Synthetic immunostimulatory nucleic acids for immunotherapy of cancer and other diseases
Synthetic immunostimulatory oligonucleotides with TLR7 and TLR9 agonists, formulated in lipid nanoparticles, address the challenge of activating immune responses in 'cold' tumors, enhancing cancer immunotherapy by inducing robust CD8+ T cell responses and cytokine production.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- ZOLA THERAPEUTICS INC
- Filing Date
- 2025-10-17
- Publication Date
- 2026-04-23
AI Technical Summary
Existing cancer immunotherapy approaches, such as checkpoint inhibitors and innate immune activators, have limited efficacy in converting 'cold' tumors into 'hot' tumors, primarily due to the lack of CD8+ T cells in these tumors, and there is a need for improved innate immune activators that can effectively induce an immune response in human patients.
Development of synthetic immunostimulatory oligonucleotides comprising TLR7 and TLR9 agonists, formulated with lipid nanoparticles, which include specific motifs and structures to enhance immune activation, specifically inducing CD8+ T cell responses in cells like plasmacytoid dendritic cells.
The synthetic oligonucleotides induce robust CD8+ T cell responses and increase cytokine production, effectively converting 'cold' tumors into 'hot' tumors and enhancing the efficacy of cancer immunotherapy.
Smart Images

Figure US2025051434_23042026_PF_FP_ABST
Abstract
Description
[0001]SYNTHETIC IMMUNOSTIMULATORY NUCLEIC ACIDS FOR IMMUNOTHERAPY OF CANCER AND OTHER DISEASES RELATED APPLICATIONS This application claims benefit under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 63 / 709,316, filed October 18, 2024, entitled “Synthetic Immunostimulatory Nucleic Acids for Immunotherapy of Cancer and Other Diseases”, the entire contents of each of which are incorporated herein by reference. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING The contents of the electronic sequence listing (Z015470002WO00-SEQ-COB.xml; Size: 334,685 bytes; and Date of Creation: October 16, 2025) are herein incorporated by reference in their entirety. BACKGROUND For many decades there have been efforts to activate the immune system against tumors for cancer immunotherapy. Much of the recent interest in such approaches has arisen from the recognition that checkpoint inhibitors are effective primarily in patients who have “hot” or inflamed tumors, where anti-tumor CD8+ T cells already are present in the tumor, but are being suppressed by checkpoint expression on tumors or tumor-associated immune cells. Unfortunately, most patients have “cold” or uninflamed tumors where CD8+ T cells are not already present in the tumor and therefore checkpoint inhibitors cannot unleash an antitumor immune response. Many approaches have been proposed to convert “cold” tumors into “hot” tumors by the intratumoral injection of innate immune activators including for example oncolytic viruses, Toll-like receptor (TLR) agonists, RIG-I-like receptor (RLR) agonists, and cyclic GMP-AMP synthase (cGAS) / stimulator of interferon genes (STING) activators. A wide variety of agonists for these receptors are well known in the art, and are known to induce type I interferon (IFN), which are believed to be the key for successful cancer immunotherapy by those expert in the art. All of these approaches have been effective in some mouse models, yet the vast majority of these approaches have failed to benefit human cancer patients (typically <5% ORR). The reason for this discrepancy has been unclear, and there is a need for improved innate immune activators. Review articles on activating innate immunity for cancer immunotherapy written by recognized experts in the field simply refer to “type I IFN” without further consideration or recognition that one may be preferred over another, or that the cellular source or receptor #14509433v1 pathway for induction matters (Mellman et al., Immunity, Volume 56, Issue 10, P2188-2205, 2023 and Cao and Kagan, Immunity, volume 56, Issue 10, P2206-2217, 2023). SUMMARY The disclosure herein is based at least in part on the development of new immunostimulatory oligonucleotides and compositions having improved activity and enhanced therapeutic utility. Provided herein, in some aspects, are methods of inducing an immune response in a cell. In some embodiments, the method comprises contacting the cell with (a) a TLR7 agonist, and (b) a TLR9 agonist. In some embodiments, the TLR7 agonist is a TLR7 / 8 agonist. In some embodiments, the TLR7 agonist and the TLR9 agonist are each independently formulated with a lipid nanoparticle (LNP) or a liposome. In some embodiments, the LNP comprises an ionizable or cationic lipid, a non- cationic lipid, a structural lipid, and a polymer conjugated lipid. In some embodiments, the lipids of the LNP comprise a molar ratio of about 20-60% cationic or ionizable lipid, about 5- 25% non-cationic lipid, about 25-55% structural lipid and about 0.5-15% polymer conjugated lipid. In some embodiments, the structural lipid is a sterol. In some embodiments, the non- cationic lipid is a phospholipid. In some embodiments, the liposome comprises DOTAP. Provided herein, in some aspects, is a synthetic oligonucleotide comprising a CpG motif and a self-complementary palindrome motif, wherein the CpG motif comprises a cytidine deoxyribonucleoside (C) linked to a guanosine deoxyribonucleoside (G) by a phosphodiester internucleoside linkage, and wherein the self-complementary palindrome motif comprises a 5′ segment of 2-15 nucleosides and a 3′ segment of 2-15 nucleosides, wherein the 5′ segment and the 3′ segment are complementary, such that the self- complementary palindrome motif is capable of forming a double-stranded segment. In some embodiments, the synthetic oligonucleotide further comprises a tetraloop sequence. In some embodiments, the tetraloop sequence is located between the 5′ segment of the self-complementary palindrome motif and the 3′ segment of the self-complementary palindrome motif. In some embodiments, the tetraloop sequence is located adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif. In some embodiments, the tetraloop sequence is directly adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif. In some embodiments, the tetraloop sequence is located adjacent the 3′ end #14509433v1 of the 3′ segment of the self-complementary palindrome motif. In some embodiments, the tetraloop sequence is directly adjacent the 3′ end of the 3′ segment of the self-complementary palindrome motif. In some embodiments, the tetraloop sequence comprises a nucleobase sequence of GNRA, ANYA, CUYG, UNAC, or UNCG, wherein N is any nucleobase, R is A or G; and Y is C, U, or T. In some embodiments, the tetraloop sequence comprises a nucleobase sequence of UUCG or GCAA. In some embodiments, the CpG motif is located between the 5′ segment of the self- complementary palindrome motif and the 3′ segment of the self-complementary palindrome motif. In some embodiments, the CpG motif is located adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif. In some embodiments, the CpG motif is directly adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif. In some embodiments, the CpG motif is located adjacent the 3′ end of the 3′ segment of the self- complementary palindrome motif. In some embodiments, the CpG motif is directly adjacent the 3′ end of the 3′ segment of the self-complementary palindrome motif. In some embodiments, the 5′ segment of the self-complementary palindrome motif is 3-8 nucleosides in length, and / or the 3′ segment of the self-complementary palindrome motif is 3-8 nucleosides in length. In some embodiments, the 5′ segment of the self-complementary palindrome motif is 4-6 nucleosides in length, and / or the 3′ segment of the self- complementary palindrome motif is 4-6 nucleosides in length. In some embodiments, the synthetic oligonucleotide comprises 8 or fewer modified internucleoside linkages. In some embodiments, the synthetic oligonucleotide comprises 6 or fewer modified internucleoside linkages. In some embodiments, the synthetic oligonucleotide comprises 5, 4, 3, 2, 1, or no modified internucleoside linkages. In some embodiments, the synthetic oligonucleotide comprises a nucleobase sequence selected from the group consisting of: GGGGUUUUUUUGUGUACGACGUCGUGGGGGGG (SEQ ID NO: 169), GGGGUCGACGUCGUGGGGGGG (SEQ ID NO: 177), GGGGACGUCGUCGUGGGGGGG (SEQ ID NO: 178), CGUGUAAACGUUAACGUGUGUUCGCACACGUUAACGUUUACACG (SEQ ID NO: 181), ACGACGUCGUUUUGUGUGUUCGCACACAAAACGACGUCGUG (SEQ ID NO: 182), ACGACGUCGUUUUGUGUGUUCGCACACAAAACGACGUCGUGGGGG (SEQ ID NO: 183), #14509433v1 UUUUUUUGUGUACGACGUCGUG (SEQ ID NO: 184), ACGACGUCGUUGUGUGUUUUUUUUG (SEQ ID NO: 185), ACGACGUCGUUUUGGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAAC ACACCUUUACGACGUCGUGGGGG (SEQ ID NO: 186), GGGGACGACGUCGUGGGGGGG (SEQ ID NO: 188), ACGACGUCGUCAACGUUG (SEQ ID NO: 189), and ACGACGUCGUUUUUCAUCGAUG (SEQ ID NO: 197), wherein each U nucleobase may optionally and independently be a T nucleobase. In some embodiments, the synthetic oligonucleotide comprises a structure selected from the group consisting of: g*g*GGUUUUUUUGUGUacgacgtcgtggg*g* g*g*g (SEQ ID NO: 169), g*g*ggtcgacgtcgtggg*g*g*g*g (SEQ ID NO: 177), g*g*ggacgtcgtcgtggg*g*g*g*g (SEQ ID NO: 178), CGUGUAAACGUUAACGUGUGUUCGCacacgttaacgtttacacg (SEQ ID NO: 181), acgacgtcgtUUUGUGUGUUCGCACACAAAacgacgtcgtg (SEQ ID NO: 182), acgacgtcgtUUUGUGUGUUCGCACACAAAacgacgtcgtggg*g*g (SEQ ID NO: 183), UUUUUUUGUGUacgacgtcgtg (SEQ ID NO: 184), acgacgtcgttGUGUGUUUUUUUU*g (SEQ ID NO: 185), acgacgtcgttttGGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACCttt acgacgtcgtggg*g*g (SEQ ID NO: 186), ggggacgacgtcgtggggggg (SEQ ID NO: 188), acgacgtcgtcaacgttg (SEQ ID NO: 189), and acgacgtcgtttttcatcgatg (SEQ ID NO: 197), wherein lower case letters represent deoxyribonucleosides, upper case letters represent ribonucleosides, ‘ppp’ represents a triphosphate, ‘*’ represents a phosphorothioate internucleoside linkage, and the absence of a ‘*’ between two letters represents a phosphodiester internucleoside linkage. Provided herein, in some aspects, is a synthetic oligonucleotide comprising a TLR7 agonist motif, a tetraloop sequence, and a self-complementary palindrome motif, wherein the self-complementary palindrome motif comprises a 5′ segment of 2-30 nucleosides and a 3′ segment of 2-30 nucleosides, wherein the 5′ segment and the 3′ segment are complementary, such that the self-complementary palindrome motif is capable of forming a double-stranded segment. In some embodiments, the tetraloop sequence is located between the 5′ segment of the self-complementary palindrome motif and the 3′ segment of the self-complementary #14509433v1 palindrome motif. In some embodiments, the tetraloop sequence is located adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif. In some embodiments, the tetraloop sequence is directly adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif. In some embodiments, the tetraloop sequence is located adjacent the 3′ end of the 3′ segment of the self-complementary palindrome motif. In some embodiments, the tetraloop sequence is directly adjacent the 3′ end of the 3′ segment of the self-complementary palindrome motif. In some embodiments, the 5′ segment of the self-complementary palindrome motif is 3-20 nucleosides in length, and / or the 3′ segment of the self-complementary palindrome motif is 3-20 nucleosides in length. In some embodiments, the 5′ segment of the self- complementary palindrome motif is 12-18 nucleosides in length, and / or the 3′ segment of the self-complementary palindrome motif is 12-18 nucleosides in length. In some embodiments, the synthetic oligonucleotide comprises 8 or fewer modified internucleoside linkages. In some embodiments, the synthetic oligonucleotide comprises 6 or fewer modified internucleoside linkages. In some embodiments, the synthetic oligonucleotide comprises 5, 4, 3, 2, 1, or no modified internucleoside linkages. In some embodiments, the synthetic oligonucleotide comprises a nucleobase sequence selected from the group consisting of: GGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC (SEQ ID NO: 164), GGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 165), GACACUAUUUUUGUGUGGUUCGCACACAAAAAUAGUGUCC (SEQ ID NO: 166), GGUGUUUUUGUGUGUUCGCACACAAAAACACC (SEQ ID NO: 167), GGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 168), GGUGUGUUUUUUUGUGUGGCAACACACAAAAAAACACACC (SEQ ID NO: 192), CCACACAAAUUUUGUGUGUUCGCACACAAAAUUUGUGUGG (SEQ ID NO: 194), and GGUUUUUGUGUGUUCGCACACAAAAACC (SEQ ID NO: 195), wherein each U nucleobase may optionally and independently be a T nucleobase. In some embodiments, the synthetic oligonucleotide comprises a structure selected from the group consisting of: pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC (SEQ ID NO: 164), #14509433v1 pppGGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 165), pppGACACUAUUUUUGUGUGGUUCGCACACAAAAAUAGUGUCC (SEQ ID NO: 166), pppGGUGUUUUUGUGUGUUCGCACACAAAAACACC (SEQ ID NO: 167), GGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 168), GGUGUGUUUUUUUGUGUGGCAACACACAAAAAAACACACC (SEQ ID NO: 192), GGΨGΨGΨΨΨΨΨΨΨGΨGΨGUUCGCACACAAAAAAACACACC (SEQ ID NO: 193), CCACACAAAUUUUGUGUGUUCGCACACAAAAUUUGUGUGG (SEQ ID NO: 194), and GGUUUUUGUGUGUUCGCACACAAAAACC (SEQ ID NO: 195), wherein each nucleoside is a ribonucleoside and each internucleoside linkage is a phosphodiester linkage, Ψ represents pseudouridine or N1-methyl-pseudouridine, ‘ppp’ represents a triphosphate. Provided herein, in some aspects, is a synthetic oligonucleotide comprising a nucleobase sequence selected from the group consisting of: GGGGGUGUGUUUUUUGGGGG (SEQ ID NO: 161), GGGGGUUUUUUUUUUGGGGG (SEQ ID NO: 163), GGGGGUCUUCUUCUUGGGGG (SEQ ID NO: 170), GGGGGCCACGCACCAGGGGG (SEQ ID NO: 171), GGGGGUUUUUGGGGG (SEQ ID NO: 172), GGGGGCUCUCUCUCUGGGGG (SEQ ID NO: 173), GGGGGAUAUAUAUAUGGGGG (SEQ ID NO: 174), GGGGGGUGUGUGUGUGGGGG (SEQ ID NO: 175), GGGGGUIUUIUUIUUGGGGG (SEQ ID NO: 176), GGUGUGUUUUUUUGUGUGUUCGCACACUUGUUGUUUCACC (SEQ ID NO: 180), GGUGUGUUUUUUUGUGUG (SEQ ID NO: 190), and CACACAAAAAAACACACC (SEQ ID NO: 191), wherein each U nucleobase may optionally and independently be a T nucleobase. In some embodiments, the synthetic oligonucleotide comprises a structure selected from the group consisting of: #14509433v1 g*gGGGUGUGUUUUUUGGg*g*g (SEQ ID NO: 161), ggGGGUUUUUUUUUUGGGgg (SEQ ID NO: 162), GGGGGUUUUUUUUUUGGGGG (SEQ ID NO: 163), GGGGGUCUUCUUCUUGGGGG (SEQ ID NO: 170), GGGGGCCACGCACCAGGGGG (SEQ ID NO: 171), GGGGGUUUUUGGGGG (SEQ ID NO: 172), GGGGGCUCUCUCUCUGGGGG (SEQ ID NO: 173), GGGGGAUAUAUAUAUGGGGG (SEQ ID NO: 174), GGGGGGUGUGUGUGUGGGGG (SEQ ID NO: 175), GGGGGUIUUIUUIUUGGGGG (SEQ ID NO: 176), GGUGUGUUUUUUUGUGUGUUCGCACACUUGUUGUUUCACC (SEQ ID NO: 180), GGUGUGUUUUUUUGUGUG (SEQ ID NO: 190), and CACACAAAAAAACACACC (SEQ ID NO: 191), wherein lower-case letters represent deoxyribonucleosides, upper case letters represent ribonucleosides, Ψ represents pseudouridine or N1-methyl-pseudouridine, ‘ppp’ represents a triphosphate, ‘*’ represents a phosphorothioate internucleoside linkage, and the absence of a ‘*’ between two letters represents a phosphodiester internucleoside linkage. Provided herein, in some aspects, is a synthetic oligonucleotide comprising a structure selected from the group consisting of: g*g*GGUUUUUUUGUGUacgacgtcgtggg*g* g*g*g (SEQ ID NO: 169), g*g*ggtcgacgtcgtggg*g*g*g*g (SEQ ID NO: 177), g*g*ggacgtcgtcgtggg*g*g*g*g (SEQ ID NO: 178), CGUGUAAACGUUAACGUGUGUUCGCacacgttaacgtttacacg (SEQ ID NO: 181), acgacgtcgtUUUGUGUGUUCGCACACAAAacgacgtcgtg (SEQ ID NO: 182), acgacgtcgtUUUGUGUGUUCGCACACAAAacgacgtcgtggg*g*g (SEQ ID NO: 183), UUUUUUUGUGUacgacgtcgtg (SEQ ID NO: 184), acgacgtcgttGUGUGUUUUUUUU*g (SEQ ID NO: 185), acgacgtcgttttGGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACCttt acgacgtcgtggg*g*g (SEQ ID NO: 186), ggggacgacgtcgtggggggg (SEQ ID NO: 188), acgacgtcgtcaacgttg (SEQ ID NO: 189), acgacgtcgtttttcatcgatg (SEQ ID NO: 197), g*gGGGUGUGUUUUUUGGg*g*g (SEQ ID NO: 161), ggGGGUUUUUUUUUUGGGgg (SEQ ID NO: 162), #14509433v1 GGGGGUUUUUUUUUUGGGGG (SEQ ID NO: 163), pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC (SEQ ID NO: 164), pppGGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 165), pppGACACUAUUUUUGUGUGGUUCGCACACAAAAAUAGUGUCC (SEQ ID NO: 166), pppGGUGUUUUUGUGUGUUCGCACACAAAAACACC (SEQ ID NO: 167), GGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 168), GGGGGUCUUCUUCUUGGGGG (SEQ ID NO: 170), GGGGGCCACGCACCAGGGGG (SEQ ID NO: 171), GGGGGUUUUUGGGGG (SEQ ID NO: 172), GGGGGCUCUCUCUCUGGGGG (SEQ ID NO: 173), GGGGGAUAUAUAUAUGGGGG (SEQ ID NO: 174), GGGGGGUGUGUGUGUGGGGG (SEQ ID NO: 175), GGGGGUIUUIUUIUUGGGGG (SEQ ID NO: 176), GGUGUGUUUUUUUGUGUGUUCGCACACUUGUUGUUUCACC (SEQ ID NO: 180), GGUGUGUUUUUUUGUGUG (SEQ ID NO: 190), CACACAAAAAAACACACC (SEQ ID NO: 191), GGUGUGUUUUUUUGUGUGGCAACACACAAAAAAACACACC (SEQ ID NO: 192), GGΨGΨGΨΨΨΨΨΨΨGΨGΨGUUCGCACACAAAAAAACACACC (SEQ ID NO: 193), CCACACAAAUUUUGUGUGUUCGCACACAAAAUUUGUGUGG (SEQ ID NO: 194), and GGUUUUUGUGUGUUCGCACACAAAAACC (SEQ ID NO: 195), wherein lower case letters represent deoxyribonucleosides, upper case letters represent ribonucleosides, Ψ = pseudouridine or N1-methyl-pseudouridine, ‘ppp’ represents a triphosphate, ‘*’ represents a phosphorothioate internucleoside linkage, and the absence of a ‘*’ between two letters represents a phosphodiester internucleoside linkage. In some embodiments, the disclosure provides a composition comprising a synthetic oligonucleotide provided herein and a delivery vehicle. In some embodiments, the composition comprises a first population comprising a plurality of a first oligonucleotide and a second population comprising a plurality of a second #14509433v1 oligonucleotide, wherein the first oligonucleotide and the second oligonucleotides are each a distinct synthetic oligonucleotide provided herein. In some embodiments, the first population and the second population are each independently formulated in a delivery vehicle. In some embodiments, the delivery vehicle comprises a liposome. In some embodiments, the delivery vehicle comprises a lipid nanoparticle (LNP). In some embodiments, the LNP comprises an ionizable or cationic lipid, a non- cationic lipid, a structural lipid, and a polymer conjugated lipid. In some embodiments, the lipids of the LNP comprise a molar ratio of about 20-60% cationic or ionizable lipid, about 5- 25% non-cationic lipid, about 25-55% structural lipid and about 0.5-15% polymer conjugated lipid. In some embodiments, the structural lipid is a sterol. In some embodiments, the non- cationic lipid is a phospholipid. According to some aspects, the disclosure provides a method of vaccinating a subject in need thereof, the method comprising administering a vaccine to the subject and administering a synthetic oligonucleotide or composition provided herein to the subject. In some embodiments, the vaccine is an infectious disease vaccine. In some embodiments, the vaccine is a cancer vaccine. In some embodiments, administering of the synthetic oligonucleotide or composition to the subject increases an immune response in the subject to the vaccine. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows the induction of IFN-α in normal human PBMC activated with examples of compounds of the disclosure compared to positive and negative controls. FIGs. 2A-2C show induction of cytokines (IFN-α, FIG. 2A; IL-6, FIG. 2B; TNF-α, FIG. 2C) in normal human PBMC following treatment with examples of compounds of the disclosure compared to controls. FIGs. 3A-3D show induction of IFN-α (FIGs. 3A and 3C) and TNF-α (FIGs. 3B and 3D) in normal human PBMC following treatment with examples of compounds of the disclosure compared to controls. FIGs. 4A-4M relate to induction of cytokines (IFN-α, FIG. 4A, summarized in FIG. 4J; IFN-β, FIG. 4B; IFN-γ, FIG. 4C; IL-1β, FIG. 4D and summarized in FIG. 4L; IL-10, FIG. 4E and summarized in FIG. 4K; IL-1RA, FIG. 4F; IL-8, FIG. 4G; IP-10, FIG. 4H; and TNF-α, FIG. 4I and summarized in FIG. 4M) by appendiceal tumor-associated cells from ascites fluid by LNP-delivered TLR7 / 8and TLR9 agonists. #14509433v1 FIG. 5 shows clustering of transcriptional data from human tumor-associated cells treated with TLR agonists. FIGs. 6A-6B relate to unique and shared differentially expressed genes induced by treatment with TLR agonists ZT045, ZT057, and ZT065. FIG. 6A shows the number of genes with increased expression following treatment with ZT045 (top left), ZT057 (top right), or ZT065 (bottom), relative to PBS-treated cells. FIG. 6B shows the number of genes with decreased expression following treatment with ZT045 (top left), ZT057 (top right), or ZT065 (bottom), relative to PBS-treated cells. FIGs. 7A-7C relate to induction of “M1” macrophage signatures in cells following treatment with PBS, R848, ZT045, ZT057, or ZT065, based on immune cell gene signatures and methods from CIBERSORT (FIG. 7A), QUANTIQSEQ (FIG. 7B), and xCELL (FIG. 7C). FIGs. 8A-8I relate to induction of immune response genes (CD80, FIG. 8A; CD68, FIG. 8B; CXCL10, FIG.8C; IFN-g, FIG. 8D; PRF1, FIG. 8E; GZMB, FIG. 8F; GNLY, FIG. 8G; CD274, FIG. 8H; and LAG3, FIG. 8I) in cells following treatment with PBS, R848, ZT045, ZT057, or ZT065. FIGs. 9A-9D relate to gene signatures (Akkari immunosuppressive MDSC signature, FIG. 9A; Ayers IFN-g signatures, FIG. 9B, expanded in FIG. 9C; Liu GOBP_COPII signature, FIG. 9D) across treatments. FIG. 10A-10M relate to induction of IFN-a / IFN-b genes (IFNA1, FIG. 10A; IFNA2, FIG. 10B; IFNA4, FIG. 10C; IFNA5, FIG. 10D; IFNA6, FIG. 10E; IFNA7, FIG. 10F; IFNA8, FIG. 10G; IFNA10, FIG. 10H; IFNA13, FIG. 10I; IFNA14, FIG. 10J; IFNA16, FIG. 10K; IFNA17, FIG. 10L; and IFNB1, FIG. 10M) by TLR agonists. FIGs. 11A-11D relate to inflammation related gene expression induced by TLR agonists. FIG. 11A shows IL1B; FIG. 11B shows IL10; FIG. 11C shows IL6; FIG. 11D shows TNF). FIGs. 12A-12D relate to differentially expressed genes in cells treated by TLR agonists (R848, FIG. 12A; ZT045, FIG. 12B; ZT057, FIG. 12C; ZT065, FIG. 12D) compared to those treated with vehicle control (PBS). FIGs. 13A-13C relate to comparison of differentially expressed genes in cells treated with various TLR agonists. FIG. 13A shows ZT045 v. ZT057. FIG. 13B shows ZT045 v. ZT065. FIG. 13C shows ZT057 v. ZT065. FIGs. 14A-14C relate to comparison of differentially expressed genes in cells treated with ZT TLR agonists compared to R848 treatment. FIG. 14A shows ZT045 v. R848. FIG. 14B shows ZT057 v. R848. FIG. 14C shows ZT065 v. R848. #14509433v1 DETAILED DESCRIPTION It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. In some aspects, the current disclosure provides new synthetic oligonucleotides or compositions that can induce the immune system to generate a strong and robust CD8+ T cell response, and therapeutic methods to direct this response against a tumor, viral- or other infected cell, or other abnormal host cell in a subject. The synthetic oligonucleotides of the present disclosure are useful in the treatment of diseases (e.g., cancer, viruses, other infections, etc.) and / or as adjuvants to increase the efficacy of vaccines against diseases. The synthetic oligonucleotides or compositions disclosed herein induce human peripheral blood mononuclear cells (PBMC) or plasmacytoid dendritic cells (pDC) to produce greater amounts of IFN-α than the gold standard CpG-A TLR9 agonists that currently are the strongest inducers of IFN-α secretion that have been published. For the purpose of the disclosure, the synthetic oligonucleotides or compositions are administered to the subject in a delivery vehicle or formulation, such as a lipid delivery vehicle (e.g., lipid nanoparticle (LNP) or liposome) such that the synthetic oligonucleotide or composition is taken up by immune cells, including specifically pDC. In some embodiments these pDC or other immune cells have also taken up tumor or pathogen antigens, such as tumor neoantigens, such that they then present these to CD8+ T cells in a stimulatory manner, inducing a systemic antigen-specific response. In some embodiments, the synthetic oligonucleotides or compositions disclosed herein comprise at least 2 of the following modules or motifs, and in some embodiments all 3: 1. A TLR9 agonist, optionally the palindrome from a CpG-A DNA 2. A TLR7 agonist, optionally a U-rich and / or GU-rich RNA 3. An aggregation motif, optionally one or more terminal polyG motifs able to form G-quadruplexes (may be DNA or RNA) In some embodiments, all 3 motifs are combined within a single oligonucleotide as a DNA / RNA hybrid, with the following general formula (from the 5’ end): #14509433v1 In some embodiments, the aggregation motif is on the 