Combination of cancer vaccines and Anti-TREM2 agents for enhanced cancer immunotherapy

Abstract

The present disclosure generally relates to methods for treating cancer, and more specifically to combinatorial approaches using cancer vaccines together with agents targeting the TREM2 receptor to enhance anti-tumor immune responses. The invention includes methods of administering cancer vaccines in combination with anti-TREM2 agents. This approach enhances anti-tumor immunity by expanding tumor-specific T cells while reducing immunosuppressive macrophages in the tumor microenvironment. Additionally, the invention provides combining cancer vaccines with both anti-TREM2 agents and immune checkpoint inhibitors.

Description

PATENTATTORNEY DOCKET NO. MDA1360-1WOCOMBINATION OF CANCER VACCINES AND ANTI-TREM2 AGENTS FOR ENHANCED CANCER IMMUNOTHERAPYCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of priority under 35 U.S. C. § 119(e) of U.S. Provisional Application No. 63 / 708,191, filed October 16, 2024. The disclosure of the prior applications is considered part of and is herein incorporated by reference in the disclosure of this application in its entirety.INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0002] The material in the accompanying sequence listing is hereby incorporated by reference into this application. The accompanying sequence listing xml file, named MDA1360-1 WO. xml, was created on October 6, 2025, and is 13,363 bytes.BACKGROUND OF THE INVENTIONFIELD OF THE INVENTION

[0003] The present disclosure relates generally to methods for treating cancer and more specifically to use of a cancer vaccine in combination with an agent that targets TREM2 receptor to enhance an anti-tumor immune response.BACKGROUND INFORMATION

[0004] Cancer immunotherapy has emerged as a promising approach for treating various types of cancer. Among the different strategies, cancer vaccines, particularly those targeting tumorspecific neoantigens, have shown potential in stimulating anti-tumor immune responses. Neoantigens are mutated proteins expressed by cancer cells that can be recognized as foreign by the immune system, making them ideal targets for cancer vaccines. These vaccines aim to activate and expand tumor-specific conventional CD4 and CD8 T cells. Different types of cancer vaccines have been developed, including synthetic long peptide (SLP) vaccines and RNA vaccines, each with unique advantages in eliciting anti-tumor immune responses.

[0005] Another important strategy in cancer immunotherapy involves immune checkpoint inhibitors, such as anti-CTLA-4 and anti-PD-1 antibodies. These agents work by blocking inhibitory signals that normally dampen T cell responses, thereby enhancing the ability of T cells to attack tumor cells.11623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO

[0006] The tumor microenvironment (TME) plays a critical role in modulating anti-tumor immune responses. Macrophages, in particular, are abundant in the TME and can significantly influence tumor progression and treatment outcomes. Tumor-associated macrophages (TAMs) often display an immunosuppressive phenotype, inhibiting effective anti-tumor immunity. Recent research has identified the triggering receptor expressed on myeloid cells 2 (TREM2) as an important regulator of macrophage function in the TME. TREM2 is highly expressed on TAMs and has been associated with poor prognosis in various cancer types.

[0007] Given the complex interplay between cancer cells, T cells, and macrophages in the TME, there is a growing interest in developing combinatorial approaches that target multiple aspects of the anti-tumor immune response. Such strategies may include combining cancer vaccines with agents that modulate the TME, such as those targeting TREM2 on macrophages, to enhance the efficacy of cancer immunotherapy.

[0008] Research in cancer immunotherapy has revealed complex interactions between cancer vaccines, T cells, and macrophages in the TME. While cancer vaccines can stimulate tumorspecific T cell responses, the impact on other immune cells, such as macrophages, is not fully understood. The role of TREM2-expressing macrophages in the context of cancer vaccination is an area of active investigation.

[0009] The phenotype of macrophages in the TME can greatly influence the outcome of cancer immunotherapy. Ml -like macrophages are generally considered anti-tumoral, while M2-like macrophages are often associated with immunosuppression and tumor progression. Understanding and potentially modulating the balance between these macrophage populations could be important for enhancing the efficacy of cancer vaccines.

[0010] The potential of combining multiple immunotherapeutic approaches, including cancer vaccines, agents targeting myeloid cells, and immune checkpoint inhibitors, represents an exciting frontier in cancer treatment. Such combinatorial strategies could potentially stimulate tumorspecific T cell responses, modulate the immunosuppressive TME, and enhance overall anti-tumor immunity. This multifaceted approach may hold promise for overcoming the limitations of current cancer immunotherapies and providing more effective treatment options for cancer patients.SUMMARY OF THE INVENTION

[0011] The present disclosure builds on the pivotal discovery that combining cancer vaccines with agents targeting the TREM2 receptor on tumor-associated macrophages enhances anti-tumor immune responses. Leveraging this discovery, the present disclosure provides methods for21623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO improving cancer immunotherapy by administering a combination of a cancer vaccine and an anti- TREM2 agent. The cancer vaccine may be any cancer vaccine, such as a synthetic long peptide (SLP) vaccine, neoantigen vaccines, an oncolytic virus-based vaccine, peptide-based vaccines, cell-based vaccines, RNA vaccines, or vaccines targeting non-mutant shared antigens and / or viral antigens. The anti-TREM2 agent may be any agent that blocks the TREM2 receptor, such as an anti-TREM2 antibody, an anti-TREM2 peptide, or small molecule. This combinatorial approach addresses the limitation of cancer vaccines in maintaining immunosuppressive macrophage populations while simultaneously enhancing tumor-specific T cell responses. The method effectively reshapes the tumor microenvironment by reducing immunosuppressive macrophages, promoting Ml -like iNOS+ anti-tumor macrophages, and increasing the frequency and function of tumor-specific CD8+ T cells. Furthermore, the disclosure demonstrates the potential of combining cancer vaccines, particularly neoantigen SLP vaccines, with both anti-TREM2 treatment and immune checkpoint inhibitors, such as anti-PD-1 antibodies, to further enhance therapeutic efficacy. This approach offers a promising strategy for enhancing the efficacy of cancer vaccines and expanding their therapeutic window, potentially leading to improved outcomes in cancer treatment.

[0012] In one embodiment, the present disclosure provides a composition for treating cancer, comprising a cancer vaccine and an anti-TREM2 agent.

[0013] In some aspects, the cancer vaccine includes any cancer vaccine, such as an RNA vaccine, a SLP cancer vaccine, an oncolytic virus-based vaccine, a peptide-based vaccine, a cellbased vaccine, or combinations thereof.

[0014] In some aspect, the cancer vaccine targets antigens, such as neoantigens, non-mutant tumor antigens, viral antigens, defective ribosomal products, or combinations thereof.

[0015] In some aspects, the anti-TREM2 agent is an agent that blocks TREM2 receptor, such as an anti-TREM2 antibody, an anti-TREM2 peptide, an anti-TREM2 small molecule, or combinations thereof.

[0016] In some aspects, the SLP cancer vaccine includes one or more synthetic long peptides encoding tumor-specific neoantigens.

[0017] In some aspects, the composition further includes an adjuvant, such as poly I:C, poly ICLC, poly LC12U, CpG oligodeoxynucleotides (CpG ODN), imiquimod, resiquimod, flagellin, monophosphoryl lipid A (MPL), double-stranded RNA mimetics, RIG-I agonists, STING agonists, and combinations thereof.31623862901.3439994.000083PATENT ATTORNEY DOCKET NO. MDA1360-1WO

[0018] In another embodiment, the present disclosure provides a method of treating cancer in a subject, the method comprising: administering to the subject a therapeutically effective amount of: a cancer vaccine; and an anti-TREM2 agent.

[0019] In some aspects, the cancer vaccine includes any cancer vaccine, such as an RNA vaccine, a SLP cancer vaccine, an oncolytic virus-based vaccine, a peptide-based vaccine, a cellbased vaccine, or combinations thereof.

[0020] In some aspect, the cancer vaccine targets antigens, such as neoantigens, non-mutant tumor antigens, viral antigens, defective ribosomal products, or combinations thereof.

[0021] In some aspects, the anti-TREM2 agent is an agent that blocks TREM2 receptor, such as an anti-TREM2 antibody, an anti-TREM2 peptide, an anti-TREM2 small molecule, or combinations thereof.

[0022] In some aspects, the cancer vaccine and the anti-TREM2 agent are administered concurrently.

[0023] In some aspects, the cancer vaccine and the anti-TREM2 agent are administered sequentially.

[0024] In some aspects, the method further includes administering an adjuvant, such as poly EC, poly ICLC, poly EC12U, CpG oligodeoxynucleotides (CpG ODN), imiquimod, resiquimod, flagellin, monophosphoryl lipid A (MPL), double-stranded RNA mimetics, RIG-I agonists, STING agonists, aluminum salts (alum), MF59, AS01, AS03, AS04, QS-21, virosomes, CAF01, Advax, chitosan, glucopyranosyl lipid A (GLA), Pam3CSK4, IC31, Matrix-M, Montanide ISA 51 , and combinations thereof.

[0025] In some aspects, administration of the cancer vaccine and the anti-TREM2 agent results in a decrease in intratumoral immunosuppressive, e.g., CX3CR1+CD206+ macrophages.

[0026] In some aspects, administration of the cancer vaccine and the anti-TREM2 agent results in an increase in intratumoral iNOS+ macrophages.

[0027] In some aspects, administration of the cancer vaccine and the anti-TREM2 agent results in an increase in neoantigen-specific CD8+ T cells.

[0028] In some aspects, the method further includes administering an immune checkpoint inhibitor.

[0029] In some aspects, the immune checkpoint inhibitor includes an anti-PD-1 antibody, an anti-CTLA-4 antibody, or combinations thereof.41623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO

[0030] In some aspects, the cancer includes melanoma, colorectal cancer, or combinations thereof.

[0031] In some aspects, the SLP cancer vaccine includes one or more synthetic long peptides encoding tumor-specific neoantigens identified from the subject’s tumor.

[0032] In some aspects, the disclosed method results in enhanced tumor regression compared to administering either the cancer vaccine or the anti-TREM2 agent alone.

[0033] In some aspects, the method further includes administration of chemotherapy or radiation therapy.

[0034] In another embodiment, the present disclosure provides a method of modulating the tumor microenvironment in a subject with cancer, including: administering to the subject a therapeutically effective amount of: a cancer vaccine; and an anti-TREM2 agent, wherein the administration results in a decrease in intratumoral immunosuppressive, e.g., CX3CR1+CD206+ macrophages and an increase in intratumoral iNOS+ macrophages.

[0035] In some aspects, the cancer vaccine includes an RNA vaccine, a SLP cancer vaccine, an oncolytic virus-based vaccine, a peptide-based vaccine, a cell-based vaccine, or combinations thereof.

[0036] In some aspects, the cancer vaccine targets antigens, such as neoantigens, non-mutant tumor antigens, viral antigens, defective ribosomal products, or combinations thereof.

[0037] In some aspects, the anti-TREM2 agent includes an anti-TREM2 antibody, an anti- TREM2 peptide, an anti-TREM2 small molecule, or combinations thereof.BRIEF DESCRIPTION OF THE DRAWINGS

[0038] FIG. 1A illustrates a timeline of the experimental schedule and graphs showing tumor growth, cumulative mouse survival, and percent tumor rejection in wildtype (WT) mice transplanted with Y1.7AI and Y I .7LI melanoma cells and treated with control monoclonal antibody (mAb) or anti-CTLA-4 starting 3 days post-tumor transplant. Tumor growth data is presented as individual mouse tumor growth as mean tumor diameter and are representative of at least three independent experiments. Tumor rejection graph displays percentage of mice with complete tumor rejection from at least three independent experiments.

[0039] FIG. IB illustrates a timeline of the experimental schedule and graphs showing tumor growth, cumulative mouse survival, and percent tumor rejection in WT mice transplanted with Y 1.7AI and Y 1.7LI melanoma cells and treated with mAlg8 or mLama4 NeoAg SLP (Neoantigen synthetic long peptide) plus poly I:C vaccines or poly I:C alone starting 3 days post-tumor51623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO transplant. Tumor growth data is presented as individual mouse tumor growth as mean tumor diameter and are representative of at least three independent experiments. Tumor rejection graph displays percentage of mice with complete tumor rejection from at least three independent experiments. Cumulative survival curve includes mice from at least three independent experiments (***p < 0.001, log-rank (Mantel-Cox) test).

[0040] FIG. 1C illustrates a timeline of the experimental schedule and bar graphs displaying mAlg8 or mLama4 tetramer-specific CD8 T cells in Y1.7AI and Y I .7LI tumors treated with control mAh, anti-CTLA-4, poly EC, mAlg8 SLP + poly EC (NeoAg SLP vaccine for Y 1 ,7AI) or mLama4 SLP + poly I:C (NeoAg SLP vaccine for Y1.7LI) as in (A) and (B) and harvested 16 days post-tumor transplant. SIINFEKL (SEQ ID NO: 8) -H2-Kb tetramer served as irrelevant control. Display mean ± SEM and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.005, NS, not significant; unpaired, two-tailed Student's t test).

[0041] FIG. ID illustrates a timeline of the experimental schedule and graphs showing tumor growth, cumulative mouse survival, and percent tumor rejection in WT mice transplanted with YULI melanoma cells and treated with control mAb, anti-CTLA-4, anti-PD-1, anti-CTLA-4 + anti-PD-1, irrelevant (for YULI) mAlg8 SLP + poly I:C (control VAX), or relevant mLama4 SLP + poly I:C (NeoAg SLP Vax) starting on day 7 post-tumor transplant. Tumor growth data is presented as individual mouse tumor growth as mean tumor diameter and are representative of at least three independent experiments. Tumor rejection graph displays percentage of mice with complete tumor rejection from at least three independent experiments. Cumulative survival curve includes mice from at least three independent experiments (***p < 0.001, log-rank (Mantel-Cox) test).

[0042] FIG. 2A illustrates the experimental setup for single-cell RNA sequencing (scRNAseq) analysis of intratumoral CD45+ cells from Y 1.7LI tumors under different treatment conditions. WT mice were injected with YULI melanoma cells and subsequently treated beginning on day 7 with control mAb, anti-CTLA-4, anti-PD-1, anti-CTLA-4 + anti-PD-1, Control Vax, or mLama4 NeoAg SLP Vax and harvested on day 15 post-tumor transplant. Tumors from 5 individual mice per treatment group were pooled and processed. Intratumoral live CD45+ cells were sorted and analyzed by scRNAseq.

[0043] FIG. 2B illustrates a uniform manifold approximation and projection (UMAP) plot from scRNAseq of intratumoral CD45+ cells with annotated cell types.

[0044] FIG. 2C illustrates a feature plot showing lineage-specific transcripts.61623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO

[0045] FIG. 2D illustrates a feature plot displaying subclustering of activated T cell-containing clusters.

[0046] FIG. 2E illustrates a heatmap displaying average expression of select transcripts by cluster.

[0047] FIG. 2F illustrates a bar graph showing frequency of subclustered T cell-containing clusters by treatment.

[0048] FIG. 2G is a table listing select genes describing each CD8 and CD4 T cell cluster.

[0049] FIG. 2H is a dot plot graph illustrating expression level and percent of cells expressing Foxp3, Cd4, Cd8, Ifng in Cd4 / 8Cycling by treatment condition.

[0050] FIG. 3A illustrates the experimental setup for analysis of mLama4 tetramer positive CD8 T cells from Y1.7LI tumors under different treatment conditions. WT mice were injected with Y I .7LI melanoma cells and subsequently treated beginning on day 7 with control mAb, anti- CTLA-4, anti-PD-1, anti-CTLA-4 + anti-PD-1, Control Vax or mLama4 NeoAg SLP Vax and harvested on day 15 post-tumor transplant. Tumors from 5 individual mice per treatment group were pooled and processed.

[0051] FIG. 3B illustrates a bar graph showing CD 8 T cells as a percentage of intratumoral live CD45+ cells in Y1.7LI tumors under different treatment conditions. Bar graphs display mean ± SEM and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.005, **** P < 0.0001; NS, not significant, unpaired t test). Tumors from 5 individual mice per treatment group were pooled and processed. Single cell suspensions of harvested tumors were stained with mLama4-H2-Kb PE and APC labelled tetramers for analysis

[0052] FIG. 3C illustrates a bar graph showing irrelevant SIINFELK tetramer-positive and mLama4 tetramer-positive CD8 T cells as a percentage of CD8 T cells in Y1.7LI tumors under different treatment conditions. Bar graphs display mean ± SEM and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.005, **** P < 0.0001; NS, not significant, unpaired t test).

[0053] FIG. 3D illustrates a bar graph showing irrelevant SIINFELK tetramer-positive and mLama4 tetramer-positive CD8 T cells as a percentage of CD45+ cells in YULI tumors under different treatment conditions. Bar graphs display mean ± SEM and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.005, **** P < 0.0001; NS, not significant, unpaired t test).71623862901.3439994.000083PATENT ATTORNEY DOCKET NO. MDA1360-1WO

[0054] FIG. 3E illustrates a uniform manifold approximation and projection (UMAP) plot from scRNAseq of mLama4 NeoAg-specific CD8 T cells. Cell types were annotated based on transcriptional states of NeoAg-specific CD8 T cells.

[0055] FIG. 3F illustrates feature plots displaying expression of select phenotype and lineage transcripts.

[0056] FIG. 3G illustrates a heatmap displaying average expression of select transcripts by cluster.

[0057] FIG. 3H illustrates scRNAseq dot plots depicting expression level / percent of cells expressing select transcripts within select mLama4 NeoAg-specific CD8 T cell clusters by treatment condition.

[0058] FIG. 31 illustrates violin plots denoting expression levels of select genes per neoAg- specific CD8 T cell.

[0059] FIG. 3J illustrates a table listing select genes describing NeoAg-specific CD8 T cell cluster.

[0060] FIG. 4A illustrates a heatmap comparing features (module scores) of mLama4 NeoAg- specific CD8 T cell clusters (rows) to published mouse CD8 T cell gene signatures (columns) identified and annotated (e.g., “Effector-like”).

[0061] FIG. 4B illustrates a heatmap comparing features (module scores) of mLama4 NeoAg- specific CD8 T cell clusters (rows) to published human CD8 T cell gene signatures (columns) identified and annotated (e.g., “CD8_l.Exh / Cell Cycle”).

[0062] FIG. 4C illustrates bar graphs displaying frequency of mLama4 NeoAg-specific CD8 T cells within each cluster by treatment condition represented in two different ways.

[0063] FIG. 4D illustrates bar graphs displaying percent of PD-1+ TIM-3+ / LAG-3+ or MFI of PD-1, TIM-3, or LAG-3 on PD-1+, TIM-3+, or LAG-3+ mLama4-specific CD8 T cells in Y1.7LI tumors under different treatment conditions and harvested on day 15 post-tumor transplant. Bar graphs display mean ± SEM and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.005, **** P < 0.0001; NS, not significant, unpaired t test).

