Cytotoxic CD4+ t cells with no / low il-10 secretion

Abstract

Provided are ex vivo methods of generating a population of cytotoxic CD4+ T-cells comprising contacting a population of CD4+ T-cells with an anti-CD3 antibody or a fragment or equivalent thereof, and an anti-CD28 antibody or a fragment or equivalent thereof, in the presence of IL-27, and optionally wherein the population of CD4+ T cells are naive CD4+ T cells or cytotoxic CD4+ T cells.

Description

Aty. Dkt. No.: 116639-3010CYTOTOXIC CD4+ T CELLS WITH NO / LOW IL-10 SECRETIONCROSS-REFERENCE TO RELATED PATENT APPLICATION

[0001] This application claims priority under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 707,604, filed October 15, 2024 and U.S. Provisional Application No. 63 / 806,641, filed May 15, 2025, and the entire contents of each of which are incorporated herein by reference.BACKGROUND

[0002] The immune system has evolved an intricate system of checks and balances to simultaneously protect the body from a diverse array of foreign pathogens while promoting tolerance that protects against attack of one’s own cells or tissues.

[0003] Regulatory CD4+ T-cells (T-regs) are central mediators of immune tolerance playing an important role in preventing self-reactivity including inflammation. Impaired T-reg function can lead to the development and progression of autoimmune disorders. Improved engineered T-cells are needed for treating various diseases, including cancers, autoimmune diseases and food allergies.SUMMARY OF THE DISCLOSURE

[0004] The present disclosure relates to particular subsets of Granzyme and / or perforin positive CD4+ T-cells, methods of isolating, generating, culturing and expanding these cells, compositions comprising, or alternatively consisting essentially of, or yet further consisting of these cells, and use of the cells and compositions, including methods of treatment of a disease by administering these cells alone or in combination with other therapies.

[0005] An aspect of this disclosure is directed to an ex vivo method of generating a population of cytotoxic CD4+ T-cells comprising, or alternatively consisting essentially of, or yet further consisting of contacting a population of CD4+ T-cells with an anti-CD3 antibody or a fragment or equivalent thereof, and an anti-CD28 antibody or a fragment or equivalent thereof, in the presence of IL-27. In some embodiments, the population of CD4+ T cells are naive CD4+ T cells. In some embodiments, the population of CD4+ T cells are cytotoxic CD4+ T cells. In some embodiments, the population of naive or cytotoxic CD4+ T-cells is obtained by negative enrichment.Aty. Dkt. No.: 116639-3010

[0006] In some embodiments, the population of naive or cytotoxic CD4+ T-cells comprises, or alternatively consists essentially of, or yet further consists of one or more of naive CD4+ T-cells, Thl T-cells, Thl7 T-cells, and T-regulatory cells. In some embodiments, the population of naive or cytotoxic CD4+ T-cells is substantially homogenous.

[0007] In some embodiments, the population of naive or cytotoxic CD4+ T-cells is isolated from an in vitro culture system comprising, or alternatively consisting essentially of, or yet further consisting of a tumor specimen or tumor cell-line and a population of effector T-cells.

[0008] In some embodiments, the tumor or cancer specimen has been surgically removed from an animal having a tumor or cancer.

[0009] In some embodiments, the population of naive or cytotoxic CD4+ T-cells has been isolated from a biological sample from an animal having a tumor, a cancer, or an autoimmune disease.

[0010] In some embodiments, the biological sample is a fluid or tissue sample from the animal, optionally wherein the biological sample is a fluid or tissue sample from a microenvironment surrounding the tumor.

[0011] In some embodiments, the animal is a human patient diagnosed with a cancer or an autoimmune disease.

[0012] In some embodiments, the contacting is done in the presence of between about 10 ng / mL to about 30 ng / mL of IL-27 and in the absence of TGF beta and retinoic acid.

[0013] In some embodiments, the anti-CD3 antibody or the fragment or equivalent thereof is bound to a solid support, optionally where the solid support is a cell culture container.

[0014] In some embodiments, the anti-CD3 antibody or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |ig / mL.

[0015] In some embodiments, the anti-CD28 antibody or the fragment or equivalent thereof is soluble anti-CD28 antibody or the fragment or equivalent thereof.

[0016] In some embodiments, the anti-CD28 antibody or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |ig / mL.

[0017] In some embodiments, the contacting is done between 2 days and 5 days or until one or more of the cells of the population are Granzyme B positive.Atty. Dkt. No.: 116639-3010

[0018] In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of isolating the population of CD4+ T-cells.

[0019] In one aspect, provided is a population of CD4+ T-cells prepared by a method described in this disclosure. In some embodiments, the population is substantially homogeneous.

[0020] In some embodiments, at least 50%, or alternatively at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 99% of the population are Granzyme B positive.

[0021] In some embodiments, at least 50%, or alternatively at least 60%, or at least 70%, or at least 80%, or at least 90%, of the CD4+ cytotoxic T-cells are perforin positive.

[0022] Another aspect of the disclosure is directed to a composition comprising, or alternatively consisting essentially of, or yet further consisting of the population of CD4+ cells described herein, and a carrier and / or a cryopreservative or a stabilizer. In some embodiments, the carrier is a pharmaceutically acceptable carrier.

[0023] Another aspect of the disclosure is directed to a composition comprising, or alternatively consisting essentially of, or yet further consisting of Granzyme B+, Perforin+, FoxP3-, IL-10low, Runx3+ and ThPOK+ T-cells.

[0024] In some embodiments, the T-cells are IL-10 deficient.

[0025] In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of a pharmaceutically acceptable carrier and / or a cryopreservative or stabilizer.

[0026] In some embodiments, the population is substantially homogeneous.

[0027] In some embodiments, the T-cells are mammalian cells. In some embodiments, the T- cells are human cells.

[0028] Another aspect of the disclosure is directed to a method for treating a tumor or cancer or augmenting an anti-cancer immune response in a subject in need thereof, comprising, or alternatively consisting essentially of, or yet further consisting of administering an effective amount of a CD4+ T-cell population of the present disclosure or the composition of the present disclosure to the subject, thereby treating the tumor or the cancer.

[0029] In some embodiments, the population of the present disclosure or the composition of the present disclosure comprises cells autologous to the subject.Atty. Dkt. No.: 116639-3010

[0030] In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of administering an effective amount of one or more cytoreductive therapy and / or immunotherapy to the subject, prior to, concurrently or subsequent to administration of the effective amount of the population or the composition.

[0031] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a canine, feline, or a human patient, and wherein the effective amount of the population of cells or composition is species-specific to the mammal.

[0032] Another aspect of the disclosure is directed to a method for treating an undesirable or aberrant immune response in a subject in need thereof, comprising, or alternatively consisting essentially of, or yet further consisting of administering an effective amount of any one of the populations disclosed herein or the compositions disclosed herein to the subject, thereby treating the undesirable or aberrant immune response. In some embodiments, the undesirable or aberrant immune response comprises an autoimmune disease or condition or an allergic response.

[0033] In some embodiments, the populations disclosed herein or the compositions disclosed herein comprise cells autologous to the subject.

[0034] In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of administering an effective amount of one or more immunosuppressive therapy.

[0035] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a canine, feline, or a human patient, and wherein the effective amount of the population of cells or composition is species-specific to the mammal. In some embodiments, the subject is a human.

[0036] Another aspect of the disclosure is directed to an ex vivo method for activating a CD4+ T-cell comprising, or alternatively consisting essentially of, or yet further consisting of contacting the T-cell with an anti-CD3 antibody or a fragment or equivalent thereof, and an anti-CD28 antibody or a fragment or equivalent thereof, in the presence of IL-27.

[0037] In some embodiments, the CD4+ T-cell is an engineered T-cell. In some embodiments, the T cell is a CAR-T cell.

[0038] In some embodiments, the contacting is done in the presence of between about 10 ng / mL to about 30 ng / mL of IL-27 and in the absence of TGF beta and retinoic acid.Aty. Dkt. No.: 116639-3010

[0039] In some embodiments, the anti-CD3 antibody or the fragment or equivalent thereof is bound to a solid support, optionally wherein the solid support is a cell culture container.

[0040] In some embodiments, the concentration of the anti-CD3 antibody or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |ig / mL.

[0041] In some embodiments, the anti-CD28 antibody, or the fragment or equivalent thereof is soluble.

[0042] In some embodiments, the concentration of the anti-CD28 antibody, or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |ig / mL.

[0043] In some embodiments, the contacting is done between 2 days and 5 days, or until one or more of the cells of the population are Granzyme B positive.

[0044] In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of isolating the activated T-cells.

[0045] Another aspect of the disclosure is directed to a composition comprising a population of T-cells, wherein the population of T-cells comprise T-cells that display the following marker profile: CD4+, Granzyme B+, Perforin , FoxP3‘, IL'10low, Runx3+and ThPOK+.

[0046] In some embodiments, the T-cells are IL-10 deficient T-cells.

[0047] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier and / or a cryopreservative or stabilizer.

[0048] In some embodiments, the population of T-cells is substantially homogeneous.

[0049] In some embodiments, the T-cells are mammalian cells, optionally human cells.

[0050] Another aspect of the disclosure is directed to a method for treating allergy in a subject in need thereof, comprising, or alternatively consisting essentially of, or yet further consisting of administering an effective amount of the populations or the compositions of the present disclosure to the subject, thereby treating the allergy.

[0051] In some embodiments, the allergy is selected from a pollen allergy, a food allergy, a medication allergy, latex allergy, an insect allergy, a mold allergy, or a dust allergy.

[0052] In some embodiments, the allergy is a food allergy selected from a group consisting of peanut allergy, milk (lactose or milk protein) allergy, egg allergy, tree nuts allergy, fish allergy, shellfish allergy, soy allergy, and wheat (gluten) allergy.Atty. Dkt. No.: 116639-3010BRIEF DESCRIPTION OF THE FIGURES

[0053] FIGs. 1A-1E. IL-27 induces cytotoxic molecules in naive CD4+ T cells.(A)Representative plots of intracellular staining of GZMB and PRF1 followed by flow cytometric analysis of CD4+ T cells activated for three days in various conditions, or naive CD8+ T cells (left). Bar graph (right) shows the mean + / - SEM, n = 4. B) Histograms (left) and bar graphs (right) of RUNX3 protein levels evaluated as a function of mean fluorescent intensity (MFI). Representative plots and the means ± SEM are presented (right, n = 5). (C) Histograms (left) and bar graphs (right) of TBX21 protein levels evaluated as a function of mean fluorescent intensity (MFI). Representative plots and means ± SEM are presented (right, n = 5). D) IL- 10 expression was evaluated following PMA / Ionomycin activation in the presence of Golgi Stop. Bar graphs show the means ± SEM are presented (right, n = 5). E) IFNy secretion was evaluated following PMA / Ionomycin activation in the presence of Golgi Stop. Bar graphs show the means ± SEM are presented (right, n = 5).

[0054] FIGs. 2A-2D. Proteomic profiling of IL-27 polarized CD4+ T cells elucidates distinct and overlapping gene expression signatures compared to Thl cells. (A) Flow cytometric and mass spectrometric analysis of RUNX3, GZMB, and PRF1 protein levels in samples generated ultimately for proteomic profiling. Relative expression is relative to the mean of all samples. (B) Heatmap of the 669 proteins of the 6,209 quantified found to be differentially abundant across the various CD4 T cell types. Supplemental Data 1 and Table 1 contain the interactive and all data, respectively. (C) Volcano plot of differentially abundant proteins between Thl and IL-27 conditions. A nominal p value of 0.01 was used for the threshold. Differential and / or biologically relevant proteins are labeled. (D) Select normalized enrichment scores (NES) for C2 gene sets enriched in Thl (green) or IL-27 (teal) proteomes.* indicates a p value of < 0.001. R, reactome, B, Biocarta. All gene sets can be found in Supplemental Table 2.

[0055] FIGs. 3A-3D. IFNy signaling is not required for cytotoxicity in IL-27 polarized CD4+ T cells. (A) Representative plots of intracellular staining of IFNy followed by flow cytometric analysis of CD4+T cells activated for three days in various conditions (left). Bar graph (right) shows mean % positive + / - SEM, n = 4. SSC, side scatter. (B) Histograms (left) and bar graphs (right) of TBX21 protein levels evaluated as a function of mean fluorescent intensity (MFI). Representative plots and means ± SEM are presented (right, n = 3). (C) Histograms (left) and bar graphs (right) of RUNX3 protein levels evaluated as a function ofAty. Dkt. No.: 116639-3010 mean fluorescent intensity (MFI). Bar graphs show the means ± SEM are presented (right, n = 4). (D) Representative plots of intracellular staining of GZMB and PRF1 followed by flow cytometric analysis of CD4+T cells activated for three days in various conditions (left). Bar graph (right) shows mean + / - SEM, n = 4.

[0056] FIGs. 4A-4E. TGF impairs the expression of GZMB and PRF1 without affecting RUNX3 or TBX21 levels. (A) Representative plots of intracellular staining of GZMB and PRF1 followed by flow cytometric analysis of CD4+T cells activated for three days in various conditions (left). Bar graph (right) shows mean + / - SEM, n = 3. (B) Histograms (left) and bar graphs (right) of RUNX3 protein levels evaluated as a function of mean fluorescent intensity (MFI). Representative plots and means ± SEM are presented (right, n = 3). (C) Histograms (left) and bar graphs (right) of TBX21 protein levels evaluated as a function of mean fluorescent intensity (MFI). Representative plots and means ± SEM are presented (right, n = 3). (D) IFNy secretion in the presence or absence of TGFP was evaluated following PMA / Ionomycin activation in the presence of Golgi Stop. Bar graphs show the means ± SEM are presented (right, n = 3). (E) FOXP3 levels were evaluated three days into polarization with or without TGFp. Bar graphs show the means ± SEM are presented (right, n = 3).

[0057] FIGs. 5A-5C. IL-27 signaling and transcriptional control of Gzmb expression in IL-27-polarized CD4+ T cells. (A) Representative histograms (top) for respective STAT phosphorylation sites in naive CD4+T cells activated in the labeled conditions. Bar graphs below show the mean ± SEM, n = 3. (B) Genome browser tracks showing open chromatin (ATAC-seq) and STAT3 ChIP signals in IL-27 polarized CD4+ T cells, BATF and IRF4 ChlP-seq in Th2s, and TBX21 ChlP-seq in Thl cells. (C) Bar graph showing 1110 (focus of Zhang et al.23) and Gzmb mRNA levels in CD4+ T cells treated with IL-27 for 72 hours across various knockout mice. Mean ± SEM of replicate measurements are shown (see Methods). Dashed line delineates a 2-fold change in gene expression compared to wildtype mice.

[0058] FIGs. 6A-6D. In vitro IL-27-differentiated CD4+ T cells maintain in vivo Granzyme B and perforin secretion capacity. (A) CD44 and CD62L surface levels (top left panel) or GZMB and PRF1 expression (bottom left panels) were assessed by flow cytometry to evaluate T cell differentiation before T cell injection. Representative plots and means ± SEM are presented (right, n=2). (B) Total number of live cells in the spleen (SP) andAtty. Dkt. No.: 116639-3010 peripheral lymph nodes (pLN) eleven days after T cell transfer. (C) Percentage of TCRP+CD4+of CD45+cells and absolute TCRP+CD4+numbers from the spleen and lymph nodes 11 days after T cell transfer. Representative plots and means ± SEM are presented, n = 10.(D) Percentage and absolute GZMB and / or PRF1 positive CD4+T cells recovered eleven days after T cell transfer. Means ± SEM are presented, n = 10.