5’ but not the 3’ end of the DNA / RNA hybrid. In some embodiments, the aggregation motif is on the 3’ but not the 5’ end of the DNA / RNA hybrid. In some forms the TLR9 agonist and TLR7 agonist are on separate ODN and ORN that are mixed and delivered within a single delivery vehicle. In some forms the TLR9 agonist and TLR7 agonist are on separate ODN and ORN that are delivered in separate delivery vehicles delivered at the same time, or nearly the same time. In some forms the TLR9 agonist and TLR7 agonist are on separate ODN and ORN that are delivered in separate delivery vehicles at different points in time, which may be 1-4 or more weeks apart. In some embodiments the GU-rich RNA TLR7 agonist is also an agonist for TLR8. In some embodiments, a synthetic oligonucleotide disclosed herein is a TLR9 agonist with one or more of the following features: i) Primarily or fully phosphodiester (PO) backbone; wherein up to 4 (e.g., 0, 1, 2, 3, or 4) internucleoside linkages at the 5' end of the oligonucleotide, the 3' end of the oligonucleotide, or both the 5' end and the 3' end of the oligonucleotide are optionally non-PO internucleoside linkages (e.g., phosphorothioate internucleoside linkages). If non-PO internucleoside linkages are present at both the 5' end and the 3' end of the oligonucleotide, the number of such non-PO linkages may be the same on both ends (i.e., both the 5' end and the 3' end have the same number of non-PO linkages) or may be different. Preferably, each CpG motif within the oligonucleotide contains a PO internucleoside linkage. ii) A palindrome of at least 8 nucleobases in length, optionally 10-12 nucleobases in length. #14509433v1 In some embodiments, a synthetic oligonucleotide disclosed herein is a TLR7 agonist or a TLR7 / 8 agonist comprising a TLR7 agonist motif (as described herein) and a tetraloop hairpin. Oligonucleotides In some embodiments a synthetic oligonucleotide disclosed herein acts as an agonist of TLR7, TLR8, or both TLR7 and TLR8. Some agonists of TLR7, TLR8, or both TLR7 and TLR8 in combination, are known in the art, and include synthetic oligoribonucleotides (ORN) with phosphorothioate (PS) backbones and small molecule agonists including for example imiquimod (Aldara®) and R-848. The most widely used agonists for TLR7 and TLR8 in clinical development have been small molecule agonists, which can selectively activate TLR7, or TLR8, or both TLR7 and TLR8 (reviewed in Bhagchandani et al., Advanced Drug Delivery Reviews, 2021). For example, the TLR7 / 8 small molecule agonist imiquimod is approved for topical treatment of genital warts and skin cancers, and many similar molecules have been taken into clinical development. Synthetic oligoribonucleotide (ORN) agonists with modified nuclease-resistant phosphorothioate (PS) backbones that activate TLR7, and / or TLR8 also are known in the art, and can induce comparable levels of IFN-α production to the reference standard TLR7 / 8 agonist, R-848, or CpG-C DNA (also referred to as C-Class, or CpG 2395 or 10103). ORN agonists for TLR7 or TLR8 generally have PS backbones in order to increase nuclease resistance and are fully comprised of ribonucleotides. Provided herein are synthetic oligonucleotides comprising one or more aggregation motifs, and (i) one or more TLR7 agonist motifs, (ii) one or more TLR9 agonist motifs, or (iii) both one or more TLR7 agonist motifs and one or more TLR9 agonist motifs. In some embodiments the one or more TLR7 agonist motifs are comprised of ribonucleotides. In some embodiments, the one or more aggregation motifs are, independently of one another, comprised of ribonucleotides, deoxyribonucleotides, or mixtures thereof. In some embodiments, the one or more TLR9 agonist motifs are, independently of one another, comprised of ribonucleotides, deoxyribonucleotides, or mixtures thereof. A unique aspect of the synthetic oligonucleotides disclosed herein is that they comprise at least one deoxyribonucleotide and at least one ribonucleotide. Synthetic oligonucleotides of the present disclosure in some embodiments comprise a general sequence architecture of Ai-Bj-Ckor Ai-Bj-Dm-Ck, wherein A and C comprise aggregation motifs and i and k are each independently an integer of 0, 1, 2, 3, 4, or 5; wherein B and D each independently comprise a TLR7 agonist motif or a TLR9 agonist motif and j and m are each independently an integer of 0, 1, 2, 3, 4, or 5 and at least one of j and m is not #14509433v1 0. In some embodiments, at least one of i and k is not 0. For example, in some embodiments, a synthetic oligonucleotide of the present disclosure comprises a general sequence architecture of Ai-Bj, Ai-Dm, Bj-Ck, Dm-Ck, Ai-Bj-Dm, or Bj-Dm-Ck. In some embodiments, a synthetic oligonucleotide of the present disclosure comprises a general sequence architecture of A1-B1-C1 or A1-B1-D1-C1, wherein A and C comprise aggregation motifs and B and D each independently comprise a TLR7 agonist motif or a TLR9 agonist motif. In some embodiments, a synthetic oligonucleotide of the present disclosure comprises a general sequence architecture of Bj-Ai-Ck, Ai-Ck-Bj, Bj-Dm-Ai-Ck, Ai-Ck-Bj-Dm, Bj-Ai-Dm- Ck, Bj-Ai-Ck-Dm, or Ai-Bj-Ck-Dm, wherein A and C comprise aggregation motifs and i and k are each independently an integer of 0, 1, 2, 3, 4, or 5 and at least one of i and k is not 0; wherein B and D each independently comprise a TLR7 agonist motif or a TLR9 agonist motif and j and m are each independently an integer of 0, 1, 2, 3, 4, or 5 and at least one of j and m is not 0. For example, in some embodiments, a synthetic oligonucleotide of the present disclosure comprises a general sequence architecture of Bj-Ai-Dm. In some embodiments, both i and k are 0 (i.e., A and C are absent). For example, in some embodiments, a synthetic oligonucleotide of the present disclosure comprises a general sequence architecture of Bj-Dm. In such embodiments, Bj comprises at least one TLR7 agonist motif, and Dm comprises at least one TLR9 agonist motif; or Bj comprises at least one TLR9 agonist motif, and Dmcomprises at least one TLR7 agonist motif. For example, if j and m are each 1, if B is a TLR7 agonist motif, then D is a TLR9 agonist motif, and if B is a TLR9 agonist motif, then D is a TLR7 agonist motif. In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (e.g., RNA or DNA oligonucleotides) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage. In some embodiments, an oligonucleotide disclosed herein is a synthetic oligonucleotide. As disclosed herein, a “synthetic oligonucleotide” refers to a non-naturally occurring oligonucleotide. A synthetic oligonucleotide, in some embodiments, refers to a synthetic DNA or synthetic RNA. In some embodiments, a synthetic oligonucleotide is produced through an in vitro transcription or a polymerization reaction (e.g., artificial (non- natural) chemical synthesis, solid phase nucleic acid synthesis, or another method known by one of ordinary skill in the art). In some embodiments, a synthetic oligonucleotide includes a #14509433v1 modification at one or both ends of the nucleic acid sequence in the synthetic oligonucleotide. In some embodiments, the synthetic oligonucleotide is produced by nucleic acid synthesis (e.g., in vitro), chemical nucleic acid synthesis, and / or solid phase nucleic acid synthesis, or produced through other methods well known in the art. In some embodiments, one or more nucleosides of the oligonucleotide include a modification. In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleosides (e.g., nucleobases) in length, or any range or combination thereof. In some embodiments, the nucleic acid sequence of a synthetic oligonucleotide disclosed herein is 10 to 30, 10 to 35, 10 to 40, 10 to 45, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100 or more than 100 nucleosides (e.g., nucleobases) in length. In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein is 10 to 30 nucleosides (e.g., nucleobases) in length. In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein is 15 to 22 nucleosides (e.g., nucleobases) in length. In some embodiments, the oligonucleotide (e.g., synthetic oligonucleotide) is 20 nucleosides (e.g., nucleobases) in length. In some embodiments, the oligonucleotide (e.g., synthetic oligonucleotide) is 17 nucleosides (e.g., nucleobases) in length. As used herein, in the context of oligonucleotides, the terms “base” and “nucleobase” are used interchangeably. In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides, e.g., synthetic oligonucleotides) disclosed herein are further described by their nucleobase sequence. In some embodiments, the oligonucleotide (e.g., synthetic oligonucleotide) is single-stranded. Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for beta-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl #14509433v1 sugar moieties and at least one particular phosphorothioate internucleoside linkage in a particular stereochemical configuration. In certain embodiments, oligonucleotides disclosed herein comprise a tetraloop motif. A tetraloop motif is a structural element found in a nucleic acid molecule (e.g., an RNA molecule) which contains 4 nucleobases that form a small loop, often stabilizing the overall three-dimensional structure of the nucleic acid molecule. Tetraloop motifs generally contain a GNRA, ANYA, CUYG, UNAC, or UNCG sequence, in which N is any nucleobase, R is A or G; and Y is C, U, or T. In some embodiments, a tetraloop of an oligonucleotide disclosed herein is located in the middle of the oligonucleotide (i.e., not including the 5’-most or 3’- most nucleobase of the oligonucleotide). In some embodiments, a tetraloop of an oligonucleotide disclosed herein is not present at the 5’-most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleobases of the oligonucleotide. In some embodiments, a tetraloop of an oligonucleotide disclosed herein is not present at the 3’-most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleobases of the oligonucleotide. By way of example and not limitation, a tetraloop of an oligonucleotide disclosed herein may be located at positions 2-5, 3-6, 4-7, 5-8, 6-9, 7-10, or 8-11 of the oligonucleotide, if the oligonucleotide is at least 12 nucleobases in length. TLR7 agonists As used herein, a “TLR7 agonist” or “TLR7 agonist motif” is a nucleic acid sequence that interacts with and activates TLR7. In some embodiments, the TLR7 agonist motif is a nucleic acid sequence that comprises a native backbone U-rich and / or GU-rich RNA sequence with a length of at least 3 bases, more preferably at least 6 bases, and most preferably 8 or more bases comprising one or more repeats of the trinucleotide NUN, where N is preferably a pyrimidine, and most preferably a uridine. In some forms the TLR7 agonist may be more than 10, more than 20, or more than 50 bases in length. Without wishing to be bound by theory, there is no fixed upper limit since these may be degraded inside cells to the shorter oligoribonucleotides that bind and activate TLR7, but for practical purposes shorter RNA motifs of 20 or fewer bases are generally preferred. Certain preferred embodiments further comprise one or more UA or most preferably UG dinucleotides which may activate TLR8, which is believed to contribute to the therapeutic effect in some patients. In some embodiments, TLR7 agonists are specific for TLR7. In some embodiments, TLR7 agonists activate both TLR7 and TLR8. In certain forms oligonucleotides disclosed herein avoid RNA sequences known in the art or discovered to activate TLR8. TLR8 activation may increase the risk of toxicity due to the broader set of myeloid and other immune cells expressing TLR8 compared to TLR7, #14509433v1 leading to the release of higher levels of proinflammatory cytokines. Therefore TLR8 preferentially may be activated in patients in whom activation of TLR7 and / or TLR9 alone is not sufficient to induce tumor regression. During clinical development of oligonucleotides disclosed herein comprising TLR7 / 9 agonists , it is anticipated that biomarkers will be discovered to predict from baseline biopsies which patients will require treatment with a TLR8 agonist in addition to a TLR7 agonist and / or a TLR9 agonist using standard methods for biomarker development known in the art. Certain preferred GU-rich RNA TLR7 agonists comprise UUU, UGU, GUG, UUG, or GUU trinucleotides, which