The values are expressed as the average with SD (n = 3, in technical duplicates), and MFI is depicted relative to AAV6 wild-type. A one-way ANOVA was conducted to determine statistical significance in comparison to AAV6 wild- type. (B) The expression efficiency of AAV9-AERYTKY was directly compared toAAV6 wild-type using immunofluorescent staining with DAPI, α-actinin, andeYFP, as indicated. Shown are representative images from n = 3. Scale bars are 100 µm. (C) In addition, the expression of AAV9-AERYTKY was compared side-by- side with AAV9-RGDLGLS, a benchmark AAV9 capsid variant for targeting cardiac tissue in vivo (Weinmann et al., 2020. Nat Commun 11: 5432). The data presents means with SD (n = 4 in technical duplicates, AAVs from two independent productions). A one-way ANOVA was conducted to determine statistical significance in comparison to AAV9-AERYTKY. Figure 4: Parallel evaluation of the expression efficiencies of newly selected capsids in vivo. All selected and produced capsids were combined into a barcoded AAV library. Which also included various AAV wild-types and known benchmark motifs from literature. This barcoded library was injected systemically in the tail vein of male C57BL / 6N mice (5×1011viral genomes per mouse), and tissues were harvested after two weeks. DNA and RNA were isolated, analyzed via NGS to determine the number of reads of the barcoded region, which was normalized to the abundance in the input library and to the total viral genomes per diploid genomes. The relative expression efficiencies of the top ten AAV capsids per tissue are depicted individually. The means with SD are shown (n = 2). Figure 5: Comparison of AAV9-AERYTKY with AAV9 wild-type in vivo. Expression efficiencies of AAV9-AERYTKY and AAV9 wild-type were compared individually in mice in vivo. AAV vectors were systemically applied into female FVB mice (2.5×1011viral genomes per mouse) using retro-orbital injections and tissues were harvested after three weeks. (A) DNA was isolated to determine the biodistribution by monitoring the total viral genomes per diploid genomes. The means with SD are shown (n = 3). (B) RNA was isolated to detect eYFP mRNA levels in the indicated organs. The values are normalized to ribosomal protein L32 (RPL32) and depicted relative to AAV9 wild-type. AAV9-AERYTKY is highlighted in green. An unpaired two-tailed t-test was performed to determine statistical significance. Figure 6: Evaluation of selected AAV capsid variants on human engineered heart tissue. The AAV capsids that showed the highest expression efficiency in vitro were tested for their ability to transduce hEHTs. The hEHTs were infected with an MOI of 2.5×104(AAV9 wild-type and variants) or 2.5×103(#, AAV6 wild-type). (A) After seven days, the EHTs were imaged (representative images, scale bars indicate 200 µm) and (B) the eYFP intensities were determined. (C) In addition, the contractile force was evaluated before the infection and after seven days. Values are shown as average with SD (n = 3). A one-way ANOVA was performed to determine statistical significance in comparison to AAV9 wild-type. Figure 7. Overview of promoter constructs. Abbreviations: CE1: CASQ2 enhancer; CE2; TNNT2enhancer; CCP: NPPAcore; ME1: ACTA1 enhancer; UE: CMVfr3; UCP: SCP3; SMP (full promoter): SPC5-12; TNNT2 (small promoter piece): TNNT2core; TNNT2 (full promoter): TNNT2ddd (full promoter with ~200bp (189 bp) deleted from the end and middle i.e., a length optimized TNNT2). Figure 8. Fold induction of the individual constructs when compared to the standard TNNT2 promoter in neonatal rat ventricular cardiomyocytes (NRVMs; A), C2C12 cells (B), HepG2 cells (C), and HEK293 cells (D). Figure 9. Library based screening of variants in pig. (A) Brightfield image of an explanted pig heart (B) Direct fluorescence from the explanted heart 2 weeks after injection and infusion, with direct fluorescence signal visible at the intramyocardial injection site (IM) and the intracoronary infusion site (IC). IM and IC regions were identified base on location of a suture placed during open chest surgery. (C) Input normalized DNA reads from the injection site. (D) Input normalized RNA reads from the injection site. (E) Input normalized DNA reads from the infusion site. (F) Extrapolated RNA reads from the infusion site. Figure 10: Transduction and transcriptional repression in hiPSC-CM. (A) Normalized read counts of different AAV serotypes following barcoded library transduction. (B) Cas9 / HPRT relative expression following transduction with AAV6 and AAV9-RGDF. (C) TNNI1 / HPRT relative expression following transduction with AAV6 and AAV9-RGDF containing dCas9-KRAB and a guide-RNA targeting TNNI1 or a scrambled control guide-RNA. DETAILED DESCRIPTION OF THE INVENTION Definitions As are used herein, the singular forms "a", "an" and "the", include the plural forms as well. As is used herein, the term "or" includes any and all combinations of one or more of the associated listed items, unless the context clearly indicates otherwise. As are used herein, the terms "comprise" and "comprising", and conjugations thereof, are open language and specify the presence of stated features but do not preclude the presence or addition of one or more other features. It will be understood that when a particular step of a method is referred to as subsequent to another step, it can directly follow said other step, or one or more intermediate steps may be carried out before carrying out the particular step, unless specified otherwise. As is used herein, the term “cardiomyocyte (CM)”, refers to a muscle cell ofthe heart (e.g., a cardiac muscle cell). The term cardiomyocyte includes any cell in the cardiac myocyte lineage that shows at least one phenotypic characteristic of a cardiac muscle cell. Said phenotypic characteristic may include expression of one or more cardiac proteins, such as cardiac sarcomeric or myofibrillar proteins or atrial natriuretic factor, or one or more electrophysiological characteristics. Cardiomyocyte-specific markers include, but are not limited to, cardiac troponin I (P19429), cardiac troponin-C (P63316), tropomyosin (P09493), caveolin-3 (P56539), GATA-4 (P43694), myosin heavy chain (P12883), myosin light chain-2a (Q01449), myosin light chain-2v (P10916), ryanodine receptor (Q92736), and atrial natriuretic factor (P01160), with the UniProt accession number indicated in between brackets. As is used herein, the term “identity”, as is used in sequence identity, refersto the overall identity between two or more nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between two or more proteins. Calculation of the percent identity of two nucleic acid sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequence for optimal alignment). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which may be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. Suitable tools for global alignment techniques include the Needleman–Wunsch algorithm (Needleman and Wunsch, 1970. J Mol Biol 48: 443-453, and Fast Optimal Global Sequence Alignment Algorithm (Chakraborty and Bandyopadhyay, 2013. Scientific Reports 3: 1746).As is used herein, the terms “transfecting” and “transfection” refer to theprocess of introduction of a nucleic acid molecule, such as a DNA molecule, into a cell, preferably an eukaryotic cell such as a cardiomyocyte. The term "transfection" encompasses methods known to the person skilled in the art for introducing nucleic acid molecules into cells, for example, electroporation, lipofection, e.g., cationic lipid-and / or liposome-based, calcium phosphate precipitation, nanoparticle-based transfection, and transfection based on cationic polymers such as DEAE-dextran or polyethyleneimine, and the like. As is used herein, the terms “transducing” and “transduction” refer to aprocess of introduction of a nucleic acid molecule, such as a DNA molecule, into a cell, preferably a eukaryotic cell such as a cardiomyocyte, which is mediated by use of a viral vector. Such a viral vector may be a lentiviral vector, adenoviral vector, adeno-associated virus vector, retroviral vector, or any combination thereof. A preferred vector is an adeno-associated virus vector. As is used herein, the term “recombinant AAV (rAAV) vector construct” refersto a vector comprising an expression cassette that is flanked on both sites by inverted terminal repeat (ITR) sequences of about 145 bases each. A single ITRcomprises palindromic arms (A-A’, B-B’, and C-C’) that provide its characteristic T-shape feature. Additionally, the ITR contains a 4-nucleotide Rep binding element (RBE) that serves as a binding site for Rep78 and Rep68 to initiate replication and a terminal resolution site that serves as the target site for Rep proteins (Savvy et al., 2013. Hum Gene Ther Methods 28: 277–289). As is used herein, the term “expression cassette” refers to a nucleic acidmolecule that provides expression of a nucleotide sequence comprising a coding sequence for a therapeutic protein, which nucleotide sequence is present in said construct. An expression cassette preferably comprises a promoter sequence, a transcribed region of a gene of interest that encodes a therapeutic protein, and, optionally, a 3' untranslated region and / or one or more posttranscriptional regulatory elements such as a polyadenylation signal. The promoter is coupled to the transcribed region that encodes a therapeutic protein. In some embodiments, the polyadenylation signal is a synthetic minimal polyadenylation signal. An expression cassette may further comprise enhancer sequences, that stimulate the expression of a therapeutic protein in certain tissues or at certain stages of development. As is used herein, the term “posttranscriptional element”, abbreviated as“PRE”, refers to a virus-derived sequence, which may enhance gene expression,especially intronless gene expression such as heterologous intronless gene expression (Powell et all., 2015. Discov Med 19: 49-57). Said PRE may be located downstream of a gene of interest sequence and proximal to a polyadenylation signal. PREs may play a role in mRNA stability, nuclear export and enhancement of gene expression. As is used herein, the term “promoter” refers to a genetic element thatenables initiation of transcription of the transcribed region and is therefore a primary point of control for expression of a therapeutic protein in the heart. Said promoter preferably is a cardiomyocyte-specific promoter, such as a cardiac troponin C promoter, cardiac troponin I promoter, a cardiac troponin T2 (TNNT2) promoter (Wu et al., 2010. Genesis 48: 63-72), especially a TNNT2ddd promoter, a cardiomyocyte-specific Na(+)-Ca(2+) exchange promoter such as NCX1 (Agostini et al., 2013. Biomed Res Int 2013: 845816), a cardiac myosin light chain 2 promoter (Griscelli et al., 1997. Comptes Rendus Acad Sci III 320: 103-112), a MYH6 promoter, an ACTA1 promoter, a synthetic promotor such as a SPC5-12 promoter (US patent application 2004 / 017572), a MHCK7 promoter (Salva et al., 2007. Mol Ther 15: 320-329), a DES promoter (Pacak et al., 2008. Genetic Vaccines Ther 6: 13) or fragments of said promoters, or a core promoter from cardiac genes such as TNNT2 or NPPA, coupled to cardiac-specific regulatory elements, such as regions of aforementioned promoters or for example a CASQ2 regulatory element (Rincon et al., 2015. Mol Ther 23: 43–52), or a PRKAA2 regulatory element (Anderson et al., 2017. Development 44: 1235-1241). In embodiments, said promoter is a non- cardiomyocyte-specific promoter, such as a cytomegalovirus (CMV) promoter, aCMV early enhancer / chicken β actin (CAG) promoter, a short variant of CMV earlyenhancer / chicken β actin (sCAG) promoter, a chicken β actin (CBA) promoter, a p5promoter, a mouse PGK promoter (mPGK). Said promoter preferably is optimized for expression in human, preferably in a human cardiomyocyte. As is used herein, the term “AAV-based viral particle”, also termed“recombinant AAV-based viral particle” refers to an AAV viral particle or viral-like particle that comprises a