[0059] FIGs. 7A-7B. IL-27-treated CD4+ T cell directly kill target cells. (A) Percentage of GZMB expression of CAR-CD4+ T cells treated with IL-27 or ThO conditions prior to, and for three days of, co-culture with MC38-CD19 cells were assessed by flow cytometry. Representative plots and mean ± SEM are presented, n=4. (B) Live MC38-CD19 cell counts across timepoints following co-culture with CD4fT cells under IL-27 or ThO conditions. The number of MC38-CD19 cells negative for Live / Dead staining was quantified at 0, 24, 48, and 72 hours of culture via flow cytometry. Representative plots present mean ± SEM (n::::4). n.d.: no data available.DETAILED DESCRIPTIONDefinitions

[0060] As it would be understood, the section or subsection headings as used herein is for organizational purposes only and are not to be construed as limiting and / or separating the subject matter described.

[0061] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods, devices, and materials are now described. All technical and patent publications cited herein are incorporated herein by reference in their entirety. Nothing herein is to be construed as an admission that the disclosure is not entitled to antedate such disclosure by virtue of prior disclosure.

[0062] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in EnzymologyAtty. Dkt. No.: 116639-3010(Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1 : A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Techique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); Herzenberg et al. eds (1996) Weir’s Handbook of Experimental Immunology; Manipulating the Mouse Embryo: A Laboratory Manual, 3rd edition (Cold Spring Harbor Laboratory Press (2002)); Sohail (ed.) (2004) Gene Silencing by RNA Interference: Technology and Application (CRC Press).

[0063] As used in the specification and claims, the singular form “a,” “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes a plurality of cells, including mixtures thereof.

[0064] As used herein, the term “comprising” is intended to mean that the compounds, agents, compositions and methods include the recited elements, but not exclude others. “Consisting essentially of’ when used to define compounds, agents, compositions and methods, shall mean excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants, e.g., from the isolation and purification method and pharmaceutically acceptable carriers, preservatives, and the like. “Consisting of’ shall mean excluding more than trace elements of other ingredients. Embodiments defined by each of these transition terms are within the scope of this technology.

[0065] All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied (+) or (-) by increments of 1, 5, or 10%. It is to be understood, although not always explicitly stated that all numerical designations are preceded by the term “about.” It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.Atty. Dkt. No.: 116639-3010

[0066] The term “about,” as used herein when referring to a measurable value such as an amount or concentration and the like, is meant to encompass variations of 20%, 15%, 10%, 5%, 3%, 2%, 1 %, 0.5%, or even 0.1 % of the specified amount.

[0067] As used herein, comparative terms as used herein, such as high, low, increase, decrease, reduce, or any grammatical variation thereof, can refer to certain variation from the reference. In some embodiments, such variation can refer to about 10%, or about 20%, or about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 1 fold, or about 2 folds, or about 3 folds, or about 4 folds, or about 5 folds, or about 6 folds, or about 7 folds, or about 8 folds, or about 9 folds, or about 10 folds, or about 20 folds, or about 30 folds, or about 40 folds, or about 50 folds, or about 60 folds, or about 70 folds, or about 80 folds, or about 90 folds, or about 100 folds or more higher than the reference. In some embodiments, such variation can refer to about 1%, or about 2%, or about 3%, or about 4%, or about 5%, or about 6%, or about 7%, or about 8%, or about 0%, or about 10%, or about 20%, or about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 75%, or about 80%, or about 85%, or about 90%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% of the reference.

[0068] As will be understood by one skilled in the art, for any and all purposes, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Furthermore, as will be understood by one skilled in the art, a range includes each individual member.

[0069] “Optional” or “optionally” means that the subsequently described circumstance may or may not occur, so that the description includes instances where the circumstance occurs and instances where it does not.

[0070] As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).

[0071] “Substantially” or “essentially” means nearly totally or completely, for instance, 95% or greater of some given quantity. In some embodiments, “substantially” or “essentially” means 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9%.

[0072] As used herein, the phrase “substantially homogeneous” refers to a sample or preparation in which the biological material of interest (e.g., cells, proteins, nucleic acids, or other biomolecules) is present with a high degree of purity and uniformity, such that theAtty. Dkt. No.: 116639-3010 presence of other biological species, contaminants, or variants is minimal and does not materially affect the intended diagnostic, therapeutic, or research utility of the sample. In some embodiments, substantially homogeneous refers to a population in which at least about 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% of the constituents share one or more defining characteristics — such as genetic identity, biochemical activity, structural form, or immunological marker profile. Minor amounts of other components or subtypes may be present, provided they do not significantly interfere with the functional properties, signal detection, or analytical accuracy in the biomedical application.

[0073] The terms or “acceptable,” “effective,” or “sufficient” when used to describe the selection of any components, ranges, dose forms, etc. disclosed herein intend that said component, range, dose form, etc. is suitable for the disclosed purpose.

[0074] A “composition” is intended to mean a combination of active agent and another compound or composition, inert (for example, a detectable agent or label) or active, such as an adjuvant , diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers.

[0075] Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri, tetraoligosaccharides, and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1-99.99% by weight or volume. Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. Representative amino acid components, which can also function in a buffering capacity, include alanine, arginine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like. Carbohydrate excipients are also intended within the scope of this technology, examples of which include but are not limited to monosaccharides such as fructose, maltose, galactose, glucose, D- mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol.Atty. Dkt. No.: 116639-3010

[0076] A composition as disclosed herein can be a pharmaceutical composition. A “pharmaceutical composition” is intended to include the combination of an active agent with a carrier, inert or active, making the composition suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo.

[0077] “Pharmaceutically acceptable carriers” refers to any diluents, excipients, or carriers that may be used in the compositions disclosed herein. Pharmaceutically acceptable carriers include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances, such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences, Mack Publishing Company, a standard reference text in this field. They may be selected with respect to the intended form of administration, that is, oral tablets, capsules, elixirs, syrups and the like, and consistent with conventional pharmaceutical practices.

[0078] A combination as used herein intends that the individual active ingredients of the compositions are separately formulated for use in combination and can be separately packaged with or without specific dosages. The active ingredients of the combination can be administered concurrently or sequentially.

[0079] An “effective amount” is an amount sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications, or dosages. Such delivery is dependent on a number of variables including the time period for which the individual dosage unit is to be used, the bioavailability of the therapeutic agent, the route of administration, etc. It is understood, however, that specific dose levels of the therapeutic agents disclosed herein for any particular subject depends upon a variety of factors including the activity of the specific agent employed, bioavailability of the agent, the route of administration, the age of the animal and its body weight, general health, sex, the diet of the animal, the time of administration, the rate of excretion, the drug combination, and the severity of the particular disorder being treated and form of administration. In general, one will desire to administer an amount of the agent that is effective to achieve a serum levelAtty. Dkt. No.: 116639-3010 commensurate with the concentrations found to be effective in vivo. These considerations, as well as effective formulations and administration procedures are well known in the art and are described in standard textbooks.

[0080] “Therapeutically effective amount” of an agent refers to an amount of the agent that is an amount sufficient to obtain a pharmacological response; or alternatively, is an amount of the agent that, when administered to a patient with a specified disorder or disease, is sufficient to have the intended effect, e.g., treatment, alleviation, amelioration, palliation or elimination of one or more manifestations of the specified disorder or disease in the patient. A therapeutic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a therapeutically effective amount may be administered in one or more administrations.

[0081] When the disease is cancer, the following clinical endpoints are non-limiting examples of treatment: (1) elimination of a cancer in a subject or in a tissue / organ of the subject or in a cancer loci; (2) reduction in tumor burden (such as number of cancer cells, number of cancer foci, number of cancer cells in a foci, size of a solid cancer, concentrate of a liquid cancer in the body fluid, and / or amount of cancer in the body); (3) stabilizing or delay or slowing or inhibition of cancer growth and / or development, including but not limited to, cancer cell growth and / or division, size growth of a solid tumor or a cancer loci, cancer progression, and / or metastasis (such as time to form a new metastasis, number of total metastases, size of a metastasis, as well as variety of the tissues / organs to house metastatic cells); (4) less risk of having a cancer growth and / or development; (5) inducing an immune response of the patient to the cancer, such as higher number of tumor-infiltrating immune cell, higher number of activated immune cells, or higher number cancer cell expressing an immunotherapy target, or higher level of expression of an immunotherapy target in a cancer cell; (6) higher probability of survival and / or increased duration of survival, such as increased overall survival (OS, which may be shown as 1-year, 2-year, 5-year, 10-year, or 20-year survival rate), increased progression free survival (PFS), increased disease free survival (DFS), increased time to tumor recurrence (TTR) and increased time to tumor progression (TTP). In some embodiments, the subject after treatment experiences one or more endpoints selected from tumor response, reduction in tumor size, reduction in tumor burden, increase in overall survival, increase in progression free survival, inhibiting metastasis, improvement of quality of life, minimization of drug-related toxicity, and avoidance of side-effects (e.g., decreased treatment emergent adverse events). In some embodiments, improvement ofAtty. Dkt. No.: 116639-3010 quality of life includes resolution or improvement of cancer-specific symptoms, such as but not limited to fatigue, pain, nausea / vomiting, lack of appetite, and constipation; improvement or maintenance of psychological well-being (e.g., degree of irritability, depression, memory loss, tension, and anxiety); improvement or maintenance of social well-being (e.g., decreased requirement for assistance with eating, dressing, or using the restroom; improvement or maintenance of ability to perform normal leisure activities, hobbies, or social activities; improvement or maintenance of relationships with family). In some embodiments, improved patient quality of life that is measured qualitatively through patient narratives or quantitatively using validated quality of life tools known to those skilled in the art, or a combination thereof. Additional non-limiting examples of endpoints include reduced hospital admissions, reduced drug use to treat side effects, longer periods off-treatment, and earlier return to work or caring responsibilities. In one aspect, prevention or prophylaxis is excluded from treatment.

[0082] As used herein, the phrase “derived from” means isolated from, purified from, or engineered from, or any combination thereof.

[0083] As used herein, “treating” or “treatment” of a disease in a subject refers to (1) preventing the symptoms or disease from occurring in a subject that is predisposed or does not yet display symptoms of the disease; (2) inhibiting the disease or arresting its development; or (3) ameliorating or causing regression of the disease or the symptoms of the disease. As understood in the art, “treatment” is an approach for obtaining beneficial or desired results, including clinical results. For the purposes of the present technology, beneficial or desired results can include one or more, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of a condition (including a disease), stabilized (i.e., not worsening) state of a condition (including disease), delay or slowing of condition (including disease), progression, amelioration or palliation of the condition (including disease), states and remission (whether partial or total), whether detectable or undetectable. When the disease is cancer, the following clinical end points are non-limiting examples of treatment: reduction in tumor burden, slowing of tumor growth, longer overall survival, longer time to tumor progression, inhibition of metastasis or a reduction in metastasis of the tumor. In one aspect, treatment excludes prophylaxis.

[0084] As used herein, the term “animal” refers to a mammal. In some embodiments, the mammal is a human, a cat, a dog, a cow or a sheep.Atty. Dkt. No.: 116639-3010

[0085] The term “subject,” “host,” “individual,” and “patient” are as used interchangeably herein to refer to animals. In some embodiments, a subject is a human. Any suitable mammal can be treated by a method described herein. Non-limiting examples of mammals include humans, non-human primates (e.g., apes, gibbons, chimpanzees, orangutans, monkeys, macaques, and the like), domestic animals (e.g., dogs and cats), farm animals (e.g., horses, cows, goats, sheep, pigs) and experimental animals (e.g., mouse, rat, rabbit, guinea pig). In some embodiments, a mammal is a human. A mammal can be any age or at any stage of development (e.g., an adult, teen, child, infant, or a mammal in utero). A mammal can be male or female. In some embodiments, a subject is a human. In some embodiments, a subject has, or is diagnosed of having, or is suspected of having, or is at risk of having a disease, such as a cancer.

[0086] “ Cancer”, which is also referred to herein as “tumor”, is a known medically as an uncontrolled division of abnormal cells in a part of the body, benign or malignant. In one embodiment, cancer refers to a malignant neoplasm, a broad group of diseases involving unregulated cell division and growth, and invasion to nearby parts of the body. Non-limiting examples of cancers include carcinomas, sarcomas, leukemia and lymphoma, e.g., colon cancer, colorectal cancer, rectal cancer, gastric cancer, esophageal cancer, head and neck cancer, breast cancer, brain cancer, lung cancer, stomach cancer, liver cancer, gall bladder cancer, or pancreatic cancer. In one embodiment, the term “cancer” refers to a solid tumor, which is an abnormal mass of tissue that usually does not contain cysts or liquid areas, including but not limited to, sarcomas, carcinomas, and certain lymphomas (such as NonHodgkin's lymphoma). In another embodiment, the term “cancer” refers to a liquid cancer, which is a cancer presenting in body fluids (such as, the blood and bone marrow), for example, leukemias (cancers of the blood) and certain lymphomas. In a specific embodiment, the term “cancer” refers to a colon adenocarcinoma.

[0087] Additionally or alternatively, a cancer may refer to a local cancer (which is an invasive malignant cancer confined entirely to the organ or tissue where the cancer began), a metastatic cancer (referring to a cancer that spreads from its site of origin to another part of the body), a non-metastatic cancer, a primary cancer (a term used describing an initial cancer a subject experiences), a secondary cancer (referring to a metastasis from primary cancer or second cancer unrelated to the original cancer), an advanced cancer, an unresectable cancer, or a recurrent cancer. As used herein, an advanced cancer refers to a cancer that hadAtty. Dkt. No.: 116639-3010 progressed after receiving one or more of: the first line therapy, the second line therapy, or the third line therapy.

[0088] The term “contacting” means direct or indirect binding or interaction between two or more. A particular example of direct interaction is binding. A particular example of an indirect interaction is where one entity acts upon an intermediary molecule, which in turn acts upon the second referenced entity. Contacting as used herein includes in solution, in solid phase, in vitro, ex vivo, in a cell and in vivo. Contacting in vivo can be referred to as administering, or administration.

[0089] “Administration” or “delivery” of an oncolytic virus or a composition containing same can be performed in one dose, continuously or intermittently throughout the course of treatment. Methods of determining the most effective means and dosage of administration are known to those of skill in the art and will vary with the composition used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician or in the case of animals, by the treating veterinarian. Suitable dosage formulations and methods of administering the agents are known in the art. Route of administration can also be determined and method of determining the most effective route of administration are known to those of skill in the art and will vary with the composition used for treatment, the purpose of the treatment, the health condition or disease stage of the subject being treated, and target cell or tissue. Non-limiting examples of route of administration include oral administration, intraperitoneal, infusion, nasal administration, inhalation, injection, and topical application. In some embodiments, the administration is administration to a tumor microenvironment. In some embodiments, administering or a grammatical variation thereof also refers to more than one doses with certain interval. In some embodiments, the interval is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year or longer. In some embodiments, one dose is repeated for once, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times or more.