may be repeated in any combination and may be interspersed with other nucleotides. For example, GU-rich RNA TLR7 agonists may comprise a sequence of UUUUGUGUGUUGGUU (SEQ ID NO: 7), UUUUGUGUGGUUUUG (SEQ ID NO: 8), UUUUGUUUGGUGGUU (SEQ ID NO: 9), UUUUGUUUGGUUGUG (SEQ ID NO: 10), UUUGUGUGUUUGGUU (SEQ ID NO: 11), UUUGUGUGUGUUUUG (SEQ ID NO: 12), UUUGUGUUGUGUGUU (SEQ ID NO: 13), UUUGUGUUGGUUUGU (SEQ ID NO: 14), UUUUUGUGUGUGGUU (SEQ ID NO: 15), UUUUUGUGUGUUGUG (SEQ ID NO: 16), UUUUUGGUGUGUGUU (SEQ ID NO: 17), UUUUUGGUGGUUUGU (SEQ ID NO: 18), UGUUUUGUGUUGGUU (SEQ ID NO: 19), UGUUUUGUGGUUUUG (SEQ ID NO: 20), UGUUUUUUGGUGGUU (SEQ ID NO: 21), UGUUUUUUGGUUGUG (SEQ ID NO: 22), UGUGUGUUUUUGGUU (SEQ ID NO: 23), UGUGUGUUUGUUUUG (SEQ ID NO: 24), UGUGUGUUGUUUGUU (SEQ ID NO: 25), UGUGUGUUGGUUUUU (SEQ ID NO: 26), UGUUUGUUUGUGGUU (SEQ ID NO: 27), UGUUUGUUUGUUGUG (SEQ ID NO: 28), UGUUUGGUGUUUGUU (SEQ ID NO: 29), UGUUUGGUGGUUUUU (SEQ ID NO: 30), GUGUUUUGUUUGGUU (SEQ ID NO: 31), GUGUUUUGUGUUUUG (SEQ ID NO: 32), GUGUUUUUGUGUGUU (SEQ ID NO: 33), GUGUUUUUGGUUUGU (SEQ ID NO: 34), GUGUGUUUUUUGGUU (SEQ ID NO: 35), GUGUGUUUUGUUUUG (SEQ ID NO: 36), GUGUGUUUGUUUGUU (SEQ ID NO: 37), GUGUGUUUGGUUUUU (SEQ ID NO: 38), GUGUUGUUUUGUGUU (SEQ ID NO: 39), GUGUUGUUUGUUUGU (SEQ ID NO: 40), GUGUUGUGUUUUGUU (SEQ ID NO: 41), GUGUUGUGUGUUUUU (SEQ ID NO: 42), with or without additional nucleotides interspersed throughout the sequence. Other preferred embodiments comprise one or more of these trinucleotides with an “A” added on the 5’ end of the trinucleotide. For example, a GU-rich RNA TLR7 agonist may comprise a sequence of 5’-X-AUUU-X1-3’, 5’-X-AUGU-X1-3’, 5’-X-AGUG-X1-3’, 5’-X-AUUG-X1-3’, 5’-X- AGUU-X1-3’, wherein X and X1comprise other nucleotides of the TLR7 agonist, and X or X1may independently be present or absent in the TLR7 agonist. Other preferred embodiments comprise one or more of these trinucleotides with an “A” added on the 3’ end #14509433v1 of the trinucleotide. For example, a GU-rich RNA TLR7 agonist may comprise a sequence of 5’-X-UUUA-X1-3’, 5’-X-UGUA-X1-3’, 5’-X-GUGA-X1-3’, 5’-X-UUGA-X1-3’, 5’-X- GUUA-X1-3’, wherein X and X1comprise other nucleotides of the TLR7 agonist, and X or X1may independently be present or absent in the TLR7 agonist. Other preferred embodiments comprise one or more of these trinucleotides with a “C” added on the 5’ end of the trinucleotide. For example, a GU-rich RNA TLR7 agonist may comprise a sequence of 5’-X-CUUU-X1-3’, 5’-X-CUGU-X1-3’, 5’-X-CGUG-X1-3’, 5’-X-CUUG-X1-3’, 5’-X- CGUU-X1-3’, wherein X and X1comprise other nucleotides of the TLR7 agonist, and X or X1may independently be present or absent in the TLR7 agonist. Other preferred embodiments comprise one or more of these trinucleotides with a “C” added on the 3’ end of the trinucleotide. For example, a GU-rich RNA TLR7 agonist may comprise a sequence of 5’-X-UUUC-X1-3’, 5’-X-UGUC-X1-3’, 5’-X-GUGC-X1-3’, 5’-X-UUGC-X1-3’, 5’-X- GUUC-X1-3’, wherein X and X1comprise other nucleotides of the TLR7 agonist, and X or X1may independently be present or absent in the TLR7 agonist. These motifs may be repeated any number of times, and may be interspersed with other bases. For clarity, it should be understood that X and X1in any of the TLR7 agonists disclosed herein may comprise additional trinucleotides (including repeated trinucleotides, such as the GU-rich trinucleotides described above) and / or other sequence motifs. In contrast to the PS backbone ORN known in the art as TLR7 or TLR8 agonists, the ORN of the oligonucleotides disclosed herein preferably comprise the native PO backbone which is believed to allow RNase digestion to generate short nucleotides to bind and activate TLR7 and / or TLR8. Preferred TLR7 agonists specifically exclude small molecule agonists generally considered in the art to be the gold standard for activating this receptor. In some forms the TLR7 agonist domain is designed to be self-complementary, e.g., containing a palindrome, in order to form duplex or hairpin structures. Self-complementary sequences may be inverted or direct repeats, and may be designed to form concatemers (e.g., using 2 different palindromes). Table 1. Examples of TLR7 agonists UUCG sequences in boxes represent a tetraloop. Lowercase = DNA; uppercase = RNA; * = phosphorothioate internucleoside linkage; underlining indicates a self-complementary palindrome; ppp represents a triphosphate. #14509433v1 In some preferred embodiments, a synthetic oligonucleotide comprises a nucleobase sequence of GGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 168), wherein each U may optionally and independently be a T. In some preferred embodiments, a synthetic oligonucleotide comprises a structure of GGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 168), wherein each nucleoside is a ribonucleoside, and each internucleoside linkage is a phosphodiester linkage. In the both the preceding sequence and structure comprising SEQ ID NO: 168, the UUCG is a tetraloop sequence, and the portion before (towards the 5′ end of the oligonucleotide) UUCG and the portion after (towards the 3′ end of the oligonucleotide) UUCG form a palindrome. TLR9 agonists In some embodiments the synthetic oligonucleotides comprise agonists of TLR9. TLR9 agonists typically comprise a cytosine followed by a guanine, with a phosphate group connecting the cytosine and the guanine (a CpG motif). In some embodiments, a TLR9 agonist comprises at least one unmethylated CpG motif. Many forms of TLR9 agonists are known in the art, such as CpG oligodeoxynucleotides (ODN). Three major types of CpG ODN known in the art include CpG-A, CpG-B, and CpG-C, which have distinct structures and immune effects (see Table 2 below). Two CpG-B ODN have been approved by the FDA as adjuvants for two human vaccines: CpG 1018 in Heplisav-B® and CpG 7909 in Cyfendus®. A recent review lists 11 CpG oligodeoxynucleotides (ODN) that have been in development including for the treatment of cancer (Karpetyan et al., Oncotargets 2020). #14509433v1 Most TLR9 agonists in clinical development have used the nuclease-resistant PS backbone (CpG-B, CpG-C; also referred to as B-Class and C-Class). At least three phase 3 clinical trials of CpG ODN in cancer immunotherapy have failed (two for PF3512676, and 1 for tilsotolimod), leading to deep skepticism among many experts for the future potential of this class of therapeutic. A native backbone CpG-A (or A-Class) DNA TLR9 agonist packaged inside a virus-like particle (VLP), vidutolimod, also is in clinical development (table below). Of the 3 forms of CpG DNA, the CpG-A is known to induce by far the highest production of IFN-α production (Ribas et al., Cancer Discovery, 2021), but the poor stability of the native DNA backbone and the complex structure of these molecules has greatly limited their development – no other CpG-A DNAs have been reported in human clinical development. Table 2. Examples of CpG Oligodeoxynucleotides Thus, provided herein are synthetic oligonucleotides having unique structures capable of activating TLR9. In some embodiments, the synthetic oligonucleotides have a TLR9 agonist motif and a polyG motif. A unique aspect of the structure relates to the combination of deoxyribonucleotides and ribonucleotides in the same oligonucleotide. In some embodiments, the TLR9 agonist motif is comprised of deoxyribonucleotides and the polyG motif is comprised of ribonucleotides. In some aspects, a composition is provided. The composition includes a synthetic oligonucleotide comprising a TLR9 agonist motif and a polyG motif, and a lipid nanoparticle (LNP). As used herein, a “TLR9 agonist” is a nucleic acid sequence that interacts with and activates TLR9. In some embodiments, the TLR9 agonist motif is a nucleic acid sequence #14509433v1 that comprises a native backbone DNA palindrome containing at least 1 unmethylated CpG motif in which the CpG is preceded by an A or a T and followed by an A or a T, such as the GACGATCGTC (SEQ ID NO: 46) in G10, above. A palindrome is a DNA sequence that is a mirror of itself such that 2 copies will bind together by the rules of Watson-Crick-Franklin hybridization to form a duplex. TLR9 agonist DNA palindromes of the present disclosure are believed to facilitate the formation of a duplex for better function. Exemplary TLR9 agonists, for instance, contain a palindrome comprising any of: ACGT, TCGA, AACGTT, TTCGAA, CACGTG, GACGTC, CGTACG, CGATCG, ACGATCGT, TCGTACGA, CGTTAACG, CGAATTCG, TTTCGAAA, AAACGTTT, GACGATCGTC (SEQ ID NO: 46), GTCGTACGAC (SEQ ID NO: 47), TCGTCGACGA (SEQ ID NO: 48), ACGACGTCGT (SEQ ID NO: 49), ACGTCGACGT (SEQ ID NO: 50), TCGACGTACGTCGA (SEQ ID NO: 51), GACGAGCTCGTC (SEQ ID NO: 52), TCGACGTCGACGTCGA (SEQ ID NO: 53). Such palindromes are contained within CpG-A ODN known in the art. Additional examples of CpG-A, CpG-B, and CpG-C ODN known in the art that comprise palindromes are shown in Table 3. Table 3. Additional CpG ODN examples. Preferred palindromes may contain one or more CpG dinucleotides in which the CpG is preceded by a C or a G, and / or followed by a C or a G, as long as a plurality of the CpG motifs in the palindrome are preceded and followed by an A or a T. Preferred palindromes may contain one or more phosphorothioate or other modifications, as long as at least one of the CpG dinucleotides is linked by a native phosphodiester linkage. More than one preferred palindrome may be included in preferred oligonucleotides. The length of each preferred palindrome is a minimum of 4 bases long up to 100 bases in length. Especially preferred palindromes are 8-20 bases and most preferred 10-12 bases in length, in accordance with the rules defined in the preceding sentences. In some embodiments, a palindrome may comprise #14509433v1 3-10 nucleotides complementary to another 3-10 nucleotides. In some embodiments, a palindrome comprises a sequence Xm:Yn, wherein X and Y comprise m and n linked nucleosides, respectively, wherein Xmand Ynare at least 60% complementary to one another over the length of the shorter of Xm and Yn (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or fully complementary to one another, or any range of complementarity therein), wherein m and n are independently integers representing the number of nucleosides of X and Y, respectively. In some embodiments, m and n are each independently 3-10. In some embodiments, m=n. In some embodiments, n=m+ / -i, where i =1, 2, 3, 4, 5, 6, or 7. For example, if m = 10, n = 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, or 17. In some embodiments, m=n+ / -i, where i =1, 2, 3, 4, 5, 6, or 7. For example, if n = 10, m = 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, or 17. In some embodiments, a palindrome comprises a sequence of XXX:YYY, where X and Y comprise bases that are complementary to each other. In some embodiments, a palindrome comprises a sequence of XXXX:YYYY, where X and Y comprises bases that are complementary to each other. In some embodiments, a palindrome comprises a sequence of XXXXX:YYYYY, where X and Y comprises bases that are complementary to each other. In some embodiments, a palindrome comprises a sequence of XXXXXX:YYYYYY, where X and Y comprises bases that are complementary to each other. In some embodiments, a palindrome comprises a sequence of XXXXXXX:YYYYYYY, where X and Y comprises bases that are complementary to each other. In some embodiments, a palindrome comprises a sequence of XXXXXXXX:YYYYYYYY, where X and Y comprises bases that are complementary to each other. In some embodiments, a palindrome comprises a sequence of XXXXXXXXX:YYYYYYYYY, where X and Y comprises bases that are complementary to each other. In some embodiments, a palindrome comprises a sequence of XXXXXXXXXX:YYYYYYYYYY, where X and Y comprises bases that are complementary to each other. In each of these embodiments, additional nucleosides may be present outside of the palindromic region in a synthetic oligonucleotide of the disclosure, for example linked to the 5’ end of the first X nucleoside, and / or linked to the 3’ end of the last Y nucleoside. Perfect complementarity is not required throughout the entire duplex, as long as at least one or more of the minimal 4 base palindromes above are included. For example, a palindrome may form a duplex that has at least one mismatch (e.g., at least 2 mismatches, at least 3 mismatches, or at