[0064] FIG. 4E illustrates bar graphs displaying IFN-y+ or TNF-a+ CD8 T cells and IFN-y or TNF-a MFI as assessed by intracellular cytokine staining of mLama4 peptide restimulated CD8 T cells isolated from YULI tumors under different treatment conditions and harvested 15 days post-tumor transplant. Bar graphs display mean ± SEM and are representative of at least three81623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO independent experiments (*P < 0.05, **P < 0.01, ***P < 0.005, **** P < 0.0001; NS, not significant, unpaired t test).

[0065] FIG. 4F illustrates a bar graph displaying the frequency of total mLama4 NeoAg-specific CD8 T cells within the combined 5 cycling clusters by treatment condition.

[0066] FIG. 5A illustrates heatmaps displaying normalized expression of select genes in each CD4 T cell cluster by treatment condition.

[0067] FIG. 5B illustrates a bar graph depicting frequency of CD4 T cells within each cluster by treatment condition.

[0068] FIG. 5C illustrates a heatmap comparing features (module scores) of CD4 T cell clusters (rows) to published human CD4 T cell gene signatures (columns) of NeoAg-specific CD4 T cells.

[0069] FIG. 5D illustrates a bar graph displaying CD4 T cells as a percentage of intratumoral live CD45+ cells as determined by flow cytometry in Y1.7LI tumors under different treatment conditions and harvested 15 days post-tumor transplant. Bar graphs display mean ± SEM and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.005,< 0.0001, NS, not significant, unpaired t test).

[0070] FIG. 5E illustrates a bar graph displaying IFNy+ CD4 T cells as assessed by intracellular cytokine staining on CD4 T cells isolated from Y 1.7LI tumors under different treatment conditions and harvested 15 days post-tumor transplant. Bar graphs display mean ± SEM and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.005,< 0.0001, NS, not significant, unpaired t test).

[0071] FIG. 5F illustrates Monocle 3-Guided Cell Trajectory of CD4 T Cell Clusters. An uniform manifold approximation and projection (UMAP) plot displaying exclusively CD4 T cellcontaining clusters (left) of all experimental conditions, CD4 T cell trajectory graph overlaid on UMAP (middle) where the origin of the inferred pseudotime is indicated by the red arrow and assigned with pseudotime score 0, and geodesic distances and pseudotime score among other CD4 T cells are calculated from there based on transcripts associated cell states. CD4 T cell clusters overlaid on Monocle3 pseudo time plot (right).

[0072] FIG. 6A illustrates a uniform manifold approximation and projection (UMAP) displaying sub-clustering of select myeloid clusters from CD45+ scRNAseq analysis and heat map displaying normalized expression of select genes in each monocyte / macrophage cluster.

[0073] FIG. 6B illustrates a bar graph depicting frequency of Monocytes / macrophages in each cluster by treatment condition represented as percent of CD45+ cells.91623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO

[0074] FIG. 6C illustrates a heatmap displaying normalized expression of Mrcl (CD206), Cx3crl, and Nos2 (iNOS) in each monocyte / macrophage cluster by treatment condition.

[0075] FIG. 6D illustrates a scRNAseq dot plot depicting expression level / percent of cells expressing Trem2 and Cx3crl within all monocytes / macrophages clusters by treatment condition.

[0076] FIG. 6E illustrates representative flow cytometry plots and graph displaying CX3CR1+CD206+ macrophages in Y I .7LI tumors under different treatment conditions and harvested 15 days post-tumor transplant.

[0077] FIG. 6F illustrates representative flow cytometry plots and graph displaying iNOS+ macrophages in YULI tumors under different treatment conditions and harvested 15 days posttumor transplant.

[0078] FIG. 6G illustrates violin plots denoting expression level of Cx3crl transcript per cell in each monocyte / macrophage cluster by treatment condition.

[0079] FIG. 6H illustrates violin plots denoting expression level of Nos2 (iNOS) transcript per cell in each monocyte / macrophage cluster by treatment condition.

[0080] FIG. 7A illustrates Trem2 mRNA detection by quantitative reverse transcriptase PCR (qRT-PCR) on sorted intratumoral CX3CR1+ CD206+ macrophages and non-CX3CRl+ CD206+ macrophages isolated 19 days post-tumor transplant from Y 1.7LI tumor bearing WT mice treated with NeoAg SLP Vax on day 12 and 18. RNA was isolated from intratumoral macrophages from 2 individual mice (two independent experiments).

[0081] FIG. 7B illustrates a schematic depimmune checkpoint therapydepiction of experiment to determine the anti-tumor immunity with the NeoAg SLP vaccines and the blockade of TREM2.

[0082] FIG. 7C illustrates graphs showing tumor growth in WT mice transplanted with Y 1.7LI melanoma cells and receiving intratumoral injection of 0.5 x 106CX3CR1+CD206+macrophages or PBS on days 4, 7, and 10 post-tumor transplant and treated with irrelevant SLP + poly I:C (Control Vax), relevant NeoAg SLP + poly I:C (NeoAg SLP Vax), anti-TREM2, NeoAg SLP Vax + isotype control mAb (Iso), or NeoAg SLP Vax + anti-TREM2. Fraction indicates number of mice rejecting tumors / number of mice used in the experiment.

[0083] FIG. 7D illustrates an experiment timeline and graphs showing tumor growth in WT mice transplanted with Y 1.7LI mouse melanoma tumors and treated with isotype control mAb (Iso), anti-TREM2, Iso + Control Vax (irrelevant SLP + poly I:C), Iso + NeoAg SLP Vax (NeoAg SLP + poly I:C), anti-TREM2 + Control Vax or anti-TREM2 + NeoAg SLP Vax. Fraction indicates number of mice rejecting tumors / number of mice used in the experiment.101623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO

[0084] FIG. 7E illustrates a schematic depimmune checkpoint therapydepiction of experiment to determine the population of macrophages and CD8T cells in the tumor after the treatment with the NeoAg SLP vaccines and the blockade of TREM2. Scatterplots display individual mice (n=5 per group) and are representative of two independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, * *** P < 0.0001, NS, not significant, unpaired t test).

[0085] FIG. 7F illustrates graphs displaying frequency of intratumoral CX3CR1+CD206+macrophages and iNOS+macrophages. Scatterplots display individual mice (n=5 per group) and are representative of two independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, NS, not significant, unpaired t test).

[0086] FIG. 7G illustrates a graph displaying mLama4 tetramer-positive CD8 T cells as a percentage of CD8 T cells. Scatterplots display individual mice (n=5 per group) and are representative of two independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, NS, not significant, unpaired t test).

[0087] FIG. 7H illustrates a graph displaying IFN-y+ CD8 T cells as assessed by intracellular cytokine staining of mLama4 peptide restimulated CD8 T cells isolated from Y 1.7LI tumors under different treatment conditions. Scatterplots display individual mice (n=5 per group) and are representative of two independent experiments (*P < 0.05,< 0.01, ***P < 0.001, ****P <0.0001, NS, not significant, unpaired t test).

[0088] FIG. 8A illustrates a schematic of NeoAg minigenes used to express NeoAgs in the parental BrafV600E Pten- / -Cdkn2a- / - YUMM1.7 melanoma line, along with peptide sequences encoded by minigenes. mLama4 or mAlg8 and mltgbl NeoAg minigene coding sequences were separated by 2A peptide sequences that induce ribosomal skipping during translation.

[0089] FIG. 8B (SEQ ID NOs: 2, 7 and 9) illustrates graphs showing tumor growth in WT C57BL / 6J mice transplanted with parental BrafV600E Pten- / - Cdkn2a- / - YUMM1.7 melanoma cells and treated with control mAb, anti-CTLA-4, anti-PD-1 or anti-CTLA4 + anti-PD-1 combination immune checkpoint therapy (ICT) on days 3, 6, 9, 12, 18, 24 post tumor-transplant. Tumor growth data is presented as individual mouse tumor growth as mean tumor diameter and is representative of three independent experiments.

[0090] FIG. 8C illustrates graphs showing WT C57BL / 6J mice transplanted with Y1.7 mAMHC' fmIMHC-II (Y1.7AI) and Y1.7 mLMI I( -l.mIMI I( _|1(YULI) melanoma cells and treated with control mAb or anti-CTLA-4 on days 3, 6, 9, 12, 18, 24 or mAlg8 NeoAg (relevant for Y1.7AI) synthetic long peptide (SLP) + poly I:C (poly I:C) (neoAg SLP Vax) or mLama4 NeoAg (relevant111623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO for Y 1.7LI) synthetic long peptide (SLP) + poly EC (neoAg SLP Vax) on days 3, 9, 15. Mice were rechallenged with same tumor used for initial tumor challenge at least 60 days post-rejection of primary tumor. Naive WT C57BL / 6J mice transplanted with Y 1.7AI or Y1.7LI tumor without any treatment were included as controls, indicating cell line preps used in rechallenge experiments were capable of tumor formation. Tumor growth data is presented as individual mouse tumor growth as mean tumor diameter and is representative of three independent experiments.

[0091] FIG. 8D illustrates graphs showing WT C57BL / 6J mice transplanted with Y I .7LI melanoma cells and treated with anti-CTLA-4 immune checkpoint therapy (ICT) on days 3, 6, 9, 12, 18, 24 or mLama4 NeoAg SLP + poly I:C (neoAg SLP Vax) on days 3, 9, 15. Mice were rechallenged with either with same tumor used for initial tumor challenge (Y 1.7LI) or parental BrafV600E Pten- / - Cdkn2a- / - YUMM1.7 at least 60 days post-rejection of primary tumor. Naive WT C57BL / 6J mice transplanted with either Y 1.7LI or parental YUMM1.7 without any treatment were included as controls. Tumor growth data is presented as individual mouse tumor growth as mean tumor diameter and is representative of three independent experiments.

[0092] FIG. 8E illustrates experimental scheme and representative flow cytometry plots displaying mAlg8 or mLama4 tetramer-specific CD8 T cells in Y1.7AI and Y 1.7LI tumors treated with control mAb, anti-CTLA-4, poly EC, mAlg8 SLP + poly I:C NeoAg SLP vaccine (for Y1.7AI) or mLama4 SLP + poly I:C NeoAg SLP vaccine (for Y1.7LI) and harvested 16 days post-tumor transplant. mAlg8-H2-Kb or mLama4-H2-Kb, tetramers were labeled with PE and APC. Dot plots are gated on live CD45+ Thy 1.2+ CD8 T cells.

[0093] FIG. 8F illustrates bar graphs showing co-expression of PD-1 and TIM-3 on mAlg8- or mLama4-specific CD8 T cells in Y1.7AI and Y1.7LI tumors treated with control mAb, anti- CTLA-4, poly I:C alone, mAlg8 SLP + poly I:C NeoAg SLP vaccine (for Y1.7AI), or mLama4 SLP + poly I:C NeoAg SLP vaccine (for Y1.7LI). Bar graphs display mean ± SEM and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, NS, not significant, unpaired t test).

[0094] FIG. 9 A illustrates experimental scheme and graphs showing Y1.7LI tumor growth in WT C57BL / 6J mice treated with isotype control mAb, anti-CD4, or anti-CD8a mAbs on days -1, 6, 13, 20 and anti-CTLA-4 or anti-PD-1 on days 7, 10, 13, 16, 22, 28 or irrelevant mAlg8 SLP + poly I:C (Control Vax) or relevant mLama4 SLP + poly I:C (neoAg SLP Vax) on days 7, 13, 19. Tumor growth data is presented as individual mouse tumor growth as mean tumor diameter and are representative of three independent experiments.121623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO

[0095] FIG. 9B illustrates graphs showing WT C57BL / 6J mice transplanted with Y1.7LI melanoma cells were treated with control mAh, anti-CTLA-4, anti-PD-1, anti-CTLA-4 + anti-PD- 1, irrelevant (for Y1.7LI) mAlg8 SLP + poly EC (Control Vax), or relevant mLama4 SLP + poly EC (neoAg SLP Vax) starting on day 7 post tumor-transplant, and subsequently on days 10, 13, 16, 22, 28 for immune checkpoint therapy (ICT) and days 13, 19 for Control Vax or neoAg SLP Vax. Mice were rechallenged with the same tumor line used for initial tumor challenge (YULI) at least 60 days post-rejection of primary tumor. Naive WT C57BL / 6J mice transplanted with Y 1.7LI tumor without any treatment was included as a control. Tumor growth data is presented as individual mouse tumor growth as mean tumor diameter and are representative of three independent experiments.

[0096] FIG. 10A illustrates bar graphs showing flow cytometry data displaying intratumoral lymphoid and myeloid cells as a percentage of intratumoral live or live CD45+ cells in Y1.7LI tumors treated with control mAb, anti-CTLA-4, anti-PD-1, anti-CTLA-4 + anti-PD-1, irrelevant (for YULI) mAlg8 SLP + poly I:C (Control Vax), or relevant mLama4 SLP + poly I:C (neoAg SLP Vax) beginning on 7 days post-tumor transplant and harvested on day 15. Bar graphs display mean ± SEM and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.005, ****P < 0.0001, NS, not significant, unpaired t test).

[0097] FIG. 10B illustrates dot plot depicting expression level and percent of cells expressing Foxp3, Ctla4, Icos, Tigit, Havcr2 (TIM-3), Klrgl, Gzmb and graph displaying frequency of regulatory T cell (Treg) scRNAseq clusters by treatment condition.

[0098] FIG. 10C illustrates bar graphs displaying mixed T cell clusters represented as percentage of total subclustered T cells and percentage of Foxp3+ CD4 Tregs, conventional CD4 T cells, or CD8 T cells in clusters T_l, T_2, and T_3 by treatment condition.

[0099] FIG. 10D illustrates bar graphs displaying gd T cell clusters represented as percentage of total subclustered T cells by treatment condition.

[0100] FIG. 10E illustrates bar graphs displaying innate lymphoid cell (ILC) clusters represented as percentage of total subclustered T cells by treatment condition.

[0101] FIG. 11 illustrates a heatmap of the top 10 most differentially expressed genes (DEG) across T cell / innate lymphoid cell (ILC) clusters.

[0102] FIG. 12A illustrates a heatmap displaying normalized expression of select genes in each T cell / innate lymphoid cell (ILC) cluster by treatment condition.131623862901.3439994.000083PATENT ATTORNEY DOCKET NO. MDA1360-1WO

[0103] FIG. 12B illustrates a Gene set enrichment analysis (GSEA) displaying significantly enriched gene sets in cluster Cd4 / 8 Cycling.

[0104] FIG. 12C illustrates a bar graph showing proliferation of T cells in cluster Cd4 / 8Cycling by treatment condition represented as percentage of subclustered T cells.

[0105] FIG. 12D illustrates a bar graph showing a percentage of Foxp3+ Tregs, conventional CD4 T cells, or CD8 T cells in Cd4 / 8Cycling by treatment condition.

[0106] FIG. 12E illustrates a bar graph displaying CD8 T cells from cluster Cd4 / 8Cycling represented as percentage of total subclustered T cells.

[0107] FIG. 12F illustrates a bar graph displaying conventional CD4 T cells from cluster Cd4 / 8Cycling represented as percentage of total subclustered T cells.

[0108] FIG. 13A illustrates a heatmap displaying normalized expression of select genes in each bulk CD8 T cell clusters.

[0109] FIG. 13B illustrates a bar graph depicting frequency of each CD8 T cell cluster by treatment condition.

[0110] FIG. 13C illustrates a gene set enrichment analysis (GSEA) displaying significantly enriched gene sets in each CD8 T cell cluster.

[0111] FIG. 14A illustrates representative flow cytometry plots displaying mLama4-specific (assessed by tetramer and dextramer staining) CD 8 T cells in Y1.7LI tumors treated with control mAb, anti-CTLA-4, anti-PD-1, anti-CTLA-4 + anti-PD-1, irrelevant (for Y1.7LI) mAlg8 SLP + poly EC (Control Vax), or relevant mLama4 SLP + poly EC (neoAg SLP Vax) beginning on days 7 and harvested 15 days post-tumor transplant. mLama4-H2-Kb tetramers were labeled with PE and APC and mLama4-H2-Kb dextramer was labeled with PE. Dot plots are gated on live CD45+ Thyl.2+ CD8 T cells.

[0112] FIG. 14B illustrates a heatmap displaying normalized expression of select genes in each mLama4 NeoAg-specific CD8 T cell clusters by treatment condition.

[0113] FIG. 14C illustrates representative flow cytometry plots displaying PD-1+ and / or TIM- 3+ / LAG-3+ after gating on mLama4 tetramer positive CD8 T cells.

[0114] FIG. 15 illustrates a heatmap of the top 10 most DEG across NeoAg-specific CD8 T cells clusters.

[0115] FIG. 16A illustrates a gene set enrichment analysis (GSEA) displaying significantly enriched gene sets for each NeoAg-specific CD8 T cells cluster.141623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO

[0116] FIG. 16B illustrates a bar graph showing a frequency of total mLama4 NeoAg-specific CD8 T cells by treatment condition within the 5 cycling clusters combined.

[0117] FIG. 16C illustrates dot plots and bar graph displaying Annexin V and viability dye (NIR) staining gated on intratumoral CD8 T cells from Y1.7LI tumors treated with control mAb, anti-CTLA-4, anti-PD-1, anti-CTLA-4 + anti-PD-1, irrelevant (for Y I .7LI) mAlg8 SLP + poly EC (Control Vax), or relevant mLama4 SLP + poly I:C (neoAg SLP Vax) beginning on day 7 and harvested on day 15 post-tumor transplant.

[0118] FIG. 17A illustrates a gene set enrichment analysis (GSEA) displaying significantly enriched gene sets within each CD4 T cell cluster by treatment condition.

[0119] FIG. 17B illustrates Violin plots denoting expression level of select genes per CD4 T cell for each CD4 T cell cluster.

[0120] FIG. 18A illustrates a uniform manifold approximation and projection (UMAP) plot displaying myeloid cell sub-clustering and dendritic cell (DC) annotations.

[0121] FIG. 18B illustrates a heatmap displaying normalized expression of select genes in each DC cluster.

[0122] FIG. 18C illustrates a graph depicting frequency of DCs in each cluster by condition and treatment represented as percent of live CD45+ cells.

[0123] FIG. 18D illustrates a heatmap displaying normalized expression of select genes in each DC cluster by treatment condition.

[0124] FIG. 18E illustrates a heatmap displaying normalized expression of select genes in each DC cluster by treatment condition.

[0125] FIG. 19A illustrates violin plots denoting expression level of Cx3crl transcript per cell in each monocyte / macrophage cluster by treatment condition.

[0126] FIG. 19B illustrates violin plots denoting expression level of Nos2 (iNOS) transcript per cell in each monocyte / macrophage cluster by treatment condition.

[0127] FIG. 19C illustrates a heatmap displaying normalized expression of select genes in each monocyte / macrophage cluster by treatment condition.