[0090] The term administration shall include without limitation, administration by oral, parenteral (e.g., intramuscular, intraperitoneal, intravenous, intravascular, intraperitoneal, intracerebroventricular (ICV), intrathecal, intracistemal injection or infusion, intracranial, ocular, intradermally, percutaneously, subcutaneous injection, or implant), intratum orally, by inhalation spray nasal, intratracheal, vaginal, rectal, sublingual, urethral (e.g., urethralAty. Dkt. No.: 116639-3010 suppository) or topical routes of administration (e.g., gel, ointment, cream, aerosol, etc.) and can be formulated, alone or together, in suitable dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants, excipients, and vehicles appropriate for each route of administration. The disclosure is not limited by the route of administration, the formulation or dosing schedule.

[0091] An agent of the present disclosure can be administered for therapy by any suitable route of administration. It will also be appreciated that the optimal route will vary with the condition and age of the recipient, and the disease being treated.

[0092] Administration or treatment in “combination” refers to administering two agents such that their pharmacological effects are manifest at the same time. Combination does not require administration at the same time or substantially the same time, although combination can include such administrations.

[0093] The phrase “first line” or “second line” or “third line” refers to the order of treatment received by a patient. First line therapy regimens are treatments given first, whereas second or third line therapy are given after the first line therapy or after the second line therapy, respectively.

[0094] The terms "oligonucleotide" or "polynucleotide" or "portion," or "segment" thereof refer to a stretch of polynucleotide residues which is long enough to use in PCR or various hybridization procedures to identify or amplify identical or related parts of mRNA or DNA molecules. The polynucleotide compositions of this invention include RNA, cDNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, intemucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example,Atty. Dkt. No.: 116639-3010 those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.

[0095] As used herein, the term “purified” does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified nucleic acid, peptide, protein, biological complexes, cell, virus or other active compound is one that is isolated in whole or in part from proteins or other contaminants. Generally, substantially purified peptides, proteins, biological complexes, cell, virus or other active compounds for use within the disclosure comprise more than 80% of all macromolecular species present in a preparation prior to admixture or formulation of the peptide, protein, biological complex, cell, virus or other active compound with a pharmaceutical carrier, excipient, buffer, absorption enhancing agent, stabilizer, preservative, adjuvant or other co-ingredient in a complete pharmaceutical formulation for therapeutic administration. More typically, the peptide, protein, biological complex, cell, virus or other active compound is purified to represent greater than 90%, often greater than 95% of all macromolecular species present in a purified preparation prior to admixture with other formulation ingredients. In other cases, the purified preparation may be essentially homogeneous, wherein other macromolecular species are not detectable by conventional techniques.

[0096] In some embodiments, the term “engineered” or “recombinant” refers to having at least one modification not normally found in a naturally occurring protein, polypeptide, polynucleotide, strain, wild-type strain or the parental host strain of the referenced species. In some embodiments, the term “engineered” or “recombinant” refers to being synthetized by human intervention.

[0097] As used herein, the term “autologous,” in reference to cells refers to cells that are isolated and infused back into the same subject (recipient or host). “Allogeneic” refers to non-autologous cells.

[0098] “Immune cells” include all cells that are produced by hematopoietic stem cells (HSC) including, but not limited to, HSCs, white blood cells (leukocytes), lymphocytes (including T-cells, B cells, and natural killer (NK) cells) and myeloid-derived cells (neutrophils, eosinophils, basophils, monocytes, macrophages, dendritic cells). “Leukocytes” include but are not limited to lymphocytes, granulocytes, monocytes, and macrophages.

[0099] As used herein, the term “T cell” or “T-cell,” refers to a type of lymphocyte that matures in the thymus. T-cells play an important role in cell-mediated immunity and areAtty. Dkt. No.: 116639-3010 distinguished from other lymphocytes, such as B cells, by the presence of a T-cell receptor (TCR) on the cell surface. T-cells may either be isolated or obtained from a commercially available source. “T-cell” includes all types of immune cells expressing CD3. Non-limiting examples of T-cells and markers for isolation thereof including naive T-cells (CCR7+, CD45RA+), double-negative T-cells (CD3+, CD4-, CD8-), CD4+ T-cells (such as but not limited to T-helper (“Th”) cells such as: T-regulatory cells, Tregs (CD25+), Thl cells (CDCR3+, CCR5+), Th2 cells (CXCR4+, CCR3+, CCR4+, CCR5+, CCR7+, CD30+), Thl7 cells (CD4+, IL-17A+) and naive CD4+ T-cells (CD4+, CD45RA+, CD62L+)), CD8+ T- cells, natural killer T-cells, central memory T-cells (CCR7+, CD45RA-), effector memory T- cells (CCR7-, CD45RA-), and gamma-delta T-cells. Natural killer T-cells (NKT) co-express NK-cell markers and a semi-invariant T-cell receptor (TCR). They are implicated in the regulation of immune responses associated with a broad range of diseases. Non-limiting examples of commercially available T-cell lines include lines BCL2 (AAA) Jurkat (ATCC® CRL-2902™), BCL2 (S70A) Jurkat (ATCC® CRL-2900™), BCL2 (S87A) Jurkat (ATCC® CRL-2901™), BCL2 Jurkat (ATCC® CRL-2899™), Neo Jurkat (ATCC® CRL-2898™), TALL-104 cytotoxic human T-cell line (ATCC # CRL-11386). Further examples include but are not limited to mature T-cell lines, e.g., such as Deglis, EBT-8, HPB-MLp-W, HUT 78, HUT 102, Karpas 384, Ki 225, My-La, Se-Ax, SKW-3, SMZ-1 and T34; and immature T- cell lines, e g., ALL-SIL, Bel3, CCRF-CEM, CML-T1, DND-41, DU.528, EU-9, HD- Mar, HPB-ALL, H-SB2, HT-1, JK-T1, Jurkat, Karpas 45, KE-37, KOPT-K1, K-Tl, L-KAW, Loucy, MAT, MOLT-1, MOLT 3, MOLT-4, MOLT 13, MOLT- 16, MT-1, MT -ALL, P12 / Ichikawa, Peer, PER0117, PER-255, PF-382, PFI-285, RPML8402, ST-4, SUP-T1 to T14, TALL-1, TALL-101, TALL-103 / 2, TALL-104, TALL-105, TALL-106, TALL-107, TALL-197, TK-6, TLBR-1, -2, -3, and -4, CCRF-HSB-2 (CCL-120.1), J.RT3-T3.5 (ATCC TIB-153), J45.01 (ATCC CRL-1990), J.CaM1.6 (ATCC CRL-2063), RS4;11 (ATCC CRL- 1873), CCRF-CEM (ATCC CRM-CCL-119); and cutaneous T-cell lymphoma lines, e.g., HuT78 (ATCC CRM-TIB-161), MJ[G11] (ATCC CRL-8294), HuT102 (ATCC TIB-162). Null leukemia cell lines, including but not limited to REH, NALL-1, KM-3, L92-221, are a another commercially available source of immune cells, as are cell lines derived from other leukemias and lymphomas, such as K562 erythroleukemia, THP-1 monocytic leukemia, U937 lymphoma, HEL erythroleukemia, HL60 leukemia, HMC-1 leukemia, KG-1 leukemia, U266 myeloma. Non-limiting exemplary sources for such commercially available cell lines include the American Type Culture Collection, or ATCC, (atcc.org) and the German Collection of Microorganisms and Cell Cultures (dsmz.de).Atty. Dkt. No.: 116639-3010

[0100] A “cytotoxic cell” intends a cell that is capable of killing other cells or microbes. Examples of cytotoxic cells include but are not limited to CD8+ T-cells, certain CD4+ T- cells, double-negative T-cells, gamma delta T-cells, natural-killer (NK) cells, NK T-cells, and neutrophils, which cells are capable of mediating cytotoxicity responses.

[0101] As used herein, “ThPOK” refers to a transcription factor encoded by the Zinc Finger And BTB Domain Containing 7B gene (Genecards: ZBTB7B, HGNC: 18668 NCBI Gene: 51043 Ensembl: ENSG00000160685 OMIM®: 607646 UniProtKB / Swiss-Prot: 015156).

[0102] As used herein, “Granzyme B” refers to a serine protease (Genecards: GZMB, HGNC: 4709 NCBI Gene: 3002 Ensembl: ENSG00000100453 OMIM®: 123910 UniProtKB / Swiss-Prot: P10144). In some embodiments, Granzyme B is detected in intact cells using activity-specific molecular probes, such as cleavable peptide substrates conjugated to a fluorescent reporter and a quencher moiety, wherein fluorescence is restored upon proteolytic cleavage by active intracellular Granzyme B. In some embodiments, Granzyme B detection modalities may include microscopy (e.g., confocal imaging), flow cytometry, or plate-based fluorescence reading, enabling spatial and / or quantitative assessment of enzyme activity within cellular populations. In some embodiments, complementary methods such as intracellular immunoassays or Western blotting can be employed to detect total Granzyme B protein regardless of activity state, while quantitative reverse-transcription PCR (RT-qPCR) can measure Granzyme B mRNA.

[0103] As used herein, “Perforin” refers to a protein with structural similarities to complement component C9 which forms membrane pores that allow the release of granzymes and subsequent cytolysis of target cells. (Genecards: PRF1, HGNC: 9360 NCBI Gene: 5551 Ensembl: ENSG00000180644 OMIM®: 170280 UniProtKB / Swiss-Prot: P14222).

[0104] As used herein, “FOXP3” refers to a forkhead / winged-helix family of transcriptional regulator. (Genecards: FOXP3, HGNC: 6106 NCBI Gene: 50943 Ensembl: ENSG00000049768 OMIM®: 300292 UniProtKB / Swiss-Prot: Q9BZS1). In some embodiments, perforin detection is carried out to assess the cytolytic potential of immune effector cells, such as cytotoxic T lymphocytes and natural killer cells. In some embodiments, total perforin protein is measured using immunoassays, including ELISA formats employing a perforin-specific capture antibody and an enzyme-linked detection antibody to generate a quantifiable optical signal. In some embodiments, perforin expression and molecular weight distribution are analyzed via Western blot, allowing discriminationAtty. Dkt. No.: 116639-3010 between precursor and processed forms using sequence-selective antibodies. In some embodiments, intracellular perforin is measured by flow cytometry following fixation and permeabilization, wherein fluorescently labeled anti-perforin antibodies are applied to stained cell populations for quantitative multiparametric analysis. In some embodiments, perforin gene expression is quantified by reverse transcription quantitative polymerase chain reaction (RT-qPCR).

[0105] As used herein, “IL- 10” refers to a cytokine encoded by Interleukin- 10 gene (Genecards: IL10, HGNC: 5962 NCBI Gene: 3586 Ensembl: ENSG00000136634 OMIM®: 124092 UniProtKB / Swiss-Prot: P22301).

[0106] As used herein, “Runx3” refers to a member of the runt domain-containing family of transcription factors (Genecards: RUNX3, HGNC: 10473 NCBI Gene: 864 Ensembl: ENSG00000020633 OMIM®: 600210 UniProtKB / Swiss-Prot: Q13761).

[0107] The term “CD4+ T-cells” refers to T-cells that express CD4 on their surface and, generally, are ThPOK+ (upregulated); these cells include naive CD4+ T-cells, Thl T-cells, Thl7 T-cells, and T-regulatory cells. It is well understood that surface markers, e.g., CD8aa and CD4, can be identified by antibodies to the listed surface markers, i.e., an anti- CD8a antibody or an anti-CD4 antibody. When used in this context the prefix “anti-” and the descriptor “antibody” refer to an antibody, fragment, derivative, or biological equivalent thereof that recognizes or binds the recited protein, e.g., anti-CD4 antibody recognizes and binds CD4. As used herein, the term “CD8+ cytotoxic T-cell” refers to a cytotoxic T-cell and / or a precursor thereof which is CD8+ and expresses CD8aa on its surface. The CD8aa surface expression is an indicator that these CD8+ cytotoxic T-cells have high affinity to the antigen against which they were generated. For example, those CD8+ cytotoxic T-cell generated against a tumor antigen are necessarily tumor-specific. An “anti-tumor CD8+ cytotoxic T-cell” is understood to be tumor specific. As noted above, this tumor specificity may either be based on the antigen against which the CD8+ cytotoxic T-cell was generated or may be present as a result of an engineered T-cell receptor, such as a chimeric antigen receptor.

[0108] As used herein, “CD8aa” refers to a homodimer of CD8a (also known as CD8a) that may be expressed on the surface of certain T-cells. Non-limiting exemplary amino acid sequences for CD8a can be found in the Uniprot database under accession numbers P01732 (human CD8a); P01731 (mouse CD8a); P33706 (dog CD8a); other homologs of the sameAtty. Dkt. No.: 116639-3010 may also be found in the Uniprot database, i.e., at uniprot.org. “CD8aP” refers to a heterodimer of CD8a and CD8P (also known as CD8b) that is expressed on the surface of CD8+T-cells. Non-limiting exemplary amino acid sequences for CD8P can be found in the Uniprot database under accession numbers P10966 (human CD8P); P10300 (mouse CD8P); P79336 (cat CD8P); other homologs of the same may also be found in the Uniprot database, i.e., at uniprot.org. As used herein, “anti- CD8a” and “anti- CD8P” refer to antibodies or fragments, derivatives, or biological equivalents thereof that recognizes and bind to CD8a and CD8P, respectively. These may be recombinantly expressed, generated by exposing antibody producing cells to CD8a or CD8P, or other means known in the art, using for example, the proteins described herein. Further they can be purchased from commercial vendors, such as but not limited to Becton Dickinson.

[0109] When used herein in reference to one or more cell populations, the term “substantially homogenous” refers to a population that comprises at least 60%, alternatively, at least 65%, or alternatively, at least 70%, or alternatively, at least 75%, or alternatively, at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95% or alternatively at least 98% of the same cell type or the same marker profile. In contrast, the term “clonal” describing a cell population, refers to cells that are genetically identical, i.e. 100% of the same cell type and all originating from a single ancestor.

[0110] In some embodiments, detection of cells characterized by specific marker expression profiles (e.g., Granzyme B+, Perforin , FoxP3 , IL-10low, Runx3+, and ThPOK+) is achieved using multiparametric flow cytometry. In such implementations, cells are stained with a panel of fluorophore-conjugated antibodies or nucleic acid probes selective for these intracellular and / or cell-surface markers, following appropriate fixation and permeabilization for intracellular targets. Fluorescence signals are acquired and analyzed to identify and quantify cells meeting the combined marker profile, thereby enabling discrimination of cytotoxic effector T-cell populations from regulatory and helper subsets. In some embodiments, immunofluorescence microscopy, mass cytometry (CyTOF), or multiplex immunohistochemistry are employed to assess marker co-expression, optionally with spatial resolution in intact tissue sections. In other embodiments, gene expression profiling methods such as RT-qPCR or RNA sequencing are used to quantify transcripts encoding Granzyme B, Perforin, Runx3, and ThPOK, and to confirm low IL-10 and absent FoxP3 transcription, thereby corroborating protein-level findings.Aty. Dkt. No.: 116639-3010[OHl] As used herein, the term “engineered T-cell receptor” refers to a molecule comprising the elements of (a) an extracellular antigen binding domain, (b) a transmembrane domain, and (c) an intracellular signaling domain. In some aspects, an engineered T-cell receptor is a genetically modified TCR, a modified TCR, a recombinant TCR, a transgenic TCR, a partial TCR, a chimeric fusion protein, a chimeric antigen receptor (“CAR”), a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation CAR (also known as a “TRUCK”). In some aspects, the engineered T-cell receptor comprises an antibody or a fragment of an antibody. In particular aspects, the engineered T-cell receptor is a genetically modified TCR or a CAR.