least 4 mismatches). In some embodiments, a palindrome may form a duplex that has one mismatch, 2 mismatches or fewer, 3 mismatches or fewer, or 4 mismatches or fewer. In some embodiments, a TLR9 agonist comprises a palindrome with one mismatch, such as CUGG:CGAG, GGUG:CUCC, GAUG:CAUC, CAUG:CUUC, #14509433v1 GUAG:UUAC, or similar. In some embodiments, a TLR9 agonist comprises a palindrome with two mismatches, such as AAGCU:UUGAA (SEQ ID NO: 61), UGCUA:UUGCC (SEQ ID NO: 62), GUGCA:UUCAG (SEQ ID NO: 63), GAUAG:CAAUG (SEQ ID NO: 64), CGCCA:GGGUG (SEQ ID NO: 65), or similar. In some embodiments, a TLR9 agonist comprises a palindrome with three mismatches, such as UGCUAU:AUGGAA (SEQ ID NO: 66), GUGCUA:UACAAU (SEQ ID NO: 67), GGUGCU:UGCUCG (SEQ ID NO: 68), CGUGCU:AUCACC (SEQ ID NO: 69), AGUGCU:AGCGUC (SEQ ID NO: 70), or similar. In some embodiments, a TLR9 agonist comprises a palindrome with four mismatches, such as UGCUAUUCGU:ACGUAGGGAA (SEQ ID NO: 71), GUGCUUAAGU:GCUAAACCAC (SEQ ID NO: 72), CGUGCUUGAG:UUCUAGGAGG (SEQ ID NO: 73), AAUGUUCGAA:UUCGUUCAUC (SEQ ID NO: 74), AUUGUUCAAU:UUUGGAGAUU (SEQ ID NO: 75), or similar. It should be understood that in sequences disclosed herein, a “:” does not necessarily represent a physicochemical structure of the oligonucleotide, but can simply note the point of symmetry of the palindrome. In some embodiments, however, a “:” can represent a linker or a spacer. In some embodiments, a TLR9 agonist does not comprise a palindrome. The use of a native phosphodiester backbone is believed to facilitate cleavage of the CpG by DNase II in the endosome during TLR9 activation, resulting in much greater pDC secretion of IFN-α compared to PS backbone CpG motifs. In some embodiments the synthetic oligonucleotides are agonists of TLR7 / 9 or TLR7 / 8 / 9. TLR7 / 9 dual agonists or TLR7 / 8 / 9 triple agonists optimized for induction of IFN- α have not been reported in the literature. In mouse models TLR7 and TLR9 appear to be antagonistic; dual activation of these receptors with standard ligands known in the art reduces efficacy in tumor models (e.g., Christensen et al. Immunity. 2006;25:417–428; Berland et al., Immunity. 2006;25:429–440; Leibler et al., Nature Immunology. 2022;23:1457–1469; doi: 10.1007 / s00432-017-2421-7.). Studies in human cells have provided no evidence of synergy or additive effect between these receptors, and synthetic oligonucleotides able to activate these receptors can at best induce comparable levels of IFN-α production to CpG-C DNA (well below that induced by CpG-A DNA) (Forsbach et al Nucleic Acid Therapeutics, 2011). In contrast to the teachings of the art, it has been surprisingly discovered that the combination of these agonists has enhanced properties. Thus, provided herein are compositions comprising first and second synthetic oligonucleotides wherein the first synthetic oligonucleotide comprises a TLR7 agonist motif, and the second synthetic oligonucleotide comprises a TLR9 agonist motif and one or both of the first and second synthetic oligonucleotides comprises an aggregation motif. The #14509433v1 composition in some embodiments includes at least two synthetic oligonucleotides and a LNP. Table 4. Examples of TLR9 agonists UUCG sequence in box represent a tetraloop. Lowercase = DNA; uppercase = RNA; * = phosphorothioate internucleoside linkage; underlining indicates a self-complementary palindrome. Table 5. Examples of additional TLR agonists 4-nucleobase sequences in boxes represent tetraloops. Lowercase = DNA; uppercase = RNA; * = phosphorothioate internucleoside linkage; Ψ = pseudouridine or N1-methyl- pseudouridine. #14509433v1 Aggregation motifs As used herein, an “aggregation motif” is a molecule or structure on one or both ends of a synthetic oligonucleotide that cause it to form a multimeric structure, including for example a micelle (using for example a terminal cholesterol conjugation) or most preferably #14509433v1 a G-quadruplex (e.g., by the inclusion of a G-quadruplex forming motif on one or both ends of a synthetic oligonucleotide). In some embodiments an “aggregate” refers to 2 or more separate oligonucleotides (either having the same sequence or having different sequences) that interact noncovalently with each other through the aggregation motif. G-quadruplexes can be formed from a single or several separate strands of nucleic acid (e.g., DNA or RNA, or a hybrid thereof), and can display a wide variety of topologies. G-quadruplex forming motifs can be generated by those skilled in the art based on known design criteria. For example, G-quadruplex forming motifs are described in Burge et al. “Quadruplex DNA: sequence, topology and structure” Nucleic Acids Research 34(19): 5402- 5415 (2006); Harris et al. “G-Quadruplexes in Pathogens: A Common Route to Virulence Control?” PLoS Pathogens 11(2):e1004562 (DOI: 10.1371 / journal.ppat.1004562); Miglietta et al. “G-quadruplex–R-loop interactions and the mechanism of anticancer G-quadruplex binders” Nucleic Acids Research 48(21):11942-11957 (2020); Price et al. “Infrared Spectroscopy Reveals the Preferred Motif Size and Local Disorder in Parallel Stranded DNA G-Quadruplexes” ChemBioChem 21(19): 2792-2804 (2020); Wanrooij et al. “A hybrid G- quadruplex structure formed between RNA and DNA explains the extraordinary stability of the mitochondrial R-loop” Nucleic Acids Research 40(20): 10334-10344 (2012); Amrane et al. “Deciphering RNA G-quadruplex function during the early steps of HIV-1 infection” Nucleic Acids Research 50(21):12328-12343 (2022); and Perrone et al. “Conserved presence of G-quadruplex forming sequences in the Long Terminal Repeat Promoter of Lentiviruses” Scientific Reports 7: 2018 (DOI: 10.1038 / s41598-017-02291-1); the entire contents of each of which are herein incorporated by reference for this purpose. An example putative quadruplex-forming motif is G3-10N0-7G3-10N0-7G3-10N0-7G3-10, wherein N is each independently any nucleoside. Typically in G-quadruplexes formed with such sequences, the N segments form loop structures in between the G segments that coordinate into quadruplexes. Methods of predicting G-quadruplex formation based on sequence are known in the art, e.g., as described in Wong et al. “A Toolbox for Predicting G-Quadruplex Formation and Stability” Journal of Nucleic Acids 2010: 564946 (DOI: 10.4061 / 2010 / 564946), the entire contents of which are herein incorporated by reference for this purpose. A G-quadruplex forming motif may comprise ribonucleic acid (RNA) nucleosides, deoxyribonucleic acid (DNA) nucleosides, or a combination of both RNA bases and DNA nucleosides. In some embodiments, a synthetic oligonucleotide comprises more than one G- quadruplex forming motif. In some embodiments, a synthetic oligonucleotide comprises one G-quadruplex forming motif comprising DNA and at least one other G-quadruplex forming #14509433v1 motif. In some embodiments, a synthetic oligonucleotide comprises one G-quadruplex forming motif comprising RNA and at least one other G-quadruplex forming motif. In some embodiments, a synthetic oligonucleotide comprises at least one G-quadruplex forming motif comprising RNA and at least one G-quadruplex forming motif comprising DNA. In some embodiments, an aggregation motif comprises a G-quadruplex forming motif comprising both RNA and DNA. G-quadruplex forming motifs may be synthetically designed or derived from existing sources, such as viruses. Some examples of G-quadruplex forming motifs derived from viral DNA or RNA are shown in Table 6 below. Predictive algorithms can be used to identify additional G-quadruplex forming motifs that a synthetic oligonucleotide herein comprises. For example, such predictive algorithms are described in Wong et al. Journal of Nucleic Acids 2010 (supra); Eddy et al. “Gene function correlates with potential for G4 DNA formation in the human genome” Nucleic Acids Research 34(14):3887-3896 (2006); and Huppert et al. “Prevalence of quadruplexes in the human genome” Nucleic Acids Research 33(9): 2908-2916 (2005); the entire contents of each of which are herein incorporated by reference for this purpose. Table 6. Examples of G-quadruplex-forming motifs derived from viral DNA or viral RNA. #14509433v1 In some embodiments, an aggregation motif may comprise one or more polyG motifs. A polyG motif comprises a nucleotide sequence wherein a majority of bases are guanine (G). A polyG motif may comprise multiple consecutive guanine nucleosides, interspersed with non-guanine nucleosides. A polyG motif may comprise ribonucleic acid (RNA) nucleosides, deoxyribonucleic acid (DNA) nucleosides, or a combination of both RNA bases and DNA nucleosides. In some embodiments, a synthetic oligonucleotide comprises an aggregation motif (e.g., a G-quadruplex forming motif and / or polyG motif) on the 5’ end. In some embodiments, a synthetic oligonucleotide comprises an aggregation motif (e.g., a G- quadruplex forming motif and / or polyG motif) on the 3’ end. In preferred embodiments, a synthetic oligonucleotide comprises aggregation motifs (e.g., G-quadruplex forming motifs and / or polyG motifs) on both ends. In some embodiments, a synthetic oligonucleotide comprises more than one polyG motif. In some embodiments, a synthetic oligonucleotide comprises one polyG motif comprising DNA and at least one other polyG motif. In some embodiments, a synthetic oligonucleotide comprises one polyG motif comprising RNA and at least one other polyG motif. In some embodiments, a synthetic oligonucleotide comprises at least one polyG motif comprising RNA and at least one polyG motif comprising DNA. In some embodiments, a synthetic oligonucleotide comprises an aggregation motif comprising RNA at the 5’ end and an aggregation motif comprising RNA at the 3’ end. In some #14509433v1 embodiments, a synthetic oligonucleotide comprises an aggregation motif comprising DNA at the 5’ end and an aggregation motif comprising DNA at the 3’ end. In some embodiments, a synthetic oligonucleotide comprises an aggregation motif comprising DNA at the 5’ end and an aggregation motif comprising RNA at the 3’ end. In some embodiments, a synthetic oligonucleotide comprises an aggregation motif comprising RNA at the 5’ end and an aggregation motif comprising DNA at the 3’ end. In some embodiments, an aggregation motif comprises a polyG motif comprising both RNA and DNA. In some embodiments, polyG motifs comprise at least one G. In some embodiments, a polyG motif is a sequence motif that is capable of forming a G-quadruplex. Such a G-quadruplex can either be intramolecular (i.e., formed within a single oligonucleotide) or intermolecular (i.e., formed by association of two or more oligonucleotides). In some embodiments, polyG motifs comprise at least 3 consecutive Gs (e.g., at least 4 consecutive Gs, at least 5 consecutive Gs, at least 6 consecutive Gs, at least 7 consecutive Gs, at least 8 consecutive Gs, at least 9 consecutive Gs, or more), and more preferably at least 4 consecutive Gs. In some embodiments, polyG motifs comprise at least 10 consecutive Gs (e.g., 10 consecutive Gs, 11 consecutive Gs, 12 consecutive Gs, 13 consecutive Gs, 14 consecutive Gs, 15 consecutive Gs, or more), such as the G10 CpG-A DNA within vidutolimod, which has the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 43), wherein the sequence has a central palindrome and aggregation domains on both ends. In some embodiments, a polyG motif comprises 1 or more phosphorothioate (PS) internucleoside linkages. PS internucleoside linkages reduce exonuclease digestion of a complex. In some embodiments, a polyG motif comprises a PS internucleoside linkage at the 5’ end. In some embodiments, a polyG motif comprises a PS internucleoside linkage at the 3’ end. In some embodiments, a polyG motif comprises a PS internucleoside linkage at the 5’ end and a PS internucleoside linkage at the 3’ end. In some embodiments, a polyG motif comprises 2 PS internucleoside linkages at the 5’ end. In some embodiments, a polyG motif comprises 3 PS internucleoside linkages at the 5’ end. In some embodiments, a polyG motif comprises 4 PS internucleoside linkages at the 5’ end. In some embodiments, a polyG motif comprises 5 PS internucleoside linkages at the 5’ end. In some embodiments, a polyG motif comprises 2 PS internucleoside linkages at the 3’ end. In some embodiments, a polyG motif comprises 