[0128] FIG. 20A illustrates an experimental scheme and graphs showing tumor growth and cumulative survival of WT C57BL / 6J mice transplanted with Y1.7LI melanoma cells on day 0 and treated beginning on day 12 with different monotherapies: control mAb, anti-CTLA-4, anti- PD-1, irrelevant SLP + poly EC (Control Vax), or relevant mLama4 SLP + poly I:C (neoAg SLP Vax); or combination therapies: anti-CTLA-4 + anti-PD-1 combination IMMUNE151623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WOCHECKPOINT THERAPY (ICT), anti-CTLA-4 + control VAX, anti-CTLA-4 + neoAg SLP Vax, anti-PD-1 + control VAX, or anti-PD-1 + neoAg SLP Vax. Tumor growth data is presented as individual mouse tumor growth as mean tumor diameter with fraction indicating (# of mice rejecting tumor) / (# of mice used in experiment) and are representative of three independent experiments. Cumulative survival curve includes mice from three independent experiments (*P < 0.01, **P < 0.05, ***P < 0.001, log-rank (Mantel-Cox) test).

[0129] FIG. 20B illustrates an experimental scheme and graphs showing tumor growth and cumulative survival of WT C57BL / 6J mice transplanted with MC38 cells on day 0 and treated beginning on day 12 with different monotherapies: control mAh, anti-CTLA-4, anti-PD-1, irrelevant HPV SLP + poly I:C (Control Vax), or relevant mAdpgk SLP + mRpll8 SLP + mDpagtl SLP + poly I:C (neoAg SLP Vax); or combination therapies: anti-CTLA-4 + anti-PD-1 combination IMMUNE CHECKPOINT THERAPY (ICT), anti-CTLA-4 + Control Vax, anti- CTLA-4 + neoAg SLP Vax, anti-PD-1 + Control Vax, or anti-PD-1 + neoAg SLP Vax. Tumor growth data is presented as individual mouse tumor growth as mean tumor diameter with fraction indicating (# of mice rejecting tumor) / (# of mice used in experiment) and are representative of three independent experiments. Cumulative survival curve includes mice from three independent experiments (*P < 0.01, **P < 0.05, ***P < 0.001, log-rank (Mantel-Cox) test).

[0130] FIG. 21 shows flow cytometry dot plots and gating of intratumoral myeloid and lymphoid populations.

[0131] FIG. 22 illustrates graphs showing tumor growth in wild-type (WT) mice transplanted with Y1.7LI mouse melanoma tumors and treated with isotype control mAb (Iso), anti-TREM2 (a TREM2), Iso + Control Vax (irrelevant SLP + poly I:C), Iso + SLP nVax (mLama4 NeoAg SLP + poly I:C), or aTREM2 + SLP nVax. Treatments were administered on days 7, 12, 17, and 22 for Iso and aTREM2, and on days 12, 18, and 24 post-transplant for Control Vax or SLP nVax. The anti-mouse TREM2 [Fc Muted (Clone 178 (LALAPG))] was used for non-depleting TREM2 blocking. Tumor growth data is presented as individual mouse tumor growth over time. Fractions indicate the number of mice rejecting tumors out of the total number of mice used in the experiment.

[0132] FIG. 23 illustrates graphs showing tumor growth in wild-type (WT) mice transplanted with Y 1.7LI mouse melanoma tumors and treated with various combinations of therapies: isotype control mAb (Iso); Control Vax (irrelevant SLP + poly I:C) + Iso; Control Vax + anti-PD-1 (aP) + anti-TREM2 (aT); aP + aT; SLP nVax (mLama4 NeoAg SLP + poly I:C) + aP; SLP nVax +161623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO aT; or SLP nVax + aP + aT. Iso and aTREM2 were administered on days 12, 17, and 22 posttransplant. Control Vax or SLP nVax were given on days 15, 21, and 27 post-transplant. Anti-PD- 1 treatment was administered on days 15 and 18 post-transplant. Tumor growth data is presented as individual mouse tumor growth over time. Fractions indicate the number of mice rejecting tumors out of the total number of mice used in the experiment.

[0133] FIG. 24A is a graph illustrating a gene signature from mouse CX3CR1+ macrophages (that co-express TREM2 and are the targets of TREM2 blockade) compared to human intratumoral macrophage single cell RNAseq data from tumors of patients with lung cancer, liver cancer, or melanoma.

[0134] FIG. 24B is a graph illustrating CX3CR1+ MO gene signature associates with poorer overall survival in a cohort of melanoma patients treated with aPD-l / PD-Ll & / or aCTLA-4 immune checkpoint therapy (ICT).

[0135] FIG. 24C are box plots illustrating distribution of CX3CR1+M signature scores in responders (R) and non-responders (NR) from GeoMx DSP spatial transcriptomic profiling of melanoma (primary and metastatic) samples from aPD-1 -treated patients. Lymphocyte aggregates (LA) or tertiary lymphoid structure (TLS) were identified via staining of melanoma tissue. Scores were calculated for regions of interest (RO I) and compared between R and NR using a Wilcoxon rank-sum test (**p < 0.01).

[0136] FIG. 24D is a graph illustrating that cell-cell co-occurrence was assessed by applying SpatialDecon to GeoMx DSP ROI data to estimate cell type, then comparing the observed frequency of co-occurrence across ROIs to the expected frequency.DETAILED DESCRIPTION OF THE INVENTION

[0137] The present invention stems from the critical discovery that combining cancer vaccines with agents targeting the TREM2 receptor on tumor-associated macrophages can synergistically enhance anti-tumor immune responses. This finding highlights a direct link between modulating the myeloid compartment and improving the efficacy of cancer vaccines. The cancer vaccines may include, but are not limited to, neoantigen synthetic long peptide (SLP) vaccines, RNA vaccines, oncolytic virus-based vaccines, peptide -based vaccines, cell-based vaccines. The anti- TREM2 agents include anti-TREM2 antibodies, anti-TREM2 peptides, anti-TREM2 small molecule inhibitors. While cancer vaccines, particularly neoantigen vaccines, effectively expand tumor-specific T cells, they may also maintain immunosuppressive macrophage populations expressing TREM2. By targeting TREM2 in combination with cancer vaccines, the invention aims171623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO to reshape the tumor microenvironment, reduce immunosuppressive CX3CR1+CD206+ macrophages, promote anti-tumor Ml -like iNOS+ macrophages, and enhance the activation of tumor-specific CD8+ T cells. This combinatorial approach has been shown to enhance tumor control compared to either therapy alone, particularly in settings where the therapeutic window for cancer vaccines is limited. Furthermore, the invention explores the potential of combining cancer vaccines with both anti-TREM2 agents and immune checkpoint inhibitors, such as anti- PD-1 antibodies, to further enhance therapeutic efficacy. This multi-faceted strategy offers a promising approach for more effective cancer immunotherapy.

[0138] Before the present compositions and methods are described, it is to be understood that this invention is not limited to particular compositions, methods, and experimental conditions described, as such compositions, methods, and conditions may vary. It is also to be understood that the terminology used herein is for purposes of describing particular aspects only, and is not intended to be limiting, since the scope of the present invention will be limited only in the appended claims.

[0139] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0140] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, it will be understood that modifications and variations are encompassed within the spirit and scope of the instant disclosure. The preferred methods and materials are now described.

[0141] As used in this specification and the appended claims, the singular forms “a”, “an”, and “the” include plural references unless the context clearly indicates otherwise. Thus, for example, references to “the method” include one or more methods, and / or steps of the type described herein which will become apparent to those persons skilled in the art upon reading this disclosure and so forth.

[0142] As used herein, the term “and / or” includes any and all combinations of one or more of the associated listed items.

[0143] The term “effective amount” or “therapeutically effective amount” as used herein refers to the amount of a therapeutic compound, a combination of therapeutic compounds or181623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO pharmaceutical compositions thereof provided herein, which is sufficient to result in the desired outcome.

[0144] The terms “subject” and “patient” may be used interchangeably. As used herein, in some aspects, a subject is a mammal. In some aspects, the subject is a human. In some aspects, the subject is a mammal, e.g., a human, diagnosed with a disease or disorder. In some aspects, the subject is a mammal, e.g., a human, at risk of developing a disease or disorder.

[0145] “Administer” or “administration” refers to the act of injecting or otherwise physically delivering a substance as it exists outside the body into a patient, such as by mucosal, intradermal, intravenous, intramuscular delivery, and / or any other method of physical delivery described herein or known in the art. The terms “administration of’ and or “administering” should be understood to mean providing a pharmaceutical composition in a therapeutically effective amount to the subject in need of treatment. Administration routes can be enteral, topical or parenteral. As such, administration routes include but are not limited to intracutaneous, subcutaneous, intravenous, intraperitoneal, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, transdermal, transtracheal, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal and intrastemal, oral, sublingual buccal, rectal, vaginal, nasal ocular administrations, as well infusion, inhalation, and nebulization. The phrases “parenteral administration” and “administered parenterally” as used herein means modes of administration other than enteral and topical administration.

[0146] Examples of routes of administration include but are not limited to inhalation, otic, buccal, conjunctival, dental, endocervical, endosinusial, endotracheal, enteral, epidural, extra- amniotic, extracorporeal, hemodialysis, infiltration, interstitial, intraabdominal, intraamniotic, intraarterial, intraarticular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavernous, intracavitary, intracerebroventricular, intracistemal, intracorneal, intracoronal, intracoronary, intracorpous cavernaosum, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathoracic, intratubular, intratumor, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, intravenous drip, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, ophthalmic, oral, oropharyngeal, parenteral,191623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO percutaneous, periarticular, peridural, perineural, periodontal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, vaginal, infraorbital, intraparenchymal, intrathecal, intraventricular, stereotactic administration, or any combination thereof.

[0147] As used herein, the terms “treat,” “treatment” and “treating” refer to the reduction or amelioration of the progression, severity, and / or duration of a disease or disorder resulting from the administration of one or more therapies. Treating may be determined by assessing whether there has been a decrease, alleviation and / or mitigation of one or more symptoms associated with the underlying disorder such that an improvement is observed with the patient, despite that the patient may still be afflicted with the underlying disorder. The term “treating” includes both managing and ameliorating the disease.

[0148] In one embodiment, the present disclosure provides a composition for treating cancer, comprising a cancer vaccine and an anti-TREM2 agent. This combination approach leverages the ability of cancer vaccines to stimulate tumor-specific T cell responses while simultaneously targeting immunosuppressive macrophages in the tumor microenvironment through TREM2 inhibition. The synergistic effect of these two components aims to enhance overall anti-tumor immunity and overcome limitations associated with each therapy when used alone.

[0149] In some aspects, the cancer vaccine is any cancer vaccine, such as a neoantigen synthetic long peptide (SLP) vaccine, an oncolytic virus-based vaccine, peptide-based vaccines, cell-based vaccines or an RNA vaccine, while the anti-TREM2 agent is an agent that blocks the TREM2 receptor, such as an anti-TREM2 antibody, an anti-TREM2 peptide or small molecule.

[0150] In some aspects, the cancer vaccine is an RNA vaccine. RNA vaccines represent a cutting-edge approach to cancer immunotherapy, offering several advantages over traditional vaccine platforms. RNA vaccines can be designed to encode one or multiple tumor-specific neoantigens, allowing for a highly personalized treatment approach. Upon administration, the RNA is taken up by cells and translated into protein, leading to both direct antigen presentation by transfected cells and cross-presentation by professional antigen-presenting cells. This results in the activation of both CD8+ and CD4+ T cell responses. RNA vaccines also have the advantage of stimulating innate immune responses through mechanisms such as TLR7 / 8 activation, which can enhance overall vaccine immunogenicity.201623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO

[0151] In some aspects, the cancer vaccine is a neoantigen SLP cancer vaccine. Neoantigen SLP vaccines represent a personalized approach to cancer immunotherapy. These vaccines are designed based on the specific neoantigens present in an individual patient's tumor. Neoantigens are protein sequences expressed by cancer cells that can be recognized as foreign by the immune system. They can arise from various genomic alterations, including non-synonymous singlenucleotide variants (SNVs), frameshifts, splice variants, gene fusions, altered open reading frames, and endogenous retroelements, for example. Synthetic long peptides are used because they can contain both MHC class I and II epitopes, potentially activating both CD8+ and CD4+ T cells. The long peptide format also requires processing by antigen-presenting cells, which can lead to more efficient and prolonged antigen presentation compared to short peptides.

[0152] In some aspects, the anti-TREM2 agent is an anti-TREM2 antibody. TREM2 (Triggering Receptor Expressed on Myeloid cells 2) is a receptor primarily expressed on macrophages and has been implicated in maintaining immunosuppressive, tumor-promoting macrophages in the tumor microenvironment. Anti-TREM2 antibodies can block the interaction between TREM2 and its ligands, potentially reprogramming tumor-associated macrophages towards a more anti-tumor phenotype. These antibodies may be full-length IgG antibodies or antibody fragments, such as Fab, F(ab')2, or single-chain variable fragments (scFv), depending on the desired pharmacokinetic and tissue penetration properties.

[0153] In some aspects, the anti-TREM2 agent is an anti-TREM2 small molecule. Small molecule inhibitors of TREM2 offer potential advantages over antibodies in terms of oral bioavailability and ability to cross the blood-brain barrier, which could be particularly relevant for treating brain cancers. These small molecules typically work by binding to TREM2 and preventing its activation or downstream signaling. The development of highly specific and potent small molecule TREM2 inhibitors is an active area of research in the field of immunotherapy.

[0154] In some aspects, the neoantigen SLP cancer vaccine includes one or more synthetic long peptides encoding tumor-specific neoantigens. These peptides are typically 20-35 amino acids in length and are designed based on the specific mutations identified in a patient tumor through genomic and bioinformatic analyses. The use of multiple neoantigen peptides in a single vaccine formulation can help address tumor heterogeneity and reduce the likelihood of immune escape through antigen loss.

[0155] In some aspects, the composition further includes an adjuvant. Adjuvants are critical components of cancer vaccines as they help to boost the immune response to the vaccine antigens.211623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WOThey can work through various mechanisms, such as enhancing antigen uptake by antigen- presenting cells, promoting the maturation of dendritic cells, or creating a local inflammatory environment that supports T cell activation.

[0156] In some aspects, the adjuvant may be polyinosinic:polycytidylic acid (poly I:C). Poly I:C is a synthetic double-stranded RNA that acts as a potent immunostimulant. It is recognized by pattern recognition receptors including TLR3 and MDA5, leading to the production of type I interferons and pro -inflammatory cytokines. Poly I:C has been shown to enhance the activation of dendritic cells and promote cross-presentation of antigens to CD8+ T cells, making it particularly suitable for use in cancer vaccines.

[0157] In another embodiment, the present disclosure provides a method of treating cancer in a subject, the method comprising: administering to the subject a therapeutically effective amount of: a cancer vaccine; and an anti-TREM2 agent. This combinatorial approach aims to simultaneously stimulate tumor-specific T cell responses through vaccination while modulating the tumor microenvironment through TREM2 inhibition.

[0158] The method may involve various administration routes, including but not limited to intravenous, subcutaneous, or intratumoral injection. The cancer vaccine and anti-TREM2 agent may be administered concurrently or sequentially, depending on the specific treatment protocol.

[0159] The efficacy of this combination therapy can be assessed through various means, including but not limited to tumor size reduction, changes in tumor markers, imaging studies, and improvements in patient symptoms and quality of life. The combination therapy may result in enhanced tumor regression compared to administering either the cancer vaccine or the anti- TREM2 agent alone.