genomic, single stranded DNA molecule comprising an expression cassette that is flanked on both sites by inverted terminal repeat (ITR) sequences of about 145 bases each, which genomic DNA molecule is encapsidated by VP1, VP2 and VP3 proteins in an approximate 1:1:10 ratio (VP1:VP2:VP3). Said AAV-based viral particle is infectious and may transduce a cell. Said AAV-based viral particle may comprise VP1, VP2 and VP3 proteins from AAV9, or variant AAV9 VP1, VP2 and VP3 proteins. In embodiments, an AAV-based viral particle may comprise chimeric VP1, VP2 and VP3 proteins from different AAV species. As is used herein, the term “AAV9-based viral particle” refers to an AAV-based viral particle comprising a genomic, single stranded DNA molecule comprising an expression cassette that is flanked on both sites by AAV9 inverted terminal repeat (ITR) sequences and of which genomic DNA molecule is encapsidated by AAV9 VP1, VP2 and VP3 proteins. In embodiments, an AAV9- based viral particle is encapsidated by AAV9 VP1, VP2 and VP3 proteins, but comprises AAV9-AERYTKY, AAV9-NRVAVRP, AAV9-PDRFGRP, and / or AAV9- RGDFRAS, in which the consecutive amino acid residues AQ at position 589 and 590 of UniProt accession number Q6JC40, indicated in bold in the VP1 amino acid sequence of AAV9 herein below, are interrupted by the indicated insertion encoding said heptapeptides. As is used herein, the term “gene of interest” refers to a gene that is suitablefor local treatment of arrhythmias such as SCN10A-short, also designated as S10s; the skeletal muscle sodium channel sodium voltage-gated channel alpha subunit 4 (SkM1); gap junction protein alpha 1 (GJA1, encoding connexin 43 (Cx43), or a fragment thereof, e.g., GJA1-20k (Palatinus et al., 2023. Circulation Res 132:744– 746); GJA5, encoding for Cx40; or potassium channel genes, such as the potassium voltage-gated channel subfamily H member 2 (KCNH2, also termed HERG) mutant G628S (Sasano et al., 2006. Nat Med 12: 1256-1258); or combinationsthereof. In addition, the term “gene of interest” refers to a gene that is suitable forlocal treatment of inherited or acquired forms of heart failure, such as S10s, human myosin binding protein C3 (hMYBPC3), plakophilin 2 (PKP2), and sarcoplasmic / endoplasmic reticulum calcium ATPase 2 (SERCA2a; also termed ATPase sarcoplasmic / endoplasmic reticulum Ca2+ transporting 2 (ATP2A2).As is used herein, the term “pharmaceutically acceptable excipient” refers toan excipient for administration of an active substance. Said pharmaceutically acceptable excipient may comprise any substance or vehicle suitable for delivering the substance to a therapeutic target, in particularly cardiomyocytes, of the individual. The term refers to any pharmaceutical acceptable diluent, salt, stabilizer, buffering agent, and other additives such as a sugar, for example sucrose, trehalose, maltose, mannitol, sorbitol, or glycerol, and / or an amino acid such as DL-methionine, glycine, L-alanine, L-arginine, and / or L-aspartate. As is used herein, the term ‘buffering agent” refers to an agent that can resistpH change of a composition upon the addition of an acidic or basic component. Buffering agents can be salts of a weak acid and a weak base. Examples are salts of citric acid, acetic acid, aspartic acid, glutamic acid, tartaric acid, succinic acid, malic acid, fumaric acid, alpha-ketoglutaric acid, histidine, lactic acid, tromethamine (2-amino-2-(hydroxymethyl)propane-1,3-diol (TRIS), gluconic acid, and combinations thereof. In embodiments, a buffering agent is used for keeping the pH at between 6-8, preferably at about 7.0. As is used herein, a pharmaceutical composition according to the invention may comprise 1-1000 mM of one or more excipients, such as 10-750 mM, 50-500 mM, 100-400 mM, including 200 mM, 250 mM, 300 mM or 350 mM. AAV vectors for local administration into the heart Adeno-associated viral (AAV) vectors are increasingly used for preclinical and clinical cardiac gene therapy approaches. However, gene transfer to cardiomyocytes poses a challenge due to differences between AAV serotypes in terms of expression efficiency in vitro and in vivo. For example, AAV9 vectors work well in rodents heart muscle cells in vivo, but not in cultivated neonatal rat ventricular cardiomyocytes (NRVCMs), necessitating the use of AAV6 vectors for in vitro studies. Therefore, an objective was to develop an AAV that could efficiently express genes in NRVCMs, human engineered heart tissue (hEHT), and mammalian hearts, and for which a high in vitro transduction efficiency in cardiomyocytes is predictive for a high transduction efficiency in vivo. Random AAV9 peptide libraries were used and variants were selected on NRVCMs at the vector genome and RNA levels in parallel. The enriched library variants were characterized using high-throughput analysis of barcoded variants followed by individual validation of the most promising candidates. Interestingly, striking differences were found in NRVCM transduction and gene expression patterns of the AAV capsid variants depending on the selection strategy. AAV variants selected based on the vector genome level enabled the highest transduction, but were outperformed by AAVs selected on the RNA level in terms of expression efficiency. Additionally, a new AAV9 capsid variant was identified that not only allowed significantly higher gene expression in NRVCMs compared to AAV6 (see Figure 3), but also enabled similar gene expression in the heart as AAV9 wild-type vectors after being intravenously injected into mice. Therefore, this AAV variant could streamline preclinical gene therapy studies of myocardial diseases by eliminating the need for using different AAVs for NRVCMs, hEHT, and mice. The identified AAV9 variants are highly promising for in vitro and in vivo transduction of cardiomyocytes. A further advantage of the AAV9-based viral particles is that they produce at a substantially higher yield, when compared to AAV6 variants. In addition, a high in vitro transduction efficiency in cardiomyocytes was found to predict a high in vivo transduction efficiency, provided that vectors are applied in a cardiac-specific fashion. Adeno-associated virus belongs to the Parvoviridae family, which may be characterized as non-enveloped, encapsidated viruses with a single-stranded 4–6 kilo base pairs (kbp) DNA genome comprising two main open reading frames (ORFs). These ORFs are termed rep, encoding viral replicative proteins, and cap, encoding three proteins that are required for packaging of the AAV genome, termed viral protein 1 (VP1), VP2 and VP3. The VPs share a common C-terminus that includes the entirety of VP3, and are produced by alternative splicing and leaky scanning from one open reading frame (Becerra et al., 1988. J Virol 62: 2745– 2754). A different reading frame within the cap mRNA encodes an assembly- activating protein (AAP), which promotes capsid assembly by increasing capsid protein stability and VP-VP interactions (Maurer et al., 2018. Cell Rep 23: 1817– 1830). A capsid of a wild type viral AAV particle is assembled from 60 viral proteins in an approximate 1:1:10 ratio (VP1:VP2:VP3) (Oyama et al., 2021. Human Gene Ther 32: 1403-1416). The N-terminal regions of VP1 and VP2 contain elements required for AAV infectivity such as nuclear localization signals, protein interaction domains, domains for signal transduction in eukaryotic cells, which domains are highly conserved and mutation of critical amino acids within the respective domains results in a severe infection-deficient phenotype (Popa-Wagner et al., 2012. J Virol 86: 9163–9174). Recombinant AAV-based vectors may be produced in eukaryotic producer cells. Said producer cells may express AAV-based rep and cap open reading frames. In addition, said producer cells preferably express adenovirus E1A, E4, E2A proteins, and adenovirus viral-associated (VA) RNA. Expression of said AAV-based rep and cap open reading frames, and of the adenovirus-based RNA and proteins, may be provided by transfection of the cells with one or more helper plasmids, and / or infection with one or more helper viruses, or a combination thereof. As an alternative, or in addition, one or more of the proteins or RNA may be expressed from a cassette that is stably integrated into the genome of the producer cells, as is known to a person skilled in the art. There are presently a total of 13 AAV serotypes, termed AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7 AAV8, AAV9, AAV10, AAV11, AAV12 and AAV13 (Issa et al., 2023. Cells 12: 785). Although AAV2 is the most popular serotype, other serotypes may be more effective as gene delivery vectors. For example, AAV9 passes the blood-brain-barrier in humans, while AAV6 efficiently infects airway epithelia of murine and canine models (Issa et al., 2023. Cells 12: 785). In addition to the different serotypes, hybrids of certain AAV strains have been generated, for example by assembly of a capsid from one strain with the genome from another strain. Said pseudotyping may be used to create strains with hybrid capsids from different strains of AAV (Wu et al., 2006. Mol Ther 14: 316-327). Genome shuffling (Stemmer, 1994. Nature 370: 389–391) of viral genomes, for example by shuffling the capsid genomes, may be used for molecular breeding of novel cell / tissue-specific AAV variants. In addition to these serotypes and pseudotypes, capsid variants may be generated by insertional mutagenesis at one or more specific sites within one or more of the capsid proteins. For example, display of short peptides on the surface of AAVs has allowed the generation of gene therapy vectors with altered cell specificities and / or transduction efficiencies (Varadi et al., 2012. Gene Ther 19: 800-809; Borner et al., 2020. Mol Ther 28: 1016-1032; Tabebordbar et al., 2021. Cell 184: 4919–4938). Said peptides preferably comprise between 1 and 10 amino acid residues, such as between 7 and 9 amino acid residues, as such insertions seem to be well tolerated in AAV (Girod et al., 1999. Nat Med 5: 1052-1056; Müller et al., 2003. Nat Biotechnol 21: 1040-1046; Perabo 2003. Mol Ther 8: 151-157). Engineering of novel AAV variants has largely focused on intravenous application of AAV and therefore novel variants related to AAV9 have been generated, an effective wild-type AAV variant in the context of systemic application. For locally administrated gene therapy the majority of investigators thus far has also focused on AAV9, while the efficiency of other serotypes, let alone optimized variants of other serotypes, has not been reported. Several regions on the capsid proteins, termed variable regions, have been identified that may allow the insertion of small peptides (Govindasamy et al., 2006. J Virol 80: 11556–11570; Weitzman and Linden. 