3 PS internucleoside linkages at the 3’ end. In some embodiments, a polyG motif comprises 4 PS internucleoside linkages at the 3’ end. In some embodiments, a polyG motif comprises 5 PS internucleoside linkages at the 3’ end. In some embodiments, a polyG motif comprises 2 PS internucleoside linkages at the 5’ end and 3 PS internucleoside linkages at the 3’ end. In some embodiments, a polyG motif comprises 2 PS internucleoside linkages at the #14509433v1 5’ end and 4 PS internucleoside linkages at the 3’ end. In some embodiments, a polyG motif comprises 2 PS internucleoside linkages at the 5’ end and 5 PS internucleoside linkages at the 3’ end. In some embodiments, a polyG motif comprises nucleosides interspersed with at least one PS internucleoside linkage. PolyG motifs useful in synthetic oligonucleotides can have the general sequence architecture of w-Ga-x-Gb-y-Gc-z-Gd(SEQ ID NO: 117) or Ga-w-Gb-x-Gc-y-Gd-z (SEQ ID NO: 118), wherein w, x, y, and z each independently represent nucleoside sequences 0-5 nucleotides in length comprising non-guanosine nucleosides (e.g., H or N, according to IUPAC nucleotide code); a, b, c, and d each independently are integers of 0-10 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10), and wherein each internucleoside linkage of the polyG motif can independently be a phosphodiester internucleoside linkage or modified internucleoside linkage (e.g., phosphorothioate internucleoside linkage). For example, a polyG motif in some embodiments comprises, consists essentially of, or consists of a sequence N0-5G0-10N0-5G0-10N0-5G0-10N0-5G0-10 (SEQ ID NO: 117) or G0-10N0- 5G0-10N0-5G0-10N0-5G0-10N0-5 (SEQ ID NO: 118). In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence H0-5G0-10H0-5G0-10H0-5G0-10H0-5G0-10 (SEQ ID NO: 119) or G0-10H0-5G0-10H0-5G0-10H0-5G0-10H0-5 (SEQ ID NO: 120). In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence (N*)0-5G0-10(N*)0-5G0-10(N*)0-5G0-10(N*)0-5G0-10(SEQ ID NO: 121) or G0-10(N*)0-5G0-10(N*)0-5G0-10(N*)0-5G0-10(N*)0-5 (SEQ ID NO: 122), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence (H*)0-5G0-10(H*)0-5G0-10(H*)0-5G0-10(H*)0-5G0-10(SEQ ID NO: 123), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, the number of G’s in one or more (e.g., 1, 2, 3, or all 4) of the G0-10 (SEQ ID NO: 124) segments of the sequence motif is 3 or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, one or more (e.g., 1, 2, 3, or all 4) of the G0-10(SEQ ID NO: 124) segments of the sequence motif comprises at least one phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence (N*)0-3N0-3G0-10(N*)0-3N0-3G0-10(N*)0-3N0-3G0-10(N*)0-3N0-3G0-10(SEQ ID NO: 125) or G0-10(N*)0-3N0-3G0-10(N*)0-3N0-3G0-10(N*)0-3N0-3G0-10(N*)0-3N0-3 (SEQ ID NO: 126), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence (H*)0-3H0-3G0-10(H*)0-3H0-3G0-10(H*)0-3H0-3G0-10(H*)0-3H0-3G0-10(SEQ ID NO: 127) or G0-10(H*)0-3H0-3G0-10(H*)0-3H0-3G0-10(H*)0-3H0-3G0-10(H*)0-3H0-3 (SEQ ID NO: 128), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, the number of G’s in one or #14509433v1 more (e.g., 1, 2, 3, or all 4) of the G0-10 (SEQ ID NO: 124) segments of the sequence motif is 3 or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, one or more (e.g., 1, 2, 3, or all 4) of the G0-10(SEQ ID NO: 124) segments of the sequence motif comprises at least one phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence N0-3(N*)0-3G0-10N0-3(N*)0-3G0-10N0-3(N*)0-3G0-10N0-3(N*)0-3G0-10(SEQ ID NO: 129) or G0-10N0-3(N*)0-3G0-10N0-3(N*)0-3G0-10N0-3(N*)0-3G0-10N0-3(N*)0-3 (SEQ ID NO: 130), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence H0-3(H*)0-3G0-10H0-3(H*)0-3G0-10H0-3(H*)0-3G0-10H0-3(H*)0-3G0-10 (SEQ ID NO: 131) or G0-10H0-3(H*)0-3G0-10H0- 3(H*)0-3G0-10H0-3(H*)0-3G0-10H0-3(H*)0-3 (SEQ ID NO: 132), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, the number of G’s in one or more (e.g., 1, 2, 3, or all 4) of the G0-10segments of the sequence motif is 3 or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, one or more (e.g., 1, 2, 3, or all 4) of the G0-10 segments of the sequence motif comprises at least one phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence N0-3(N*)0-3N0-3(N*)0-3N0-3G0-10N0-3(N*)0-3N0-3(N*)0-3N0-3G0-10N0-3(N*)0-3N0-3(N*)0-3N0-3G0-10N0-3(N*)0-3N0-3(N*)0-3N0-3G0-10(SEQ ID NO: 133) or G0-10N0-3(N*)0-3N0-3(N*)0-3N0-3G0-10N0-3(N*)0-3N0-3(N*)0-3N0-3G0-10N0-3(N*)0-3N0-3(N*)0-3N0-3G0-10N0-3(N*)0-3N0- 3(N*)0-3N0-3 (SEQ ID NO: 134), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence H0-3(H*)0-3H0-3(H*)0-3H0-3G0-10H0-3(H*)0-3H0-3(H*)0-3H0-3G0-10H0-3(H*)0-3H0-3(H*)0-3H0-3G0-10H0-3(H*)0-3H0-3(H*)0-3H0-3G0-10 (SEQ ID NO: 135) or G0-10H0-3(H*)0-3H0- 3(H*)0-3H0-3G0-10H0-3(H*)0-3H0-3(H*)0-3H0-3G0-10H0-3(H*)0-3H0-3(H*)0-3H0-3G0-10H0-3(H*)0-3H0-3(H*)0-3H0-3(SEQ ID NO: 136), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, the number of G’s in one or more (e.g., 1, 2, 3, or all 4) of the G0-10 segments of the sequence motif is 3 or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, one or more (e.g., 1, 2, 3, or all 4) of the G0-10segments of the sequence motif comprises at least one phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence (N*)0-3N0-3(N*)0-3N0-3(N*)0-3G0-10(N*)0-3N0-3(N*)0-3N0-3(N*)0-3G0-10(N*)0-3N0-3(N*)0-3N0-3(N*)0-3G0-10(N*)0-3N0-3(N*)0-3N0-3(N*)0-3G0-10(SEQ ID NO: 137) or G0-10(N*)0-3N0-3(N*)0-3N0-3(N*)0-3G0-10(N*)0-3N0-3(N*)0-3N0-3(N*)0-3G0-10(N*)0-3N0-3(N*)0-3N0-3(N*)0-3G0- 10(N*)0-3N0-3(N*)0-3N0-3(N*)0-3 (SEQ ID NO: 138), wherein * represents a phosphorothioate #14509433v1 internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence (H*)0-3H0-3(H*)0-3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0-3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0-3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0-3H0-3(H*)0-3G0-10(SEQ ID NO: 139) or G0-10(H*)0-3H0-3(H*)0-3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0-3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0- 3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0-3H0-3(H*)0-3 (SEQ ID NO: 140), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, the number of G’s in one or more (e.g., 1, 2, 3, or all 4) of the G0-10 segments of the sequence motif is 3 or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, one or more (e.g., 1, 2, 3, or all 4) of the G0-10 segments of the sequence motif comprises at least one phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence N0-3(N*)0-3N0-3(N*)0-3G0-10N0-3(N*)0-3N0-3(N*)0-3G0-10N0-3(N*)0-3N0-3(N*)0-3G0-10N0-3(N*)0-3N0-3(N*)0-3G0-10(SEQ ID NO: 141) or G0-10N0-3(N*)0-3N0-3(N*)0-3G0-10N0-3(N*)0-3N0-3(N*)0-3G0-10N0-3(N*)0-3N0-3(N*)0-3G0-10N0-3(N*)0-3N0-3(N*)0-3 (SEQ ID NO: 142), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence H0-3(H*)0-3H0-3(H*)0-3G0-10H0-3(H*)0-3H0-3(H*)0-3G0-10H0-3(H*)0-3H0-3(H*)0-3G0-10H0-3(H*)0-3H0-3(H*)0-3G0-10 (SEQ ID NO: 143) or G0-10H0-3(H*)0-3H0-3(H*)0-3G0-10H0-3(H*)0-3H0-3(H*)0-3G0-10H0-3(H*)0-3H0-3(H*)0-3G0-10H0-3(H*)0-3H0-3(H*)0-3(SEQ ID NO: 144), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, the number of G’s in one or more (e.g., 1, 2, 3, or all 4) of the G0-10 segments of the sequence motif is 3 or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, one or more (e.g., 1, 2, 3, or all 4) of the G0-10segments of the sequence motif comprises at least one phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence (N*)0-3N0-3(N*)0-3N0-3G0-10(N*)0-3N0-3(N*)0-3N0-3G0-10(N*)0-3N0-3(N*)0-3N0-3G0-10(N*)0-3N0-3(N*)0-3N0-3G0-10 (SEQ ID NO: 145) or G0-10(N*)0-3N0-3(N*)0-3N0-3G0-10(N*)0-3N0- 3(N*)0-3N0-3G0-10(N*)0-3N0-3(N*)0-3N0-3G0-10(N*)0-3N0-3(N*)0-3N0-3 (SEQ ID NO: 146), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence (H*)0-3H0-3(H*)0-3H0- 3G0-10(H*)0-3H0-3(H*)0-3H0-3G0-10(H*)0-3H0-3(H*)0-3H0-3G0-10(H*)0-3N0-3(H*)0-3H0-3G0-10 (SEQ ID NO: 147) or G0-10(H*)0-3H0-3(H*)0-3H0-3G0-10(H*)0-3H0-3(H*)0-3H0-3G0-10(H*)0-3H0-3(H*)0-3H0-3G0-10(H*)0-3H0-3(H*)0-3H0-3(SEQ ID NO: 148), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, the number of G’s in one or more (e.g., 1, 2, 3, or all 4) of the G0-10 segments of the sequence motif is 3 or more (e.g., 3, 4, 5, 6, 7, 8, 9, or #14509433v1 10). In some embodiments, one or more (e.g., 1, 2, 3, or all 4) of the G0-10 segments of the sequence motif comprises at least one phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence (N*)0-3N0-3(N*)0-3G0-10(N*)0-3N0-3(N*)0-3G0-10(N*)0-3N0-3(N*)0-3G0-10(N*)0-3N0- 3(N*)0-3G0-10 (SEQ ID NO: 149) or G0-10(N*)0-3N0-3(N*)0-3G0-10(N*)0-3N0-3(N*)0-3G0-10(N*)0-3N0-3(N*)0-3G0-10(N*)0-3N0-3(N*)0-3(SEQ ID NO: 150), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, a polyG motif comprises, consists essentially of, or consists of a sequence (H*)0-3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0-3G0-10(SEQ ID NO: 151)or G0-10(H*)0-3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0-3G0-10(H*)0-3H0-3(H*)0-3 (SEQ ID NO: 152), wherein * represents a phosphorothioate internucleoside linkage. In some embodiments, the number of G’s in one or more (e.g., 1, 2, 3, or all 4) of the G0-10segments of the sequence motif is 3 or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, one or more (e.g., 1, 2, 3, or all 4) of the G0-10 segments of the sequence motif comprises at least one phosphorothioate internucleoside linkage. In each polyG motif, each individual nucleoside (e.g., each G, N, and H) can be an RNA nucleoside or a DNA nucleoside. It should be understood that in sequences in which modified (e.g., phosphorothioate) internucleoside linkages are designated, internucleoside linkages which are not specifically designated are phosphodiester linkages. Alternatively or in addition, an aggregation motif may comprise a lipid, or a protein or a portion thereof. In some embodiments, an aggregation motif comprises a lipid. In some embodiments, the lipid is cholesterol. In some embodiments, the lipid is a free fatty acid (e.g., acetic acid, oleic acid, palmitic acid, linoleic acid, or another free fatty acid). In some embodiments, an aggregation motif comprises a protein or a portion thereof. In some embodiments, the protein is biotin or a portion thereof. In some embodiments, the protein is avidin or a portion thereof. In some embodiments, the protein is streptavidin or a portion thereof. In some embodiments, the protein is an immunoglobulin or a portion thereof. Oligonucleotide modifications In some embodiments, a synthetic oligonucleotide disclosed herein comprises one or more modifications. Oligonucleotide modifications include, but are not limited to, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.) and 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); (b) base modifications, e.g., replacement with modified bases, stabilizing #14509433v1 bases, destabilizing bases, bases that base pair with an expanded repertoire of partners, and conjugated bases; (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar; as well as (d) internucleoside linkage modifications, including modification or replacement of phosphodiester linkages. An oligonucleotide (e.g., a synthetic oligonucleotide disclosed herein) can comprise one or more of any of these modifications, or a combination thereof. In some embodiments, the oligonucleotide modification is in one or more bases and / or sugars. For example, in some embodiments an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein includes nucleic acids having backbone sugars that are covalently attached to low molecular weight organic groups other than a hydroxyl group or hydrogen at the 2' position and other than a phosphate group or hydroxyl group at the 5' position. Thus, in some embodiments, a substituted or modified oligonucleotide includes a 2'- O-alkylated ribose group. In some embodiments, a modified oligonucleotide includes sugars such as hexose, 2’-F hexose, 2’-amino ribose, constrained ethyl (cEt), locked nucleic acid (LNA), bridged nucleic acid (BNA), arabinose or 2'-fluoroarabinose instead of ribose. Thus, in some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein is heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have an amino acid backbone with nucleic acid bases). In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide) disclosed herein includes at least one LNA modification or modified nucleoside. An LNA modification or modified nucleoside is a modified RNA nucleoside in which the