[0160] Exemplary cancers include but are not limited to Acute Lymphoblastic Leukemia, Adult; Acute Lymphoblastic Leukemia, Childhood; Acute Myeloid Leukemia, Adult; Adrenocortical Carcinoma; Adrenocortical Carcinoma, Glioblastoma, Childhood; AIDS-Related Lymphoma; AIDS-Related Malignancies; Anal Cancer; Astrocytoma, Childhood Cerebellar; Astrocytoma, Childhood Cerebral; Bile Duct Cancer, Extrahepatic; Bladder Cancer; Bladder Cancer, Childhood; Bone Cancer, Osteosarcoma / Malignant Fibrous Histiocytoma; Brain Stem Glioma, Childhood; Brain Tumor, Adult; Brain Tumor, Brain Stem Glioma, Childhood; Brain Tumor, Cerebellar Astrocytoma, Childhood; Brain Tumor, Cerebral Astro cytoma / Malignant Glioma, Childhood; Brain Tumor, Ependymoma, Childhood; Brain Tumor, Medulloblastoma, Childhood; Brain Tumor, Supratentorial Primitive Neuroectodermal Tumors, Childhood; Brain Tumor,221623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WOVisual Pathway and Hypothalamic Glioma, Childhood; Brain Tumor, Childhood (Other); Breast Cancer; Breast Cancer and Pregnancy; Oral Squamous Cell Carcinoma, Breast Cancer, Childhood; Breast Cancer, Male; Bronchial Adenomas / Carcinoids, Childhood: Carcinoid Tumor, Childhood; Carcinoid Tumor, Gastrointestinal; Carcinoma, Adrenocortical; Carcinoma, Islet Cell; Carcinoma of Unknown Primary; Central Nervous System Lymphoma, Primary; Cerebellar Astrocytoma, Childhood; Cerebral Astrocytoma / Malignant Glioma, Childhood; Cervical Cancer; Childhood Cancers; Chronic Lymphocytic Leukemia; Chronic Myelogenous Leukemia; Osteosarcoma; Chronic Myeloproliferative Disorders; Clear Cell Sarcoma of Tendon Sheaths; Colon Cancer; Chondrosarcoma; Colorectal Cancer, Childhood; Fibrosarcoma; Chordoma; Cutaneous T-Cell Lymphoma; Endometrial Cancer; Ependymoma, Childhood; Epithelial Cancer, Ovarian; Esophageal Cancer; Esophageal Cancer, Childhood; Ewing's Family of Tumors; Extracranial Germ Cell Tumor, Childhood; Extragonadal Germ Cell Tumor; Extrahepatic Bile Duct Cancer; Eye Cancer, Intraocular Melanoma; Giant cell tumor of bone; Eye Cancer, Retinoblastoma; Gallbladder Cancer; Gastric (Stomach) Cancer; Gastric (Stomach) Cancer, Childhood; Gastrointestinal Carcinoid Tumor; Germ Cell Tumor, Extracranial, Childhood; Germ Cell Tumor, Extragonadal; Germ Cell Tumor, Ovarian; Gestational Trophoblastic Tumor; Glioma. Childhood Brain Stem; Glioma. Childhood Visual Pathway and Hypothalamic; Hairy Cell Leukemia; Osteoblastoma; Head and Neck Cancer; Hepatocellular (Liver) Cancer, Adult (Primary); Hepatocellular (Liver) Cancer, Childhood (Primary); Hodgkin's Lymphoma, Adult; Hodgkin's Lymphoma, Childhood; Hodgkin's Lymphoma During Pregnancy; Adamantinoma; Hypopharyngeal Cancer; Hypothalamic and Visual Pathway Glioma, Childhood; Intraocular Melanoma; Islet Cell Carcinoma (Endocrine Pancreas); Kaposi's Sarcoma; Kidney Cancer; Laryngeal Cancer; Laryngeal Cancer, Childhood; Leukemia, Acute Lymphoblastic, Adult; Leukemia, Acute Lymphoblastic, Childhood; Leukemia, Acute Myeloid, Adult; Leukemia, Acute Myeloid, Childhood; Leukemia, Chronic Lymphocytic; Leukemia, Chronic Myelogenous; Leukemia, Hairy Cell; Lip and Oral Cavity Cancer; Liver Cancer, Adult (Primary); Liver Cancer, Childhood (Primary); Lung Cancer, Non-Small Cell; Lung Cancer, Small Cell; Lymphoblastic Leukemia, Adult Acute; Lymphoblastic Leukemia, Childhood Acute; Lymphocytic Leukemia, Chronic; Lymphoma, AIDS — Related; Lymphoma, Central Nervous System (Primary); Lymphoma, Cutaneous T-Cell; Lymphoma, Hodgkin's, Adult; Lymphoma, Hodgkin's; Childhood; Lymphoma, Hodgkin's During Pregnancy; Lymphoma, Non-Hodgkin's, Adult; Lymphoma, Non-Hodgkin's, Childhood; Lymphoma, Non-Hodgkin's During Pregnancy;231623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WOLymphoma, Primary Central Nervous System; Macroglobulinemia, Waldenstrom's; Male Breast Cancer; Malignant Mesothelioma, Adult; Malignant Mesothelioma, Childhood; Malignant Thymoma; Medulloblastoma, Childhood; Melanoma; Melanoma, Intraocular; Merkel Cell Carcinoma; Mesothelioma, Malignant; Metastatic Squamous Neck Cancer with Occult Primary; Multiple Endocrine Neoplasia Syndrome, Childhood; Multiple Myeloma / Plasma Cell Neoplasm; Mycosis Fungoides; Myelodysplasia Syndromes; Myelogenous Leukemia, Chronic; Myeloid Leukemia, Childhood Acute; Myeloma, Multiple; Myeloproliferative Disorders, Chronic; Nasal Cavity and Paranasal Sinus Cancer; Nasopharyngeal Cancer; Nasopharyngeal Cancer, Childhood; Neuroblastoma; Non-Hodgkin's Lymphoma, Adult; Non-Hodgkin's Lymphoma, Childhood; NonHodgkin's Lymphoma During Pregnancy; Non-Small Cell Lung Cancer; Oral Cancer, Childhood; Oral Cavity and Lip Cancer; Oropharyngeal Cancer; Osteosarcoma / Malignant Fibrous Histiocytoma of Bone; Ovarian Cancer, Childhood; Ovarian Epithelial Cancer; Ovarian Germ Cell Tumor; Ovarian Low Malignant Potential Tumor; Pancreatic Cancer; Pancreatic Cancer, Childhood', Pancreatic Cancer, Islet Cell; Paranasal Sinus and Nasal Cavity Cancer; Parathyroid Cancer; Penile Cancer; Pheochromocytoma; Pineal and Supratentorial Primitive Neuroectodermal Tumors, Childhood; Pituitary Tumor; Plasma Cell Neoplasm / Multiple Myeloma; Pleuropulmonary Blastoma; Pregnancy and Breast Cancer; Pregnancy and Hodgkin's Lymphoma; Pregnancy and Non-Hodgkin's Lymphoma; Primary Central Nervous System Lymphoma; Primary Liver Cancer, Adult; Primary Liver Cancer, Childhood; Prostate Cancer; Rectal Cancer; Renal Cell (Kidney) Cancer; Renal Cell Cancer, Childhood; Renal Pelvis and Ureter, Transitional Cell Cancer; Retinoblastoma; Rhabdomyosarcoma, Childhood; Salivary Gland Cancer; Salivary Gland'Cancer, Childhood; Sarcoma, Ewing's Family of Tumors; Sarcoma, Kaposi's; Sarcoma (Osteosarcoma Malignant Fibrous Histiocytoma of Bone; Sarcoma, Rhabdomyosarcoma, Childhood; Sarcoma, Soft Tissue, Adult; Sarcoma, Soft Tissue, Childhood; Sezary Syndrome; Skin Cancer; Skin Cancer, Childhood; Skin Cancer (Melanoma); Skin Carcinoma, Merkel Cell; Small Cell Lung Cancer; Small Intestine Cancer; Soft Tissue Sarcoma, Adult; Soft Tissue Sarcoma, Childhood; Squamous Neck Cancer with Occult Primary, Metastatic; Stomach (Gastric) Cancer; Stomach (Gastric) Cancer, Childhood; Supratentorial Primitive Neuroectodermal Tumors, Childhood; T-Cell Lymphoma, Cutaneous; Testicular Cancer; Thymoma, Childhood; Thymoma, Malignant; Thyroid Cancer; Thyroid Cancer, Childhood; Transitional Cell Cancer of the Renal Pelvis and Ureter; Trophoblastic Tumor, Gestational; Unknown Primary Site, Cancer of, Childhood; Unusual Cancers of Childhood; Hematological Malignancies; Ureter and Renal241623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WOPelvis, Transitional Cell Cancer; Urethral Cancer; Uterine Sarcoma; Vaginal Cancer; Visual Pathway and Hypothalamic Glioma, Childhood; Vulvar Cancer; Waldenstrom's Macro globulinemia; and Wilms' Tumor.

[0161] This combination approach has potential applications across a wide range of cancer types, including but not limited to melanoma, colorectal cancer, lung cancer, and hematological malignancies. The versatility of the cancer vaccine component, particularly in the case of personalized neoantigen vaccines, allows for potential application in numerous cancer types.

[0162] The combination of cancer vaccines with anti-TREM2 agents represents an approach to cancer immunotherapy that addresses multiple aspects of tumor immunology. By stimulating tumor-specific T cell responses while simultaneously modulating the immunosuppressive tumor microenvironment, this approach has the potential to overcome limitations associated with current cancer immunotherapies and provide more effective treatment options for cancer patients.

[0163] In some aspects, the method further includes administration of chemotherapy or radiation therapy. In some aspects, the chemotherapy includes alkylating agents, antimetabolites, anti-tumor antibiotics, topoisomerase inhibitors, mitotic inhibitors, and corticosteroids. In some aspects, the radiation therapy includes external beam radiation therapy (EBRT), internal radiation therapy (brachytherapy), systemic radiation therapy, intraoperative radiation therapy (IORT), and stereotactic radiosurgery (SRS).

[0164] In another embodiment, the present disclosure provides a method of modulating the tumor microenvironment in a subject with cancer, including: administering to the subject a therapeutically effective amount of: a cancer vaccine; and an anti-TREM2 agent, wherein the administration results in a decrease in intratumoral CX3CR1+CD206+ macrophages and an increase in intratumoral iNOS+ macrophages.

[0165] This method aims to reshape the immune landscape within the tumor microenvironment by targeting two key aspects: stimulating anti-tumor T cell responses through vaccination and reprogramming tumor-associated macrophages through TREM2 inhibition. The combination of these approaches can lead to a more favorable immune environment for tumor control and elimination.

[0166] The cancer vaccine component of this method can be an RNA vaccine, a SLP vaccine, or other types of cancer vaccines. These vaccines are designed to stimulate tumor-specific T cell responses, which can directly target and kill cancer cells. In some aspects, the cancer vaccine251623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO targets antigens, such as neoantigens, non-mutant tumor antigens, viral antigens, defective ribosomal products, or combinations thereof.

[0167] The anti-TREM2 agent, which can be an antibody or a small molecule inhibitor, targets the TREM2 receptor on macrophages. TREM2 has been implicated in maintaining immunosuppressive, tumor-promoting macrophages in the tumor microenvironment. By inhibiting TREM2, this method aims to reprogram these macrophages towards a more anti-tumor phenotype.

[0168] The decrease in intratumoral immunosuppressive, e.g., CX3CR1+CD206+ macrophages is one outcome of this method. These macrophages are typically associated with an immunosuppressive, pro-tumor phenotype. By reducing their presence in the tumor microenvironment, this method aims to decrease immunosuppression and promote anti-tumor immunity.

[0169] Simultaneously, the increase in intratumoral iNOS+ macrophages represents a shift towards a more anti-tumor macrophage phenotype. iNOS+ macrophages are associated with pro- inflammatory, anti-tumor functions, including the production of nitric oxide which can have cytotoxic effects on tumor cells.

[0170] This modulation of the macrophage population in the tumor microenvironment, combined with the stimulation of tumor-specific T cell responses by the cancer vaccine, can create a more favorable environment for anti-tumor immunity. This synergistic effect may lead to enhanced tumor control and potentially improved clinical outcomes for cancer patients.

[0171] The method may be applicable to various types of solid tumors where the tumor microenvironment plays a significant role in tumor progression and resistance to therapy. This could include, but is not limited to melanoma, colorectal cancer, breast cancer, prostate cancer, lung cancer, kidney cancer, head and neck cancer, brain cancer, or stomach cancer.

[0172] The effectiveness of this method in modulating the tumor microenvironment can be assessed through various techniques, including flow cytometry or immunohistochemistry of tumor biopsies to quantify the different macrophage populations. Additionally, the overall anti-tumor effect can be evaluated through standard measures of tumor response, such as tumor size reduction, changes in tumor markers, and imaging studies.

[0173] This method of modulating the tumor microenvironment represents an approach to cancer immunotherapy that goes beyond simply stimulating T cell responses. By also targeting the myeloid compartment of the tumor microenvironment, this method aims to create a more261623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO comprehensive anti-tumor immune response, potentially overcoming resistance mechanisms and improving the efficacy of cancer immunotherapy. Adjuvants are important components of most vaccines as they help to boost the immune response to the vaccine antigens. They can work through various mechanisms, such as enhancing antigen uptake by antigen-presenting cells, promoting the maturation of dendritic cells, or creating a local inflammatory environment that supports T cell activation. In some aspects, the adjuvant may be polyinosinic:polycytidylic acid (poly I:C). Poly I:C is a synthetic double-stranded RNA that acts as a potent immunostimulant. It is recognized by pattern recognition receptors including TLR3 and MDA5, leading to the production of type I interferons and pro-inflammatory cytokines. Poly I:C has been shown to enhance the activation of dendritic cells and promote cross-presentation of antigens to CD8+ T cells, making it particularly suitable for use in cancer vaccines. Other adjuvants include poly ICLC, poly EC12U, CpG oligodeoxynucleotides (CpG ODN), imiquimod, resiquimod, flagellin, monophosphoryl lipid A (MPL), double-stranded RNA mimetics, RIG-I agonists, STING agonists, and combinations thereof.

[0174] Neoantigen SLP vaccines can induce potent anti-tumor immunity comparable to or exceeding that of immune checkpoint therapy (ICT) in melanoma models. The vaccines elicit strong neoantigen-specific CD8 T cell responses, including those expressing inhibitory receptors, and provide long-term, neoantigen-specific protection against tumor rechallenge. This suggests the establishment of immunological memory.

[0175] In another embodiment, the present disclosure provides a method of treating cancer in a subject, the method comprising: administering to the subject a therapeutically effective amount of: a cancer vaccine; and an anti-TREM2 agent. This combinatorial approach aims to simultaneously stimulate tumor-specific T cell responses through vaccination while modulating the tumor microenvironment through TREM2 inhibition. The method may involve various administration routes, including but not limited to intravenous, subcutaneous, or intratumoral injection. The cancer vaccine and anti-TREM2 agent may be administered concurrently or sequentially, depending on the specific treatment protocol.

[0176] The efficacy of the disclosed combination therapy can be assessed through various means, including but not limited to tumor size reduction, changes in tumor markers, imaging studies, and improvements in patient symptoms and quality of life. The combination therapy may result in enhanced tumor regression compared to administering either the cancer vaccine or the anti-TREM2 agent alone. The disclosed combination approach has potential applications across271623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO a wide range of cancer types, including but not limited to melanoma, colorectal cancer, lung cancer, and hematological malignancies. The versatility of the cancer vaccine component, particularly in the case of personalized neoantigen vaccines, allows for potential application in numerous cancer types.

[0177] The combination of cancer vaccines with anti-TREM2 agents represents an approach to cancer immunotherapy that addresses multiple aspects of tumor immunology. By stimulating tumor-specific T cell responses while simultaneously modulating the immunosuppressive tumor microenvironment, this approach has the potential to overcome limitations associated with current cancer immunotherapies and provide more effective treatment options for cancer patients. In another embodiment, the present disclosure provides a method of modulating the tumor microenvironment in a subject with cancer, including: administering to the subject a therapeutically effective amount of: a cancer vaccine; and an anti-TREM2 agent, wherein the administration results in a decrease in intratumoral immunosuppressive, e.g., CX3CR1+CD206+ macrophages and an increase in intratumoral iNOS+ macrophages.

[0178] Combining NeoAg SLP vaccines with ICT or myeloid-targeting strategies, such as anti- TREM2, can broaden the therapeutic window and enhance efficacy. NeoAg SLP Vax induced robust expansion of IFN-y-producing NeoAg-specific CD8 T cells that highly express PD-1. While NeoAg SLP Vax or ICT led to robust rejection of tumors when initiated on day 7 posttransplant, a majority of tumor-bearing mice displayed tumor outgrowth when treatment with anti- CTLA-4, anti-PD-1, or NeoAg SLP Vax was initiated on day 12 post-transplant. Using a day 12 treatment start timepoint, mice treated with NeoAg SLP Vax in combination with anti-CTLA-4 or anti-PD-1 displayed enhanced tumor control compared to Control Vax + anti-PD-1 or Control Vax + anti-CTLA-4. This combination provided superior tumor growth inhibition compared to combination anti-CTLA-4 and anti-PD-1 ICT.

[0179] Control Vax or NeoAg SLP Vax maintained, rather than suppressed (as observed with ICT), M2-like CX3CR1+CD206+ macrophages that also expressed the TREM2 receptor transcript. In the day 12 NeoAg SLP vaccine setting, expression of Trem2 was enriched on sorted intratumoral CX3CR1+CD206+ macrophages compared to non-CX3CRl+CD206+ macrophages harvested on day 19 from tumor-bearing mice treated with NeoAg SLP Vax on days 12 and 18. Intratumoral injection of sorted CX3CR1+CD206+ macrophages from day 12 NeoAg SLP vaccine-treated mice into tumor-bearing mice on days 4, 7, and 10 post-transplant rendered NeoAg SLP Vax initiated on day 7 ineffective. The inhibition of NeoAg SLP Vax efficacy by the injected281623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WOCX3CR1+CD206+ macrophages was reversed by administering a non-depleting TREM2 blocking mAb. Based on these findings, it was hypothesized that targeting the CX3CR1+CD206+ macrophages could extend the therapeutic window for NeoAg SLP vaccines. Indeed, anti- TREM2 used in combination with NeoAg SLP vax (initiated on day 12 post-transplant) enhanced efficacy in tumor-bearing mice. This enhanced efficacy was associated with a reduction of intratumoral CX3CR1+CD206+ macrophages, promotion of iNOS+ macrophages, and increased IFN-y+ NeoAg-specific CD8 T cells.

[0180] The following examples are provided to further illustrate the aspects of the present invention but are not intended to limit the scope of the invention. While they are typical of those that might be used, other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.EXAMPLES

[0181] The invention is further illustrated by the following non-limiting examples.EXAMPLE 1Neoantigen SLP Vaccines and Immune Checkpoint Therapy Induce T Cell-Dependent Long-Term Tumor Protection in Mouse Melanoma Models

[0182] For this study, the genetically engineered mouse model (GEMM)-derived Braf600EPten / _Cdkn2a / ' YUMM1.7 mouse melanoma line was modified to express different combinations of MHC-I and MHC-II NeoAgs. GEMM tumors are generally poorly immunogenic; however, they can be engineered to express NeoAgs to study tumor-immune interactions. We engineered YUMM1.7 to express known tumor antigens via introduction of minigenes encoding the G1254V mutation in Lama4 (mLama4MHC‘I), the A506T mutation in Alg8 (mAlg8MHC_I), and the N710Y mutation in Itgbl (mItgblMHC'n) NeoAgs in various combinations: mLama4MI I( _|+ mltgbl MHC- II (YULI line) or mAlg8MI I( _|+ mItgblMHC'n(Y1.7AI line) (FIG. 8A). Consistent with prior observations, the parental YUMM1.7 melanoma line was insensitive to anti-CTLA-4 and / or anti- PD-1 ICT (FIG. 8B). In contrast, expression of mLama4MI IC-1or mAlg8MI IC-1NeoAg along with mItgblMHC'nNeoAg rendered YUMM1.7 melanoma lines (Y1.7LI and Y1.7AI) sensitive to anti- CTLA-4 ICT (FIG. 1A). We next asked whether therapeutic cancer vaccines composed of the synthetic long peptide (SLP) containing the minimal MHC-I NeoAg epitope and the adjuvant poly I:C (pLC) could induce regression of the YULI and Y1.7AI NeoAg-expressing lines. Tumor291623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO bearing mice treated with pI:C alone displayed outgrowth of Y1.7LI or Y1.7AI melanoma, whereas vaccines comprising relevant NeoAg SLP + pI:C (NeoAg SLP Vax) induced rejection or delayed outgrowth of Y1.7LI or Y1.7AI (FIG. IB). NeoAg vaccine-induced tumor rejection was dependent upon specific NeoAg expression, as mAlg8 SLP + pI:C did not induce Y I .7LI (mLama4-expressing) tumor rejection and vice versa with Y 1.7AI (mAlg8-expressing) (FIG. IB). Mice that rejected Y1.7AI or Y I .7LI tumors upon NeoAg SLP Vax or anti-CTLA-4 were rechallenged in the absence of additional treatment with the same tumor lines 60+ days after rejection of primary tumors. Upon secondary challenge, no detectable tumor was observed indicating long-term protection against rechallenge with the same tumor (FIG. 8C). In contrast, both Y1.7-NeoAg expressing lines grew out when injected into naive mice in the absence of treatment, indicating cell line preparations used in rechallenge experiments were capable of tumor formation. When mice that previously rejected Y I .7LI tumors were rechallenged with parental YUMM1 .7, progressive tumor growth was observed (FIG. 8D), indicating immunity was NeoAg- specific.