2011. "Adeno-Associated Virus Biology." In Snyder and Moullier, eds. Humana Press, New York). One or more of these variable regions, termed VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, and VR- VII of AAV9 (DiMattia et al., 2012. J Virol 86: 6947-6958), may be used for the insertion of short peptides on the surface of AAVs. Said insertion site preferably permits the display of an inserted peptide on the capsid surface and hence its interaction with a cellular receptor. Furthermore, the insertion of a peptide at the insertion site may hamper the interaction with a natural receptor of the capsid protein, thereby altering the inherent tropism of the AAV capsid. In embodiments, said insertion of 1-10 amino acid residues, such as 7 amino acid residues, 8 amino acid residues, or 9 amino acid residues, is performed in one or more regions chosen from the regions depicted in Table 1. In embodiments, said insertion of nucleotide sequences encoding the 1-10 amino acid residues, such as 7 amino acid residues, is in the region provided by nucleotide positions 1741-1780 of the enclosed adeno-associated virus 9 capsid protein 1 (VP1) gene sequences, corresponding to GenBank accession number MZ668415.1. In embodiments, said insertion of nucleotide sequences encoding the 1-10 amino acid residues, such as 7 amino acid residues, is between nucleotide positions 1767-1768 of the enclosed adeno-associated virus 9 capsid protein 1 (VP1) gene sequences, corresponding to GenBank accession number MZ668415.1. If needed, an artificial restriction site may be generated in one or more of the indicated regions depicted in Table 1, by providing an altered coding sequence for one or more of the indicated regions. Said altered coding sequence may encode an identical amino acid sequence. However, one or two amino acids may be altered by the provision of the altered coding sequence, such as one or two conserved amino acid alterations. Table 1. Variable regions in AAV9 genome. Numbering is based on AAV9 VP1 (UniProt O56137_9VIRU), as provided herein below. Variable AAV9 amino-acid residues region (VP1 numbering) VR-I 327–332 VR-II 452–460 VR-III 488-505 VR-IV 527-539 VR-V 545-558 VR-VI 581-593 VR-VII 704-714 As an alternative, or in addition, said insertion of 1-10 amino acid residues, such as 7 amino acid residues, 8 amino acid residues, or 9 amino acid residues, is performed in one or more regions chosen from the regions depicted in Table 1 with the aid of programmable, sequence-specific DNA-binding modules that are linked to a non-specific DNA cleavage domain. Said programmable cleavage modules include Transcription Activator-Like (TAL) effector nucleases (TALENs), Zinc- finger nucleases (ZFNs) and RNA-guided nucleases (RGNs) such as clustered regularly interspaced short palindromic repeats (CRISPR)-based adaptive immune systems of prokaryotes. TALENs comprise a TALE (Transcription Activator-Like Effector) DNA- binding domain fused to a nuclease domain (e.g., of the type IIS restriction enzyme Fokl). TALEs are naturally-occurring transcription factors that bind specific sequences within gene promoters. These proteins are found in phytopathogenic bacteria of the genus Xanthomonas, and their role is to induce expression of specific host plant genes for enhanced virulence. TALEs contain a central region of tandem direct repeats that are responsible for sequence-specific DNA binding. Most repeats are composed of 34 amino acids with the only distinguishing feature among different repeats being a hypervariable polymorphism at positions 12 and13 called “repeat-variable di-residue” (RVD). Each individual RVD dictates thebinding of the repeat to a single nucleotide. This direct one-repeat to one-nucleotide relationship establishes a simple rule underlying TALE-DNA interactions. TALENs operate in pairs of two monomers (Gaj et al., 2013. Trends Biotechnol 31, 397-405). The directional binding of each TALEN monomer to its respective half- target site induces dimerization of the FokI portions resulting in site-specific DNA cleavage. Therefore, TALENs can be engineered to recognize and cleave a DNA target of choice with high specificity. ZFNs are yet another class of artificial endonucleases that can be designed to bind to a predefined genomic target site and thus induce a DNA break at this specific site (Gaj et al., 2013. Trends Biotechnol 31, 397-405). ZFNs are artificial enzymes generated by fusing an array of zinc finger DNA-binding domains to a nuclease DNA-cleaving domain (e.g. that of FokI). Like TALENs, ZFNs work as dimers inducting single- or double-stranded DNA breaks at predefined target sequences of choice. RGNs are RNA-dependent DNA nucleases based on type II clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated (Cas) adaptive immune systems of prokaryotes. These RGN systems comprise transfecting cells with RNA Pol-II and RNA Pol-III expression cassettes encoding, respectively, the Cas9 nuclease and a chimeric single guide RNA (sgRNA). The sequence-specific sgRNA module is engineered by fusing sequence-tailored CRISPR RNAs (crRNAs) to trans-acting CRISPR RNA (tracrRNA) scaffolds. Thus, RGN target site specificity is governed by RNA-DNA hybridizations, as opposed to protein-DNA interactions. This feature makes CRISPR / Cas-based RGN systems easy to engineer allowing also multiplexing i.e. targeting simultaneously multiple sequences within a target cell. Further molecular cloning methods that may be used for generating an insertion of 1-10 amino acid residues, such as 7 amino acid residues, 8 amino acid residues, or 9 amino acid residues in one or more regions chosen from the regions depicted in Table 1 include overlap PCR, GoldenGate cloning, Gateway Cloning, and Gibson assembly. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of AERYTKY, NRVAVRP, PDRFGRP, and / or RGDFRAS in one or more of VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, and / or VR-VII. For example, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of AERYTKY, NRVAVRP, PDRFGRP, and / or RGDFRAS, or a combination thereof, in two or more variable regions selected from VR-I, VR-II, VR- III, VR-IV, VR-V, VR-VI, and VR-VII. In embodiments, said variable regions include VR-II and VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of AERYTKY in VR-II and an insertion of NRVAVRP in VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of AERYTKY in VR-II and an insertion of RGDFRAS in VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of AERYTKY in VR-II and an insertion of PDRFGRP in VR-VI. In embodiments, said variable regions include VR-II and VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of NRVAVRP in VR-II and an insertion of AERYTKY in VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of NRVAVRP in VR-II and an insertion of RGDFRAS in VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of NRVAVRP in VR-II and an insertion of PDRFGRP in VR-VI. In embodiments, said variable regions include VR-II and VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of RGDFRAS in VR-II and an insertion of AERYTKY in VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of RGDFRAS in VR-II and an insertion of NRVAVRP in VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of RGDFRAS in VR-II and an insertion of PDRFGRP in VR-VI. In embodiments, said variable regions include VR-II and VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of PDRFGRP in VR-II and an insertion of AERYTKY in VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of PDRFGRP in VR-II and an insertion of NRVAVRP in VR-VI. In embodiments, an AAV9-based viral particle according to the invention comprises a variant capsid protein comprising an insertion of PDRFGRP in VR-II and an insertion of RGDFRAS in VR-VI. In embodiments, the variant capsid protein comprises an insertion of AERYTKY, of NRVAVRP, PDRFGRP, or of RGDFRAS in VR-VI. An AAV-based vector that is suited for local administration into the heart, such as direct intramyocardial injection, including direct human intramyocardial injection, may be selected by panning experiments. For example, said AAV-based vector may be selected after transduction of neonatal rat ventricular cardiomyocytes (NRVCM), after in vivo transduction of mouse and pig hearts, after transduction of cultured slices of human myocardium, after transduction of human cardiomyocytes, or a combination thereof. In examples, said AAV-based vector may be selected after one, two or three rounds of transduction of NRVCM. In embodiments, said AAV-based vector may be selected after one, two or three rounds of transduction of NRVCM, followed by transduction of cultured slices of human myocardium. In embodiments, said AAV-based vector may be selected after transduction of neonatal rat ventricular cardiomyocytes (NRVCM) at the vector genome level and / or at the RNA level. AAV variants that are selected at the vector genome level may enable a high transduction efficiency. AAV variants that are selected at the RNA level may enable a high expression efficiency. A preferred AAV variant not only enables high gene expression levels in NRVCMs and human engineered heart tissue (hEHT), but also enables high gene expression in the heart after being intravenously injected into mice. Such AAV variant could streamline preclinical gene therapy studies of myocardial diseases by eliminating the need for using different AAVs for NRVCMs, hEHT, human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs), and mice. An AAV-based vector that is suited for local administration into the heart is an AAV9-based vector and derivatives thereof, such as AAV9-AERYTKY, AAV9- NRVAVRP, AAV9-PDRFGRP, and AAV9-RGDFRAS. In these variants, the consecutive amino acid residues AQ at position 589 and 590 of UniProt accession number Q6JC40TD, indicated in bold in the VP1 amino acid sequence of AAV9 herein below, are interrupted by an insertion encoding the indicated amino acid residues. As is indicated in the examples, the insertion variants AAV9-AERYTKY, AAV9-NRVAVRP, AAV9-PDRFGRP, and AAV9-RGDFRAS, characterized by a high mean expression level per NRVCM, outperform all other tested AAV9 variants. As is shown in the enclosed examples, expression after intravenous injection was comparable in most tissues to AAV9 wild-type, with the exception of the brain where expression of the variants was significantly lower (Figure 5). Said AAV9-based viral particle, such as the insertion variants AAV9- AERYTKY, AAV9-NRVAVRP, AAV9-PDRFGRP, and AAV9-RGDFRAS, preferably comprises an expression cassette for transduction of a therapeutic gene product into the heart. For example, said AAV9-based viral particle may comprise an expression product that can be used for the treatment of arrhythmias or for the induction of regeneration, for example after a cardiac infarct. The invention further provides an expression construct for expression of capsid variants AAV9-AERYTKY, AAV9-NRVAVRP, AAV9-PDRFGRP, and AAV9- RGDFRAS in AAV producing cells. In said expression construct, the consecutive amino acid residues AQ at position 589 and 590 of UniProt accession number Q6JC40TD, indicated in bold in the VP1 amino acid sequence of AAV9 herein below, are interrupted by a nucleotide sequence encoding the indicated amino acid insertion. Said expression construct may further comprise a posttranscriptional regulatory element (PRE) and / or a polyadenylation signal. Said PRE or PRE / polyadenylation signal preferably is or comprises a virus-derived PRE, such as a Hepatitis B virus (HPRE), a Woodchuck Hepatitis virus (WPRE), CW3SL, CW3A, CW3SA, CW3SSA or WPRE3 (Choi et al., 2014. Mol brain 7: 17). In embodiments, said PRE / polyadenylation signal is CW3SL, as is depicted herein below, or a sequence having at least 80% sequence identity thereto. The invention further provides a method of producing an AAV9-based viral particle, comprising providing AAV producing cells with an expression construct for expression of capsid variants AAV9-AERYTKY, AAV9-NRVAVRP, AAV9- PDRFGRP, and AAV9-RGDFRAS, and providing said cells with a recombinant AAV (rAAV) vector construct in order to produce an AAV9-based viral particle comprising capsid variants AAV9-AERYTKY, AAV9-NRVAVRP, AAV9-PDRFGRP, and / or AAV9-RGDFRAS. The invention further provides an AAV9-based viral particle comprising capsid variants AAV9-AERYTKY, AAV9-NRVAVRP, AAV9-PDRFGRP, and / or AAV9-RGDFRAS, in which the consecutive amino acid residues AQ at position 589 and 590 of UniProt accession number Q6JC40TD, indicated in bold in the VP1 amino acid sequence of AAV9 herein below, are interrupted by a nucleotide sequence encoding the indicated amino acid insertion. In examples, said expression cassette may express a gene of interest, such as a sodium voltage-gated channel alpha subunit 10, Nav1.8 (encoded by SCN10A) or parts thereof such as a non-natural C-terminal part of a voltage-gated sodium channel alpha sub-unit, termed SCN10A-short, or S10s, upon delivery to a cardiomyocyte. In examples, said expression cassette may express a sodium channel subunit such as SkM1, a gap junction protein such as GJA1 and GJA5, or fragments thereof, a potassium channel subunit such as HERG, a G628S HERG mutant, or a combination thereof. In addition, said expression cassette may express a gene for treatment of inherited or acquired forms of heart