ribose moiety is modified with an additional linkage connecting the 2’ oxygen and the 4’ carbon. Without wishing to be bound by theory, LNA modifications enhance base stacking and backbone organization, and significantly increase the hybridization properties of oligonucleotides. In some embodiments, the melting temperature of oligonucleotides comprising an LNA modification(s) can be increased relative to an unmodified oligonucleotide having the same nucleic acid sequence. In some embodiments, the LNA modification is, comprises or consists of (2'-O, 4'-C methylene)-adenosine. In some embodiments, the LNA modification is, comprises or consists of 5-methyl-(2'-O, 4'-C methylene)-cytidine. In some embodiments, the LNA modification is, comprises or consists of (2'-O, 4'-C methylene)-cytidine. In some embodiments, the LNA modification is, comprises or consists of (2'-O, 4'-C methylene)-guanosine. In some embodiments, the LNA modification is, comprises or consists of 5-methyl-(2'-O, 4'-C methylene)-uridine. In some embodiments, the oligonucleotide includes two or more LNA #14509433v1 modifications, each of which, in some embodiments, comprises, consists of, or consists essentially of an LNA modification disclosed herein. In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein is DNA, RNA, PNA, cEt, LNA, ENA or hybrids including any chemical or natural modification thereof. Chemical and natural modifications are well known in the art and include but are not limited to those described above. Non-limiting examples of modifications include modifications designed to increase binding to a target strand (e.g., increase melting temperature of a hybridized pair of nucleic acid molecules, such as an oligonucleotide and a target nucleic acid), to assist in identification of the oligonucleotide or an oligonucleotide- target complex, to increase cell penetration, to stabilize against nucleases and other enzymes that degrade or interfere with the structure or activity of the oligonucleotides, to provide a mode of disruption (a terminating event) once sequence-specifically bound to a target, and to improve the pharmacokinetic properties of the oligonucleotide. In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein comprises at least one modification (e.g., a 2’-MOE modification, an LNA modification, or any other modification disclosed herein). In some embodiments, the oligonucleotide comprises at least two modifications. In some embodiments, the at least two modifications comprise an LNA modification and another modification disclosed herein. In some embodiments, the at least two modifications comprise a 2’-MOE modification and another modification disclosed herein. In some embodiments, the at least two modifications comprise a 2’-MOE modification and an LNA modification. In some embodiments, the oligonucleotide comprises two, three, four, five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more than 20 modifications (e.g., 2’-MOE modification(s), LNA modification(s), and / or any other modification(s) disclosed herein). In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide) disclosed herein includes one or more 2’-O-methoxyethyl (2’-MOE) modifications. In some embodiments, the oligonucleotide includes one or more LNA modifications or modified nucleosides. In some embodiments, the oligonucleotide includes a 2’-MOE modification and an LNA modification. In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide) disclosed herein comprises an end modification. In some embodiments, 5’- and / or 3’-end modifications involve incorporation or addition of non-native or non-natural components to the 5’- and / or 3’-end of a nucleic acid or oligonucleotide. Such modifications may improve physicochemical properties, stability, resistance to nuclease degradation, etc. End modifications may include the addition of amino modifiers (e.g., 5’-DMS(O)MT-amino #14509433v1 modifier C6, 5’-amino modifier C3-TFA, 5’-amino modifier C12, 5’-amino modifier C6- TFA, 5’-amino-dT, 5’-amino modifier-5, and 3’-amino modifier C7-CPG); thiol modifiers (e.g., 5’-thiol-modifier C6 S-S and 3’-thiol-modifier C6 S-S); 3’-glyceryl modification; binding modifiers (e.g., 5’-biotin, biotin-dT, biotin-TEG, 3’-biotin-TEG-CPG, digoxigenin, and 2,4-dinitrophenol-TEG); spacers (e.g., spacer 9, spacer 12, spacer 18, spacer C3, 3’- spacer-C3-CPG); nucleoside / nucleotide analogs (e.g., 3’-deoxynucleoside-CPG, 2’,3’- dideoxycytidine, halogenated bases, 2’-deoxypseudouridine, 5,6-dihydro-dT, 5,6-dihydro-dU, 5-OH-dC, 5-OH-dU, 8-oxo-dA, 8-oxo-dG, thymidine glycol, dUracil, 2’-deoxynebularine, derivative K, derivative P, inosine, 5-nitroindole, 3-nitropyrrole, 2,6-diaminopurine, 5-Me- dC, 2-aminopurine, etheno-dA, N6-Me-dA, O6-Me-dG, O4-Me-dT, dSpacer, 5’-O-MedT, 7- deaza-dA, 7-deaza-dG, 7-deaza-dX, 7-deaza-8-aza-dA, and puromycin), intercalators (e.g., psoralen C2, and psoralen C6); cholesterol moieties (e.g., cholesteryl-TEG and 3’- cholesteryl-TEG-CPG); methyl RNA nucleotides (e.g., 2’-OMe-A, 2’-OMe-C, 2’-OMe-G and 2’-OMe-U); and / or thiophosphates to the 5’-end and / or the 3’-end of a nucleic acid or oligonucleotide. In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide) disclosed herein comprises a base modification. In some embodiments, a base modification involves replacement of a “natural” or “native” nucleobase of an oligonucleotide with a “non-natural” or “non-native” substituent, or involves chemical modification of a native nucleobase. Non- limiting examples of base modifications include methylation, hydroxymethylation, alkylation, methoxyethyl modifications, and substitutions with heterocyclic, stabilizing, destabilizing, promiscuous, or conjugated base moieties. “Natural” nucleobases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine and uracil. “Non-native” or “non-natural” substituents include 5-methyl-cytosine (5-Me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5- propynyl (-C≡C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8- thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5- bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7- deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Base modifications also include replacement of the native purine or pyrimidine base with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone, #14509433v1 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. Base modifications can improve various oligonucleotide properties, including stability (e.g., nuclease resistance, thermostability, chemical stability, biological stability, stability in various salt conditions, etc.), target hybridization, biocompatibility (e.g., reduced hepatotoxicity, reduced nephrotoxicity, reduced immune stimulation, etc.), mismatch discrimination, water solubility, etc. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that do not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5- propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7- methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine (7deazaG), 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N- isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size- expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2- aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. 3,687,808, those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30: 613, the contents of each of which are herein incorporated by reference in their entireties. Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et #14509433v1 al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., U.S. 4,845,205; Spielvogel et al., U.S. 5,130,302; Rogers et al., U.S. 5,134,066; Bischofberger et al., U.S. 5,175,273; Urdea et al., U.S. 5,367,066; Benner et al., U.S. 5,432,272; Matteucci et al, U.S. 5,434,257; Gmeiner et al., U.S. 5,457,187; Cook et al., U.S. 5,459,255; Froehler et al., U.S. 5,484,908; Matteucci et al, U.S. 5,502,177; Hawkins et al., U.S. 5,525,711; Haralambidis et al, U.S. 5,552,540; Cook et al., U.S. 5,587,469; Froehler et al., U.S. 5,594,121; Switzer et al., U.S. 5,596,091; Cook et al., U.S. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. 5,681,941; Cook et al, U.S. 5,811,534; Cook et al., U.S. 5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S. 5,587,470; Cook et al., U.S. 5,457,191; Matteucci et al., U.S. 5,763,588; Froehler et al., U.S. 5,830,653; Cook et al., U.S. 5,808,027; Cook et al, 6,166,199; and Matteucci et al., U.S. 6,005,096, the contents of each of which are herein incorporated by reference in their entireties. In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide) disclosed herein comprises one or more (e.g., two or more, three or more, etc.) modified nucleosides (e.g., modified nucleosides with a base modification(s) and / or modified nucleosides with a sugar modification(s)). In some embodiments, the modification is a 2’-O-methyl (2’-O-Me) modification, a 2’-O-methoxyethyl (2’-MOE or MOE) modification, a 2’-O-methoxyethoxy- 5-methyl (5-Me-MOE) modification, an LNA modification, a 5-methyl (5-Me or iMe) modification (e.g., 5-methyl-cytidine or 5-methyl-uridine), a 5-methyl LNA modification, a 7-deaza modification, or a 7-deaza-2’-O-methyl (7deazaOM) modification. In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide) disclosed herein comprises an LNA modification and a 5-methyl modification. In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide) disclosed herein comprises an LNA modification, a 5-methyl modification, and a 7-deaza modification. In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein comprises an MOE modification and a 5-methyl modification. In some embodiments, the oligonucleotide further comprises one or more modified internucleoside linkages, such as phosphorothioate internucleoside linkage(s). As a non-limiting example, the oligonucleotide may comprise one or more LNA modified nucleosides, one or more 5-Me modified nucleosides, one or more 7- deaza modified nucleosides, one or more 2’-MOE modified nucleosides and / or one or more phosphorothioate internucleoside linkages. In some embodiments, a modified nucleoside is a 2’-O-methyl adenosine (mA), a 2’- O-methyl cytidine (mC), a 2'-O-methyl guanosine (mG), a 2'-O-methyl uridine (mU), a deoxyadenosine (A, dA), a deoxycytidine (C, dC), a deoxyguanosine (G, dG), a deoxythymidine (T, dT), a 2'-O-methoxyethoxy adenosine (moeA, 2’-MOE-A), a 2'-O- #14509433v1 methoxyethoxy-5-methyl cytidine (5-Me-MOE-C), a 2'-O-Methoxyethoxy Guanosine (moeG, 2’-MOE-G), a 2'-O-Methoxyethoxy-5-Methyl Uridine (moeT, 2’-MOE-T), an LNA Adenosine (lA), an LNA 5-Methyl Cytidine (5-Me-lC), an LNA Guanosine (lG), an LNA Thymidine (lT), a 5-Methyl deoxy Cytidine (iMe-dC), a 7-Deaza deoxy Guanosine (7deazaG), or a 7-deaza-2'-O-Methyl Guanosine (7deazaOMG). In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5’-end of the oligonucleotide. In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide) disclosed herein comprises a sugar modification. In some embodiments, a sugar modification involves replacement of a “natural” or “native” sugar ring of a nucleoside of a nucleic acid sequence and / or oligonucleotide (e.g., a synthetic oligonucleotide) with a “non-natural” or “non- native” substituent, or involves chemical modification of a native sugar ring. Sugar ring substituent groups include OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N- alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. These include O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)2ONH2, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other substituent groups include C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O- alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. In some embodiments, a sugar modification includes a 2′-O-methoxyethoxy (2′-O- CH2CH2OCH3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE), a 2′- #14509433v1 dimethylaminooxyethoxy (i.e., a O(CH2)2ON(CH3)2 group, also known as 2′-DMAOE), or 2′- dimethylaminoethoxyethoxy (also known as 2′-O-dimethyl-amino-ethoxy-ethyl or 2′- DMAEOE; i.e., 2′-O-CH2-O-CH2-N(CH3)2). In some embodiments, a sugar modification includes an LNA modification, a 2’-O-Me modification, or a 2’-MOE modification. In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties. In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridge two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 4’, and / or 