[0183] Next, peptide-MHC (pMHC) tetramers were used to detect intratumoral CD8 T cells recognizing the mLama4 or mAlg8 NeoAg presented on H-2Kb. Tumors from anti-CTLA-4 treated mice contained greater frequencies of mAlg8- or mLama4-specific CD8 T cells compared to mice receiving control mAb (FIG. 1C and 8E). Whereas pLC alone had little effect on the frequency of NeoAg-specific CD8 T cells, NeoAg SLP Vax induced a 4-fold or more increase in mAlg8- or mLama4-specific CD8 T cells (FIG. 1C and 8E) including those co-expressing the inhibitory receptors PD-1 and TIM-3 (FIG. 8F); however, this alone does not necessarily indicate reduced function. To expand on these observations, we focused on the Y I .7LI line and delayed treatment initiation until day 7 post-transplant, a timepoint when anti-CTLA-4, anti-PD-1, combination anti-CTLA-4 plus anti-PD-1, or NeoAg SLP Vax induced tumor rejection in a majority of mice (FIG. ID). ICT- and NeoAg SLP Vax-induced tumor rejection was dependent on both CD4 and CD8 T cells, as mAb depletion of either T cell subset abolished therapeutic efficacy (FIG. 9A). Y 1 ,7LI-rechallenged mice that rejected Y 1.7LI tumors upon NeoAg SLP Vax or anti-CTLA-4 and / or anti PD-1 initiated on day 7, but not untreated naive mice, showed no detectable tumor upon secondary challenge (FIG. 9B).301623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WOEXAMPLE 2Tumor Microenvironment Remodeling Induced by Neoantigen SLP Vaccines and Immune Checkpoint Therapy

[0184] An unbiased approach was used to assess whether effective NeoAg SLP vaccines induced TME alterations that are distinct or overlapping with different forms of ICT. Y 1.7LI tumor bearing mice were treated with (1) control mAb, (2) anti-CTLA-4, (3) anti-PD-1, (4) anti- CTLA-4 + anti-PD-1, (5) Control Vax (irrelevant SLP + pLC), or (6) NeoAg SLP Vax (mLama4 SLP + pLC) beginning on day 7 (FIG. 2A). Tumors were harvested on day 15 (a critical timepoint prior to tumor rejection) and live CD45+cells were sorted for scRNAseq. We used unsupervised graph-based clustering to stratify myeloid cells and lymphocytes (FIGS. 2B and 2C). scRNAseq and flow cytometry both indicated that immunotherapy altered the proportions of different myeloid and lymphoid subsets (FIG. 10A).

[0185] To gain more insights into how the different immunotherapies altered T cells in the TME, we chose clusters containing activated T cells for subclustering and identified multiple clusters of conventional CD4 and CD8 T cells, Foxp3+CD4+T regulatory cells (Tregs), gamma delta T cells (gdT), and innate lymphoid cells (ILCs) (FIGS. 2D, 2E, 10B-10E, 11, and 12A). Cluster Cd4 / 8cyciingcontained a mix of Tregs, CD4 T cells, and CD8 T cells and displayed a cell proliferation transcriptional signature (FIGS. 2D-2H, 11, 12A, and 12B). As compared to control mAb, anti-CTLA-4, anti-PD-1, Control Vax, or NeoAg SLP Vax treated mice contained a greater frequency of cells within Cd4 / 8cyciing (FIG. 12C). Within Cd4 / 8cyciing, anti-CTLA-4 (+ / - anti-PD- 1) reduced proliferating Tregs and expanded CD4 T cells, while the ratio of proliferating CD8 T cells to Tregs or CD4 T cells was higher with anti-PD-1 (FIGS. 12D-12F). NeoAg SLP Vax contained the greatest ratio of cycling CD8 T cells to other T cells in this cluster as compared to all other conditions (FIG. 12E).

[0186] Five exclusively CD8 T cell clusters were identified, spanning a range of activation states including proliferating (Cd8cyciing), CD69hlIFN-stimulated [Cd8iSTiM (interferon STIMulated)], PD-1+TCF7+plastic / stem-like or progenitor exhausted (Cd8pE), and PD-1+TCF7" terminal effectors or dysfunctional / exhausted CD8 T cells (Cd8Eff / Ex) (FIGS. 2D, 2E, 11, 12A, and 13A- 13C).311623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WOEXAMPLE 3Anti-PD-1 Expands PD-1+TCF1‘ Neoantigen-specific Teff / Tex and Robustly Promotes Bhlhe40luNeoantigen-specific Teff / Tex When Combined with Anti-CTLA-4

[0187] It has been demonstrated that tumor antigen-specific CD8 T cells have unique properties, and that immunotherapy primarily affects tumor reactive versus bystander CD8 T cells. Therefore, we monitored CD8 T cells specific for the mLama4 NeoAg in the setting of NeoAg SLP Vax or ICT (FIG. 3A). Anti-CTLA-4 and / or anti-PD-1 increased the overall frequency of intratumoral CD8 T cells (FIG. 3B). Anti-CTLA-4 (+ / - anti-PD-1) also drove a significant increase in mLama4-specific CD8 T cells as a percent of CD8 T cells or CD45+cells. Anti-PD-1 significantly increased mLama4-specific CD8 T cells as a percent of CD45+cells (FIGS. 3B-3D and 14A). NeoAg SLP Vax drove the greatest increase in mLama4-specific CD8 T cells from less than 2% (control mAb or Control Vax) to over 20% of CD8 T cells, which accounted for over 4% of intratumoral CD45+cells (FIGS. 3C, 3D, and 14A).

[0188] Since the scRNAseq of CD45+cells did not distinguish NeoAg-specific CD8 T cells, we profiled NeoAg-specific CD8 T cells by sorting intratumoral mLama4-specific CD8 T cells (FIG. 3A). The two smallest clusters contained contaminating stromal cells, with the remaining clusters comprising NeoAg-specific CD8 T cells that we annotated based on expression of select transcripts and comparisons with both mouse and human published datasets (FIGS. 3E-3H, 4A, 4B, 14B, 15, and 16A). Clusters nAg.Cd8Eff / EXand nAg.Bhlhe40H1Cd8 expressed Pdcdl, Havcr2 (TIM-3), Lag3, and Tigit, as well as effector transcripts (e.g., Nkg7, Ccl5, Gzmb, Gzmk, Prfl, Cxcr6). These two clusters also expressed Tox and exhibited little to no detectable expression of Tcf7 (FIGS. 3F-3J and 13B), consistent with activated effector and / or dysfunctional / exhausted CD8 T cells. Whereas the proportion of cells in this cluster increased with anti-PD-1 (+ / - anti- CTLA-4), NeoAg SLP Vax reduced the proportion of nAg.Cd8Eff / Ex cells when compared to control mAb or Control Vax (FIG. 4C) In nAg.Bhlhe40H1Cd8, the top defining marker was Bhlhe40 (FIGS. 3G and 15), which we previously demonstrated was upregulated in tumorspecific T cells and required for CD4 and / or CD8 T cell effector function and response to ICT. In addition to Bhlhe40 (as well as Pdcdl, Havcr2, and Lag3), this cluster also expressed other transcripts induced by TCR activation, including Ctla4, Cd69, Nr4al (Nur77), and Nr4a3 and also displayed high expression of Tbx21 (T-bet) and Ifng (FIGS. 3G and 3H). As compared to control mAb treatment where nAg.Bhlhe40H1Cd8 represented ~2.4% of mLama4-specific CD8 T cells, a321623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO~2.6-fold increase occurred with anti-PD-1 (FIG. 4C). Strikingly, anti-CTLA-4 and anti-PD-1 combination ICT increased this cluster to over 28% of mLama4-specific CD8 T cells.

[0189] In addition to increasing the frequency of cells within PD-1+TCF1‘ Teff / Tex clusters (nAg.Cd8Eff / Ex and nAg.Bhlhe40H1Cd8), combination ICT increased expression of Bhlhe40, Fasl, Il7r, Icos, and Cd28, while decreasing Tox, Pdcdl, Lag3, Entpdl, and Tigit expression within both clusters (FIGS. 3H and 13B). The decrease in Tox, Pdcdl, Lag3, Entpdl, and Tigit was also observed with anti-CTLA-4 (FIGS. 3H and 13B). In contrast, increased Bhlhe40 expression was most prominent in the presence of anti-PD-1. Other features (e.g., increased Icos, Cd28, and Fasl) were unique to anti-CTLA-4 and anti-PD-1 combination ICT treatment (FIGS. 3H and 13B).EXAMPLE 4Neoantigen SLP Vaccination Preferentially Increases PD-1+TCF1+ Stem-like and Proliferating Neoantigen-specific CD8 T Cells

[0190] Amongst the most prominent NeoAg SLP vaccine-driven changes, NeoAg SLP vaccines drove an over 3 -fold increase in the frequency of mLama4-specific CD 8 T cells within cluster nAg.PD-l+TCF7+Cd8 as compared to control mAb and over 8-fold increase as compared to Control Vax (FIG. 4C). Cluster nAg.PD-l+TCF7+Cd8 displayed high expression of PdcdF, low to moderate expression of Ifng, Gzmk, and Prfl ; and little to no detectable expression of Havcr2 or Entpdl (FIGS. 3G and 3H). nAg.PD-l+TCF7+Cd8 also expressed transcripts encoding molecules related to T cell homing such as Ccr7, as well as Bach2, Slamf6, and Tcp (TCF-1), indicative of plastic or stem-like features observed in progenitor exhausted CD8 T cells (FIGS. 3G, 3H, and 15). nAg.PD-l+TCF7+Cd8 also expressed Xcll (a chemoattractant for Xcrl+type I conventional dendritic cells (DC Is)). While NeoAg SLP vaccines promoted this population, the proportion of NeoAg-specific CD8 T cells within this cluster was reduced with combination anti- CTLA-4 and anti-PD-1 (FIG. 4C). Anti-CTLA-4 containing treatments displayed decreased expression of Pdcdl, Lag3, Tigit and increased expression of Slprl, Sell (Cd621), and Kip, as well as Il7r (FIGS. 3H and 14B).

[0191] Five clusters of “cycling” NeoAg-specific CD8 T cells displaying a range of activation states and proliferation signatures (FIGS. 3G and 15) were annotated. The frequency of total cells within cycling clusters was modestly increased by anti-CTLA-4 or anti-PD-1 ICT, whereas combination ICT decreased the frequency (FIG. 16B). NeoAg SLP Vax and Control Vax increased the frequency of cells in each of the 5 cycling NeoAg-specific CD8 T cell clusters as331623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO compared to control mAb, although to differing degrees (FIGS. 4C and S9B). Within nAg.Cd8cyciing_i, nAg.Cd8cyciing_3, and nAg.Cd8cyciing_4, either Control Vax or NeoAg SLP Vax increased the frequency of NeoAg-specific CD8 T cells as compared to control mAb (FIG. 4C). nAg.Cd8cycimg_2 represented 3.79% of NeoAg-specific CD8 T cells with control mAb treatment and 10.6% under Control Vax conditions, whereas under NeoAg SLP Vax conditions, the frequency of cells within this cluster increased to 19.2% of NeoAg-specific CD8 T cells (FIG. 4C). As compared to the other cycling clusters, nAg.Cd8cyciing_2 expressed higher Xcll, Tnfrsf4 (0X40), Tnfrsf9 (4-1BB), Prfl, and Ifng (FIGS. 3G and 15). Although both Control Vax and NeoAg SLP Vax promote cycling NeoAg-specific CD8 T cells, far more NeoAg-specific CD8 T cells are observed within tumors treated with NeoAg SLP Vax as compared to Control Vax (FIGS. 3C and 3D). We noted that under Control Vax, significantly more intratumoral CD8 T cells were undergoing apoptosis than with NeoAg SLP Vax or control mAb (FIG. 16C). Together, these results suggest that although both Control Vax and NeoAg SLP Vax promote NeoAg-specific CD8 T cell proliferation, a greater turnover of cells occurs with Control Vax.

[0192] Assessment of surface PD-1, TIM-3, and LAG-3 revealed that a majority of NeoAg- specific CD8 T cells expressed PD-1, with similar frequencies of PD-1+TIM-3+or PD-1+LAG- 3+NeoAg-specific CD8 T cells observed between control mAb, Control Vax, and the different ICT treatment conditions (FIGS. 4D and 14C). However, expression of PD-1 on a per cell basis was lower in ICT treated groups. In contrast, an increase in the percentage of PD-1+TIM-3+or PD-1+LAG-3+NeoAg-specific CD8 T cells was observed in mice treated with NeoAg SLP Vax compared to control mAb or Control Vax (FIGS. 4D and 14C). Intracellular cytokine staining (ICS) on isolated intratumoral CD8 T cells restimulated with the mLama4 NeoAg peptide revealed that NeoAg SLP Vax or anti-CTLA-4 increased the frequency of IFN-y+or TNFa+CD8 T cells, with NeoAg SLP Vax inducing the greatest expansion (> 5-fold) as compared to control mAb or Control Vax (FIGS. 4E-EF). Amongst mLama4 NeoAg-stimulated IFN-y+CD8 T cells, expression of IFN-y increased significantly with anti-CTLA-4 and / or anti-PD-1, with NeoAg SLP Vax prompting the most robust increase (FIGS. 4E-4F).EXAMPLE 5Anti-CTLA-4 Promotes Thl-like CD4 T Cells Expressing ICOS and Bhlhe40

[0193] Since effective NeoAg SLP Vax or anti-CTLA-4 / anti-PD-l ICT require not only CD8, but also CD4 T cells (FIG. 9A), we examined CD4 T cells from scRNAseq of CD45+cells (FIG.341623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO2A). Anti-CTLA-4 induced a higher frequency of conventional CD4 T cells and reduced the percentage of Tregs as assessed by scRNAseq and flow cytometry (FIGS. 10A, 10B, 12D, and 12F). Notably, anti- CTLA-4 (+ / - anti-PD-1) induced subpopulations of Thl-like cells expressing Ifng and Bhlhe40, including cluster ICOShlBhlhe40hlCD4Thl that also highly expressed Icos, Pdcdl, Ctla4, Cxcr6, Csf2 (GM-CSF), Fasl, Furin (encoding a TCR / IL-12-STAT4-induced proprotein convertase), and Tnfaip3 (A20) (FIGS. 2E, 5A, 5B, and 12A). ICOShlBhlhe40hlCD4Thl displayed enrichment in IL-2 STAT5 and IL-6 JAK STAT3 signaling, TNFa signaling via NF-kB, and IFN-y response gene sets amongst others (FIG. 17A). Although NeoAg SLP Vax exhibited a greater frequency of cells within this cluster as compared to Control Vax, the frequency under NeoAg SLP Vax conditions was similar to control mAb (FIG. 5B). Cd4Thl_A also expressed Icos and Bhlhe40, but to less of an extent than ICOShlBhlhe40hlCD4Thl (FIGS. 5A and 12A). Cd4Thl_A was further distinguished from ICOShlBhlhe40hlCD4Thl by lower Furin, Cxcr6, Runx3, Tnfaip3, Pdcdl, Havcr2, and Lag3 expression and higher Tbx21 (Tbet) and Il7r expression. Anti-CTLA-4 dramatically increased the frequency of Bhlhe40+CD4Thl_A, with anti-PD-1, and to less of an extent NeoAg SLP Vax, also increasing cells within this cluster (FIG. 5B). CD4Thl_B was the smallest Thl-like cluster. Only subtle changes to the frequency of cells within this cluster were seen with treatments apart from Control Vax and combination anti-CTLA-4 and anti-PD-1, where a small increase was observed (FIG. 5B).

[0194] Comparison with published gene signatures of NeoAg-specific CD4 T cells indicated that ICOShlBhlhe40hlCD4Thl, CD4Thl_A, and CD4Thl_B displayed enrichment in signatures of tumor-specific CD4 T cells (Lowery_2022_CD4.NeoAgTCR) derived from transcriptomic analysis of NeoAg-specific TCR clonotypes from human metastatic tumor samples (FIG. 5C). ICOShlBhlhe40hlCD4Thl, CD4Thl_A, and CD4cycling displayed features similar to NeoAg- specific conventional CD4 T cells (isolated from human melanoma) that were previously described and phenotypically annotated (Oliveira_2022_Clust6_CD4.NeoAg.Term.Exhaust, Oliveira_2022_Clust3_CD4.Follic / Progen.Exhaust, Oliveira_2022_Clust8_CD4.NeoAg.Proliferating) (FIG. 5C).

[0195] The increase in IFN-y expressing Thl-like cells most prominently induced by anti- CTLA-4 was reflected by ICS on isolated intratumoral CD4 T cells restimulated ex vivo with the mltgbl MHC-II NeoAg peptide. Anti-CTLA-4 + / - anti-PD-1 induced the strongest increase in the overall frequency of conventional CD4 T cells and IFN-y+CD4 T cells upon restimulation with351623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO mltgbl peptide (FIGS. 5D and 5E). While mice treated with anti-CTLA-4, alone or in combination with anti-PD-1, display the greatest increase in IFN-y -producing Thl-like CD4 T cells within the tumor, anti-PD-1 also spurs IFN-y+CD4 T cells (FIG. 5E). Interestingly, under combination ICT, a small cluster (Cd4Th2) expressing Icos and Bhlhe40, as well as Furin, Tnfaip3, Cd28, and 117 r was noted. Unlike the other ICOS+Bhlhe40+clusters, Ifng, Havcr2, and Lag3 were barely detectable and instead, Cd4Th2 expressed Gata3, 114, 115, and 1113, indicative of Th2-like CD4 T cells (FIG. 5A, 12A, and 17B).

[0196] To gain insight into the temporal dynamics of the observed changes in CD4 T cells, we used Monocle to analyze scRNAseq data. Monocle suggested that the starting point for conventional CD4 T cells corresponds to cells within either the Cd4Naive / Mem cluster (expressing Tcf7, Il7r, and Slprl) or CD4 T cells within the Cd4 / 8Cycling cluster (FIG. 5F) with Cd4Tfh (displaying T follicular helper-like transcriptional features) connecting Cd4 / 8Cycling CD4 T cells to the main trajectory towards Cd4Naive / Mem and the branch to more activated, polarized CD4 T cells. Notably, a pseudotime trajectory branch point occurs whereby activated CD4 T cells occupy Thl-like ICOShlBhlhe40hlCd4Thl driven by anti-CTLA-4 (+ / - anti-PD-1) (and to a lesser extent by NeoAg SLP Vax) or encounter another branch whereby they assume one of two fates: they either become Thl-like CD4 T cells within Cd4Thl_A or become Th2-like Cd4Th2, with Cd4Thl_A being induced by anti-CTLA-4 and / or anti-PD-1 or NeoAg SLP Vax and Cd4Th2 primarily being driven by combination anti-CTLA-4 and anti-PD-1 (FIG. 5F).