failure, such as S10s, hMYBPC3, PKP2, and SERCA2. In embodiments, a gene that acts downstream of ERBB2 / Neuregulin may hold potential to treat pathological hypertrophy, for example by stimulating protection and regeneration. In embodiments, said gene of interest encodes a hyperpolarization-activated cyclic nucleotide-gated channel 4 (HCN4), or parts thereof; a potassium inwardly rectifying channel subfamily J member 2, Kir2.1 (encoded by KCNJ2), or parts thereof, or variants thereof such as a dominant negative variant of Kir2.1, Kir2.1- DN; a signaling receptor, for example a beta-adrenergic receptor (e.g. ADRB2), or an intracellular transducer, for example adenylate cyclase 1 (ADCY1), or a short hairpin (shRNA) targeting a gene, for example a gene encoding potassium inwardly rectifying channel subfamily J member 2 (KCNJ2) phosphodiesterase 3 (PDE3), phosphodiesterase 4 (PDE4), phospholamban (PLN), or combinations thereof. In embodiments, said gene of interest may encode an RNA-guided nuclease (RGN), such as an a DNA base editor or a prime editor. RGN is an RNA-dependent DNA nuclease based on type II clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated (Cas) adaptive immune systems of prokaryotes. Said RGN systems make use of RNA Pol-II and / or RNA Pol-III expression cassettes encoding, respectively, a Cas nuclease, such as a Cas3, Cas9, Cas12 or Cas13 and a chimeric single guide RNA (sgRNA), that are expressed in a cell. A DNA base editor may introduce a single nucleotide polymorphism (SNP) in a target DNA sequence by chemical alteration of a nucleotide without the generation of a DNA double-strand break (DSB). Said DNA base editor comprises a catalytically impaired Cas nuclease, such as a catalytically dead nuclease, for example a catalytically dead Cas 9 (dCas9) or a catalytically dead Cas 12 (dCas12), or a Cas9 nickase (Cas9n), and a single-stranded DNA (ssDNA)-specific nucleobase modifying enzyme, such as a cytosine deaminase (APOBEC) or an adenosine deaminase (engineered TadA). Examples of said base editors include a deoxyadenosine deamination-derived base editor (ABE), a deoxycytidine deamination-derived base editor (CBE) and a adenine and cytosine base editor (ACBE). In embodiments, said RGN allows sequence-specific repression of gene expression in cells, including, for example, CRISPR interference (CRISPRi), by blocking transcriptional initiation and / or elongation. For example, said RGN may sterically block transcription elongation of a target gene. For example, said RGN may act as an epigenetic modifier comprising a catalytically impaired Cas nuclease, such as a catalytically dead nuclease, for example a catalytically dead Cas 9 (dCas9) or a catalytically dead Cas 12 (dCas12), that is fused to a Krüppel associated box (KRAB) domain to repress transcription of the target gene. In embodiments, an expression cassette in an AAV9-based viral particle according to the invention may comprise a bidirectional promoter that drives expression of two genes in interest, such as two genes of interest, two or more shRNAs. or of a gene of interest such as a Cas and a shRNA. In embodiments, said bidirectional promoter is a cardiac-specific, bidirectional promoter. In embodiments, the expression cassette for a gene of interest may comprise a promoter operationally linked to an upstream open reading frame (uORF) comprising a translation initiation sequence upstream of the coding sequence for the gene of interest. Said uORF may encode at most 8 amino acid residues,preferably 1-3 amino acid residues. Said uORF resides within the 5’ untranslatedregion (5’UTR) of the messenger RNA (mRNA) encoding the gene of interest. Thepresence of an uORF may reduce the expression of the gene of interest. In addition, said uORF may ensure a more uniform level of expression of the gene of interest, when compared to expression of the gene of interest in the absence of an uORF. Suitable uORF sequences in front of a coding sequence of a gene of interest are provided in Table 3 herein below. Packaging of an AAV9-based vector into a viral particle, or viral-like particle, is known in the art, including transfection of producer cells that express structural and packaging genes. For example, AAV9 particles may be produced by transfection of a recombinant AAV9 (rAAV9) vector construct into producer cells which provide the AAV replicase and capsid proteins and, optionally, the adenoviral E4, E2A and E1A proteins and adenovirus viral-associated (VA) RNA. As an alternative, the adenoviral E4, E2A and E1A proteins, and adenovirus VA RNA may be provided on a second plasmid, or on a viral construct, which is co-transfected or infected into the producer cells, together with the rAAV9 vector construct. In addition, stable producer cell lines, based on HEK293 cells, HELA cells and insect cells, are available for efficient production of rAAV9 (Merten, 2024. Microorganisms 12: 384). Suitable producer cells include HEK293 cells and derivatives thereof, such as HEK293T cells (Rio et al., 1985. Science 227: 23–28). HEK293 cells have been generated by transfection of cultures of normal human embryonic kidney cells with sheared adenovirus 5 DNA (Graham et al., 1977. J Gen Virol 36: 59–74). HEK293 cells are known to express the Ad5 E1A and E1B genes. In embodiments, a recombinant AAV9-based viral particle may be shielded from circulating antibodies, for example by complexing the viral particle with human serum albumin, by PEGylation (Lee et al., 2005. Biotech Bioengineering 92: 24–34), or by encapsulating the viral particles in extracellular vesicles. Said extracellular vesicles may be obtained from the producer cells that produces the viral particle (Li et al., 2023. Circulation 148: 405-425). In addition, engineered AAV9 vectors with modified protein capsids, materials tethered to the capsid surface, or fully encapsulated in a second, larger carrier have been explored, which may also aid in avoiding an immune response (Lugin et al., 2020. ACS Nano 14: 14262–14283). Pharmaceutical composition Further provided is a pharmaceutical composition comprising an AAV9-based viral particle as indicated herein above for local administration into cardiomyocytes, and a pharmacologically acceptable excipient. Said pharmaceutical composition preferably is a sterile isotonic solution. Said pharmaceutically acceptable excipient preferably is selected from diluents, binders or granulating ingredients, a carbohydrate such as starch, a starch derivative such as starch acetate and / or maltodextrin, a polyol such as xylitol, sorbitol and / or mannitol, sugars such as dextrose, dextrate and / or inulin, glidants (flow aids) and lubricants, and combinations thereof. Said excipient may further include urea, L-histidine, L-threonine, L-asparagine, L-serine, L- glutamine, polysorbate, polyethylene glycol, propylene glycol, polypropylene glycol, or a combination of two or more of the above. One or more salts and a buffering agent may also be included. Said excipients may further include sugar alcohols such as inositol. Further excipients may include a surfactant, such as a nonionic surfactant. Said pharmaceutical composition may comprise a known number of viral particles. Said number of viral particles may be determined, for example, by virus quantification by a cell-based assay such as a plaque assay or determination of a 50% tissue culture infectious dose (TCID50) as a measure of infectious virus titer. In addition, a colorimetric measurement based on protein quantification, such as a BCA assay (Thermo Fisher Scientific), an enzyme-linked immunosorbent assay (ELISA) that employs a capsid-specific antibody, a quantitative amplification reaction such as a quantitative polymerase chain reaction (qPCR), and a tunable resistive pulse sensing (TRPS) method may be used to determine a number of total viral particles in a sample. A preferred method is a quantitative amplification reaction such as qPCR, to determine the number of viral genomes (vg) in a sample as a proxy for the number of viral particles. Methods of treatment An AAV9-based viral particle as indicated herein above may be transduced into a cardiomyocyte. Said AAV9-based viral particle may be provided as pharmaceutical composition as is indicated herein above. Methods for delivery of an AAV9-based viral particle for expression of a therapeutic protein in a cardiomyocyte include administration by a parenteral route, such as intramuscular and intravenous administration. Said pharmaceutical composition comprising an AAV9-based viral particle is preferably administered by local administration, for example by direct injection into the myocardium, or infusion into a coronary artery and / or a coronary vein. For example, said pharmaceutical composition comprising an AAV9-based viral particle may be administered to an individual in need thereof by employing a catheter. Said injection or infusion may be accomplished by use of external pump or of a fully implantable device. Said external pump is preferably equipped with a percutaneous catheter, tunneled or not tunneled, or equipped with a subcutaneous injection port and an implanted catheter. Intramyocardial injections may be conducted either surgically, through a small incision in the chest, e.g., between the ribs (intercostal), allowing precise placement of one or multiple epicardial injections, or minimally invasive using an injection catheter-based approach for endomyocardial delivery. Intracoronary infusion may be conducted by inserting an infusion catheter into the cardiac coronary vasculature either antegrade, e.g., via femoral or radial arterial access (Hayase et al., 2005. Am J Physiol Heart Circ Physiol 288: H2995-3000), or retrograde via the coronary sinus (Weber et al., 2014. Gene Ther 21: 131-138; Lampela et al., 2024. Sci Rep 14: 1467). These infusion approaches may be combined with temporary local occlusion of the coronary perfusion, e.g., using an inflatable balloon catheter, to allow for prolonged durations for the AAV9-based viral particles to pass the endothelial barrier. Intracoronary delivery may also be combined with cardiac recirculation to enhance transduction efficacy through prolonged local persistence of the AAV9-based viral particles in the cardiac target area (Byrne and Kaye; 2017. Methods Mol Biol 1521: 261-269; Fargnoli et al., 2013. Ann Thorac Surg 96: 586-95). Said pharmaceutical composition comprising an AAV9-based viral particle may be provided to the myocardium, or into a coronary artery, at a dosage of about 1010-1014viral genomes (vg) per injection, such as about 5x1010vg per injection, 1011vg per injection, 5x1011vg per injection, 1012vg per injection, 5x1012vg per injection, or 1013vg per injection. This is significantly lower than what is currently applied in cardiac gene therapies that target the heart systemically, which is about 6.7E13-1.1E14vg / kg in a recent clinical trial (Greenberg et al, 2021. Circulation 144: A10727). An AAV9-based construct, such as AAV9-AERYTKY, AAV9-NRVAVRP; and / or AAV9-RGDFRAS, efficiently targets to the myocardium, especially cardiomyocytes. Therefore, a pharmaceutical composition comprising an AAV9- based viral particle may be systemically provided at a dosage of about 1010-1014viral genomes (vg) per injection, such as about 5x1010vg per injection, 1011vg per injection, 5x1011vg per injection, 1012vg per injection, 5x1012vg per injection, or 1013vg per injection / infusion. The provision of an expression construct for a therapeutic protein to at least a part of a heart of an individual in need thereof may help to at least partially restore physiological cardiac impulse conduction to prevent cardiac arrythmias, e.g., by AAV9-based viral particle mediated correction of mutations in cardiac ion channels, or modulated expression levels of wild type and mutated alleles. Other application scenarios include at least partially restoring physiological cardiac contractile function to partially restore contractility and / or to slow down the development of, or even prevent, heart failure, e.g., by