[0112] The term “chimeric antigen receptor” (CAR), as used herein, refers to a fused protein comprising an extracellular domain capable of binding to an antigen, a transmembrane domain derived from a polypeptide different from a polypeptide from which the extracellular domain is derived, and at least one intracellular domain. The “chimeric antigen receptor (CAR)” is also known as a “T-body”, “chimeric receptor”, or “chimeric immune receptor (CIR) ” The “extracellular domain capable of binding to an antigen” means any oligopeptide or polypeptide that can bind to a certain antigen. The “intracellular domain” means any oligopeptide or polypeptide known to function as a domain that transmits a signal to cause activation or inhibition of a biological process in a cell. In certain embodiments, the intracellular domain may comprise, alternatively consist essentially of, or yet further comprise one or more costimulatory signaling domains in addition to the primary signaling domain. The “transmembrane domain” means any oligopeptide or polypeptide known to span the cell membrane and that can function to link the extracellular and signaling domains. A chimeric antigen receptor may optionally comprise a “hinge domain” which serves as a linker between the extracellular and transmembrane domains. Non-limiting exemplary polynucleotide sequences that encode for components of each domain are disclosed herein, e.g.: Hinge domain: IgGl heavy chain hinge sequence:CTCGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCG (SEQ ID NO: 1); Transmembrane domain: CD28 transmembrane region:TTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAA CAGTGGCCTTTATTATTTTCTGGGTG (SEQ ID NO: 2); Intracellular domain: 4-1BB costimulatory signaling region: AAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCA GTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAAtty. Dkt. No.: 116639-3010GAAGGAGGATGTGAACTG (SEQ ID NO: 3); Intracellular domain: CD28 co-stimulatory signaling region: AGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGC CGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCG CAGCCTATCGCTCC (SEQ ID NO: 4); Intracellular domain: CD3 zeta signaling region: AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAA CCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGA CAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACA GTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTT TACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAG GCCCTGCCCCCTCGCTAA (SEQ ID NO: 5).

[0113] Further embodiments of each exemplary domain component include other proteins that have analogous biological function that share at least 70%, or alternatively at least 80% amino acid sequence identity, preferably 90% sequence identity, more preferably at least 95% sequence identity with the proteins encoded by the above disclosed nucleic acid sequences. Further, non-limiting examples of such domains are provided herein.

[0114] As used herein, the term “retinoic acid” refers to a metabolite of vitamin A (retinol) sometimes referred to as “vitamin A acid” or “RA” and having the chemical formula C20H28O2, as well as pharmaceutically acceptable salts and biological equivalents thereof. A non-limiting exemplary structure of retinoic acid is depicted below and can be accessed with CAS Registry No. 302-79-4:

[0115] As used herein, the term “TGF-P” refers to all isoforms of the multifunctional homodimeric cytokine belonging to the transforming growth factor superfamily referred to by this name or “transforming growth factor beta,” “TGFB,” or other variations thereof, as well as fragments and biological equivalents thereof. Generally, TGF-P is capable of complexing with other factors to form a serine / threonine kinase complex and binds to TGF-P receptors,Aty. Dkt. No.: 116639-3010 which generally comprise both type 1 and type 2 receptor subunits. This binding can activate a signaling cascade, which results in downstream immune effects. Non-limiting exemplary amino acid sequences for TGF-P can be found in the Uniprot database under accession numbers P01137 (human TGFB1), P04202 (murine TGFB1), P17246 (rat TGFB1), P61812 (human TGFB2), P27090 (mouse TGFB2), Q07257 (TGFB2), P10600 (human TGFB3), Q99K17 (murine TGFB3), and Q07258 (rat TGFB3); other homologs of the same may also be found in the Uniprot database, i.e., at uniprot.org. TGF-P can be produced in vivo and isolated or in vitro, e.g., using a recombinant expression system and / or TGF-P producing cell line. Alternatively, it may be purchased through a variety of commercially available sources, e.g., Sigma Aldrich, Thermo-Fisher, R&D Systems, Abeam, Bio-Rad, Milipore, and a variety of other commercial vendors of biological products.

[0116] As used herein, the term “IL-27” refers to all isoforms of the heterodimeric cytokine referred to by this name or “Interleukin 27,” “IL27,” or other variations thereof, as well as fragments, subunits, and biological equivalents thereof. Equivalents of IL-27 include other members of the IL- 12 family, such as but not limited to IL- 12, IL-23, and IL-35. Members of this family are characterized by being made a heterodimeric complex comprising an a chain (pl9, p28, or p35, in humans) and a P chain (p40 or Ebi3, in humans); this feature is unique to members of the IL- 12 family of cytokines. The amino acid and polynucleotide sequences are known in the art and recorded on publicly accessible databases. Generally, IL-27 is expressed by antigen presenting cells and interacts with its corresponding receptor - IL-27R. The interaction between IL-27 and IL-27R can affect signaling pathways including JAK- STAT and p38 MAPK pathways and can result in downstream immune effects. Non-limiting exemplary amino acid sequences of IL-27 can be found in the Uniprot database under accession numbers Q8NEV9 (human IL-27 alpha subunit), Q8K3I6 (murine IL-27 alpha subunit), QI 4213 (human IL-27 beta subunit), and 035228 (murine IL-27 beta subunit); other homologs of the same may also be found in the Uniprot database, i.e., at uniprot.org. IL-27 can be produced in vivo and isolated or in vitro, e.g., using a recombinant expression system and / or IL-27 producing cell line. Alternatively, it may be purchased through a variety of commercially available sources, e.g., Thermo-Fisher, R&D Systems, Abeam, Miltenyi, and a variety of other commercial vendors of biological products.

[0117] As used herein, the term “CD28” refers to all isoforms of a protein known to provide a co-stimulator signal for T-cell stimulation, sometimes referred to as “Cluster of Differentiation 28” or “T44,” or a fragment or biological equivalent thereof. Non-limitingAtty. Dkt. No.: 116639-3010 exemplary amino acid sequences of CD28 can be found in the Uniprot database under accession numbers Pl 0747 (human CD28); Q9GKP3 (canine CD28); Q00609 (murine CD28); other homologs of the same may also be found in the Uniprot database, i.e., at uniprot.org. CD28 can be produced in vivo and isolated or in vitro, e.g., using a recombinant expression system and / or CD28 producing cell line. Alternatively, it may be purchased through a variety of commercially available sources, e.g., Thermo-Fisher, R&D Systems, Abeam, Adipogen, and a variety of other commercial vendors of biological products.

[0118] As used herein, the term “anti-CD28” refers to an antibody or a fragment, derivative, or biological equivalent thereof that recognizes and binds to CD28. Anti-CD28 may be recombinantly expressed, generated by exposing antibody producing cells to CD28, or other means known in the art, using for example, the proteins described herein. Anti-CD28 also includes the antibodies or a fragment, derivative, or biological equivalent thereof as described in US10364287B2 and US20230256017A1, incorporated herein in their entireties. Further anti-CD28 can be purchased from commercial vendors, such as but not limited to those listed above with respect to CD28.

[0119] In some embodiments, the Anti-CD28 comprises sequences selected from a single line of the following table:

[0120] As used herein, the term “CD3” refers to all isoforms of a protein known to be a surface marker of T-cells, i.e., T-cell co-receptor, which is required for T-cell activation, sometimes referred to as “Cluster of Differentiation 3” or “T3 complex,” or a fragment or biological equivalent thereof. Generally, CD3 is composed of four distinct polypeptide chains; epsilon (a), gamma (y), delta (8) and zeta (Q, that assemble and function as three pairs of dimers (ay, a6,Non-limiting exemplary amino acid sequences of CD3 can be found in the Uniprot database under accession numbers P07766 (human CD3 epsilon chain), P09693 (human CD3 gamma chain), P04234 (human CD3 delta chain), P20963 (human CD3 zeta chain); P22646 (murine CD3 epsilon chain), Pl 1942 (murine CD3 gamma chain), P04235 (murine CD3 delta chain), P24161 (murine CD3 zeta chain); Q95LI5 (simian CD3 epsilonAtty. Dkt. No.: 116639-3010 chain), Q28074 (bovine CD3 gamma chain), Q95LI8 (simian CD3 delta chain), Q9XSJ9 (porcine CD3 zeta chain); other homologs of the same may also be found in the Uniprot database, i.e., at uniprot.org. CD3 can be produced in vivo and isolated or in vitro, e.g., using a recombinant expression system and / or CD3 producing cell line. Alternatively, it may be purchased through a variety of commercially available sources, e.g., Thermo-Fisher and a variety of other commercial vendors of biological products.

[0121] As used herein, the term “anti-CD3” refers to an antibody or a fragment, derivative, or biological equivalent thereof that recognizes and binds to CD3. Anti-CD3 may be recombinantly expressed, generated by exposing antibody producing cells to CD3, or other means known in the art, using for example, the proteins described above. Anti-CD3 also includes the antibodies or a fragment, derivative, or biological equivalent thereof as described in US11732054B2, US20230256017A1 and US11007267B2, incorporated herein in their entireties. Further anti-CD3 can be purchased from commercial vendors, such as but not limited to those listed above with respect to CD3.

[0122] In some embodiments, the Anti-CD3 comprises sequences selected from a single line of the following table:

[0123] As used herein, “immunosuppressive therapy” refers to a therapy that uses one or more immunosuppressive agents to reduce the activation and / or efficacy of the immune system of a subject (e.g., a human). Examples of immunosuppressive agents include, but are not limited to, calcineurin inhibitors, mTOR inhibitors, and tyrosine kinase inhibitors (e.g., cyclosporine a, cyclosporine G, voclosporin, tacrolimus, pimecrolimus, sirolimus, temsirolimus, deforolimus, everolimus, zotarolimus, biolimus, imatinib, dasatinib, nilotinib,Aty. Dkt. No.: 116639-3010 erlotinib, sunitinib, gefitinib, bosutinib, neratinib, axitinib, crizotinib, lapatinib, toceranib, and vatalanib).

[0124] As used herein, an “undesirable immune response” or “aberrant immune response” refers to any immune response, activity or function that is greater or less than desired or physiologically normal. An undesirable immune response, function or activity can be a normal response, function or activity. Thus, normal immune responses so long as they are undesirable, even if not considered aberrant, are included within the meaning of these terms. An undesirable immune response, function or activity can also be an abnormal response, function or activity. An abnormal (aberrant) immune response, function or activity deviates from normal. Undesirable and aberrant immune responses can be humoral, cell-mediated or a combination thereof, either chronic or acute.

[0125] One non-limiting example of an undesirable or aberrant immune response is where the immune response is hyper-responsive, such as in the case of an autoimmune disorder or disease. Another example of an undesirable or aberrant immune response is where an immune response leads to acute or chronic inflammatory response or inflammation in any tissue or organ (e.g., gut). Yet another example of an undesirable or aberrant immune response is where an immune response leads to destruction of cells, tissue or organ, such as Crohn's disease, IBD or US, or a transplant, as in graft vs. host disease. Still another example of an undesirable or aberrant immune response is where the immune response is hypo- responsive, such as where response to an antigen is less than desired, e.g., tolerance has occurred. For example, tolerance to a pathogen can result in increased susceptibility to or a more severe infection, and tolerance to a tumor-associated antigen (TAA) is thought to contribute to the ability of tumors to evade immune surveillance thereby surviving and proliferating in afflicted subjects.

[0126] The terms “immune disorder” and “immune disease” mean, an immune function or activity, that is greater than (e.g., autoimmunity) or less than (e.g., immunodeficiency) desired, and which is characterized by different physiological symptoms or abnormalities, depending upon the disorder or disease. Particular non-limiting examples of immune disorders and diseases to which the invention applies include autoimmune disorders and immunodeficiencies. Autoimmune disorders are generally characterized as an undesirable or aberrant increased or inappropriate response, activity or function of the immune system Immunodeficiencies are generally characterized by decreased or insufficient humoral or cell- mediated immune responsiveness or memory, or undesirable tolerance. Disorders andAtty. Dkt. No.: 116639-3010 diseases that can be treated in accordance with the invention include, but are not limited to, disorders and disease that cause cell or tissue / organ damage in the subject.

[0127] As used herein, an "autoimmune disease" is a disease or disorder arising from and directed against an individual's own tissues. In some embodiments, an autoimmune disease or disorder includes, but is not limited to arthritis (rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic arthritis), psoriasis, dermatitis, polymyositis, dermatomyositis, toxic epidermal necrolysis, systemic scleroderma and sclerosis, responses associated with inflammatory bowel disease, Crohn's disease, ulcerative colitis, respiratory distress syndrome, adult respiratory distress syndrome (ARDS), meningitis, encephalitis, uveitis, colitis, glomerulonephritis, allergic conditions, eczema, asthma, conditions involving infiltration of T cells and chronic inflammatory responses, atherosclerosis, autoimmune myocarditis, leukocyte adhesion deficiency, systemic lupus erythematosus (SLE), juvenile onset diabetes, multiple sclerosis, allergic encephalomyelitis, immune responses associated with acute and delayed hypersensitivity mediated by cytokines and T-lymphocytes, tuberculosis, sarcoidosis, granulomatosis including Wegener's granulomatosis, agranulocytosis, vasculitis (including ANCA), aplastic anemia, Diamond-Blackfan anemia, immune hemolytic anemia including autoimmune hemolytic anemia (AIHA), pernicious anemia, pure red cell aplasia (PRC A), Factor VIII deficiency, hemophilia A, autoimmune neutropenia, pancytopenia, leukopenia, diseases involving leukocyte diapedesis, central nervous system (CNS) inflammatory disorders, multiple organ injury syndrome, mysathenia gravis, antigen-antibody complex mediated diseases, anti-glomerular basement membrane disease, anti-phospholipid antibody syndrome, allergic neuritis, Bechet disease, Castleman's syndrome, Goodpasture's syndrome, Lambert-Eaton Myasthenic Syndrome, Reynaud's syndrome, Sjorgen's syndrome, Stevens- Johnson syndrome, solid organ transplant rejection, graft versus host disease (GVHD), pemphigoid bullous, pemphigus, autoimmune polyendocrinopathies, Reiter's disease, stiff- man syndrome, giant cell arteritis, immune complex nephritis, IgA nephropathy, IgM polyneuropathies or IgM mediated neuropathy, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmune thrombocytopenia, autoimmune disease of the testis and ovary including autoimmune orchitis and oophoritis, primary hypothyroidism; autoimmune endocrine diseases including autoimmune thyroiditis, chronic thyroiditis (Hashimoto's Thyroiditis), subacute thyroiditis, idiopathic hypothyroidism, Addison's disease, Grave's disease, autoimmune polyglandular syndromes (or polyglandular endocrinopathy syndromes), Type IAtty. Dkt. No.: 116639-3010 diabetes also referred to as insulin-dependent diabetes mellitus (IDDM) and Sheehan's syndrome; autoimmune hepatitis, lymphoid interstitial pneumonitis (HTV), bronchiolitis obliterans (non-transplant) vs NSJJP, Guillain-Barre' syndrome, large vessel vasculitis (including polymyalgia rheumatica and giant cell (Takayasu's) arteritis), medium vessel vasculitis (including Kawasaki's disease and polyarteritis nodosa), ankylosing spondylitis, Berger's disease (IgA nephropathy), rapidly progressive glomerulonephritis, primary biliary cirrhosis, Celiac sprue (gluten enteropathy), cryoglobulinemia, amyotrophic lateral sclerosis (ALS), and coronary artery disease.