[0197] We also identified three CD4 Foxp3+Treg clusters (FIG. 10B). Treg l and Treg_3 appeared to be the most activated with Treg_3 expressing the highest level of Ctla4, Havcr2, and Klrgl (FIG. 12A). Mice treated with anti-CTLA-4 + / - anti-PD-1 experienced a decrease in frequency of Treg l and Treg_3 (FIG. 10B), which is consistent with the known ability of the anti-CTLA-4 mAb we used (mouse IgG2b; clone 9D9) to partially deplete Tregs, especially those highly expressing CTLA-4. Treg_2 expressed lower amounts of Ctla4, Havcr2, Tigit, and Klrgl with the frequency of these Tregs not being affected by anti-CTLA-4, whereas anti-PD-1 with or without anti-CTLA-4, Control Vax, or NeoAg SLP Vax displaying a greater frequency of cells in this cluster (FIG. 10B). Alterations to the overall frequency of Tregs most prominently observed with anti-CTLA-4 were corroborated by flow cytometry analysis (FIG. 10A).361623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WOEXAMPLE 6Intratumoral Myeloid Cell Compartment During Neoantigen SLP Vaccines or Immune Checkpoint Therapy Treatment

[0198] To characterize intratumoral monocytes / macrophages and DCs, myeloid cell containing clusters were subclustered excluding the single cluster of neutrophils (FIGS. 2B, 2C, 10A, and 18A). In addition to a cluster of plasmacytoid DCs (pDCs), four other DC clusters were identified (FIGS. 18A-18E). Cluster CD103+cDCl expressed multiple cDCl transcripts including Itgae (Cdl03 Xcrl, and Clec9a (FIGS. 18B and 18E). CD63+Ccr7+cDC and Ccr7+cDC expressed Ccr7, Cdldl, Cd200, Fscnl, Cd274 (PD-L1), mA Pdcdl lg2 (PD-L2). As compared to Ccr7+cDC, CD63+Ccr7+cDC expressed higher Cd63, Cd40, Btla, and Cd70 (FIGS. 18D and 18E). These two migratory eDC clusters are consistent with mregDCs, a term describing a maturation state of cDCls and cDC2s upon uptake of tumor antigen and although they express immunoregulatory molecules, they are not necessarily immunosuppressive. Additionally, two small undefined clusters (Undef l and Undef_2) contained cells expressed transcripts predominantly associated with non-myeloid cells and instead expressed by lymphocytes / ILCs (Undef l) and Tregs (Undef_2).EXAMPLE 7Distinct Macrophage Remodeling Induced by Neoantigen SLP Vaccines and Immune Checkpoint Therapy

[0199] Overall, monocytes / macrophages represented a plurality of intratumoral CD45+cells and displayed a range of phenotypic states (FIGS. 6A, 10A, and 19A-19C). Ccr2+M_cl was a small (~1% of myeloid compartment) cluster that displayed transcripts consistent with monocytes, including Ccr2 and Chil3, and the frequency of cells within this cluster remained largely unchanged (FIGS. 6 A, 6B, and 19C).

[0200] Macrophages within CX3CRl+CD206hlM_c2 highly expressed Cx3crl (encoding the fractalkine receptor), Mrcl (CD206), Trem2, Vcaml, Cd63, and Cd72. A reduced frequency of CX3CR1+CD206hlM_c2 macrophages was observed with anti-CTLA-4 + / - anti-PD-1 ICT as compared to Control mAb, with expression of Cx3crl and the frequency of Cx3crl+macrophages within this cluster decreasing under all ICT treatment conditions or with NeoAg SLP Vax (FIGS. 6A-6C, 19A, and 19C). CX3CR1+CD2O6+M_c3 was a small cluster which also expressed Cx3crl, as well as Mrcl , Trem2, Vcaml, and Cd72 with the latter transcripts being expressed less371623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO than in CX3CR1+CD206hlM_c2 (FIG. 6A). CX3CR1+CD2O6+M_c3 also displayed high expression of Mki67 and exhibited lower Mertk expression as compared to CX3CRl+CD206hlM_c2. Although these two clusters expressed the highest levels of Cx3crl and Mrcl, M_c8 macrophages also expressed Cx3crl and Mrcl under control mAb conditions with ICT reducing expression of Cx3crl within these clusters (FIGS. 6C and 19A). Other clusters also expressed Cx3crl under certain treatment conditions but overall, fewer monocytes / macrophages from mice treated with ICT expressed Cx3crl and / or displayed reduced expression of Cx3crl compared to control mAb (FIGS. 6B-6D, 19A, and 19C). In contrast, monocytes / macrophages from Control Vax and NeoAg SLP Vax groups displayed similar or even higher expression of Cx3crl compared to control mAb. It was also notable that Trem2 was expressed highest in Control Vax and NeoAg SLP Vax groups with macrophages expressing Cx3crl and Mrcl also expressing Trem2 (FIGS. 6D and 19C). Several monocyte / macrophage clusters expressed high levels of Nos2 (iNOS); other clusters expressed varying levels of Nos2, with expression of Nos2 correlating with ICT treatment (FIGS. 6C and 19B). Further, expression of Cd274 (PD-L1) also correlated with expression of Nos2 within macrophage clusters (FIG. 19C). While the overall frequency of these iNOS+Ml- like clusters only modestly increased with ICT, the frequency of cells within these clusters expressing Nos2 and / or Nos2 expression on a per cell basis increased under all ICT conditions (FIGS. 6B, 6C, and 19B). Nos2hlM_c4 and Nos2hlM_c6 both manifested high expression of Nos2, Illa, Il lb, Cxcl2, Inhba, and Nfkbl, signatures of inflammatory macrophages (FIGS. 6A and 19C). While Nos2hlM_c4 displayed classic features of Ml -like macrophages including low Mrcl expression, Nos2hlM_c6 moderately expressed Mrcl and exhibited higher F13al, Trem2, and Illa, along with lower Illr2 expression compared to Nos2hlM_c4 (FIGS. 6A and 19B). Nos2hlM_c4 displayed high expression of Cxcl9 and Sppl, with expression of the latter diminished with ICT or NeoAg SLP Vax (FIG. 19C). Higher CXCL9 and lower SPP1 expression was recently found to be correlated with a macrophage prognostic score in cancer patients. Nos2hlM_c5 highly expressed Nos2 in the presence of ICT, with ICT also increasing the frequency of macrophages within this cluster (FIGS. 6B, 6C, and 20B). This cluster also expressed moderate levels of Mki67 and other cell cycle related transcripts, indicative of iNOS+macrophages with proliferative capabilities (FIG. 6A). Nos2hlM_c7 was the smallest iNOS+macrophage cluster and in addition to Nos2 expression under ICT conditions, Nos2hlM_c7 highly expressed interferon-stimulated genes (ISGs) (FIGS. 6A, 6C, 19B and 19C). These same overall patterns were manifested at the protein level where in anti-CTLA-4 and / or anti-PD-1 treated mice, the frequency of intratumoral381623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WOCX3CR1+CD2O6+macrophages decreased with a concomitant increase in iNOS+macrophages (FIGS. 6E and 6F). These findings are consistent with our observations in mouse MCA sarcoma models. In contrast, while NeoAg SLP Vax treated mice also displayed a greater frequency of iNOS+macrophages compared to control mAh or Control Vax, CX3CR1+CD2O6+macrophages were only slightly reduced by NeoAg SLP Vax as compared to Control Vax but were maintained at a similar frequency as seen in control mAb treated mice (FIGS. 6E and 6F). These results reveal that despite a relatively a similar abundance of CX3CR1+CD2O6+macrophages that were previously associated with progressively growing tumors in untreated or control mAb treated mice, NeoAg SLP Vax induces tumor regression equivalent to ICT when initiated at day 7 posttransplant.EXAMPLE 8ICT and Myeloid Targeting Strategies Broaden the Therapeutic Window for Neoantigen SLP Vaccines

[0201] Changes that were not only shared between treatment conditions, but also distinct depending upon which treatment strategy was employed were noted. This, together with our findings that NeoAg SLP Vax induces robust expansion of IFN-y-producing NeoAg-specific CD8 T cells that highly express PD-1 (FIGS. 3C, 3D, 4D, 4E, and 14C), prompted us to first ask whether NeoAg SLP Vax could synergize with ICT. While NeoAg SLP Vax or ICT led to robust rejection of Y 1.7LI when initiated on day 7 post-transplant (FIG. ID), a majority of tumor bearing mice displayed tumor outgrowth when treatment with anti-CTLA-4, anti-PD-1, or NeoAg SLP Vax was initiated on day 12 post-transplant (FIG. 20A). We therefore used a day 12 treatment start timepoint to assess whether combining NeoAg SLP Vax with anti-CTLA-4 or anti-PD-1 improved efficacy. Mice treated with NeoAg SLP Vax in combination with anti-CTLA-4 or anti- PD-1 displayed enhanced tumor control as compared to Control Vax + anti-PD-1 or Control Vax + anti-CTLA-4 (FIG. 20A). Further, NeoAg SLP Vax used in combination with anti-CTLA-4 or anti-PD-1 provided superior tumor growth inhibition compared to combination anti-CTLA-4 and anti-PD-1 ICT. We also assessed NeoAg SLP Vax and ICT combination therapy using the MC38 tumor model, which has several known endogenous MHC-I tumor NeoAgs that we previously confirmed were expressed in our MC38 line. Similar to results in the YULI model, NeoAg SLP Vax in combination with anti-CTLA-4 or anti-PD-1 provided superior protection versus monotherapy (FIG. 20B).391623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO

[0202] It was intriguing that Control Vax or NeoAg SLP Vax maintained, rather than suppressed (as observed with ICT), M2-like CX3CR1+CD2O6+macrophages that also expressed the TREM2 receptor transcript (FIGS. 6 A and 6D). We previously demonstrated that targeting TREM2 with a non-depleting recombinant anti-TREM2 mAb reshaped tumor-associated macrophages, reducing CX3CR1+CD2O6+macrophages while concomitantly expanding myeloid cells expressing immunostimulatory molecules. We reasoned that CX3CR1+CD2O6+macrophages might play a role in blunting NeoAg SLP vaccine efficacy in the day 12 post-transplant treatment initiation setting.

[0203] In the day 12 NeoAg SLP vaccine setting, expression of Trem2 was indeed enriched on sorted intratumoral CX3CR1+CD2O6+macrophages (compared to the non-CX3CRl+CD206+macrophages) harvested on day 19 from Y 1.7LI tumor bearing mice treated with NeoAg SLP Vax on day 12 and 18 (FIG. 7A). Next, we intratumorally injected sorted intratumoral CX3CR1+CD2O6+macrophages from day 12 NeoAg SLP vaccine treated mice into a separate cohort of Y1.7LI tumor bearing mice on days 4, 7, and 10 post-transplant and initiated NeoAg SLP Vax on day 7 (FIG. 7B). As expected, NeoAg SLP Vax initiated on day 7 induced tumor regression in the absence of additional exogenous CX3CR1+CD2O6+macrophages (FIG. 7C). In contrast, intratumoral injection of additional CX3CR1+CD2O6+macrophages rendered NeoAg SLP Vax initiated on day 7 ineffective. The inhibition of NeoAg SLP Vax efficacy by the injected CX3CR1+CD2O6+macrophages was reversed by giving a non-depleting TREM2 blocking mAb. Based on this, we hypothesized that targeting the CX3CR1+CD2O6+macrophages in our vaccine setting could extend the therapeutic window for NeoAg SLP vaccines. Indeed, we found that anti- TREM2 used in combination with NeoAg SLP vax (initiated on day 12 post-transplant) enhanced efficacy in Y1.7LI tumor bearing mice (FIG. 7D). This enhanced efficacy was associated with a reduction of intratumoral CX3CR1+CD2O6+macrophages, promotion of iNOS+macrophages, and increased IFN-y+mLama4 NeoAg-specific CD8 T cells (FIGS. 7E-7H). Altogether, these findings support the rationale for combination NeoAg-based therapies, including those targeting the myeloid compartment.

[0204] In this study, we compared different immunotherapies that lead to tumor rejection and applicable control treatments where tumor progression occurs using mouse melanoma models with relevant gain- and loss-of-function genetic perturbations and defined Neo Ags. Although prior studies have examined NeoAg vaccines, few (if any) studies have performed extensive comparisons between NeoAg vaccines, anti-CTLA-4, anti-PD-1, and combination ICT. While401623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO most prior studies involving ICT or NeoAg vaccines focused on either lymphoid or myeloid cells, our work has provided insights into both categories of cells and how different immunotherapies differentially affect these cells. Our treatment schedule and analyses were initially performed so that the NeoAg cancer vaccines or ICT we used lead to complete tumor rejection in a majority of mice; thus, we could compare the molecular and cellular changes that occur as a consequence of NeoAg SLP vaccines or different forms of ICT and link them to outcomes. We specifically chose to include in our study a NeoAg SLP vaccine to complement ongoing clinical trials employing SLPs usually in combination with the adjuvant polyIC:LC. The current study makes several key observations. First, NeoAg SLP vaccines and ICT work by several mechanisms related to the CD8 T cell response, with key differences in the overall magnitude of the response and phenotype of NeoAg-specific CD8 T cells observed. NeoAg SLP vaccines induce the greatest expansion of functional intratumoral NeoAg-specific CD8 T cells including proliferating T cells and PD- 1+TCF-1+stem-like CD8 T cells. Anti-PD-1 alone, and most dramatically when administered in combination with anti-CTLA-4 ICT, induced Bhlhe40hlNeoAg-specific CD8 T cells that also display high expression of Tbx21 and Ifng, as well as Nr4al and Nr4a3, which suggest recent activation and / or TCR stimulation due to the known pattern of rapid and transient expression of Nr4al and Nr4a3 following T cell stimulation. We previously found that ICT promotes Bhlhe40 upregulation in NeoAg tumor-specific T cells and that expression of Bhlhe40 in CD4 and / or CD8 T cells is vital for effective anti-CTLA-4 or anti-PD-1 ICT. A more recent study identified Bhlhe40 as modulating a key differentiation point between progenitor and intermediate subsets of exhausted T cells in an in vitro exhaustion model and chronic LCMV infection. It is therefore significant that the top defining marker of this cluster is Bhlhe40.

[0205] In addition to modulating the CD8 T cell compartment, ICT notably impacted the CD4 T cell compartment as well. Anti-CTLA-4 notably induced ICOS+Thl-like conventional CD4 T cells displaying high expression of Bhlhe40, again consistent with a critical role for Bhlhe40 is not only CD8 T cells, but CD4 T cells in response to certain immunotherapies. Interestingly, subsets of Thl-like CD4 T cells with high expression of Bhlhe40 were previously found to be enriched in patients with microsatellite instability colorectal cancer, who display more favorable outcomes in response to anti-CTLA-4. Further, studies in both preclinical models and human melanoma patients have revealed that anti-CTLA-4 induces ICOS+CD4 T cells expressing IFN- y, together suggesting human relevance of our findings. Anti-PD-1 also increased the frequency of IFN-y+CD4 T cells, but to less of an extent as compared to anti-CTLA-4.411623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO

[0206] Although CD4 T cells and MHC-II NeoAgs are critical components of anti-tumor immunity, we specifically chose to utilize an SLP vaccine against a single MHC-I NeoAg to definitively link the MHC-I NeoAg vaccine response to a specific defined NeoAg. Further, since MHC-II NeoAgs are more difficult to predict than MHC-I NeoAgs, we wanted to study the effects of an MHC-I NeoAg vaccine and whether this NeoAg vaccine approach in combination with other treatments could enhance tumor rejection. While SLPs offer several advantages over short peptides including the potential to provoke both CD4 and CD8 T cells responses; the NeoAg SLPs we used (mAlg8 or mLama4) provoke only NeoAg-specific CD8 T cell responses.

[0207] Nevertheless, determining whether incorporating an MHC-II NeoAg such as mltgbl or even a shared, non-mutant antigen will enhance the efficacy of NeoAg vaccines in our models is of future interest. To that end, a recent study found that inclusion of low doses of MHC-II - restricted NeoAg SLPs (along with MHC-I-restricted NeoAg SLPs) promoted tumor rejection, whereas NeoAg SLP vaccines containing higher concentrations of the same MHC-II NeoAg induced type 1 regulatory T cells and blunted tumor rejection. Although this inhibition could be overcome with additional treatment modalities, it nevertheless suggests inclusion of MHC-II NeoAg SLPs might improve vaccine efficacy, but the dose is critical. While NeoAg SLP vaccines targeting MHC-I NeoAgs predominately altered CD8 T cells, we found that these NeoAg SLP vaccines require CD4 T cells for efficacy. The detailed mechanisms regarding the contribution of CD4 T cells in NeoAg vaccines targeting MHC-I NeoAgs remains to be fully elucidated. While certain alterations in cellular subpopulations and gene / protein expression observed with combination ICT were distinct from either anti-CTLA-4 or anti-PD-1, several features of combination ICT were also observed with anti-CTLA-4, whereas other changes were more akin to those observed with anti-PD-1. These findings add to the accumulating evidence that the enhanced anti-tumor activity of combination anti-CTLA-4 and anti-PD-1 is mediated though not only additive effects, but also through mechanisms distinct from the monotherapies. The unique features of the T cell populations observed under different treatments prompted us to assess combining NeoAg SLP vaccines with anti-CTLA-4 or anti-PD-1. In both the Y1.7LI melanoma model and MC38 model, NeoAg SLP vaccines combined with either anti-CTLA-4 or anti-PD-1 lead to equal or better anti-tumor immune responses than even combination anti-CTLA-4 and anti- PD-1. While up to 20-30% of patients treated with anti-CTLA-4 or anti-PD-1 may experience durable cancer control, ~50% of metastatic melanoma patients treated with the combination of anti-CTLA-4 plus anti-PD-1 experience durable cancer control; however, immune related adverse421623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO events are problematic. As NeoAg SLP vaccines have demonstrated favorable safety profiles, combining NeoAg SLP vaccines with single agent ICT may yield robust anti-tumor immunity with less toxicity than anti-CTLA-4 and anti-PD-1 combination ICT.

[0208] Beyond the T cell compartment, we noted divergent impacts between NeoAg SLP vaccines and ICT on the myeloid compartment. Both ICT and NeoAg SLP Vax increased Ml-like iNOS+macrophages to levels higher than with control mAb or Control Vax. ICT reduced the frequency of intratumoral M2-like CX3CR1+CD2O6+macrophages whereas NeoAg SLP Vax (NeoAg SLP + pLC) treated mice displayed an equal or greater frequency of CX3CR1+CD2O6+macrophages compared to control mAb or ICT treated mice, albeit less than with Control Vax (irrelevant SLP + pLC). These differences were also evidenced by increased Trem2 expression, which was expressed by CX3CR1+CD2O6+macrophages. Our current study (in particular the scRNAseq data) further supports the concept that although intratumoral macrophages may have “Ml-like” or “M2-like” features, they display a spectrum of activation states and do not fit exclusively into Ml or M2 states.

[0209] The differences noted between NeoAg SLP vaccines and ICT on the macrophage compartment likely involves multiple signals within the TME. In MCA sarcoma models, we found that ICT-driven induction of iNOS+macrophages was dependent upon IFN-y, whereas ICT-driven depletion of CX3CR1+CD2O6+macrophages was partially independent of IFN-y. In our vaccine setting, we hypothesize that T cell-derived IFN-y and other factors drive monocyte polarization to iNOS+macrophages upon entering the tumor, but other signals promote maintenance, expansion, or induction of CX3CR1+CD2O6+macrophages as well. These signals are yet unknown but are likely induced by the pLC (contained in both the Control Vax and NeoAg SLP Vax), which acts as a TLR3 agonist in the endosome to potently induce a type I IFN response and can also activate RIG-I / MDA-5 in the cytosol to promote IL- 12 production. Interestingly, a recent study found that pLC-induced type I IFN unexpectedly provoked IL-4 production by monocytes and skewed tumor macrophages towards an M2-like phenotype.