AAV9-based viral particle mediated correction of mutations in desmosomal proteins or expression of the wildtype protein. EXAMPLES Example 1 Materials and methods Primary neonatal rat ventricular cardiomyocytes isolation Neonatal rat ventricular cardiomyocytes (NRVCMs) were isolated from 1-3 days old Wistar rats (Charles River) as previously described (Kluge et al., 2019. J Mol Cell Cardiol 129: 130-143). The cells were kept in DMEM with 2 mM L- glutamine (Gibco), 100 U / ml penicillin, and 100 µg / ml streptomycin (Pen Strep, Gibco) +10% (v / v) fetal bovine serum (FBS, Capricorn Scientific) at 37 °C and 5% CO2. After 24 hours, cells were used for transduction experiments. Animal work Animal experiments were carried out under the guidelines from directive 2010 / 63 / EU of the European Parliament on the protection of animals used for scientific purposes with the approval of the regional council (permission no. V242- 56596 / 2022). Animals were housed under standard conditions with a 12h-light- / 12h-night-cycle. Water and food were offered ad libitum. Barcoded AAV vector libraries were injected systemically via tail vein injection into 8-week-old male C57BL / 6N mice (Charles River). Each mouse was injected with 5×1011viral genomes in a total volume of 100 µL. Mice were sacrificed two weeks after injection by cervical dislocation and organs were snap-frozen. Single AAV vector injections for comparison of AAV9-AERYTKY and AAV9 wild-type were performed at the Academic Medical Centre in Amsterdam and conducted according to the local legislation (permission no. AVD11800202114455). AAV vectors were injected systemically via retro-orbital injections into 8-week-old female FVB mice (Janvier Labs, France). Each mouse was injected with 2.5×1011viral genomes in a total volume of 100 µL. Mice were sacrificed three weeks after injection by inhaling carbon dioxide followed by cervical dislocation. The apex of the heart and the other organs were snap-frozen. The base of the heart and a part of the liver were used for histological analysis. AAV9 random peptide insertion library and selection process The AAV9 random heptapeptide insertion library was generated and used for in vitro biopanning as described earlier (Varadi et al., 2012. Gene Ther 19: 800-9) with the exception that the plasmid library was directly used for production of the AAV library. For the selections, 0.5 to 1×106cells were seeded into 6-well plates (GreinerBio-One). After 24 hours, the cells were washed with 1x Dulbecco’s phosphate-buffered saline (DPBS; ThermoFisher) and then infected with the AAV9 peptide library at an MOI of 1×105in serum-free DMEM. Three hours post-infection, the cells were washed three times with 1× DPBS, and fresh DMEM +10% FBS was added. After 72 hours, cells were harvested, DNA and RNA were isolated, and used as templates for PCR amplification of the region containing the random heptapeptide with the following primers: Forward: 5’-AGTCATGATAACCAACGAAG-3’;Reverse: 5’-GAAAGTTGCCGTCCGTGT-3’.The resulting PCR product was then purified (NucleoSpin Plasmid Kit, Macherey-Nagel), digested with BglI, and cloned into the AAV9 backbone plasmid pKV-AAV9Lib / BB (Varadi et al., 2012. Gene Ther 19: 800-9) using SfiI restriction sites. The resulting plasmid libraries were then used to generate the preselected AAV9 libraries. In the first round of selection, only DNA was processed to produce the primary library, but after the second round of selection, DNA and RNA were employed separately to generate secondary libraries. After the third rounds of the selection process, PCR products containing the insertion region of the gDNA and cDNA were analyzed by Illumina-based amplicon sequencing (GENEWIZ, Azenta Life Sciences, Manchester, England). Selected peptide motifs were cloned into plasmid p5E18-VD2 / 9-SfiI1759 toproduce AAV9 capsid variants using the helper plasmid pDG∆VP (Dubielzig et al.,1999. J Virol 73: 8989-8998) in a three-plasmid system (Varadi et al., 2012. Gene Ther 19: 800-9). AAV production and titration AAV production was carried out as described elsewhere (Jungmann et al., 2017. Hum Gene Ther Methods 28: 235-246). In brief, human embryonic kidney (HEK)293T cells (ATCC) were seeded into a 5-layer CellStack Culture Chamber (Corning) or an appropriate number of 15 cm petri dishes 24 hours prior to transfection. The transfection of cells was carried out using polyethylenimine (PEI, Polysciences) and a two- or three-plasmid system for wild-type AAVs and AAV capsid variants, respectively. Following a 72 hours incubation period, the cells were harvested and lysed to extract the AAVs, which were subsequently purified through a discontinuous iodixanol (OptiprepTM, Progen) gradient. The iodixanol solution was then exchanged to 1x DPBS using Zeba Spin Desalting columns (7K MWCO, Thermo Scientific) and, if necessary, AAVs were concentrated in Vivaspin centrifugal concentrators (10 kDa MWCO, Sartorius). For viral genome quantification, alkaline lysis was performed, followed by quantitative qPCR (CFX96 Real-Time PCR System, Bio-Rad) utilizing the SensiFAST SYBR No-ROX Kit (Meridian Bioscience) as described previously (Jungmann et al., 2017. Hum Gene Ther Methods 28: 235-246). The AAV9 peptidelibraries were titrated via REP2 (Forward: 5’-AAGTCCTCGGCCCAGATAGAC-3’,Reverse: 5’-CAATCACGGCGCACATGT-3’) and a respective plasmid standard.Additionally, barcoded AAV variants were quantified targeting the CMV promoter(Forward: 5’-CATTATGCCCAGTACATGACC-3’, Reverse: 5’-GAAATCCCCGTGAGTCAAACC-3’) and a viral standard.Barcoded next-generation sequencing analysis To validate multiple AAV capsid variants simultaneously, we followed the method previously described by Weinmann et al., 2020 (Weinmann et al., 2020. Nat Commun 11: 5432). Each capsid was used for packaging a CMV promoter-driven eYFP reporter genome containing a unique barcode in the 3’-untranslatedregion. The individual AAVs were mixed equimolar and concentrated if necessary. For in vitro validation, cells were infected with an MOI of 1×105. For in vivo validation, mice were injected intravenously with 5×1011vg. The barcoded library for in vivo validation contained a total of 52 AAV variants. We calculated the relative proportions considering all 52 variants, of which only 36 were relevant for the experiments. After DNA and RNA isolation, the barcode-containing region of the gDNA and cDNA was amplified via PCR using the following primers: Forward:5’-CGACAACCACTACCTGAGCTAC-3’ and Reverse: 5’-GGCTGGCAACTAGAAGGCACA-3’. The amplified DNA was then purified andanalyzed through Illumina-based amplicon sequencing. Reads were normalized to the read populations of the mixed input library before infection or injection. We applied a Python script as previously described to identify barcode reads and normalize the data (Weinmann et al., 2020. Nat Commun 11: 5432). YFP quantification by flow cytometry To quantify in vitro transduction, 2 to 4×105cells per well were seeded in a 12-well plate (Greiner Bio-One). After 24 hours, the cells were washed with 1× DPBS, and serum-free DMEM was added for the infection with distinct AAVs with an MOI of 1×104. After further 24 hours, cells were washed again with 1× DPBS, and fresh DMEM +10% FBS was added. Three days post-infection, the medium was replaced with 1× DPBS and the mean fluorescent intensity was determined using a BioTek Citation 5 Imaging Reader (excitation 488 nm, emission 530 nm) from Agilent. The cells were detached with trypsin-EDTA solution (Gibco), washed with 1× DPBS, and a single-cell suspension was generated in Falcon Round Bottom Polystyrene Tubes (Corning). Positive eYFP expressing cells were detected with the LSRFortessaTM (BD Biosciences) using the FACSDivaTM software. Vital cells were separated using FSC-A against SSC-A and doublets were extracted using FSC-H against FSC-A. The eYFP positive gate for FITC-A was set using control cells infected with PBS. Human engineered heart tissue transduction The generation of human engineered heart tissues (hEHT) was performed as described previously (Mannhardt et al., 2016. Stem Cell Reports 7: 29-42; Breckwoldt et al., 2017. Nat Protoc 12: 1177-1197). Each hEHT contained 1×106hiPSC-CM cells (in-house cell line UKEi001-A) and was cultured in 24-well plates containing DMEM, 1% penicillin / streptomycin, 10% horse serum (Gibco), 10 µg / ml insulin (Sigma-Aldrich), 33 µg / ml aprotinin from bovine lung (Serva Electrophoresis), and 2 mM tranexamic acid (Sigma-Aldrich) for 14 days prior infection. The AAVs were added to the culture medium with an MOI of 2.5×104(AAV9 wild-type and capsid variants) or 2.5×103(AAV6 wild-type). hEHTs were incubated for 24 hours before transferring them to fresh medium. Medium was changed in 2- to 3-day intervals. After seven days, images were captured (90% intensity, 30 ms, 4× magnification) with an EVOS fl microscope (Peqlab), and fluorescence intensities were quantified using ImageJ. Furthermore, contractile force was measured directly before the infection and 7 days after (EHT Technologies GmbH) as previously described (2-4 hours after medium change; Mannhardt et al., 2016. Stem Cell Reports 7: 29-42). Immunostainings For immunocytochemistry staining, NRVCMs were seeded on coverslips prior coated with collagen in 12-well plates. Cells were fixed using 4% paraformaldehyde (PFA, Sigma-Aldrich) for 10 minutes, washed with 1× DPBS, and treated with 0.1% (v / v) Triton X-100 (Serva Electrophoresis), 2.5% (w / v) BSA (Carl Roth) for at least 1 hour at room temperature. Cells were incubated with anti-α-actinin antibody (Dilution 1:400, monoclonal, mouse; Sigma-Aldrich #A7811) and anti-GFP AF488 conjugate (Dilution 1:400, polyclonal, rabbit; Invitrogen, Thermo Scientific #A21311) overnight at 4 °C. Then, cells were washed with 1× DPBS and incubated with anti-mouse AF647 (Dilution 1:400, polyclonal, chicken; Invitrogen, Thermo Scientific #A21463) and DAPI (Dilution 1:1000, Sigma-Aldrich) for 1-2 hours at room temperature. The coverslips were mounted on microscope slides using FluorPreserveTM Reagent (Calbiochem) and examined with a Keyence BZ-X810 Fluorescence Microscope (Keyence) at 20× magnification. Histological analysis was performed by fixing hearts and livers in 4% PFA overnight and embedding in paraplast (Leica Biosystems). Sections of 3-4 µm thickness were prepared using the HistoCore Multicut (Leica Biosystems), then blocked with 0.1% (v / v) Triton X-100, 2.5% (w / v) BSA for 1 hour, and stained with anti-GFP AF555 conjugate (Dilution 1:400, polyclonal, rabbit; Invitrogen, Thermo Scientific #A31851) overnight at 4 °C followed by DAPI for 1 hour at room temperature. Images were taken using a Laser Scanning Microscope 800 (Carl Zeiss) at 20× magnification. DNA / RNA isolation and cDNA synthesis Cultured cells were homogenized by transferring them onto QIAshredder (QIAGEN) columns and centrifugation at 17000 r.c.f. for 2 min. Tissue was in a prior step disrupted with ceramic beads in a Precellys24 homogenizer (Peqlab) and, subsequently, homogenized as described above. Isolation of total DNA and RNA both from cultured cells and tissues was performed using the AllPrepDNA / RNA / miRNA Universal Kit (Qiagen) according to the manufacturer’sinstructions. Reverse transcription of RNA into cDNA was carried out using LunaScript RT SuperMix Kit (New England Biolabs) adding 1 µg of RNA, if applicable. Viral genome quantification and mRNA level determination The ratios of viral genomes (vg) per diploid genomes (dg) were determined using multiplexed qRT-PCR of isolated genomic DNA with iQ Multiplex Powermix(Bio-Rad). eYFP was quantified to determine the vg copy number (Forward: 5’-GAGCGCACCATCTTCTTCAAG-3’ and Reverse: 5’-TGTCGCCCTCGAACTTCAC-3’, Probe: 5’-FAM-ACGACGGCAACTACAAGACC-3’; adapted from Weinmann etal., 2020. Nat Commun 11: 5432) which was then normalized to the RPP30 copynumber (Forward: 5’-AGCCTGGGCTACTTGGT-3’ and Reverse: 5’-CTGATGGCCGTGGTTTCTT-3’, Probe: 5’-HEX-ACTTGTTTCTGTTTCTTGAGACAGGATCTC-3’; kindly provided by the Grimm lab) divided by two to obtain the number of dg. For