[0128] As used herein, the phrase “negative enrichment” in the context of a population of cells refers to eliminating unwanted cells from the population and leaving behind the wanted population of cells. For instance, obtaining CD4+ T cells using negative enrichment is a result of eliminating non-CD4+cells from the population of cells.

[0129] As used herein, the term “adoptive cell therapy” refers to a cell-based immunotherapy that relates to the transfusion of autologous or allogenic lymphocytes (aka. “adoptive cells”), e.g., T or B cells, which are genetically modified or not genetically modified, and which have been expanded ex vivo prior to said transfusion.

[0130] As used herein, the term “cryopreservation” or a grammatical variation thereof refers to storage of cells or tissue in an environment of less than about 8° C, which allows for extended storage of cells and can be at any temperature below 8° C, including temperatures at or below 4° C, 0° C, -20° C, -70° C, -80° C, -135° C, or in liquid nitrogen (-196° C). Methods for cry opreserving cells with a medium containing choline salts and sucrose is disclosed in US Patent No. 5985538. Additional cryopreservation compositions (“cryopreservatives”) and methods are disclosed in US Patent No.7935478, US Patent No. 7112576 and US Application No. 20170198251A1.

[0131] As used herein, the terms “cryopreservative,” “cryoprotectant” and “cryoprotective agent” refer to a substance that prevents or reduces damage to cells during cry opreservation. Exemplified cryoprotective agents include a sugar (such as sucrose, dextrose, trehalose, pectin), glycerol, ethylene glycol, propylene glycol, polyethylene glycol (PEG), 1,2- propanediol, trehalose, carbohydrates (such as hydroxy ethyl starch (HES)), dextran, polylysine and dimethyl sulfoxide (DMSO).Modes for Carrying Out the DisclosureAtty. Dkt. No.: 116639-3010

[0132] The present disclosure relates to particular subsets of Granzyme and / or perforin positive CD4+ T-cells, methods of isolating and generating these cells, compositions comprising, or alternatively consisting essentially of, or yet further consisting of these cells, and methods of treatment of a disease by administering these cells alone or in combination with other therapies.Methods for generating a population of CD4+ T cells

[0133] An aspect of this disclosure is directed to an ex vivo method of generating a population of cytotoxic CD4+ T-cells comprising, or alternatively consisting essentially of, or yet further consisting of contacting a population of CD4+ T-cells with an anti-CD3 antibody or a fragment or equivalent thereof, and an anti-CD28 antibody or a fragment or equivalent thereof, in the presence of IL-27. In some embodiments, the contacting is done in the absence of TGF beta and retinoic acid. In some embodiments, the population of CD4+ T cells are naive CD4+ T cells or cytotoxic CD4+ T cells.

[0134] In some embodiments, the population of naive or cytotoxic CD4+ T-cells is obtained by negative enrichment. In some embodiments, the population of naive or cytotoxic CD4+ T-cells comprise cells for adoptive cell therapy. In some embodiments, the population of naive or cytotoxic CD4+ T-cells comprise CAR-T cells.

[0135] In some embodiments, the population of naive or cytotoxic CD4+ T-cells comprises, or alternatively consists essentially of, or yet further consists of one or more of naive CD4+ T-cells, Thl T-cells, Thl7 T-cells, and T-regulatory cells and is, optionally, wherein the population of naive or cytotoxic CD4+ T-cells is substantially homogenous.

[0136] In some embodiments, the population of naive or cytotoxic CD4+ T-cells is isolated from an in vitro culture system comprising, or alternatively consisting essentially of, or yet further consisting of a tumor specimen or tumor cell-line and a population of effector T-cells.

[0137] In some embodiments, the tumor or cancer specimen has been surgically removed from an animal having a tumor or cancer. Types of cancer, and stage should be included.

[0138] In some embodiments, the population of naive or cytotoxic CD4+ T-cells has been isolated from a biological sample from an animal having a tumor, a cancer, or an autoimmune disease.Atty. Dkt. No.: 116639-3010

[0139] In some embodiments, the biological sample is a fluid or tissue sample from the animal, optionally wherein the biological sample is a fluid or tissue sample from a microenvironment surrounding the tumor.

[0140] In some embodiments, the animal is a human patient diagnosed with a cancer or an autoimmune disease.

[0141] In some embodiments, the contacting is done in the presence of between about 10 ng / mL to about 30 ng / mL of IL-27 and in the absence of TGF beta and retinoic acid.

[0142] In some embodiments, the anti-CD3 antibody or the fragment or equivalent thereof is bound to a solid support, optionally where the solid support is a cell culture container.

[0143] In some embodiments, the concentration of the anti-CD3 antibody or the fragment or equivalent thereof is between about 0.5 pg / mL and 4 pg / mL (e.g., about 0.5, 0.7, 0.9, 1, 1.3, 1.5, 1.8, 2, 2.3, 2.5, 2.8, 3, 3.3, 3.5, 3.8, or 4 pg / mL).

[0144] In some embodiments, the anti-CD28 antibody or the fragment or equivalent thereof is soluble anti-CD28 antibody or the fragment or equivalent thereof.

[0145] In some embodiments, the concentration of the anti-CD28 antibody or the fragment or equivalent thereof is between about 0.5 pg / mL and 4 pg / mL(e.g., about 0.5, 0.7, 0.9, 1, 1.3, 1.5, 1.8, 2, 2.3, 2.5, 2.8, 3, 3.3, 3.5, 3.8, or 4 pg / mL).

[0146] In some embodiments, the contacting is done between 2 days and 5 days or until one or more of the cells of the population are Granzyme B positive.

[0147] In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of isolating the population of CD4+ T-cells.Populations of Cells and Compositions

[0148] In one aspect, provided is a population of CD4+ T-cells prepared by a method described in this disclosure. In some embodiments, the population is substantially homogeneous. In some embodiments, the population comprises adoptive cells. In some embodiments, the population comprises CAR-T cells.

[0149] In some embodiments, at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 99% of the population are Granzyme B positive.

[0150] In some embodiments, at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, of the CD4+ cytotoxic T-cells are perforin positive.Atty. Dkt. No.: 116639-3010

[0151] Another aspect of the disclosure is directed to a composition comprising, or alternatively consisting essentially of, or yet further consisting of the population of CD4+ cells described herein, and a carrier and / or a cryopreservative or a stabilizer. In some embodiments, the carrier is a pharmaceutically acceptable carrier.

[0152] Another aspect of the disclosure is directed to a composition comprising, or alternatively consisting essentially of, or yet further consisting of a population of T-cells, wherein the population of T-cells comprise T-cells that display the following marker profile: CD4+, Granzyme B+, Perforin , FoxP3‘, IL'10low, Runx3+and ThPOK+.

[0153] In some embodiments, IL- 10lowcomprises, or alternatively consists essentially of, or yet further consists of T-cells having less than 50% IL-10 expression (e.g., about 49%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 3%, 1% or less IL-10 expression) as compared to a wild-type control T-cell. In some embodiments, the IL-10 expression is determined at the transcriptional (RNA) level. In some embodiments, the IL-10 expression is determined at the translational (protein) level. In some embodiments, the IL-10 expression is determined using flow cytometry.

[0154] In some embodiments, the T-cells are IL-10 deficient.

[0155] In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of a pharmaceutically acceptable carrier and / or a cryopreservative or stabilizer.

[0156] In some embodiments, the population is substantially homogeneous.

[0157] In some embodiments, the T-cells are mammalian cells. In some embodiments, the T- cells are human cells.Methods of Treatment

[0158] Another aspect of the disclosure is directed to a method for treating a tumor or cancer or augmenting an anti-cancer immune response in a subject in need thereof, comprising, or alternatively consisting essentially of, or yet further consisting of administering an effective amount of a CD4+ T-cell population of the present disclosure or the composition of the present disclosure to the subject, thereby treating the tumor or the cancer.

[0159] In some embodiments, the treatment comprises, further comprises, or alternatively consists essentially of, or yet further consists of administering an adoptive cell or a CAR-T cell. In some embodiments, the adoptive cell or the CAR-T cell has been modified using theAty. Dkt. No.: 116639-3010 methods of this disclosure (e.g., the adoptive cell or the CAR-T cell has been contacted with an anti-CD3 antibody or a fragment or equivalent thereof, and an anti-CD28 antibody or a fragment or equivalent thereof, in the presence of IL-27).

[0160] In some embodiments, the tumor or the cancer expresses high levels of MHC Class II molecules.

[0161] In some embodiments, the population of the present disclosure or the composition of present disclosure comprises, further comprises, or alternatively consists essentially of, or yet further consists of cells autologous to the subject.

[0162] In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of administering an effective amount of one or more cytoreductive therapy and / or immunotherapy to the subject, prior to, concurrently or subsequent to administration of the effective amount of the population or the composition.

[0163] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a canine, feline, or a human patient, and wherein the effective amount of the population of cells or composition is species-specific to the mammal.

[0164] Another aspect of the disclosure is directed to a method for treating an undesirable or aberrant immune response in a subject in need thereof, comprising administering an effective amount of any one of the population of the present disclosure or the composition of the present disclosure to the subject, thereby treating the undesirable or aberrant immune response. In some embodiments, the undesirable or aberrant immune response comprises an autoimmune disease or condition or an allergic response.

[0165] In some embodiments, the treatment comprises, further comprises, or alternatively consists essentially of, or yet further consists of administering an adoptive cell or a CAR-T cell. In some embodiments, the adoptive cell or the CAR-T cell has been modified using the methods of this disclosure (e.g., the adoptive cell or the CAR-T cell has been contacted with an anti-CD3 antibody or a fragment or equivalent thereof, and an anti-CD28 antibody or a fragment or equivalent thereof, in the presence of IL-27).

[0166] In some embodiments, the populations of the present disclosure or the compositions of the present disclosure comprise cells autologous to the subject.Atty. Dkt. No.: 116639-3010

[0167] In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of administering an effective amount of one or more immunosuppressive therapy.

[0168] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0169] Another aspect of the disclosure is directed to a method for treating allergy in a subject in need thereof, comprising, or alternatively consisting essentially of, or yet further consisting of administering an effective amount of a CD4+ T-cell population of the present disclosure or the composition of the present disclosure to the subject, thereby treating the allergy. In some embodiments, the CD4+ T-cells comprise CAR-T cells engineered to target B-cells that produce allergy-causing antibodies such as IgE. In some embodiments, the present methods establish tolerance against an allergen causing the allergy.

[0170] In some embodiments, the allergy is selected from a pollen allergy, a food allergy, a medication allergy, latex allergy, an insect allergy, a mold allergy, or a dust allergy.

[0171] In some embodiments, the allergy is a pollen allergy. In some embodiments, the pollen allergy is against a pollen selected from the group consisting of pine (Pinus) pollen, birch (Betula) pollen, alder (Alnus) pollen, cedar pollen, hazel (Corylus) pollen, hornbeam (Carpinus) pollen, horse chestnut (Aesculus) pollen, willow (Salix) pollen, poplar (Populus) pollen, plane (Platanus) pollen, linden / lime (Tilia) pollen, olive pollen, sugi (Cryptomefia japonica) pollen, hinoki (Chamaecypails obtusa) pollen, ryegrass (Lolium sp.) pollen, timothy (Phleum pratense), pollen ragweed (Ambrosia) pollen, plantain (Plantago) pollen, nettle / parietaria (Urticaceae) pollen, mugwort (Artemisia Vulgaris) pollen, Fat hen (Chenopodium) pollen, and sorrel / dock (Rumex) pollen.

[0172] Another aspect of the disclosure is directed to a method for treating food allergy in a subject in need thereof, comprising, or alternatively consisting essentially of, or yet further consisting of administering an effective amount of a CD4+ T-cell population of the present disclosure or the composition of the present disclosure to the subject, thereby treating the food allergy. In some embodiments, the food allergy is selected from a group consisting of peanut allergy, milk (lactose or milk protein) allergy, egg allergy, tree nuts allergy, fish allergy, shellfish allergy, soy allergy, and wheat (gluten) allergy.Atty. Dkt. No.: 116639-3010Methods for Activating a T cell

[0173] Another aspect of the disclosure is directed to an ex vivo method for activating a CD4+ T cell comprising, or alternatively consisting essentially of, or yet further consisting of contacting the T cell with an anti-CD3 antibody or a fragment or equivalent thereof, and an anti-CD28 antibody or a fragment or equivalent thereof, in the presence of IL-27.

[0174] In some embodiments, the T-cell is a CD4+ T cell.

[0175] In some embodiments, the T-cell is an engineered T cell. In some embodiments, the T cell is an adoptive cell. In some embodiments, the T cell is a CAR-T cell.

[0176] In some embodiments, the contacting is done in the presence of between about 10 ng / mL to about 30 ng / mL of IL-27 and in the absence of TGF beta and retinoic acid.

[0177] In some embodiments, the anti-CD3 antibody or the fragment or equivalent thereof is bound to a solid support, optionally wherein the solid support is a cell culture container.

[0178] In some embodiments, the concentration of the anti-CD3 antibody or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |ig / mL (e.g., 0.5, Im 1.5, 2m 2.5, 3, 3.5, 4 |ig / mL or any value therebetween).

[0179] In some embodiments, the anti-CD28 antibody, or the fragment or equivalent thereof is soluble.

[0180] In some embodiments, the concentration of the anti-CD28 antibody, or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |ig / mL (e.g., 0.5, Im 1.5, 2m 2.5, 3, 3.5, 4 |ig / mL or any value therebetween).

[0181] In some embodiments, the contacting is done between 2 days and 5 days, or until one or more of the cells of the population are Granzyme B positive.

[0182] In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of isolating the activated T-cells.