[0210] Although type I IFN is usually associated with Ml-like inflammatory macrophages, it would be interesting to investigate in future studies whether blocking IFN signaling could reverse the macrophage phenotype associated with pLC. While the NeoAg SLP vaccine produces greater frequencies of stem-like TCF1+ CD8 T cells (which in turn supply effector CD8 T cells which may have anti-tumor potential) the vaccine may also trigger a myeloid-driven compensation mechanism increasing CX3CR1+CD206+ macrophages (possibly driven by pLC). In the MC38431623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO tumor model, the Seder group recently found that a systemic self-assembling NeoAg-TLR7 / 8 agonist nanoparticle vaccine altered the intratumoral monocyte / macrophage compartment by potently reducing Chil3+ monocytes. The reduction of Chil3+ monocytes was likely a result of the adjuvant used, as the irrelevant antigen-TLR7 / 8 agonist also reduced the frequency of Chil3+ monocytes. We did not observe NeoAg SLP Vax induced alterations in Chil3+ monocytes, which represented about 1% of cells in Y1.7LI, in contrast to MC38, where about 25% of the intratumoral myeloid cells are Chil3+ monocytes.

[0211] The presence of CX3CR1+CD206+ macrophages in the NeoAg SLP vaccine setting prompted us to ask whether these macrophages had the capacity to suppress anti-tumor responses. CX3CR1+CD206+ macrophages from NeoAg SLP Vax treated mice displayed high expression of Trem2. TREM2 is a myeloid cell receptor that was studied primarily in the setting of neuroinflammation and neurodegeneration but has recently emerged as a regulator of macrophage function in tumors. TREM2 is widely expressed on macrophages in human tumors and expression of TREM2 is generally associated with worse prognosis. We isolated CX3CR1+CD2O6+macrophages from mice treated with NeoAg SLP Vax initiated on day 12 post-transplant. Intratumoral injection of these macrophages rendered NeoAg SLP Vax initiated on day 7 ineffective, providing evidence that the CX3CR1+CD2O6+macrophages are indeed immunosuppressive and that TREM2 is a relevant target since effects of the injected CX3CR1+CD2O6+macrophages could be reversed by a non-depleting TREM2 blocking mAb.

[0212] We previously demonstrated that targeting TREM2 with a non-depleting recombinant anti-TREM2 mAb reduced CX3CR1+CD206+ macrophages while concomitantly expanding myeloid cells expressing immunostimulatory molecules. Further, blockade of TREM2 alters gut microbiome and induces proinflammatory programs in intestinal macrophages to enhance anti- PD-1 efficacy. We hypothesized that combining NeoAg SLP vaccines that maintain or promote CX3CR1+CD206+ macrophages expressing TREM2 with treatments targeting this macrophage population might enhance the efficacy of NeoAg SLP vaccines. Indeed, we found that anti- TREM2 mAb used in combination with NeoAg SLP vax enhanced efficacy. This enhanced efficacy was associated with a reduction of intratumoral CX3CR1+CD206+ macrophages, promotion of iNOS+ macrophages, and increased IFN-y+ mLama4 NeoAg-specific CD8 T cells.

[0213] This study provides key insights into the transcriptional, molecular, and functional changes that occur within major immune cell populations within the TME following different forms of cancer immunotherapy and compliments ongoing human clinical studies of NeoAg441623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO vaccines. Although we did not fully elaborate on every specific immune cell population, the myeloid and lymphoid cell subsets and potential biomarkers we have described herein should inform the development of improved personalized NeoAg vaccines and combinatorial therapies in human patients.

[0214] This study offers key insights into processes underlying different forms of ICT and NeoAg SLP cancer vaccines, uncovering rationale combination therapies including those targeting the immunosuppressive myeloid compartment. While we focused on mLama4 / mAlg8 / mItgbl NeoAg specific T cells, we did not exclude the possibility that T cell responses to other undefined NeoAg or shared, non-mutant antigens are also relevant. Further, we did not elaborate on how much of the intratumoral T cell response is tumor reactive and what percentage mLama4 / mAlg8 / mItgbl NeoAg specific T cells comprise tumor reactive T cell response. Although we compared our T cell subpopulations to those found in humans, the applicability of our findings to patients treated with different immunotherapies, including NeoAg cancer vaccines needs additional validation. Further, many different vaccine platforms besides SLP plus pI:C are used in humans, including RNA-based vaccines and our results may be more specific to SLP plus pLC vaccines. Although targeting a single NeoAg in the Y1.7 model and three NeoAgs in the MC38 model was efficacious, it is likely that targeting multiple NeoAgs and possibly even non-mutant antigens (with at least some of the antigens being clonal), will be required in patients due to tumor heterogeneity and therapy induced-immunoediting.EXAMPLE 9CX3CR1+macrophage signature in human melanoma associates with poorer outcomes and distinct spatial immune cell interactions

[0215] A gene signature derived from mouse CX3CR1+macrophages that are a major target of anti-TREM2 in the preclinical tumor models was generated and compared to single cell RNA sequencing data from patient tumors. This analysis revealed the presence of similar intratumoral populations in human lung cancer, liver cancer, and melanoma (FIG. 24 A). Further, a gene signature derived from these mouse CX3CR1+macrophages correlated with poorer overall survival in a cohort of melanoma patients (FIG. 24B). Next, as a part of a collaboration, spatial transcriptomic profiling was performed on clinically annotated, deidentified melanoma tumors from patients treated with anti-PD-1 (nivolumab or pembrolizumab) using the GeoMx Digital Spatial Profiler (DSP) platform. In both lymphocyte aggregates and tertiary lymphoid structures (TLS), the CX3CR1+macrophage gene signature was enriched in patients that lacked response to451623862901.3439994.000083PATENT ATTORNEY DOCKET NO. MDA1360-1WO immune checkpoint therapy (nonresponder, NR) (FIG. 24C). Next, the spatial resolution of the regions of interest (ROIs) was leveraged to calculate a cell proximity index, comparing macrophages with a CX3CR1+gene signature or an iNOS+gene signature to other immune cell types in human melanoma tumors. Notably, CX3CR1+macrophages were preferentially located near Thl7 cells, Tregs, and CD8+T exhausted (Tex) cells, whereas iNOS+macrophages were more often in proximity to cells associated with anti-tumor immune responses including Thl cells, CD8+progenitor exhausted (Pex) cells, and type I dendritic cells (cDCls) (FIG. 24D). Together, these findings link CX3CR1+macrophages, which are major targets of anti-TREM2, with distinct spatial niches and response to immunotherapy and survival in human patients.EXAMPLE 10Materials and MethodsMice

[0216] All mice used were on a C57BL / 6 background. Wildtype (WT) C57BL / 6J mice were purchased from Jackson Labs. All in vivo experiments used 8- to 12-week-old male or female mice (to match the sex and strain of the tumors). All mice were housed in a specific pathogen-free animal facility. All animal studies were performed in accordance with, and with the approval of the Institutional Animal Care and Use Committee (IACUC) of The University of Texas MD Anderson Cancer Center (Houston, TX).Plasmids and Cell Line Generation

[0217] Gene blocks for mAlg8, mltgbl, or mLama4 were purchased from Integrated DNA Technologies. Minigene constructs were cloned into the Bglll site of pMSCV-IRES GFP (mAlg8 and mltgbl) or pMSCV (mLama4 and mltgbl) using the Gibson Assembly method (New England Biolabs). To generate neoantigen-expressing Y1.7 melanoma cell lines, constructs were transiently transfected into Phoenix Eco cells using Fugene (Promega). After 48 hours, viral supernatants were filtered and subsequently used for transfection of Y 1.7 melanoma cell line. Y1.7 mLama4MHC'I.mItgblMHC'n(YULI) and Y1.7 mAlg8MHC'I.mItgblMHC'n(Y1.7AI) were sorted based on GFP positivity and clones were verified for neoantigen expression.Tumor Cell Lines

[0218] The Brajy600ECdkn2a' / ' PtenEYUMM1.7 parental line was originally generated in a male GEMM on the C57BL / 6 background as described. Parental YUMM1.7 was purchased from ATCC (CRL-3362) and was modified to generate NeoAg-expressing Y1.7 lines. The MC38 line461623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO was obtained from B. Schreiber (Washington University in St. Louis School of Medicine). All tumor cell lines were found to be free of common mouse pathogens and Mycoplasma as assessed by IDEXX IMPACT I mouse pathogen testing [PCR evaluation for: Corynebacterium bovis, Corynebacterium sp. (HAC2), Ectromelia, EDIM, Hantaan, K virus, LCMV, LDEV, MAV1, MAV2, mCMV, MHV, MNV, MPV, MTV, MVM, Mycoplasma pulmonis, Mycoplasma sp., Polyoma, PVM, REO3, Sendai, TMEV] in December 2023. Tumor cell lines from the same cryopreserved stocks that were used in this study tested negative for Mycoplasma and were authenticated and found to be free of non-mouse cells as assessed by mouse cell STR profiling (IDEXX CellCheck mouse 19 plus Mycoplasma spp. testing).Tumor Transplantation

[0219] The Braf600ECdkn2a' / ' PtenEYUMM1.7 parental melanoma line, Y I .7LI or Y1.7AI melanoma line, and the MC38 colorectal cancer line cells were propagated in R-10 plus BME media [RPMI media (HyClone) supplemented with 1% 1-glutamine, 1% penicillin-streptomycin, 1% sodium pyruvate, 0.5% sodium bicarbonate, 0.1% 2-mercaptoethanol, and 10% heat- inactivated fetal calf serum (FCS) (HyClone) upon thawing, tumor lines were passaged 3 to 6 times before experimental use. Prior to injection, cells were washed extensively, resuspended at a concentration of 0.5 x 106cells (for YUMM1.7, Y1.7LI, and Y1.7AI) or 1.5 x 106cells (for MC38) in 150 pL of endotoxin-free PBS and 150 pL was injected subcutaneously into the flanks of recipient mice. Tumor cells were >90% viable at the time of injection as assessed by Trypan blue exclusion. Tumor growth was quantified by caliper measurements and expressed as the average of two perpendicular diameters. Lack of survival was defined as mouse death or mean tumor diameter size of 15 mm.Tumor Rechallenge

[0220] For tumor rechallenge, mice that rejected primary tumors after treatment with anti- CTLA-4, anti-PD-1, anti-CTLA-4 + anti-PD-1, or NeoAg SLP vaccines were then rechallenged with same number of cells used in primary challenge with either the same tumor line used in the primary tumor challenge, or a different tumor line as indicated at least 60 days after complete rejection of the primary tumor.In vivo antibody treatments

[0221] For ICT treatment, YUMM1.7 parental, Y I .7LI, or Y1.7AI tumor-bearing mice were treated intraperitoneally with 200 pg of anti-CTLA-4 and / or anti-PD-1 on days 3, 6, 9, 12, 18, and 22 or days 7, 10, 13, 16, 22, and 28; or days 12, 15, 18, 21, 27 and 33 post-tumor transplant. For471623862901.3439994.000083PATENT ATTORNEY DOCKET NO. MDA1360-1WO controls, mice were injected with 200 pg of IgG2a isotype control antibodies. MC38 tumorbearing mice were treated intraperitoneally with 200 pg of anti-CTLA-4 and / or anti-PD-1 on days 12, 15, 18, and 22 post-transplant. For anti-TREM2, mice were treated via intraperitoneal injection on days 7, 12, and 17 post-tumor transplant with 200 pg of anti-TREM2 or relevant isotype control mAb. For antibody depletion studies, 250 pg of control mAb, anti-CD4, or anti-CD8a was injected intraperitoneally into mice at day -1 and every 7 days thereafter until day 20. CD4 and CD8 depletion was verified by flow cytometry analysis of surface-stained peripheral blood monocytes (PBMC) and intratumoral immune cells. For in vivo experiments, “In vivo Platinum”-grade antibodies that were verified to be free of mouse pathogens (IDEXX IMPACT I mouse pathogen testing) were purchased from Leinco Technologies: anti-PD-1 (rat IgG2a clone RMP1-14), anti- CTLA-4 (murine IgG2b clone 9D9), anti-CD4 (rat IgG2b clone GK1.5), anti-CD8a (rat IgG2b clone YTS169.4), anti-TREM2 (Fc Muted Clone 178), and isotype controls (rat IgG2a clone 1-1, mouse IgG2a clone OKT3, rat IgG2b clone 1-2, or anti-Human ILT1 (Fc Muted Clone 135.5; Isotype Control for anti-TREM2).Peptides

[0222] Mutant Lama4 8-mer (VGFNFRTL) (SEQ ID NO: 1), mutant Lama4 SLP (QKISFFDGFEVGFNFRTLQPNGLLFYYT) (SEQ ID NO: 2), mutant Adpgk SLP (HLELASMTNMELMSSIVHQ) (SEQ ID NO: 3), mutant Rpll8 SLP (KAGGKILTFDRLALESPK) (SEQ ID NO: 4), mutant Dpagtl SLP(EAGQSLVISASIIVFNLLELEGDYR) (SEQ ID NO: 5), mutant Alg8 8-mer (ITYTWTRL) (SEQ ID NO: 6), mutant Alg8 SLP (AVGITYTWTRLYASVLTGSLV) (SEQ ID NO: 7), OVA- 1257-264 (SIINFEKL) (SEQ ID NO: 8), mutant Itgbl SLP(DDCWFYFTYSVNGYNEAIVHWETPDCP) (SEQ ID NO: 9), and OVA-II323-339 (ISQAVHAAHAEINEAGR) (SEQ ID NO: 10) peptides were custom ordered from Peptide 2.0. All peptides were HPLC purified to >95% purity.Vaccination

[0223] Y 1.7LI or Y1.7AI tumor bearing male mice were vaccinated subcutaneously with 10 pg mLama4 or mAlg8 synthetic long peptide (SLP) in combination with 50 pg of VacciGrade™ high molecular weight Polyinosinic-polycytidylic acid (pLC) (InvivoGen) in a total volume of 150 pL diluted in endotoxin-free sterile PBS on days 3, 9, and 15 post-tumor transplant. In separate experiments, Y I .7LI tumor bearing male mice were vaccinated subcutaneously with 10 pg of mLama4 or mAlg8 SLP in combination with 50 pg of pLC (in a total volume of 150 pL diluted481623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO in endotoxin-free sterile PBS) on days 7, 13, and 19 or days 12, 18, and 24 post-tumor transplant. MC38 tumor bearing female mice were vaccinated subcutaneously with 20 pg of mAdpgk SLP plus 20 pg of mRpll8 SLP plus 20pg of mDpagtl plus 50 pg pI:C adjuvant or control vaccine composed of 40 pg of irrelevant HPV SLP + 50 pg of pI:C on days 12 and 19 post-tumor transplant. For SLP, peptide sequence used for mLama4; QKISFFDGFEVGFNFRTLQPNGLLFYYT (SEQ ID NO: 2), for mAlg8; AVGITYTWTRLYASVLTGSLV (SEQ ID NO: 7), for mAdpgk;HLELASMTNMELMSSIVHQ (SEQ ID NO: 3), for mRpll8; KAGGKILTFDRLALESPK (SEQ ID NO: 4) and for mDpagtl; EAGQSLVISASIIVFNLLELEGDYR (SEQ ID NO: 5). mLama4 SLP served as a relevant SLP for the Y 1.7LI line and an irrelevant SLP for the Y 1.7AI line. mAlg8 served as a relevant SLP for the Y 1.7AI line and an irrelevant SLP for the Y 1.7LI tumor.Tumor and Spleen Harvest

[0224] Established tumors were excised from mice, minced, and treated with 1 mg / mL type IA collagenase (Sigma-Aldrich) in HBSS (Hyclone) for 45 minutes at 37°C. Cells were washed three times. Red blood cells were lysed using ACK lysis buffer (Gibco). To remove aggregates and clumps, cells were passed through a 40-pm strainer. Spleens were harvested, crushed, and vigorously resuspended to make single-cell suspensions. To remove aggregates and clumps, cells were passed through a 70-pm strainer and subsequently through a 40-pm strainer.TIL Peptide Restimulation

[0225] For peptide and PMA / ionomycin T-cell stimulation, cells from tumors, isolated as described above (see tumor and spleen harvest section), stained, and CD4 and CD8 T cells were sorted. For sorting CD4 and CD8 T cells, tumor cells were stained for 5 min at room temperature with 500 ng of Fc block (anti-CD 16 / 32) and then stained with antibodies to CD45, CD3e, CD4 or CD8a and Zombie NIR Viability dye in 100 pl of staining buffer. Cells were incubated for 30 minutes at 4°C. Live CD45+Cd3e+CD4+ and live CD45+Cd3e+CD8a+ were then sorted on a BD FACSAria II (BD Biosciences). Splenocytes harvested from naive mice and 100,000 splenocytes were then pulsed with 1 pM of mLama4 8-mer peptide or mltgbl 28-mer peptide and 100,000 CD8 or CD4 TIL were subsequently added and incubated at 37°C. After 1 h, BD GolgiPlug (BD Bioscience) was added in, and cells were incubated for an additional 5 h at 37°C.Tetramer Staining

[0226] For tetramer staining, cells were stained for 5 min at room temperature with 500 ng of Fc block (anti-CD 16 / 32). H-2Kb tetramers conjugated to PE (1:50) or APC (1:25) for mutated491623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WOAlg8, mutated Lama4, or OVA-I (SIINFEKL) (SEQ ID NO: 8) (irrelevant control tetramer) were added to cells and incubated for 20 min at 37°C. Tetramer-stained cells were further stained with surface antibody for anti-CD45, anti-Thyl.2, anti-CD8a, anti-CD4, anti-PD-1, anti-TIM-3, and anti-LAG-3 antibody for 20 min at 4°C. OVA-I (SIINFEKL) (SEQ ID NO: 8) -H-2Kb, mutant Alg8-H-2Kb, and mutant Lama4-H-2Kb tetramers conjugated to PE or APC fluorophores, were obtained from the Baylor College of Medicine MHC Tetramer Production Facility.Dextramer Staining

[0227] For dextramer staining, cells were stained for 5 min at room temperature with 500 ng of Fc block (anti-CD 16 / 32). H-2Kb dextramers conjugated to PE (1:10) for mutated Lama4 was added to cells and incubated for 20 min at 37°C. Dextramer-stained cells were further stained with surface antibody for anti-CD45, anti-Thyl.2 and anti-CD8a antibody for 20 min at 4°C. Mutant Lama4-H-2Kb dextramer conjugated to PE fluorophore was obtained from Immudex LLC, Fairfax, VA, USA.Flow Cytometry

[0228] For flow cytometry, cells were stained for 5 minutes at room temperature with rat antimouse CD16 / 32 (mouse BD Fc Block; clone 2.4G2, BD Biosciences) at 1 pg / million cells and then surface stained with flow antibodies for 20 minutes at 4°C. Surface antibodies were diluted in FACS staining buffer (PBS with 2% FCS, 2 mmol / L EDTA, and 0.05% NaN3; Sigma). Antimouse CD45-BV605, CD90.2 / Thyl.2-PE-Cy7, anti-mouse CD8a-BV786, anti-mouse CD4- BV711, anti-mouse CD19-BV650, anti-mouse CD20-BV421, anti-mouse CD45R / B220- BUV395, anti-mouse Nkp46 / CD335-FITC, anti-mouse y5 TCR-PE-Cy7, anti-mouse PD-1- BV421, anti-mouse TIM-3, anti-mouse LAG-3-PerCP-Cy5.5, anti-mouse CD3e-APC , antimouse CD64-BV421, anti-mouse Ly6G-7 Alexa Fluor 700, anti-mouse CX3CR1-FITC, antimouse I-A / I-E-BV650, anti-mouse CD103-BV421, anti-mouse CD24-BV711, anti-mouse CDl lc-BV786, anti-mouse CDl lb-APC, anti-mouse F4 / 80-BUV395, anti-mouse CD64-APC, CD117-FITC, anti-mouse CD1 lb- PerCP-Cy5.5, anti-mouse PDCA-l / BST-2 BV650, anti-mouse CD172a APC, anti-mouse PDL1-PE, anti-mouse FcaRI-PE-Cy7 were used for surface staining at the indicated dilutions. Zombie NIR Viability dye was added at 1:500 during surface staining.