each well, 100-200 ng of genomic DNA were mixed with 62.5 µM per primer and 125 µM per probe in a 20 µL volume. A standard curve was generated by serial dilution of a plasmid comprising both amplicons. mRNA levels were quantified by determination of eYFP levels (Forward: 5’-GCATCAAGGTGAACTTCAAGATCC-3’ and Reverse: 5’-ATGTGATCGCGCTTCTCGTTG-3’) and normalizing them to the housekeepinggene RPL32 (Forward: 5’-CTGCTGATGTGCAACAAATCT-3’ and Reverse: 5’-GCTGTGCTGCTCTTTCTACAAT-3’) using SYBR-Green Super mix. In 20 µLvolumes, 10 ng of cDNA were mixed with 200 µM per primer. Statistical analysis All results are presented as mean values ± standard deviation (SD) unless otherwise specified. Statistical analyses were conducted using a one-way ANOVA followed by Dunnett's multiple comparison test. For the comparison of two groups, an unpaired two-tailed t-test was applied. P-values less than 0.05 were considered statistically significant. Statistical analysis was carried out using GraphPad Prism. Results Separated AAV9 random peptide library selections on the DNA and RNA levels result in enrichments of distinct AAV capsid variants To obtain capsid variants with improved properties for cardiac gene transfer, we utilized a directed evolution approach with an AAV9 random peptide library on neonatal rat ventricular cardiomyocytes (NRVCMs). Previous studies have reported the capability of AAV serotype 9 to display peptide variants and enrich distinct motifs (Varadi et al., 2012. Gene Ther 19: 800-9; Deverman et al., 2016. Nat Biotechnol 34: 204-9; Tabebordbar et al., 2021. Cell 184: 4919-4938; Ramirez et al., 2023. Hum Gene Ther 34: 682-696). However, most AAV library selections were based on amplification of the randomized region on the level of vector genomes. As approaches typically aim to improve gene expression, selections on the transduction level may not fully exploit the potential (Westhaus et al., 2022. Hum Gene Ther 33: 664-682). Thus, we aimed to characterize the effect of the selection process on the resulting AAV capsid variants by performing selections on either the DNA or RNA level. This could provide valuable insights into improving gene expression and transduction levels. First, NRVCMs were infected with the initial AAV9 peptide library. Then, the DNA was isolated and used to generate the first preselected library. To avoid the accumulation of falsely genotype-phenotype coupled or mosaic capsids with high gene expression in the high-diverse initial library (Nonnenmacher et al., 2015. Mol Ther 23: 675-82), the RNA level selection was omitted here. Previous studies demonstrated that about 95% of the capsids were eliminated after the first round of selection (Nonnenmacher et al., 2020. Mol Ther Methods Clin Dev 20: 366-378). After the second round of infection, both DNA and RNA were isolated from the cells and separately processed, resulting in DNA- or RNA-selected secondary libraries. These secondary libraries were further used in third selection rounds (Figure 1A). Subsequently, gDNA and cDNA were analyzed via NGS, and enrichments of peptide motifs were clearly visible on all levels. However, the intensity of enrichment varied. The RNA based selections seemed to lead to single peptides with a higher level of enrichment, such as AERYTKY with 25.71 % and PDRFGRP with 25.35 % (Figure 1B), compared to the DNA based selections. Nonetheless, the cDNA revealed higher enriched peptides compared to the corresponding gDNA on both selection levels (Table 2). This was expected, as single peptides leading to strong transgene expression might directly occupy a large proportion of the total reads, as demonstrated earlier (Nonnenmacher et al., 2020. Mol Ther Methods Clin Dev 20: 366-378). RNA selected capsid variants rather display improved expression efficiencies The top ten enriched peptide motifs of both the DNA and the RNA results of both selection strategies were produced individually as AAV9 capsid variants (Table 2). To facilitate individual and parallel validation, each AAV was equipped with an eYFP reporter gene driven by the constitutively-expressingcytomegalovirus (CMV) promoter and a unique fifteen nucleotide barcode in the 3’-untranslated region (Figure 2A). This linking of genomic information to the respective AAV capsid variant allowed for parallel quantification of the transduction and expression efficiencies, as previously published (Weinmann et al., 2020; Adachi et al., 2014). All variants were capable of being produced in a similar efficiency compared to AAV9 wild-type, with total viral genomes ranging from 2.4x1011to 2.4x1012per production (data not shown). The AAV capsid variants were equimolarly pooled to obtain a barcoded input library. Additionally, certain peptide motifs known to target cardiac (NLPGSGD and THGTPAD; Rode et al., 2022. Mol Ther 30: 3601- 3618) or muscle tissue (RGDLTTP and GPGRGDQTTL; Tabebordbar et al., 2021. Cell 184: 4919-4938) as well as our previously identified endothelial targeting variant (SLRSPPS, Varadi et al., 2012. Gene Ther 19: 800-9) were cloned into the AAV9 capsid backbone, produced, and added to the library. Differences in abundance were monitored via NGS and considered for data normalization. As expected, AAV6 was the only wild-type showing reasonable transduction and expression in NRVCMs (Figure 2b and 2c). Neither of the benchmark motifs seemed to efficiently transduce or express in NRVCMs, likely due to their inefficiency to target NRVCMs or their incapability to exhibit previously demonstrated effects when incorporated in our AAV9 backbone. The AAV9 capsid variants derived from the independent selections clearly showed the anticipated differences in transduction and expression efficiency (Figure 2b and 2c). The peptide motifs from the DNA selection demonstrated significantly higher transduction efficiencies but showed only very low to no transgene expression. Conversely, the RNA selection-based capsid variants demonstrated increased expression efficiencies compared to AAV9, with the peptide motifs PDRFGRP and AERYTKY exhibiting similar or even higher expression than AAV6, respectively. These results highlight the significant and selective impact of using either genomic DNA or RNA for selecting AAV peptide insertion libraries. AAV9-AERYTKY leads to significantly increased reporter gene expression in NRVCMs To verify the results from the barcode sequencing approach, individual AAVs harboring an eYFP reporter were used to monitor transgene expression through flow cytometry and fluorescence detection (Figure 3). NRVCMs were individually infected with various AAV9 capsid variants. Capsids that showed no expression in the parallel validation, such as AAV9 wild-type and GAKYAIC, barely led to eYFP positive cells. In contrast, all variants with high expression efficiency in the parallel barcode sequencing approach resulted in significantly improved NRVCM targeting, with 65 to 83 % eYFP positive cells compared to AAV9 wild-type, which resulted in less than 1 % eYFP positive cells. Furthermore, taking into account the mean fluorescence intensity of the cells, AERYTKY and PDRFGRP noticeably outperformed the current benchmark AAV6 by 7.0- and 3.4-fold, respectively (Figure 3A). To further demonstrate the significantly improved transgene expression by AERYTKY in NRVCMs, AAV vectors from two independent productions were validated again side-by-side by flow cytometry and visualized by immunocytochemistry (Figures 3B and 3C). The capsid variant RGDLGLS, which is a benchmark capable of targeting cardiac tissue in vivo, was examined for its NRVCM transduction efficiency (Weinmann et al., 2020. Nat Commun 11: 5432). Interestingly, RGDLGLS barely enhanced the transduction to about 8 % eYFP positive cells, further emphasizing the potential of the capsid variant AERYTKY as new AAV gene therapy tool for in vitro cardiac research. AAV9-AERYTKY enables cardiac gene transfer in vivo comparable to AAV9 wild- type The novel AAV9 capsid variants were tested for their capability of in vivo cardiac gene transfer in the murine model. All selected capsids and some additional benchmarks known for targeting specific tissues in vivo were combined into a single barcoded library for simultaneous screening. The library was injected intravenously, and two weeks later, tissues were collected and gDNA and cDNA analyzed via NGS. To compare the results of multiple tissues, total viral genomes per diploid genomes were determined (data not shown), used for normalization, and the normalized expression efficiencies were then used to generate a heat map. The transcriptional profile of the benchmarks is consistent with previous reports and demonstrates the high suitability of the simultaneous characterization. In our data, AAV2-ESGHGYF (Körbelin et al., 2016. Mol Ther 24: 1050-1061) and AAV- DJ (Grimm et al., 2008.J Virol 82: 5887-911) showed almost exclusively expression in lung and liver, respectively (Figure 4). The overall highest expression in the liver was enabled by AAV8 wild-type, while the muscle targeting motifs RGDLGLS and RGDLTTP exhibit highest expression in both skeletal muscle and heart (Figure 4). Despite testing various AAV9 capsid variants in the mouse heart, none of them revealed an improvement of transgene expression in the heart in vivo. This is not surprising since the selections were performed in vitro. Nevertheless, some variants showed detargeting from the liver either on the gene expression (Figure 4) or transduction level (data not shown). We observed that the cardiac benchmark RGDLGLS was not able to efficiently transduce NRVCMs (Figure 3C). Therefore, we propose AERYTKY as an alternative for in vitro and in vivo studies in cardiomyocytes using a single vector. Our barcoded parallel comparison with AAV9 wild-type in mice revealed that AERYTKY did not exhibit higher expression in the liver, unlike SARVDAR and PDRFGRP. Therefore, we studied AERYTKY individually after intravenous injection and compared it directly with AAV9 wild-type (Figure 5). Quantification of viral genomes per diploid genomes indicated a similar biodistribution of both vectors in a set of organs (Figure 5A). Additionally, expression levels quantified on the mRNA level were comparable across all tissues, with a notable difference in the brain (Figure 5B). These findings were also corroborated by representative sections of hearts and livers (data not shown). AAV9 capsid variants increase transduction of hiPSC derived engineered heart tissues Finally, the most promising AAV9 capsid variants were investigated for their ability to transfer genes into human iPSCs that were differentiated into cardiac organoid-like tissue (hEHT). After transducing these hEHTs with the variants, we took images after seven days to evaluate eYFP intensities (Figure 6a, b). Consistent with our in vitro findings, most of the examined peptide motif insertions significantly improved the transduction efficiency. In particular, AERYTKY, NRVAVRP, and RGDFRAS exhibited a 4.9-, 7.8-, and 11.2-fold increase in eYFP intensity compared to AAV9 wild-type, respectively. AAV6 wild-type was examined simultaneously at a 10-fold lower dose as benchmark control. Contractile force before and after infection was not significantly changed, when compared to control (Figure 6c). These novel AAV capsid variants could be potential candidates to support preclinical cardiovascular research involving human iPSC cardiomyocytes and differentiated cardiac organoids. Example 2 Materials and methods Enhancer regions and core promoters from genes that could be highly expressed within cardiac tissue were selected. Specific combinations were designed, a promoter library was created by cloning the fragments into a luciferase expressing vector. After transfection, promoter strength was assessed in AAV-infected cells by a luciferase assay. Cells included neonatal rat ventricular cardiomyocytes (NRVM, as primary cells of target tissue; C2C12, a mouse skeletal muscle cell line, an organ with highest expected off-target expression; HepG2, a human liver cell line, an