[0183] Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.Aty. Dkt. No.: 116639-3010EXAMPLESExample 1: Materials and MethodsMice

[0184] C57BL / 6J and Rag21mice were obtained from Jackson Laboratories. Zbtb7b- Gfp / Runx3-tdTomato mice were obtained from the Cheroutre lab at LJI. Both male and female mice were used for studies. Mice were between 8 and 12 weeks old when used for experiments and recipient mice for adoptive T cell experiments were randomly assigned to experimental groups. All mice were bred and / or maintained in the animal facility at the La Jolla Institute for Immunology (LJI). All experiments were performed in compliance with the study protocol approved by the LJI Institutional Animal Care and Use Committee (IACUC) regulations.Naive CD4+ T cell isolation, activation and differentiation

[0185] Murine naive CD4+and CD8+T cells were purified using the EASYSEP™ mouse naive CD4+ T Cell Isolation kit and the EASYSEP™ mouse naive CD8+T Cell Isolation kit (STEMCELL® technologies), respectively, according to manufacture instructions. T cell activation (0.5e6 mL; 200 uL / well) was performed using high-binding non-treated tissue culture 96-well plates (Coming) using plate bound a-CD3 (clone 145-2C11, 2 pg / mL) and soluble a-CD28 (clone 37.51 1 pg / mL) monoclonal antibodies in RPMI 1640 Medium, GlutaMAX™ Supplement (LIFE TECHNOLOGIES™) supplemented with 10% FBS (Omega Scientific), 1% penicillin / streptomycin (GIBCO®-LIFE TECHNOLOGIES™) and 50 pM P-mercaptoethanol (Sigma). For IL-27, Thl and ThO- polarizing conditions, mIL-27 (25 ng / mL) or mIL-12 (25 ng / mL) and a-IL-4 monoclonal antibody (5 pg / ml) or rhIL-2 (20 ng / uL, 800U), a-IFNy monoclonal antibody (5 pg / ml) and a-IL-4 monoclonal antibody (5 pg / ml), respectively, were added to the cultures. Naive CD8+T cells were cultured in the presence of rhIL-2 (20 ng / uL, 800U). When indicated, a-IFNy monoclonal antibody (5 pg / ml) or hTGFp (2.5 ng / mL) was added. Cells were maintained in a standard tissue culture incubator containing 5% CO2.Adoptive T cell transfer

[0186] To evaluate the in vivo expansion and fate of in vitro differentiated IL-27 cells, IL-27 polarized, as well ThO T cells were retro-orbitally injected 3 days following activation and polarization into Rag2~'~ recipients (1.5e6 cells). Rag2- / “ recipients were sacrificed 11 daysAtty. Dkt. No.: 116639-3010 later and T cell phenotypes in dissociated peripheral lymph nodes and spleen were analyzed by flow cytometry.Flow cytometry

[0187] A range of 2e5 - 1.5e6 cells were used to perform flow cytometry phenotype assessment. Expression of surface markers was evaluated using the appropriate fluorochrome-conjugated monoclonal antibodies and viability addressed using fixable viability dye in a total volume of 50 pL. Cells were incubated in the dark for 20 minutes in PBS containing 2% FBS at 4°C and then washed once in the same medium at 500 g for five minutes. An extracellular stain cocktail was used to identify CD4+ cells (BD Biosciences BV711, Clone: GK1.5) and additional markers, CD44 (eFluor780, Clone: IM7), CD62L (AlexaFluor700,IM7), and TCRp (PerCP / Cy5.5, Clone: TW7-16B4 ). For fFNy and IL-10 intracellular cytokine staining, 4e5 - 1.5e6 cells were stimulated with phorbol 12-myristate 13 -acetate (PMA) (100 ng / ml, Sigma) and ionomycin (1 pg / ml, Sigma) in the presence of GolgiStop (BD BIOSCIENCES™), as indicated by the manufacture in complete RPMI media for 3.5h at 37°C (total volume of 200-1 mL). For intracellular staining of transcription factors: Granzyme b (GZMB) (BIOLEGEND®, PACIFIC BLUE®, Clone: GB11), Perforin (PRF1) (BIOLEGEND®, APC, Clone: S16009A), FoxP3 (eBiosciences, Pe-Cy7, Clone: FJK16s), Tbet (BIOLEGEND®, PerCP / Cy5.5, Clone 4B10) , RUNX3 (BD PHARMIGEN®, PE, Clone: R3-5G4), IFNy (BIOLEGEND®, BUV737, Clone: XMG1.2), and IL-10 (BV HORIZON®, BV605, Clone: JES5-16E3), fixation and permeabilization was done using the FoxP3 / Transcri ption Factor intracellular staining kit from (BD Biosciences) as per the manufacturer’s instructions and cells were incubated for 40 minutes at 4°C. Cells were then washed with the permeabilization buffer and incubated with intracellular antibodies for 1 hour at RT followed by 4°C overnight. Cell analyses were performed on Fortessa cytometer (BD Biosciences). A minimum of 20,000-30,000 events (viability dye-negative) were recorded for each sample. Data analyses were performed using FLOWJO® software (TREE STAR®, Ashland, OR).

[0188] The gating strategy involved first identifying the live cell population, followed by the exclusion of doublets based on forward scatter (FSC) and side scatter (SSC) characteristics. Within the live cell gate, CD4+and CD8+T cell populations were identified based on their respective surface marker expression. To assess effector memory (Tern), central memory (Tcm), and naive T cell populations, cells within the CD4+gate were further analyzed based on the expression of CD44 and CD62L. Specifically, the percentage of cells expressing bothAty. Dkt. No.: 116639-3010CD44 and CD62L (CD44+CD62L+) within the CD4+populations was determined (% of parent). For functional analysis, the percentage of GZMB+ and PRF1+ cells was quantified within the CD4+ and CD8+ parent populations (% of parent). The frequency of F0XP3+cells was determined within the CD4+T cell population (% of parent). Additionally, the mean fluorescence intensity (MFI) of RUNX3 and TBX21 was measured within the relevant cell populations to quantify their expression levels.Phospho-STATs induction and PhosFlow staining

[0189] Naive CD4+ T cells were incubated in cold PBS containing 2% FBS with a-CD3 (clone 145-2C11, 1 pg / mL) and a-CD28 (clone PV1, 1 pg / mL) per million of naive CD4+T cells for 20 minutes at 4°C. Armenian hamster crosslinker polyclonal antibodies (Jackson ImmunoResearch) were then added at a final concentration of 18 pg / mL and incubated during 20 minutes at 4°C. After incubations, cold PBS was added and cells were collected by centrifugation. Naive CD4+T cells were resuspended to a concentration of le6 cells / mL in 37°C PBS containing 2% FBS with either mIL-27 (25 ng / mL) or mIL-12 (25 ng / mL) or mlL- 27 (25 ng / mL) and hTGFp (2.5 ng / mL) or no cytokines as a control (200 uL PBS-FBS buffer). After 30 minutes, 200 pL of 37°C BD Cytofix buffer (BD biosciences) were directly added and cells incubated during 10 minutes at 37°C. After centrifugation, 1 mL of BD Phosflow Perm Buffer III (BD biosciences) was added and cells incubated during 30 minutes at 4°C. After incubation, cells were washed twice with cold PBS containing 2% FBS and pSTAT fluorochrome-conjugated monoclonal antibodies added and incubated during 45 minutes at RT. Cells were washed with cold PBS containing 2% FBS before analysis in the flow cytometer.Proteomics

[0190] Naive CD4+ T cells were isolated from Zbtb7b-Gfp / Runx3-tdTomato mice, and differentiated as described above. After confirmation of differentiation by flow cytometry, the remaining cells were processed for TMT -based quantitative proteomics as previously described34. For this work, TMTpro reagents were used, and data was acquired on an Orbitrap Eclipse (Thermo). Data was analyzed using Spectrum Mill (Agilent and Broad Institute), Protigy (github.com / broadinstitute / protigy), and visualized with software.broadinstitute.org / morpheus / . One Thl sample (TMTpro channel 130C) was left out of downstream statistical comparisons as it did not meet the a priori correlation criteria of r > 0.1. Individual values were divided by the mean of all samples for experiment-wideAty. Dkt. No.: 116639-3010 comparisons. The data was global median centered and median absolute deviation scaled using Protigy (github.com / broadinstitute / protigy). Differential analysis was performed using a two-sample moderated T test for all pairwise comparisons between Thl, ThO, and IL-27 treated cells with a p value less than 0.01. Hierarchical clustering was performed using software.broadinstitute.org / morpheus / . GSEA was performed using gsea- msigdb.org / gsea / index.jsp using the C2 set of signatures using human entries as these are more extensive. Select gene sets are shown in FIG. 2C.Cytotoxicity co-culture

[0191] Naive CD4+ T cells were prepared at 0.5 x 106cells / mL (200 pL per well) in high- protein-binding, non-tissue-culture-treated 96-well plates (Corning). Cells were stimulated overnight with plate-bound a-CD3 antibody (clone 145-2C11, 2 pg / mL) and soluble a-CD28 antibody (clone 37.51, 1 pg / mL) in RPMI 1640 medium supplemented with GLUTAMAX™ (LIFE TECHNOLOGIES™), 10% fetal bovine serum (FBS; Omega Scientific), 1% penicillin-streptomycin (GIBCO®), and 50 pM P-mercaptoethanol (Sigma). Following activation, cells were transduced with a retroviral vector encoding an 19.28z chimeric antigen receptor (CAR) by spinoculation at 32 °C for 90 minutes in the presence of 8 pg / mL polybrene (Sigma). A second transduction was performed 24 hours later to improve transduction efficiency. Cells were then maintained for 3 days under two parallel polarization conditions: IL-27 (mIL-27 - 25 ng / mL) or ThO (rhIL-2 - 20 ng / uL, 800U, a-IFNy monoclonal antibody - 5 pg / ml and a-IL-4 monoclonal antibody - 5 pg / ml) in complete RPMI medium prior to co-culture with target cells.

[0192] Transduction efficiency of >70% was confirmed by flow cytometry using fluorochrome-conjugated anti-mouse-Thyl. l (BIOLEGEND®, FITC, Clone: 90.1) (a surrogate marker for CAR expression) and anti-mouse-CD4 (BD HORIZON®, BV711, clone: GK1.5) antibodies, along with a viability dye to exclude dead cells. Based on the percentage of Thyl.l+CD4+T cells, cell counts were normalized so that equivalent numbers of CAR-expressing T cells were seeded in each experimental condition. MC38 cells engineered to express human CD 19 (MC38-CD19) and mKate2 were plated one day before co-culture at a density of 1.0 x io5cells per well in 24-well tissue-culture-treated plates.

[0193] For co-culture, activated CD4+-CAR-T cells were added to MC38-CD19 target cells at an effector-to-target ratio of 8: 1 in 1 mL complete RPMI medium. Co-cultures were maintained for up to 72 hours, and samples were harvested at 0, 24, 48, and 72 hours.Atty. Dkt. No.: 116639-3010

[0194] For flow cytometry analysis, between 2.7 x 10A5 and 7.0 x 10A6 cells per sample were collected. Cells were first stained with a LIVE / DEAD-Blue fixable viability dye (Thermo) according to the manufacturer’s instructions. Extracellular stain was performed by incubating with fluorochrome-conjugated anti-mouse CD4 (BD HORIZON®, BV510, clone: GK1.5) or anti-mouse-CD4 (BD HORIZON®, BV711, clone: GK1.5) and anti-mouse Thy 1.1 (BIOLEGEND®, FITC, Clone: 90.1) antibodies in phosphate-buffered saline (PBS) containing 2% FBS for 20 minutes at 4 °C. Followed by a wash with the same buffer and 500g for 5 minutes. Cells were then fixed and permeabilized using the FoxP3 / Transcription Factor Staining Buffer Set (BD BIOSCIENCES®) according to the manufacturer’s instructions. Intracellular staining for Granzyme B (GZMB) and perforin (PRF1) was performed by incubating with fluorochrome-conjugated anti-mouse-GZMB (BIOLEGEND®, PACIFIC BLUE®, Clone: GB11) and anti-mouse-PRFl (BIOLEGEND®, APC, Clone: SI 6009 A) antibodies for 1 hour at room temperature, followed by overnight incubation at 4 °C.

[0195] Data were acquired on a BD LSRFORTESSA® flow cytometer (BD Biosciences, San lose, CA), collecting at least 20,000 live (viability dye-negative) events per sample. Flow cytometry data were analyzed using FLOWIO® software (Flowlo, LLC, Ashland, OR). To ensure equitable comparison between samples with different total event counts, the FLOWIO® DownSample plugin was used to randomly select an equal number of MC38- CD19 cell events from each sample at each time point. Specifically, MC38-CD19 events were downsampled to match the lowest MC38-CD19 count observed among all conditions at the corresponding time point, ensuring that viability and functional marker comparisons were not biased by unequal sampling depth. For analysis of intracellular effectors, data were gated on live, CD4+CAR-expressing (Thyl.U) T cells for assessment of GZMB and PRF1.Statistical analyses

[0196] All statistical comparisons were performed in GRAPHPAD PRISM®. Unpaired T tests were used for pairwise comparisons, ordinary one-way ANOVA tests were used when various pairs of comparison are made. P values are only shown for relevant comparisons.Analysis of public ATAC-seq, ChlP-seq, and RNA-seq data

[0197] Public ATAC-seq and ChlP-seq datasets of CD4+ T cells were analyzed to identify binding patterns of transcriptional factors around the Gzmb locus. The ATAC-seq data of IL- 27-polarized CD4+ T cells at 72 hours were processed using a public ATAC-seq pipeline36,37.Atty. Dkt. No.: 116639-3010ChlP-seq of STAT3, BATF, IRF4, and TBX21 were generated and processed in previously published studies, and all reads were aligned to the mm9 genome. The Integrative Genomics Viewer (IGV) was used to visualize ATAC-seq and ChlP-seq peaks, in which each dataset was scaled to their local signals around Gzmb.

[0198] For transcriptomic analysis, RNA-seq data of CD4+ T cells polarized with IL-27 for 72 hours from 16 transcriptional factor knockout (KO) mice and their respective wildtype (WT) controls were performed and analyzed with RSEM-based quantification in a previous study23. To analyze effects of different transcriptional factor KOs, RSEM data were converted to estimated count matrices by tximport, normalized using TMM normalization, and processed using DeSeq2. Log2 fold change and standard errors were calculated for each KO vs. WT comparison. Wildtype samples were measured for all KO comparison in duplicate or triplicate. Stat3 was performed as a single measurement; Nfil3, Irf8, Ahr, Cebpb, Fosl2, Batf, Tbx21, Atf3, Etsl, Irf4, and Hifla had duplicate RNA-seq measurements; Maf Irfl, Prdml was performed in triplicate, and Irf9 had quadruplicate measurements. Genes with absolute log2 fold change of KO vs. WT > 1 were considered differentially expressed.Example 2

[0199] Cytotoxicity in T cells is typically accredited to CD8+ T cells, defined by their expression of the effector molecules Granzyme B (GZMB) and perforin (PRF1). While cytotoxic properties have been observed in CD4+ T cells, these attributes have been historically assigned to T helper 1 (Thl) cells. Here, Applicant shows that the pleiotropic cytokine IL-27 robustly induces a cytotoxic protein program in naive CD4+ T cells. IL-27 polarized CD4+ T cells express the transcription factors RUNX3 and TBX21 (TBET) to levels similar to those of CD8+ and This, respectively, but are proteomically distinct from Thl cells. Unlike Thl cells, which are polarized by the IL-12-STAT4-TBX21 / IFNy axis, GZMB and TBX21 levels in IL-27 polarized CD4+ T cells are not promoted by the autocrine IFNy-signaling feedback loop. TGFp is capable of diminishing GZMB and PRF1 levels. However, RUNX3 and TBX21 levels, transcription factors that canonically promote cytotoxic gene expression, are not diminished by co-administration of TGFP with IL-27, suggesting alternative mechanisms for Gzmb and Prfl induction. The IL-27-induced cytotoxic phenotype is stable, as CD4+ T cells passaged in Rag2 knockout mice maintain GZMB and PRF1 levels when harvested from secondary lymphoid organs. Consistent with their cytotoxic programming, IL-27-polarized CD4+ T cells killed cognate cancer cells in a co-culture environment, further supporting their cytotoxic function. These data demonstrateAtty. Dkt. No.: 116639-3010 that IL-27 can induce cytotoxicity in CD4+ T cells, and suggest a distinct regulatory mechanism and cell state or lineage trajectory from conventional CD8+ T cells or Thl cells.