[0229] For intracellular staining, surface-stained cells were fixed and permeabilized with Fixation / Permeabilization Solution Kit (BD Bioscience). Fixed and permeabilized cells were then stained with anti-mouse CD206-PE-Cy7 and anti-mouse iNOS / NOS2-PE for 30 minutes at 4°C. The exception was for sorting of live CX3CR1+ CD206+ macrophages used for intratumoral501623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO injection, where anti-CD206 was instead included in surface staining and intracellular staining was not performed.

[0230] For FOXP3 staining, surface-stained cells were fixed and permeabilized using the eBioscience FOXP3 / Transcription Factor Staining Buffer Set. Fixed and permeabilized cells were then stained with anti-mouse FOXP3-FITC for 30 minutes at 4°C.

[0231] For intracellular cytokine staining of lymphocytes, tumor cells were isolated and CD4 and CD8 T cells were sorted and added to peptide pulsed or PMA+Ionomycin stimulated splenocytes and incubated at 37°C for 6 hours with GolgiStop (BD Bioscience). Cells were then washed and stained for 5 minutes at room temperature with Fc block at 1 pg / million cells and then surface stained for 30 minutes at 4°C, and then fixed and permeabilized with BD Fixation and Permeabilization Kit. Fixed and permeabilized cells were then stained with anti-mouse IFN-y- APC and anti-mouse TNF-PE-Cy7 for 30 minutes at 4°C. All flow cytometry was performed on an BD Fortessa X-20, BD LSR, BD Fortessa, and analyzed using Flow Jo software. Gating strategy used is depicted in FIG. 21.Quantitative RT-PCR

[0232] RNA was extracted from sorted macrophages using RNAeasy Plus Mini Kit (Qiagen). 100 pg of RNA was reverse-transcribed and subjected to qRT-PCR using the SuperScript III Platinum Two-Step qRT-PCR Kit with SYBR Green (Invitrogen). qPCR was performed on the StepOne Real-Time PCR System (Applied Biosystems). Each sample was run in triplicate for each gene and the cDNA from each sample was divided equally per reaction in a 20 pl volume. The qPCR conditions were as follows: 50°C for 2 minutes and 95°C for 2 minutes, followed by 40 cycles of 95°C for 15 seconds and 59°C for 30 seconds. Melting curve analysis was performed to confirm a single amplicon. Differences in gene expression were determined using the equation 2-AACt, where the Ct value of Trem2 was subtracted from the Ct value of the Gapdh control to yield the ACt value. For each sample, the ACt value Trem2 done in triplicate was averaged and compared to give one AACt value per sample. Mouse qPCR Trem2 primers were as follows: forward primer-5’ CTGGAACCGTCACCATCACTC3’ (SEQ ID NO: 11) and reverse primer- 5’CGAAACTCGATGACTCCTCGG3’ (SEQ ID NO: 12). Mouse qPCR Gapdh primers were as follows: forward primer-5 ’AGGTCGGTGTGAACGGATTTG3’ (SEQ ID NO: 13) and reverse primer-5 ’TGTAGACCATGTAGTTGAGGTCA3’ (SEQ ID NO: 14).511623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO scRNAseq

[0233] For scRNAseq profiling of intratumoral live CD45+ cells, tumors from 5 individual mice per treatment group were pooled and processed and for NeoAg-specific CD8 T cells 5 individual mice per treatment group were pooled and processed.Antibody Hashing for Multiplexing

[0234] Antibody hashing and multiplexing was utilized for scRNAseq of NeoAg-specific CD8 T cells. For CD45+ scRNAseq experiments, antibody hashing and multiplexing was not performed. For analysis of NeoAg-specific CD8 T cells, cell and nuclei labeling were performed according to an adapted BioLegend cell hashing protocol (TotalSeq™-C Antibodies and Cell Hashing with lOxSingle Cell 5' Reagent Kit vl.l Protocol, BioLegend). Single cell suspensions of harvested tumors from treated mice were resuspended in BioLegend Cell Staining Buffer containing Fc receptor block and stained with mLama4 PE and APC labelled tetramers for 20 min at 37°C. Tetramer-stained cells from control mAb, Control Vax, and NeoAg SLP Vax treatment conditions were immediately surface stained by adding anti-CD90.2 / Thyl.2-PE-Cy7 and anti- CD8a-BV786 antibodies and incubated for 20 min at 4°C. Tetramer-stained samples from anti- CTLA-4, anti-PD-1, and anti-CTLA-4 plus anti-PD-1 treated groups were incubated with mixture of surface stain (anti-CD90.2 / Thyl.2-PE-Cy7 and anti-CD8a-BV786 antibodies) and barcoded antibodies with unique hashtags for each treatment condition [anti-CTLA-4: Hashtag 1 Total Seq™-C0301 anti-mouse Hashtag 1 Antibody; anti-PD-1: Hashtag 2 (Total Seq™-C0302 antimouse Hashtag 2 Antibody); anti-CTLA-4 + anti-PD-1 combination: Hashtag 3 (Total Seq™- C0303 anti-mouse Hashtag 3 Antibody)]. Hashtag antibodies were used at a concentration of 1 pg per 2 million cells. Staining with surface antibodies and hashtag antibodies was done for 30 min at 4°C. Cells were then washed 3X with BioLegend Cell Staining Buffer. Sorted mLama4 tetramer-specific CD8 T cells with unique hashtags (anti-CTLA-4, anti-PD-1, and anti-CTLA-4 + anti-PD-1 samples) were pooled for single-cell library generation and CITE-seq (cellular indexing of transcriptomes and epitopes by sequencing) through multiplexing. Separate libraries were generated for control mAb, Control Vax, and NeoAg SLP Vax samples and, thus, these were not multiplexed. Cells were counted on a Countess 3 FL automated cell counter (Life Technologies) and viabilities were determined using trypan blue exclusion. Cell capture processing and gene expression and feature barcode library preparations were performed following 10X Genomics’ guidelines for 5’ scRNAseq [CG000330_ChromiumNext GEM Single Cell 5' v2 (Dual Index) with Feature Barcode technology-Rev F], QC steps after cDNA521623862901.3439994.000083PATENT ATTORNEY DOCKET NO. MDA1360-1WO amplification and library preparation steps were carried out by running ThermoFisher Qubit HS dsDNA Assay along with Agilent (Santa Clara, CA) HS DNA Bioanalyzer for concentration and quality assessments, respectively. Library sample concentrations were verified using qPCR using a KAPA Biosystems KAPA Library Quantification Kit prior to pooling. Libraries were normalized to 5 nM for pooling. The pool was sequenced using a NovaSeq6000 S4-XP,200-cycle flow cell lane. The run parameters used were 26 cycles for readl, 90 cycles for read2, 10 cycles for index 1, and 10 cycles for index2 as stipulated in the protocol mentioned above. Raw sequencing data (fastq file) was demultiplexed and analyzed using 10X Genomics Cell Ranger v.7.1.0 software utilizing standard default settings and the cellranger count command to generate html QC metrics and coupe / vloupe files for each sample. We profiled between 937 to 1762 mLama4-specific CD8 T cells for each of the different ICT treatment conditions and 4459, 6723, and 7646 mLama4-specific CD8 T cells for control mAb, Control Vax, and NeoAg SLP Vax, respectively.CD45+ scRNAseq Library Generation

[0235] Droplet-based 5 ’ end massively parallel scRNAseq is performed by encapsulating sorted live CD45+ tumor-infiltrating cells into droplets. Libraries are prepared using Chromium Next GEM Single-cell 5’ Reagent Kit v2 (lOx Genomics) according to the manufacturer’s protocol. The generated scRNAseq libraries are sequenced using an Illumina NovaSeq6000 S2 flow cell. scRNAseq alignment, barcode assignment, and unique molecular identifier counting

[0236] The Cell Ranger Single-Cell Software Suite available at https: / / support.1 Oxgenomics.com / single-cell-gene-expression / software / overview / welcome was used to perform sample demultiplexing, barcode processing, and single-cell 5’ counting. Cellranger mkfastq was used to demultiplex raw base call files from the NovaSeq6000 sequencer, into sample-specific fastq files. Files were demultiplexed with 81.9% to 97.1% perfect barcode match, and 90%+ q30 reads. Afterward, fastq files for each sample were processed with Cellranger count, which was used to align samples to mmlO genome, filtered, and quantified. For each sample, the recovered cells’ parameter was specified as 10,000 cells that we expected to recover for each individual library.Preprocessing analysis with Seurat package

[0237] The Seurat pipeline was applied to each dataset following tutorial specifications from https: / / satijalab.org / seurat / articles / archive; version 4.3 and https: / / hbctraining.github.io / scRNA- seq_online / . Data from all groups were merged into a single Seurat object, and integration was531623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO performed using the reciprocal principal component analysis (PCA) workflow to identify integration anchors. After integration, genes that were expressed in fewer than 3 cells and cells that contained fewer than 500 transcripts (unique molecular identifiers; UMI) were excluded. Cells with more than 10% of mitochondrial transcripts were also excluded from analysis. The cutoffs used were set based on the characteristics of the cell population in each dataset. Data were normalized using LogNormalize method (counts for each cell divided by the total counts for that cell, multiplied by the scale factor of 104 and natural-log transformed using log Ip). PCA was performed on about 2,000 genes with PCA function. A uniform manifold approximation and projection (UMAP) dimensional reduction was performed on the scaled matrix (with most variable genes only) using the first 40 or 50 principal components (PCA) for mLama4 neoAg- specific CD8 T cells and CD45+ cells, respectively, to obtain a two-dimensional representation of the cell states.For clustering, we used the function FindClusters that implements SNN (shared nearest neighbor) modularity optimization-based clustering algorithm on 30 PCA components, leading to 33 clusters.Identification of cluster-specific genes and marker-based classification

[0238] To identify marker genes, the FindAllMarkers function was used with likelihood-ratio test for single-cell gene expression. To characterize clusters, we used ImmGen database. For heat map representation, mean expression of markers inside each cluster was used. To compare gene expression for the clusters inside cohorts (e.g., T cells, macrophages) we used FindMarkers function to calculate average log2 fold change and identify differentially expressed genes between each pair of experimental conditions using a Wilcoxon rank-sum test for calculating P values and Bonferroni correction for Padj values.T cell population analysis

[0239] To gain more insights into different immuno therapies-induced T cells remodeling in the TME, we subclustered activated T cells (excluding quiescent T cell clusters 10 and 12). Identification of most variable genes, PCA, UMAP, clustering, and marker selection analysis were performed as described above.Gene set enrichment analysis (GSEA)

[0240] To identify if MSigDB hallmark gene sets are up-regulated or down-regulated between clusters and treatments, we performed gene set enrichment analysis. Fold-changes of gene expression between comparisons were calculated using Seurat R package v.4.3.0.1, and541623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO normalized enrichment scores as well as p-values of given gene sets were then estimated using the gage R package v.2.46.1.Pseudo time trajectory analysis

[0241] To determine the potential lineage differentiation within CD4 T cell subpopulations, we used the Monocle3 R package to construct CD4 differentiation trajectories after specifying the corresponding cells as root nodes. Subsequently, graph test was used to find the pseudo time trajectory difference genes, and the obtained genes were used to plot the heat map.Comparison to published datasets

[0242] The gene lists defining phenotype of TILs were retrieved from published human or mouse scRNAseq datasets to compare the cluster annotation between published study and our current study. The module scores for individual cells were calculated using the “AddModuleScore” function in the Seurat package. The results were visualized using the normalized average module scores for each cluster (FIGS. 4 A, 4B and 5C).Statistical analysis

[0243] Samples were compared using an unpaired, two-tailed Student t test, two-way ANOVA, or log-rank (Mantel-Cox) test unless specified otherwise.

[0244]

[0245] Although the invention has been described with reference to the presently preferred embodiment, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims.551623862901.3439994.000083

Claims

PATENT ATTORNEY DOCKET NO. MDA1360-1WOWHAT IS CLAIMED IS:

1. A composition comprising:(a) a cancer vaccine; and(b) an anti-TREM2 agent.

2. The composition of claim 1, wherein the cancer vaccine is selected from the group consisting of an RNA vaccine, a synthetic long peptide (SLP) cancer vaccine, an oncolytic virus-based vaccine, a peptide-based vaccine, a cell-based vaccine, and combinations thereof.

3. The composition of claims 1 or 2, wherein the cancer vaccine targets antigens selected from neoantigens, non-mutant tumor antigens, viral antigens, defective ribosomal products, or combinations thereof.

4. The composition of claim 1, wherein the anti-TREM2 agent is selected from the group consisting of an anti-TREM2 antibody, an anti-TREM2 peptide, an anti-TREM2 small molecule, and combinations thereof.

5. The composition of claim 2, wherein the SLP cancer vaccine comprises one or more synthetic long peptides encoding tumor-specific neoantigens.

6. The composition of claim 1, further comprising an adjuvant.

7. The composition of claim 6, wherein the adjuvant is selected from the group consisting of poly I:C, poly ICLC, poly LC12U, CpG oligodeoxynucleotides (CpG ODN), imiquimod, resiquimod, flagellin, monophosphoryl lipid A (MPL), double-stranded RNA mimetics, RIG-I agonists, STING agonists, aluminum salts (alum), MF59, AS01, AS03, AS04, QS-21, virosomes, CAF01, Advax, chitosan, glucopyranosyl lipid A (GLA), Pam3CSK4, IC31, Matrix- M, Montanide ISA 51 , and combinations thereof.

8. A method of treating cancer in a subject, the method comprising: administering to the subject a therapeutically effective amount of:(a) a cancer vaccine; and(b) an anti-TREM2 agent.

9. The method of claim 8, wherein the cancer vaccine is selected from the group consisting of an RNA vaccine, a synthetic long peptide (SLP) cancer vaccine, an oncolytic virus-based vaccine, a peptide-based vaccine, a cell-based vaccine, and combinations thereof.

10. The method of claim 8 or 9, wherein the cancer vaccine targets antigens selected from neoantigens, non-mutant tumor antigens, viral antigens, defective ribosomal products, or combinations thereof.561623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO11. The method of claim 8, wherein the anti-TREM2 agent is selected from the group comprising of an anti-TREM2 antibody, an anti-TREM2 peptide, an anti-TREM2 small molecule, and combinations thereof.

12. The method of claim 8, wherein the cancer vaccine and the anti-TREM2 agent are administered concurrently.

13. The method of claim 8, wherein the cancer vaccine and the anti-TREM2 agent are administered sequentially.

14. The method of claim 8, further comprising administering an adjuvant.

15. The method of claim 14, wherein the adjuvant is selected from the group consisting of poly EC, poly ICLC, poly EC12U, CpG oligodeoxynucleotides (CpG ODN), imiquimod, resiquimod, flagellin, monophosphoryl lipid A (MPL), double-stranded RNA mimetics, RIG-I agonists, STING agonists, aluminum salts (alum), MF59, AS01, AS03, AS04, QS-21, virosomes, CAF01, Advax, chitosan, glucopyranosyl lipid A (GLA), Pam3CSK4, IC31, Matrix- M, Montanide ISA 51 , and combinations thereof.

16. The method of claim 8, wherein administering the cancer vaccine and the anti-TREM2 agent results in a decrease in intratumoral immunosuppressive macrophages.

17. The method of claim 16, wherein the immunsuppressive macrophages are CX3CR1+CD206+ macrophages.

18. The method of claim 8, wherein administering the cancer vaccine and the anti-TREM2 agent results in an increase in intratumoral iNOS+ macrophages.

19. The method of claim 8, wherein administering the cancer vaccine and the anti-TREM2 agent results in an increase in neoantigen-specific CD8+ T cells.

20. The method of claim 8, further comprising administering an immune checkpoint inhibitor.

21. The method of claim 20, wherein the immune checkpoint inhibitor is selected from the group consisting of an anti-PD-1 antibody, an anti-CTLA-4 antibody, and combinations thereof.

22. The method of claim 8, wherein the cancer is selected from the group consisting of melanoma, colorectal cancer, breast cancer, prostate cancer, lung cancer, kidney cancer, head and neck cancer, brain cancer, or stomach cancer.

23. The method of claim 9, wherein the SLP cancer vaccine comprises one or more synthetic long peptides encoding tumor-specific neoantigens identified from the subject's tumor.571623862901.3439994.000083PATENTATTORNEY DOCKET NO. MDA1360-1WO24. The method of claim 8, wherein the method results in enhanced tumor regression compared to administering either the cancer vaccine or the anti-TREM2 agent alone.

25. The method of claim 8, further comprising administering chemotherapy or radiation therapy.

26. A method of modulating a tumor microenvironment in a subject with cancer, comprising: administering to the subject a therapeutically effective amount of:(a) a cancer vaccine; and(b) an anti-TREM2 agent, wherein the administration results in a decrease in intratumoral immunosuppressive macrophages and an increase in intratumoral iNOS+ macrophages.

27. The method of claim 26, wherein the immunsuppressive macrophages are CX3CR1+CD206+ macrophages.

28. The method of claim 26, wherein the cancer vaccine is selected from the group consisting of an RNA vaccine, a synthetic long peptide (SLP) cancer vaccine, an oncolytic virus-based vaccine, a peptide-based vaccine, a cell-based vaccine, and combinations thereof.

27. The method of claim 26, wherein the anti-TREM2 agent is selected from the group consisting of an anti-TREM2 antibody, an anti-TREM2 peptide, an anti-TREM2 small molecule, and combinations thereof.

28. The method of claim 26, wherein the cancer vaccine targets antigens selected from neoantigens, non-mutant tumor antigens, viral antigens, defective ribosomal products, or combinations thereof.581623862901.3439994.000083

Images