organ with highest sequestration of AAV particles, and a human embryonic kidney cell line, HEK293, an AAV producer cell line. A schematic overview of the promoter constructs is provided in Figure 7. Results The fold induction of the individual constructs when compared to the standard TNNT2 promoter is shown in Figure 8. CE1-CCP and CE2-CCP present higher levels of expression than the TNNT2 promoter with similar specificity. SMP had the highest expression levels in NRVMs, adding the cardiac enhancer CE1 to SMP lead to the highest expression in C2C12. SMP was highly specific to striated muscle. As expected, promoters containing UE achieved strong expression levels, but lacked specificity. Expression in HEP2G cells shows that the specificity of promoters is determined mainly by the proximal cis-regulatory region andmodulated by the core promoter. Of note, CE1-CCP is 250 bp shorter and ≈ 50%stronger than the TNNT2 promoter and provides an improved promoter for cardiac gene therapy. In addition, CE1-SMP displays similar expression to the CMVpromoter in heart, while showing ≈ 66% higher expression than CMV in skeletalmuscle, and is a strong candidate promoter for applications in muscular dystrophies. Example 3 Materials and methods Different AAV serotypes were produced containing reporter genomes containing a unique barcode for each serotype. Vectors were produced individually as previously described by transfection of HEK293T cells and subsequently purified using iodixanol ultra-centrifugation. Vectors were titrated, and subsequently pooled in 1:1 ratios to ensure equal starting abundance in the library. Pooled libraries were administered in one pig via two routes of administration. For direct intramyocardial injection, 3E12 vg per animal was injected into the left ventricular free wall in three separate injections of 200 µL per injection. For intracoronary infusion, a catheter was inserted into the coronary sinus and the coronary artery. A balloon was inflated in the coronary sinus and the coronary artery to stop the blood flow and increase vector contact time. Vector was then injected as a single bolus of 3.2 mL containing a total dose of 2E13 vg per animal. Animals were sacrificed 2 weeks later, and macroscopic fluorescence was used to isolate the transduced areas. DNA and RNA was extracted from isolated tissue and RNA was reverse transcribed to cDNA. An amplicon containing the unique barcodes was generated by PCR from DNA and RNA. This amplicon was sequenced using ONT sequencing, and barcodes counted from sequencing reads. The counted barcodes were normalized for actual presence of the variant in the injection mix based on sequencing of the input library. Results Both intramyocardial injection as well as coronary infusion resulted in directly visible fluorescence when viewed with appropriate excitation lamp and filter glasses (Figure 9B). DNA and RNA extracted from the injection site showed a strong performance of AAV-RGDF, AAV-PDRF and AAV-AERY compared to the parental AAV9 serotype, with the RGDF vector leading to the highest read proportion on RNA (Figure 9C,D). DNA extracted from the region infused with vector showed similar performance of all engineered AAV9 variants, outperforming the parental AAV9 serotype (Figure 9E). The RNA signal from the infusion site was too low to reliably amplify the barcoded amplicon, likely due to dilution of the signal from non-transduced tissue that was isolated as the same sample. Therefore, the RNA / DNA ratio of the injection site was used to extrapolate the DNA reads from the infusion to expected RNA reads (Figure 9F). Example 4 Methods hiPSC cardiomyocytes were transduced with different AAV serotypes and harvested 5 days later. Thereafter, RNA was extracted and reverse transcribed into cDNA. For the library experiment, cDNA was amplified to obtain an amplicon containing the barcode of the viruses, which was sequenced using Oxford Nanopore Sequencing. For CRISPRi experiments, hiPSC-CMs were transduced with an AAV vector containing a Cas9 Endonuclease Dead fused to a KRAB transcriptional repression domain (dCas9-KRAB) and a guide-RNA against troponin I type 1 (TNNI1) or a control guide-RNA. Quantification was performed using RT-qPCR on cDNA. Expression of dCas9-KRAB and Hypoxanthine Guanine Phosphoribosyltransferase as reference gene was quantified by RT-qPCR. For quantification of transcriptional repression, an RT-qPCR on TNNI1, the target of the CRISPRi guideRNA, and HPRT as reference gene, were used. Results Transduction in hiPSC-CMs in library format showed strong enrichment of AAV6 and AAV9-RGDF, with AAV9-AERY and AAV9-PDRF also showing enrichment over the parental AAV9 serotype (Figure 10A). AAV6 and AAV9-RGDF were subsequently tested for efficiency of dCas9-KRAB expression (Figure 10B) and transcriptional repression using a CRISPR inhibition construct (Figure 10C), comparing a guide RNA targeting the promoter of TNNI1 or an unrelated gene as a control. Here, AAV6 showed efficient transcriptional repression at 5k and 2k MOI, with a reduction in transcriptional repression already at 1k MOI. AAV9-RGDF led to near complete transcriptional repression at 5k, 2k and 1k MOI, with only a mild dose-response effect, indicating far lower doses of AAV9-RGDF may be needed to achieve similar transcriptional repression compared to AAV6. Sequences Adeno-associated virus isolate AAV9sample187 capsid protein (VP1) gene, complete cds. GenBank: MZ668415. atggctgccg atggttatct tccagattgg ctcgaggaca accttagtga aggaattcgc gagtggtggg ctttgaaacc tggagcccct caacccaagg caaatcaaca acatcaagac aacgctcggg gtcttgtgct tccgggttac aaataccttg gacccggcaa cggactcgac aagggggagc cggtcaacgc agcagacgcg gcggccctcg agcacgacaa ggcctacgac cagcagctca aggccggaga caacccgtac ctcaagtaca accacgccga cgccgagttc caggagcggc tcaaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag gccaaaaaga ggcttcttga acctcttggt ctggttgagg aagcggctaa gacggctcct ggaaagaaga ggcctgtaga gcagtctcct caggaaccgg actcctccgc gggtattggc aaatcgggtg cacagcccgc taaaaagaga ctcaatttcg gtcagactgg cgacacagag tcagtccccg accctcaacc aatcggagaa cctcccgcag ccccctcagg tgtgggatct cttacaatgg cttcaggtgg tggcgcacca gtggcagaca ataacgaagg tgccgatgga gtgggtagtt cctcgggaaa ttggcattgc gattcccaat ggctggggga cagagtcatc accaccagca cccgaacctg ggccctgccc acctacaaca atcacctcta caagcaaatc tccaacagca catctggagg atcttcaaat gacaacgcct acttcggcta cagcaccccc tgggggtatt ttgacttcaa cagattccac tgccacttct caccacgtga ctggcagcga ctcatcaaca acaactgggg attccggcct aagcgactca acttcaagct cttcaacatt caggtcaaag aggttacgga caacaatgga gtcaagacca tcgctaataa ccttaccagc acggtccagg tcttcacgga ctcagactat cagctcccgt acgtgctcgg gtcggctcac gagggctgcc tcccgccgtt cccagcggac gttttcatga ttcctcagta cgggtatctg acgcttaatg atggaagcca agccgtgggt cgttcgtcct tttactgcct ggaatatttc ccgtcgcaaa tgctaagaac gggtaacaac ttccagttca gctacgagtt tgagaacgta cctttccata gcagctacgc tcacagccaa agcctggacc gtctcatgaa tccactcatc gaccaatact tgtactatct ctcaaagact attaacggtt ctggacagaa tcaacaaacg ctaaaattca gtgtggccgg acccagcaac atggcagtcc agggaagaaa ctacatacct ggacccagct accgacaaca acgtgtctca accactgtga ctcaaaacaa caacagcgaa tttgcttggc ctggagcttc ttcttgggct ctcaatggac gtaatagctt gatgaatcct ggacctgcta tggccagcca caaagaagga gaggaccgtt tctttccttt gtctggatct ttaatttttg gcaaacaagg aactggaaga gacaacgtgg atgcggacaa agtcatgata accaacgaag aagaaattaa aactactaac ccggtagcaa cggagtctta tggacaagtg gccacaaacc accagagtgc ccaagcacag gcgcagaccg gctgggttca aaaccaagga atacttccgg gtatggtttg gcaggacaga gatgtgtacc tgcaaggacc catttgggcc aaaattcctc acacggacgg caactttcac ccttctccgc tgatgggagg gtttggaatg aagcacccgc ctcctcagat cctcatcaaa aacacacctg tacctgcgga tcctccaacg gctttcaaca aggacaagct gaactctttc atcacccagt attctactgg ccaagtcagc gtggagattg agtgggagct gcagaaggaa aacagcaagc gctggaaccc ggagatccag tacacttcca actattacaa gtctaataat gttgaatttg ctgttaatac tgaaggtgta tatagtgaac cccgccccat tggcaccaga tacctgactc gtaatctgta a Amino acid sequences of capsid protein VP1 [Adeno-associated virus 9] (GenBank: AAS99264.1; UniProt Q6JC40) MAADGYLPDW LEDNLSEGIR EWWALKPGAP QPKANQQHQD NARGLVLPGY KYLGPGNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LKYNHADAEF QERLKEDTSF GGNLGRAVFQ AKKRLLEPLG LVEEAAKTAP GKKRPVEQSP QEPDSSAGIG KSGAQPAKKR LNFGQTGDTE SVPDPQPIGE PPAAPSGVGS LTMASGGGAP VADNNEGADG VGSSSGNWHC DSQWLGDRVI TTSTRTWALP TYNNHLYKQI SNSTSGGSSN DNAYFGYSTP WGYFDFNRFH CHFSPRDWQR LINNNWGFRP KRLNFKLFNI QVKEVTDNNG VKTIANNLTS TVQVFTDSDY QLPYVLGSAH EGCLPPFPAD VFMIPQYGYL TLNDGSQAVG RSSFYCLEYF PSQMLRTGNN FQFSYEFENV PFHSSYAHSQ SLDRLMNPLI DQYLYYLSKT INGSGQNQQT LKFSVAGPSN MAVQGRNYIP GPSYRQQRVS TTVTQNNNSE FAWPGASSWA LNGRNSLMNP GPAMASHKEG EDRFFPLSGS LIFGKQGTGR DNVDADKVMI TNEEEIKTTN PVATESYGQV ATNHQSAQAQ AQTGWVQNQG ILPGMVWQDR DVYLQGPIWA KIPHTDGNFH PSPLMGGFGM KHPPPQILIK NTPVPADPPT AFNKDKLNSF ITQYSTGQVS VEIEWELQKE NSKRWNPEIQ YTSNYYKSNN VEFAVNTEGV YSEPRPIGTR YLTRNL CE1 CASQ2 enhancer PMID: 25195597 CGGTACCGGCGCGCCAGTAGAAAAACAGCCAAGCTAGGGAGGCTGGGAGGCCAAGCCCCAGATA CCTTACATAGCTCTGCTCAGCCTCTGTCTCATTAGGAACTCCATTTTTAGGATGCAGTTGTTTC AGGCTAAAAATAAATCATGCAATGAATAAAAAAGTTAGATACGACACTGTAGAGGGATTCGCTG ATACAGTCTGTCCGAACGCGTGGTACC CE2 TNNT2enhancer ctcagtccattaggagccagtagcctggaagatgtctttacccccagcatcagttcaagtggag cagcacataactcttgccctctgccttccaagattctggtgctgagacttatggagtgtcttgg aggttgccttctgccccccaaccctgctcccagctggccctcccaggcctgggttgctggcctc tgctttatcaggattctcaagagggacagctggtttatgttgcatgactgttccctgcatatct gctctggttttaaatagcttatctgagcagctggaggaccacatgggcttatatggcgtggggt acatgttcctgtagccttgtccctggcacctgccaaaatagcagccaacaccccccacccccac cgccatccccctgccccacccgtcccctgtcgcacattcctccctccgcagggctggctcacca ggccccagccc CCP NPPAcore gggctataaaaagaggcggcactgggcagctgggagacagggacagacgtaggccaagagaggg gaaccagagag ME1 ACTA1 enhancer CGACTCCCTCTTCCCGGTAGTCGCAAGTGGGAGTTTGGGGATCTGAGCAAAGAACCCGAAGAGG AGTTGAAATATTGGAAGTCAGCAGTCAGGCACCTTCCCGAGCGCCCAGGGCGCTCAGAGTGGAC ATGGTTGGGGAGGCCTTTGGGACAGGTGCGGTTCCCGGAGCGCAGGCGCACACATGCACCCACC GGCGAACGCGGTGACCCTCGCCCCACCCCATCCCCTCCGGCGGGCAACTGGGTCGGGTCAGGAG GGGCAAACCCGCTAGGGAGACACTCCATATACGGCCCGGCCCGCGTTACCTGGGACCGGGCCAA CCCGCTCCTTCTTTGGTCAACGCAGGGGACCCGGGCGGGGGCCCAGGCCGCGAACCGGCCGAGG GAGGGGGCTCTAGTGCCCAACACCCAAATATGGCTCGAGAAGGGCAGCGACATTCCTGCGGGGT GGCGCGGAGGGA UE CMVfr3 PMID: 35482470 ATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGG GAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTG ACGCAAATGGGCGGTAGGCGTGTACGGTGGG UCP SCP3 PMID: 26872062 AGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGTCCGCCTGGAGACCTCGAGCCGAGTG GTCGTGCCTCCATAGAA SMP (full promoter) SPC5-12 PMID: 10096290 GGCCGTCCGCCTTCGGCACCATCCTCACGACACCCAAATATGGCGACGGGTGAGGAATGGTGGG GAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTGTTGGCGCTCTAAAAATAACT CCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCCAAATATGGCGACGGTTCCTCACCC GTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGGCCGCATTCCTGGGGGCCGGGCGGTGCTCCC GCCCGCCTCGATAAAAGGCTCCGGGGCCGGCGGCGGCCCACGAGCTACCCGGAGGAGCGGGAGG CGCCAAGCTCTAGA TNNT2 (small promoter piece) TNNT2core ACATGCCTGCTTAAAGCCCTCTCCATCCTCTGCCTCACCCAGTCCCCGCTGAGACTGAGCAGAC GCCTCCAGGATCTGTCGGCAG TNNT2 (full promoter) PMID: 25082846 CTCAGTCCATTAGGAGCCAGTAGCCTGGAAGATGTCTTTACCCCCAGCATCAGTTCAAGTGGAG CAGCACATAACTCTTGCCCTCTGCCTTCCAAGATTCTGGTGCTGAGACTTATGGAGTGTCTTGG AGGTTGCCTTCTGCCCCCCAACCCTGCTCCCAGCTGGCCCTCCCAGGCCTGGGTTGCTGGCCTC TGCTTTATCAGGATTCTCAAGAGGGACAGCTGGTTTATGTTGCATGACTGTTCCCTGCATATCT GCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGGCGTGGGGT ACATGTTCCTGTAGCCTTGTCCCTGGCACCTGCCAAAATAGCAGCCAACACCCCCCACCCCCAC CGCCATCCCCCTGCCCCACCCGTCCCCTGTCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCA GGCCCCAGCCCACATGCCTGCTTAAAGCCCTCTCCATCCTCTGCCTCACCCAGTCCCCGCTGAG ACTGAGCAGACGCCTCCAGGATCTGTCGGCAG TNNT2ddd (full promoter with ~200bp deleted from the end and middle i.e. length optimized TNNT2) TCCCAGCTGGCCCTCCCAGGCCTGGGTTGCTGGCCTCTGCTTTATCAGGATTCTCAAGAGGGAC AGCTGGTTTATGTTGCATGACTGTTCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAG CAGCTGGAGGACCACATGGGCTTATATGGCGTGGGGTACATGTTCCTGTAGCCTTGTCCCTGGC ACCTGCCAAAATAGCAGCCAACACCTCCCCTGTCGCACATTCCTCCCTCCGCAGGGCTGGCTCA CCAGGCCCCAGCCCACATGCCTGCTTAAAGCCCTCTCCATCCTCTGCCTCACCCAGTCCCCGCT GAGACTGAGCAGACGCCTCCAGGATCTGTCGGCAG