[0200] Applicant found that activating naive CD4+ T cells in the presence of IL-27 induced high levels of GZMB protein, in a large proportion of cells, as determined by flow cytometry (FIG. 1A). GZMB levels in IL-27 polarized CD4+ T cells were comparable to CD8+ T cells maintained in cytotoxic lymphocyte (CTL) conditions. In contrast, activating naive CD4+ T cells in ThO or T helper 1 (Thl) polarizing conditions showed significantly lower amounts of GZMB. Perforin (PRF1) levels were also elevated in IL-27-treated CD4+ T cells, though to a lesser extent than CD8+ T cells (FIG. 1A). Because the transcription factors RUNX3 and TBX21 (a.k.a. T-bet) are known to drive cytotoxic gene programs in CD8+ CTLs and Thl effector cells, respectively, Applicant tested whether IL-27 polarized CD4+ T cells expressed these proteins. IL-27 polarized CD4+ T cells expressed levels of RUNX3 comparable to CD8+ CTLs (FIG. IB) and TBX21 to levels comparable to Thl polarized cells (FIG. 1C). IL-27 polarized CD4+ T cells expressed IL- 10 in a larger proportion of cells than CD8+ CTLs, This, or ThO conditions (FIG. ID). IFNy expression was slightly induced in IL-27 conditions to a level similar to ThO conditions, but both to an extent significantly lower than CD8+ CTLs or Thl cells (FIG. IE). Together, these data demonstrate IL-27 induces a cytotoxic program in naive CD4+ T cells to levels similar to canonical cytotoxic T cells, CD8+ CTLs and Thl cells.

[0201] As cytotoxicity in CD4+ T cells is commonly associated with the Thl lineage, Applicant used mass spectrometry -based proteomics to characterize the molecular differences between IL-27 polarized CD4+ T cells and Thl-polarized cells. ThO conditions were included as a baseline comparator. Flow cytometric analysis of a subset of the samples analyzed by mass spectrometry showed consistency across both platforms for RUNX3, GZMB, and PRF1 (FIG. 2A). 669 of the 6,209 proteins quantified were differentially abundant between the IL- 27 polarized cells, This and the ThO cells (FIG. 2B). Hierarchical clustering demonstrated that Thl cells are molecularly more similar to their ThO counterparts, both of which clustered separately from IL-27-polarized CD4+ T cells (FIG. 2B). Pairwise comparison of This and IL-27-polarized cells showed extensive differences in protein abundances between the two lineages (FIG. 2C). Proteins such as GZMB and PRF1, TIGIT, LAG3, LY6C1, and ITGAV were more abundant in IL-27 conditions. IFNG, ICOS, ID2, IRF8 and NFKB1 were higher in This. Proteins like STAT3, ZBTB7B (a.k.a. ThPOK), FOSL2, and CD4 were not differentially abundant between the two cell types / lineages (FIG. 2C). Gene set enrichmentAtty. Dkt. No.: 116639-3010 analysis (GSEA) scored the IL-27-polarized cells higher in multiple cytotoxic signatures compared to the Thl cells (FIG. 2D). Interestingly, the IL-27 conditions scored higher for a Thl_cytotoxic_pathway44than the This themselves. Together, these analyses show that while IL-27-polarized CD4+ T cells are distinct from Thl cells, they share some overlapping gene expression signatures.

[0202] In Thl polarizing conditions, IL-12 signals largely to the transcription factor STAT4, driving IFNy expression and a positive feedback loop through TBX21 to reinforce both IFNy and TBX21 expression. To test whether autocrine IFNy signaling promotes TBX21 expression in IL-27 polarized CD4+ T cells, Applicant activated naive CD4+ T cells in IL-27 or Thl polarizing conditions in the presence or absence of a-IFNy antibodies. Applicant found that blocking IFNy significantly reduced IFNy production in Thl cells restimulated with PMA / ionomycin (FIG. 3A). However, the percentage of IFNy+ cells in IL-27 conditions was not affected by IFNy blockade (FIG. 3A). In line with the known Thl- promoting feedback loop, blocking IFNy did not affect TBX21 levels in IL-27 conditions, but slightly diminished its expression in Thl conditions (FIG. 3B). In contrast, RUNX3 expression was significantly reduced in Thl-polarized cells when a-IFNy antibodies were present, but not in IL-27 conditions (FIG. 3C). GZMB and PRF1 levels were also not affected by autocrine IFNy signaling in IL-27 conditions (FIG. 3D). The number of GZMB+PRF' Thl cells was significantly decreased upon IFNy signaling blockade, though GZMB+PRF1+Thl cells only trended in the same direction (FIG. 3D). These data indicate IFNy signaling does not notably promote cytotoxic gene expression in IL-27 polarized CD4+ T cells, as it does for Thl cells.

[0203] TGFP is a multifunctional cytokine capable of inducing Foxp3+ immunosuppressive Tregs, and antagonizes Tbx21 and Ifng expression in Thl differentiation. To test whether TGFP modulates the ability of IL-27 to induce a cytotoxic phenotype in CD4+T cells, Applicant co-administered TGFP with IL-27 polarizing conditions. Applicant found that the addition of TGFP dramatically reduced GZMB expression, decreasing it to levels comparable to ThO conditions (FIG. 4A). Interestingly, although TGFP did not affect the levels of RUNX3 or TBX21 (FIG. 4B-C) it reduced IFNy (FIG. 5D) but induced FOXP3 expression (FIG. 4E). These results show that TGFP negatively affects the induction of cytotoxic molecules in IL-27 polarized CD4+ T cells, and suggests a TGFP-induced negative regulator can overcome RUNX3 and TBX21’s promotion of GZMB expression.Atty. Dkt. No.: 116639-3010

[0204] To gather insight into the transcriptional regulation of Gzmb in IL-27 conditions, Applicant explored the activation of the STAT transcription factors. In human monocytes cells, IL-27 has been shown to signal through various STATs. To test which STATs became phosphorylated in naive CD4+ T cells, Applicant activated naive CD4+ T cells for 30 minutes with a-CD3 / CD28 antibodies in the presence of no cytokines, IL-12, and IL-27 with and without TGFP, and stained for specific STAT phosphorylation sites. Applicant found that IL-27 can induce the phosphorylation of STAT1 Y701, STAT3 Y705, and STAT5 Y694, where STAT3 showed the largest phosphorylation induction (FIG. 5A). STAT4 Y693 phosphorylation was not induced in any condition, likely due to the delayed expression of the IL-12 receptor. TGFP had no effect on STAT phosphorylation in IL-27 conditions (FIG. 5A). Analysis of public open chromatin (ATAC-seq) and chromatin immunoprecipitation (ChlP- seq) data showed STAT3 binding at the Gzmb promoter in CD4+ T cells polarized with IL-27 (FIG. 5B) However, knocking out Stat3 did not affect Gzmb expression. Instead, Stat3 knockout strongly reduced the expression of 1110 (FIG. 5C). Applicant also found evidence for BATF and IRF4 binding the Gzmb promoter in Th2 conditions, and TBX21 binding in Thl cells (FIG. 5B). Analysis of RNA-seq data from CD4+ T cells treated with IL-27 across several knockout mouse lines suggest that BATF, HIFloc, and TBX21 are positive regulators of Gzmb expression, where ETS1 and IRF4 were found to be negative regulators of Gzmb levels (FIG. 5C). The remaining knockout mouse lines had no effect on Gzmb levels (FIG. 5C). Together these data demonstrate that IL-27 signals through the STATs, though STAT3 activity is uncoupled from Gzmb induction. Rather, TBX21 can act as a major inducer of Gzmb expression, though its transcriptional activation activity is sensitive to concomitant TGFP signaling.

[0205] To test whether the IL-27-induced expression of cytotoxic molecules in naive CD4+ T cells was stable in vivo, Applicant performed T cell transfer experiments. Naive CD4+ T cells were polarized in IL-27 or ThO conditions and assessed prior to transfer. The IL-27- treated cells expressed higher levels of GZMB than in ThO conditions, as well as higher percentages of CD44+ CD62L+, markers for central memory T cells (FIG. 6A). After three days of activation and polarization, IL-27-treated or ThO T cells were retroorbitally injected into Rag2 knockout mice. Eleven days after transfer the mice were sacrificed and the spleen and peripheral lymph nodes were harvested. The number of cells recovered between IL-27 and ThO conditions in the spleen and lymph nodes was comparable (FIG. 6B). The number of TCRP+ CD4+ CD45+ cells recovered from the ThO transfer recipients was 3-10 timesAty. Dkt. No.: 116639-3010 lower than the IL-27 polarized transfers (FIG. 6C). A large number of GZMB+CD4+T cells were recovered from the spleens and lymph nodes of the recipient mice that received IL-27 polarized cells, in stark contrast to the ThO recipients (FIG. 6D). Together, these data indicate the expression of cytotoxic molecules induced by IL-27 is a stable phenotype following culture in vivo.

[0206] To confirm whether or not IL-27 treated CD4+ T cells could kill target cells, Applicant tested them in co-culture conditions. Applicant transduced a chimeric antigen receptor (CAR) recognizing CD 19 (19.28z) into activated, naive CD4+ T cells for two consecutive days, followed by addition of IL-27 or the ThO control conditions. CAR IL-27- polarized CD4+ T cells were then incubated with the murine colon adenocarcinoma cell line MC38 engineered to express human CD 19 and a red fluorescent reporter (mKate2). Delayed IL-27 administration reduced GZMB levels initially, but the proportion of GZMB+ cells progressively increased during co-culture in IL-27-treated cells but not ThO conditions, despite no IL-27 in the co-culture conditions (FIG. 7A). Within 24 hours of co-culture, 19.28z CD4+ CAR T cells slowed the growth of tumor cells compared to tumor cells alone (without T cells). However, IL-27-treated CAR CD4+ T cells continued to kill cognate tumor cells compared to ThO cells over the next two days of the co-culture (FIG. 7B). These results demonstrate that IL-27-polarized CD4+ T cells are indeed cytotoxic and are capable of, and efficacious at, directly killing target cells.

[0207] In this work, Applicant demonstrated that IL-27 induces bona fide cytotoxic functions in CD4+ T cells. IL-27 polarized CD4+ T cells express RUNX3 and TBX21, two transcription factors important for the induction of cytotoxic phenotypes in CD8 CTLs and Thl cells. TGFP inhibits IL-27-induced GZMB expression, but does not reduce RUNX3 and TBX21 levels. This suggests that there is likely an intermediary inhibitor downstream of TGFP that can overpower TBX21 and its promotion of Gzmb expression.Sequence Listing

[0208] SEQ ID NO: 1, DNA, Hinge domain: IgGl heavy chain hinge sequence, Artificial sequence CTCGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCG

[0209] SEQ ID NO: 2, DNA, CD28 transmembrane region, Artificial sequence TTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAA CAGTGGCCTTTATTATTTTCTGGGTGAtty. Dkt. No.: 116639-3010

[0210] SEQ ID NO: 3, DNA, Intracellular domain: 4-1BB co-stimulatory signaling region, Artificial sequenceAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAA GAAGGAGGATGTGAACTG

[0211] SEQ ID NO: 4, DNA, Intracellular domain: CD28 co-stimulatory signaling region, Artificial sequenceAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCC

[0212] SEQ ID NO: 5, DNA, Intracellular domain: CD3 zeta signaling region, Artificial sequenceAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAG GCCCTGCCCCCTCGCTAA

[0213] SEQ ID NO: 6, Protein, LCDR1 of Anti-CD28HASQNIYVWLN

[0214] SEQ ID NO: 7, Protein, LCDR2 of Anti-CD28KASNLHT

[0215] SEQ ID NO: 8, Protein, LCDR3 of Anti-CD28QQGQTYPYT

[0216] SEQ ID NO: 9, Protein, HCDR1 of Anti-CD28GYTFTSYYIH

[0217] SEQ ID NO: 10, Protein, HCDR2 of Anti-CD28CIYPGNVNTNYNEKFKD

[0218] SEQ ID NO: 11, Protein, HCDR3 of Anti-CD28SHYGLDWNFDV

[0219] SEQ ID NO: 12, Protein, LCDR1 of Anti-CD28SGSSSNIVSNYVN

[0220] SEQ ID NO: 13, Protein, LCDR2 of Anti-CD28Atty. Dkt. No.: 116639-3010DNNKRPS

[0221] SEQ ID NO: 14, Protein, LCDR3 of Anti-CD28 QSYAIGSYSVV

[0222] SEQ ID NO: 15, Protein, HCDR1 ofAnti-CD28 GFTFSTYGMS

[0223] SEQ ID NO: 16, Protein, HCDR2 of Anti-CD28 SIFYTGSSTYYADSVKG

[0224] SEQ ID NO: 17, Protein, HCDR3 of Anti-CD28 IGYAGDSKYAI

[0225] SEQ ID NO: 18, Protein, LCDR1 of Anti-CD3 SASSSVSYMN

[0226] SEQ ID NO: 19, Protein, LCDR2 of Anti-CD3DTSKLAS

[0227] SEQ ID NO: 20, Protein, LCDR3 of Anti-CD3 QQWSSNPFT

[0228] SEQ ID NO: 21, Protein, HCDR1 of Anti-CD3 GYTFTRYTMH

[0229] SEQ ID NO: 22, Protein, HCDR2 of Anti-CD3 YINPSRGYTNYNQKVKD

[0230] SEQ ID NO: 23, Protein, HCDR3 of Anti-CD3 YYDDHYSLDY

[0231] SEQ ID NO: 24, Protein, LCDR1 of Anti-CD3 GSSTGAVTSGNYPN

[0232] SEQ ID NO: 25, Protein, LCDR2 of Anti-CD3GTKFLAP

[0233] SEQ ID NO: 26, Protein, LCDR3 of Anti-CD3 VLWYSNRWV

[0234] SEQ ID NO: 27, Protein, HCDR1 of Anti-CD3GFTFNKY

[0235] SEQ ID NO: 28, Protein, HCDR2 of Anti-CD3 RSKYNNYA

[0236] SEQ ID NO: 29, Protein, HCDR3 of Anti-CD3 HGNFGNSYISYWAY

[0237] SEQ ID NO: 30, Protein, LCDR1 of Anti-CD3Atty. Dkt. No.: 116639-3010RSSTGAVTTSNYAN

[0238] SEQ ID NO: 31, Protein, LCDR2 of Anti-CD3GTNKRAP

[0239] SEQ ID NO: 32, Protein, LCDR3 of Anti-CD3ALWYSNLWV

[0240] SEQ ID NO: 33, Protein, HCDR1 of Anti-CD3GFTFNTYAMN

[0241] SEQ ID NO: 34, Protein, HCDR2 of Anti-CD3RIRSKYNNYATYYADSVKD

[0242] SEQ ID NO: 35, Protein, HCDR3 of Anti-CD3HGNFGNSYVSWFAY

[0243] SEQ ID NO: 36, Protein, LCDR1 of Anti-CD3RSSQSLVRSEGTTYFN

[0244] SEQ ID NO: 37, Protein, LCDR2 of Anti-CD3RVSNRFS

[0245] SEQ ID NO: 38, Protein, LCDR3 of Anti-CD3LQSSHFPWT

[0246] SEQ ID NO: 39, Protein, HCDR1 of Anti-CD3GFTFSKQGMH

[0247] SEQ ID NO: 40, Protein, HCDR2 of Anti-CD3MIYYDSSKMYYADTVKG

[0248] SEQ ID NO: 41, Protein, HCDR3 of Anti-CD3FWWDLDFDHEquivalents

[0249] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs.

[0250] The present technology illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms “comprising,” “including,” “containing,” etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shownAty. Dkt. No.: 116639-3010 and described or portions thereof, but it is recognized that various modifications are possible within the scope of the present technology claimed.

[0251] Thus, it should be understood that the materials, methods, and examples provided here are representative of preferred aspects, are exemplary, and are not intended as limitations on the scope of the present technology.

[0252] It should be understood that although the present invention has been specifically disclosed by certain aspects, embodiments, and optional features, modification, improvement and variation of such aspects, embodiments, and optional features can be resorted to by those skilled in the art, and that such modifications, improvements and variations are considered to be within the scope of this disclosure.

[0253] The present technology has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the present technology. This includes the generic description of the present technology with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

[0254] In addition, where features or aspects of the present technology are described in terms of Markush groups, those skilled in the art will recognize that the present technology is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0255] All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, to the same extent as if each were incorporated by reference individually. In case of conflict, the present specification, including definitions, will control.Clauses

[0256] Clause 1. An ex vivo method of generating a population of cytotoxic CD4+ T-cells comprising contacting a population of CD4+ T-cells with an anti-CD3 antibody or a fragment or equivalent thereof, and an anti-CD28 antibody or a fragment or equivalent thereof, in the presence of IL-27, and optionally wherein the population of CD4+ T cells are naive CD4+ T cells or cytotoxic CD4+ T cells.

[0257] Clause 2. The method of clause 1, wherein the population of naive or cytotoxic CD4+ T-cells is obtained by negative enrichment.Atty. Dkt. No.: 116639-3010

[0258] Clause 3. The method of clause 1 or 2, wherein the population of naive or cytotoxic CD4+ T-cells comprises one or more of naive CD4+ T-cells, Thl T-cells, Thl7 T-cells, and T-regulatory cells and is, optionally, wherein the population of naive or cytotoxic CD4+ T- cells is substantially homogenous.

[0259] Clause 4. The method of any one of clauses 1-3, wherein the population of naive or cytotoxic CD4+ T-cells is isolated from an in vitro culture system comprising a tumor specimen or tumor cell-line and a population of effector T-cells.

[0260] Clause 5. The method of clause 4, wherein the tumor or cancer specimen has been surgically removed from an animal having a tumor or cancer.

[0261] Clause 6. The method of any one of clauses 1 to 3, wherein the population of naive or cytotoxic CD4+ T-cells has been isolated from a biological sample from an animal having a tumor, a cancer, or an autoimmune disease.

[0262] Clause 7. The method of clause 6, wherein the biological sample is a fluid or tissue sample from the animal, optionally wherein the biological sample is a fluid or tissue sample from a microenvironment surrounding the tumor.

[0263] Clause 8. The method of any one of clauses 5 to 7, wherein the animal is a human patient diagnosed with a cancer or an autoimmune disease.

[0264] Clause 9. The method of any one of clauses 1-8, wherein the contacting is done in the presence of between about 10 ng / mL to about 30 ng / mL of IL-27 and in the absence of TGF beta and retinoic acid.

[0265] Clause 10. The method of any one of clauses 1-9, wherein the anti-CD3 antibody or the fragment or equivalent thereof is bound to a solid support, optionally where the solid support is a cell culture container.

[0266] Clause 11. The method of any one of clauses 1-10, wherein the concentration of the anti-CD3 antibody or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |lg / mL.

[0267] Clause 12. The method of any one of clauses 1-11, wherein the anti-CD28 antibody or the fragment or equivalent thereof is soluble anti-CD28 antibody or the fragment or equivalent thereof.Atty. Dkt. No.: 116639-3010

[0268] Clause 13. The method of any one of clauses 1-12, wherein the concentration of the anti-CD28 antibody or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |lg / mL.

[0269] Clause 14. The method of any one of clauses 1-13, wherein the contacting is done between 2 days and 5 days or until one or more of the cells of the population are Granzyme B positive.

[0270] Clause 15. The method of any one of clauses 1-14, further comprising isolating the population of CD4+ T-cells.

[0271] Clause 16. A population of CD4+ T-cells prepared by a method of any one of clauses 1 to 15, and optionally wherein the population is substantially homogeneous.

[0272] Clause 17. The population of CD4+ T-cells of clause 16, wherein at least 50%, or alternatively at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 99% of the population are Granzyme B positive.

[0273] Clause 18. The population of CD4+ T-cells of clause 15, wherein at least 50%, or alternatively at least 60%, or at least 70%, or at least 80%, or at least 90%, of the CD4+ cytotoxic T-cells are perforin positive.

[0274] Clause 19. A composition comprising the population of any one of clauses 16-18, and a carrier and / or a cryopreservative or a stabilizer.

[0275] Clause 20. The composition of clause 19, wherein the carrier is a pharmaceutically acceptable carrier.

[0276] Clause 21. A method for treating a tumor or cancer or augmenting an anti-cancer immune response in a subject in need thereof, comprising administering an effective amount of any one of the population of any one of clauses 16-18 or the composition of claim 20 to the subject, thereby treating the tumor or the cancer.

[0277] Clause 22. The method of clause 21, wherein the population of any one of claims 16- 18 or the composition of claim 20 comprise cells autologous to the subject.

[0278] Clause 23. The method of any one of clauses 21-22, further comprising administering an effective amount of one or more cytoreductive therapy and / or immunotherapy to the subject, prior to, concurrently or subsequent to administration of the effective amount of the population or the composition.Atty. Dkt. No.: 116639-3010

[0279] Clause 24. The method of any one of clauses 21 to 23, wherein the subject is a mammal.

[0280] Clause 25. The method of clause 24, wherein the mammal is a canine, feline, or a human patient, and wherein the effective amount of the population of cells or composition is species-specific to the mammal.

[0281] Clause 26. A method for treating an undesirable or aberrant immune response in a subject in need thereof, comprising administering an effective amount of any one of the population of clauses 16-18 or the composition of claim 20 to the subject, thereby treating the undesirable or aberrant immune response, wherein the undesirable or aberrant immune response comprises an autoimmune disease or condition or an allergic response.

[0282] Clause 27. The method of clause 26, wherein the population of any one of claims 16- 18 or the composition of claim 20 comprise cells autologous to the subject.

[0283] Clause 28. The method of any one of clauses 26-27, further comprising administering an effective amount of one or more immunosuppressive therapy.

[0284] Clause 29. The method of any one of clauses 26 to 28, wherein the subject is a mammal.

[0285] Clause 30. An ex vivo method for activating a CD4+ T-cell comprising contacting the T-cell with an anti-CD3 antibody or a fragment or equivalent thereof, and an anti-CD28 antibody or a fragment or equivalent thereof, in the presence of IL-27.

[0286] Clause 31. The method of clause 30, wherein the T-cell is a CAR-T cell.

[0287] Clause 32. The method of clause 30 or 31, wherein the contacting is done in the presence of between about 10 ng / mL to about 30 ng / mL of IL-27 and in the absence of TGF beta and retinoic acid.

[0288] Clause 33. The method of any one of clauses 30-32, wherein the anti-CD3 antibody or the fragment or equivalent thereof is bound to a solid support, optionally wherein the solid support is a cell culture container.

[0289] Clause 34. The method of any one of clauses 30-33, wherein the concentration of the anti-CD3 antibody or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |lg / mL.Aty. Dkt. No.: 116639-3010

[0290] Clause 35. The method of any one of clauses 30-34, wherein the anti-CD28 antibody, or the fragment or equivalent thereof is soluble.

[0291] Clause 36. The method of any one of clauses 30-35, wherein concentration of the the anti-CD28 antibody, or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |lg / mL.

[0292] Clause 37. The method of any one of clauses 30-36, wherein the contacting is done between 2 days and 5 days, or until one or more of the cells of the population are Granzyme B positive.

[0293] Clause 38. The method of any one of clauses 30-37, further comprising isolating the activated T-cells.

[0294] Clause 39. A composition comprising a population of T-cells, wherein the population of T-cells comprise T-cells that display the following marker profile: CD4+, Granzyme B+, Perforin , FoxP3‘, IL-10low, Runx3+and ThPOK+.

[0295] Clause 40. The composition of clause 39, wherein the T-cells are IL-10 deficient T- cells.

[0296] Clause 41. The composition of clause 39, further comprising a pharmaceutically acceptable carrier and / or a cryopreservative or stabilizer.

[0297] Clause 42. The composition of any of clauses 39-41, wherein the population of T- cells is substantially homogeneous.

[0298] Clause 43. The composition of any of clauses 39-42, wherein the T-cells are mammalian cells, optionally human cells.

[0299] Clause 44. A method for treating allergy in a subject in need thereof, comprising administering an effective amount of any one of the population of clauses 16-18 or the composition of clause 20 or clauses 39-42 to the subject, thereby treating the allergy.

[0300] Clause 45. The method of clause 44, wherein the allergy is selected from a pollen allergy, a food allergy, a medication allergy, latex allergy, an insect allergy, a mold allergy, or a dust allergy.

[0301] Other aspects are set forth within the following claims.

Claims

Atty. Dkt. No.: 116639-3010WHAT IS CLAIMED IS:

1. An ex vivo method of generating a population of cytotoxic CD4+ T-cells comprising contacting a population of CD4+ T-cells with an anti-CD3 antibody or a fragment or equivalent thereof, and an anti-CD28 antibody or a fragment or equivalent thereof, in the presence of IL-27, and optionally wherein the population of CD4+ T cells are naive CD4+ T cells or cytotoxic CD4+ T cells.

2. The method of claim 1, wherein the population of naive or cytotoxic CD4+ T-cells is obtained by negative enrichment.

3. The method of claim 1 or 2, wherein the population of naive or cytotoxic CD4+ T- cells comprises one or more of naive CD4+ T-cells, Thl T-cells, Th 17 T-cells, and T- regulatory cells and is, optionally, wherein the population of naive or cytotoxic CD4+ T-cells is substantially homogenous.

4. The method of any one of claims 1-3, wherein the population of naive or cytotoxic CD4+ T-cells is isolated from an in vitro culture system comprising a tumor specimen or tumor cell-line and a population of effector T-cells.

5. The method of claim 4, wherein the tumor specimen has been surgically removed from an animal having a tumor or cancer.

6. The method of any one of claims 1 to 3, wherein the population of naive or cytotoxic CD4+ T-cells has been isolated from a biological sample from an animal having a tumor, a cancer, or an autoimmune disease.

7. The method of claim 6, wherein the biological sample is a fluid or tissue sample from the animal, optionally wherein the biological sample is a fluid or tissue sample from a microenvironment surrounding the tumor.

8. The method of any one of claims 5 to 7, wherein the animal is a human patient diagnosed with a cancer or an autoimmune disease.

9. The method of any one of claims 1-8, wherein the contacting is done in the presence of between about 10 ng / mL to about 30 ng / mL of IL-27 and in the absence of TGF beta and retinoic acid.

10. The method of any one of claims 1-9, wherein the anti-CD3 antibody or the fragment or equivalent thereof is bound to a solid support, optionally where the solid support is a cell culture container.Atty. Dkt. No.: 116639-301011. The method of any one of claims 1-10, wherein the concentration of the anti-CD3 antibody or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |ig / mL.

12. The method of any one of claims 1-11, wherein the anti-CD28 antibody or the fragment or equivalent thereof is soluble anti-CD28 antibody or the fragment or equivalent thereof.

13. The method of any one of claims 1-12, wherein the concentration of the anti-CD28 antibody or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |ig / mL.

14. The method of any one of claims 1-13, wherein the contacting is done between 2 days and 5 days or until one or more of the cells of the population are Granzyme B positive.

15. The method of any one of claims 1-14, further comprising isolating the population of CD4+ T-cells.

16. A population of CD4+ T-cells prepared by a method of any one of claims 1 to 15, and optionally wherein the population is substantially homogeneous.

17. The population of CD4+ T-cells of claim 16, wherein at least 50%, or alternatively at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 99% of the population are Granzyme B positive.

18. The population of CD4+ T-cells of claim 15, wherein at least 50%, or alternatively at least 60%, or at least 70%, or at least 80%, or at least 90%, of the CD4+ cytotoxic T-cells are perforin positive.

19. A composition comprising the population of any one of claims 16-18, and a carrier and / or a cryopreservative or a stabilizer.

20. The composition of claim 19, wherein the carrier is a pharmaceutically acceptable carrier.

21. A method for treating a tumor or cancer or augmenting an anti-cancer immune response in a subject in need thereof, comprising administering an effective amount of any one of the population of any one of claims 16-18 or the composition of claim 20 to the subject, thereby treating the tumor or the cancer.

22. The method of claim 21, wherein the population of any one of claims 16-18 or the composition of claim 20 comprise cells autologous to the subject.Aty. Dkt. No.: 116639-301023. The method of any one of claims 21-22, further comprising administering an effective amount of one or more cytoreductive therapy and / or immunotherapy to the subject, prior to, concurrently or subsequent to administration of the effective amount of the population or the composition.

24. The method of any one of claims 21 to 23, wherein the subject is a mammal.

25. The method of claim 24, wherein the mammal is a canine, feline, or a human patient, and wherein the effective amount of the population of cells or composition is species-specific to the mammal.

26. A method for treating an undesirable or aberrant immune response in a subject in need thereof, comprising administering an effective amount of any one of the population of claims 16-18 or the composition of claim 20 to the subject, thereby treating the undesirable or aberrant immune response, wherein the undesirable or aberrant immune response comprises an autoimmune disease or condition or an allergic response.

27. The method of claim 26, wherein the population of any one of claims 16-18 or the composition of claim 20 comprise cells autologous to the subject.

28. The method of any one of claims 26-27, further comprising administering an effective amount of one or more immunosuppressive therapy.

29. The method of any one of claims 26 to 28, wherein the subject is a mammal.

30. An ex vivo method for activating a CD4+ T-cell comprising contacting the T-cell with an anti-CD3 antibody or a fragment or equivalent thereof, and an anti-CD28 antibody or a fragment or equivalent thereof, in the presence of IL-27.

31. The method of claim 30, wherein the T-cell is a CAR-T cell.

32. The method of claim 30 or 31, wherein the contacting is done in the presence of between about 10 ng / mL to about 30 ng / mL of IL-27 and in the absence of TGF beta and retinoic acid.

33. The method of any one of claims 30-32, wherein the anti-CD3 antibody or the fragment or equivalent thereof is bound to a solid support, optionally wherein the solid support is a cell culture container.

34. The method of any one of claims 30-33, wherein the concentration of the anti-CD3 antibody or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |ig / mL.Atty. Dkt. No.: 116639-301035. The method of any one of claims 30-34, wherein the anti-CD28 antibody, or the fragment or equivalent thereof is soluble.

36. The method of any one of claims 30-35, wherein the concentration of the anti-CD28 antibody, or the fragment or equivalent thereof is between about 0.5 |ig / mL and 4 |ig / mL.

37. The method of any one of claims 30-36, wherein the contacting is done between 2 days and 5 days, or until a CD4+ T-cell is Granzyme B positive.

38. The method of any one of claims 30-37, further comprising isolating the activated T- cells.

39. A composition comprising a population of T-cells, wherein the population of T-cells comprise T-cells that display the marker profile: CD4+, Granzyme B+, Perforin , FoxP3’, IL’ 10low, Runx3+and ThPOKt40. The composition of claim 39, wherein the T-cells are IL-10 deficient T-cells.

41. The composition of claim 39, further comprising a pharmaceutically acceptable carrier and / or a cryopreservative or stabilizer.

42. The composition of any of claims 39-41, wherein the population of T-cells is substantially homogeneous.

43. The composition of any of claims 39-42, wherein the T-cells are mammalian cells, optionally human cells.

44. A method for treating allergy in a subject in need thereof, comprising administering an effective amount of any one of the population of claims 16-18 or the composition of claim 20 or claims 39-42 to the subject, thereby treating the allergy.

45. The method of claim 44, wherein the allergy is selected from a pollen allergy, a food allergy, a medication allergy, latex allergy, an insect allergy, a mold allergy, or a dust allergy.

Images