[0002] Table 2. The table presents the top ten enriched peptide motifs from each third round of both DNA and RNA selections at the gDNA and cDNA levels.

[0003] Table 3. uORF sequences. N = A / T / G / C. Y=A / G. n = 0-6. Name SEQ NO Sequence Kozak 1 GCCATGG ACC-uORF 2 ACCATGG TCT uORF 3 TCTATGG TCT-Stop 4 TCTATGGGTTGAA ACC-Stop 5 ACCATGGGTTGAA ACC-1A 6 ACCATGTGA AAC-2A 7 ACCATGGGTTGA AAC-3A 8 ACCATGGGTGAGTGA AAC-4A 9 ACCATGGGTGAGATCTGA AAC-5A 10 ACCATGGGTGAGATCCTGTGA AAC-6A 11 ACCATGGGTGAGATCCTGTTCTGA AAC-7A 12 ACCATGGGTGAGATCCTGTTCATCTGA AAC-8A 13 ACCATGGGTGAGATCCTGTTCATCCTGTGA Consensus-short 14 NNNATGG Consensus-long 15 NNNATGGNN(NNN)nTGY(N)

Claims

Claims 1. An adenovirus associated virus 9 (AAV9)-based viral particle, said viral particle comprising in its genome an expression cassette for transduction of a coding sequence of a gene of interest into a cardiomyocyte, said AAV9-based viral particle comprising a variant capsid protein comprising an insertion of 1-10 amino acid residues, preferably 6-8 amino acid residues, in one or more variable regions selected from VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, and VR-VII.

2. The AAV9-based viral particle of claim 1, whereby the variant capsid protein comprises an insertion of AERYTKY, NRVAVRP, PDRFGRP, and / or RGDFRAS in one or more of VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, and / or VR-VII.

3. The AAV9-based viral particle according to claim 1 or 2, comprising a variant capsid protein comprising an insertion of AERYTKY, NRVAVRP, PDRFGRP, RGDFRAS, or a combination thereof, in two or more variable regions selected from VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, and VR-VII, preferably VR-II and VR-VI, whereby only one of the indicated peptides is inserted in each variable region.

4. The AAV9-based viral particle of any one of claims 1-3, whereby the variant capsid protein comprises an insertion of AERYTKY, NRVAVRP, PDRFGRP, or RGDFRAS in VR-VI.

5. The AAV9-based viral particle of any one of claims 1-4, for use in a method of treatment of a heart disease, preferably whereby said viral particle is locally administered to the heart.

6. The AAV9-based viral particle for use according to claim 5, whereby said viral particle is injected or infused into the myocardium, into a coronary artery, into the coronary venous system, or a combination thereof.

7. The AAV9-based viral particle for use according to claim 5 or 6, whereby said viral particle is administered by direct intramyocardial injection.

8. The AAV9-based viral particle for use according to any one of claims 5-7, whereby said expression cassette comprises a promoter sequence, a transcribed region and, optionally, a 3' untranslated region and / or one or more posttranscriptional regulatory elements.

9. The AAV9-based viral particle for use according to any one of claims 5-8, whereby said expression cassette is optimized for expression in human cardiomyocytes.

10. The AAV9-based viral particle for use according to any one of claims 5-9, whereby said expression cassette comprises a cardiomyocyte-specific promoter, such as a cardiac troponin C promoter, a cardiac troponin I promoter, a cardiac troponin T2 (TNNT2) promoter, a cardiomyocyte-specific Na(+)-Ca(2+) exchange promoter such as NCX1, or a cardiac myosin light chain 2 promoter.

11. A pharmaceutical composition, comprising the AAV9-based viral particle of any one of claims 1-4, and a pharmacologically acceptable excipient.

12. The pharmaceutical composition of claim 11, for use in a method of treatment of an individual suffering from a heart disease.

13. A method of producing the AAV9-based viral particle according to any one of claims 1-4, the method comprising a) transfecting a producer cell line with a transfer plasmid, comprising at least an AAV-based genome comprising an expression cassette that is flanked on both sides by ITR sequences, whereby said producer cell line expresses AAV9-based rep and cap open reading frames, and adenovirus E4, E2A and, preferably E1A proteins and adenovirus viral-associated (VA) RNA; b) culturing said transfected producer cell, whereby the producer cell produces said AAV9-based viral particle; and c) harvesting said AAV9-based viral particle and, optionally, purifying said AAV9-based viral particle.

14. The method of claim 13, whereby said adenovirus E4, E2A and, preferably E1A proteins, and adenovirus viral-associated (VA) RNA are provided by a second plasmid.

15. The method of claim 13 or 14, whereby said producer cell is an eukaryotic cell, preferably a mammalian cell such as a human cell.

Citation Information

Patent Citations

  • Beam shifting surface plasmon resonance system and method

    US20040017572A1

  • Recombinant adeno-associated viruses for CNS or muscle delivery

    WO2022076750A2