5’ positions. In certain embodiments one or more non- bridging substituent of non-bicyclic modified sugar moieties is branched. In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide) disclosed herein comprises an internucleoside linkage modification. In some embodiments, an internucleoside linkage modification involves replacement of a “natural” or “native” internucleoside linkage of a nucleic acid molecule (e.g., an oligonucleotide) with a “non- natural” or “non-native” substituent, or involves chemical modification of a native internucleoside linkage. In some embodiments, an internucleoside linkage modification may comprise replacement of an oxygen of the phosphate group in a 3’,5’-phosphodiester bond with a substituent atom or a substituent group, or may comprise replacement of the 3’,5’- phosphodiester bond or both the 3’,5’-phosphodiester bond and the sugar moiety to facilitate linkage of one nucleobase of a nucleic acid molecule to the next. Non-limiting examples of modified internucleoside linkages include phosphorothioate, phosphorodithioate, N3’ phosphoramidate, boranophosphate, 2’,5’-phosphodiester, phosphonoacetate (PACE), methylphosphonate, morpholino, amide, and peptide nucleic acid linkages. In some embodiments, an internucleoside linkage modification comprised in an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein is a phosphorothioate internucleoside linkage modification. In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein comprises a modified backbone. In some embodiments, the modified backbone comprises modified internucleoside linkages. In some embodiments, the modified backbone comprises one or more phosphorothioate internucleoside linkages. In some embodiments, all of the internucleoside linkages of the oligonucleotide are phosphorothioate internucleoside #14509433v1 linkages. In some embodiments, modified internucleoside linkages (e.g., linkages within a modified backbone) that do not include a phosphorus atom therein have internucleoside linkages that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Non-limiting examples of modified internucleoside linkages include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P=O” or “PO”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P=S” or “PS”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-O- C(=O)(NH)-S-); siloxane (-O-SiH2-O-); and N,N’-dimethylhydrazine (-CH2-N(CH3)- N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide or of particular portion(s) of the oligonucleotide (e.g., the 5' and / or 3' ends of the oligonucleotide). In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of #14509433v1 phosphorous-containing and non-phosphorous-containing internucleoside linkages are well- known to those skilled in the art. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in WO 2017 / 015555, the contents of which is herein incorporated by reference. Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration. In certain embodiments, oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage #14509433v1 (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp-Sp-Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs. Substituted sugar moieties include, but are not limited to one of the following at the 2' position: H (deoxyribose); OH (ribose); F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl- O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein includes, for example, at least one nucleotide or nucleoside modified at the 2' position of the sugar. In some embodiments, the nucleoside modification is a 2'-O-alkyl, 2'-O-alkyl-O- alkyl or 2'-fluoro-modified nucleotide or an end cap. In some embodiments, nucleoside modifications include 2'-fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3' end of the oligonucleotide. In some embodiments, an oligonucleotide includes a single modified nucleoside. In some embodiments, an oligonucleotide includes at least two modified nucleosides, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 or more nucleosides, up to the entire length of the oligonucleotide (e.g., synthetic oligonucleotide). In some embodiments, each nucleoside of the oligonucleotide is a modified nucleoside. #14509433v1 Nucleosides or nucleobases include the natural purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleosides include other synthetic and natural nucleobases. Lipid Delivery Vehicles In certain embodiments, an oligonucleotide described herein is formulated with a lipid delivery vehicle such as a lipid nanoparticle (LNP) or a liposome. As used herein, the term “LNP” refers to a stable nucleic acid-lipid particle. LNPs typically contain an ionizable amino lipid or cationic lipid, and one or more stabilizing lipids. Stabilizing lipids include neutral lipids and pegylated lipids. In some embodiments the LNP comprises an ionizable amino lipid or cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g. , a PEG-lipid conjugate). LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). As used herein, the term “liposome” refers to a lipid delivery vehicle comprising a lipid shell encapsulating an aqueous core. A liposome is an artificial, self-closed vesicular structure that can have various sizes and shapes, in which one or several lipid membranes encapsulate an aqueous core. Most typically liposome membranes are formed from lipid bilayer membranes, where the hydrophilic head groups are oriented towards aqueous environments (e.g., the aqueous core of the liposome and the aqueous solution surrounding the liposome), and the lipid chains are oriented away from aqueous environments (e.g., towards the internal portion of the bilayer). Liposomes can be formed as well from other amphiphilic monomeric and polymeric molecules, such as polymers, like block copolymers, or polypeptides. Unilamellar vesicles are liposomes defined by a single membrane (e.g., a single lipid bilayer membrane) enclosing an aqueous core. In contrast, oligo- or multilamellar vesicles are built up of several membranes. Typically, the membranes are roughly 4 nm thick and are composed of amphiphilic lipids, such as phospholipids, of natural or synthetic origin. Optionally, the membrane properties can be modified by the incorporation of other lipids such as sterols or cholic acid derivatives. A synthetic oligonucleotide of the present disclosure can be contained within the aqueous core of the liposome, associated with the lipid shell of the liposome, or both. In various embodiments, lipid delivery vehicles of the present disclosure have a mean diameter of from about 30 nm to about 150 nm, from about 40 nm to about 150 nm, from about 50 nm to about 150 nm, from about 60 nm to about 130 nm, from about 70 nm to about #14509433v1 110 nm, from about 70 nm to about 100 nm, from about 80 nm to about 100 nm, from about 90 nm to about 100 nm, from about 70 to about 90 nm, from about 80 nm to about 90 nm, from about 70 nm to about 80 nm, or about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In one embodiment, the lipid delivery vehicles of the present disclosure have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm. In one embodiment, the lipid to drug ratio (mass / mass ratio) e.g., lipid to oligonucleotide ratio) will be in the range of from about 1:1 to about 50:1 , from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part of the disclosure. In some embodiments, the oligonucleotide is encapsulated in or associated with a lipid portion of the lipid delivery vehicle or an aqueous space enveloped by some or all of the lipid portion of the lipid delivery vehicle (e.g., the aqueous core of a liposome), thereby protecting it from enzymatic degradation or other undesirable effects induced by the mechanisms of the host organism or cells. In some embodiments, a first lipid delivery vehicle or a first plurality of lipid delivery vehicles comprises a TLR7 agonist and a second lipid delivery vehicle or second plurality of lipid delivery vehicles comprises a TLR9 agonist. In some embodiments, a first lipid delivery vehicle or a first plurality of lipid delivery vehicles comprises a TLR7 agonist and a second lipid delivery vehicle or second plurality of lipid delivery vehicles comprises a TLR8 agonist. In some embodiments, a first lipid delivery vehicle or a first plurality of lipid delivery vehicles comprises a TLR8 agonist and a second lipid delivery vehicle or second plurality of lipid delivery vehicles comprises a TLR9 agonist. In some embodiments, a first lipid delivery vehicle or a first plurality of lipid delivery vehicles comprises a TLR7 agonist, a second lipid delivery vehicle or second plurality of lipid delivery vehicles comprises a TLR8 agonist, and a third lipid delivery vehicle or third plurality of lipid delivery vehicles comprises a TLR9 agonist. In some embodiments, a lipid delivery vehicle or plurality of lipid delivery vehicles comprises more than one type of TLR agonist (e.g., a TLR7 agonist, a TLR8 agonist, and / or a TLR9 agonist; for example: (i) a TLR7 agonist and a TLR8 agonist, (ii) a TLR7 agonist and a TLR9 agonist, (iii) a TLR8 agonist and a TLR9 agonist, or (iv) each of a TLR7 agonist and a TLR8 agonist and a TLR9 agonist). A “plurality of lipid delivery vehicles” comprises at least two lipid delivery vehicles. #14509433v1 In some embodiments, the lipid delivery vehicles are substantially non-toxic. In certain embodiments, the at least one agent, when present in the lipid delivery vehicles, is resistant in aqueous solution to degradation by intra- or intercellular enzymes. LNPs in some embodiments include "pSPLP," which include an encapsulated condensing agent-nucleic acid complex. In addition, the nucleic acids when present in the nucleic acid- lipid particles of the present disclosure arc resistant in aqueous solution to degradation with a nuclease. In some embodiments the LNP comprises stabilizing lipids such as neutral lipids and anionic lipids. The term “neutral lipid” refers to any one of a number of lipid species that exist in either an uncharged or neutral zwitterionic form at physiological pH. Representative neutral lipids include diacylphosphatidylcholines, diacylphosphatidylethanolamines, ceramides, sphingomyelins, dihydro sphingomyelins, cephalins, and cerebrosides. Exemplary neutral lipids include, for example, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl- phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl- phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearioyl-2-oleoyl-phosphatidyethanol amine (SOPE), and 1,2-dielaidoyl-sn-glycero-3- phophoethanolamine (transDOPE). In one embodiment, the neutral lipid is 1,2-distearoyl-sn- glycero-3-phosphocholine (DSPC). In some embodiments, the LNPs further comprise a steroid, such as cholesterol, or steroid analogue. An “anionic lipid” refers to any lipid that is negatively charged at physiological pH. These lipids include phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoylphosphatidylethanolamines, N- succinylphosphatidylethanolamines, N-glutarylphosphatidylethanolamines, lysylphosphatidylglycerols, palmitoyloleyolphosphatidylglycerol (POPG), and other anionic modifying groups joined to neutral lipids. In some embodiments, the LNPs comprise a polymer conjugated lipid, such as a PEG conjugated lipid. The term “pegylated lipid” refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art and include, for instance, 1-(monomethoxy-polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-s- DMG), #14509433v1 PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramides (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, PEG-c-DOMG, PEG-c-DMA, and PEG-s- DMG. A lipid bilayer or liposome core can be constructed from one or more lipids known to those in the art including but not limited to: 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dimyristoyl-sn-phosphatidylcholine (DMPC), 1-palmitoyl-2-oleoyl-sn- phosphatidylcholine (POPC), 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DSPG), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DOPG), 1,2-distearoyl-sn-glycero-3- phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-di-(9Z- octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE), and 1,2-dihexadecanoyl-sn- glycero-3-phosphoethanolamine (DPPE), sphingolipids such as sphingosine, sphingosine phosphate, methylated sphingosines and sphinganines, ceramides, ceramide phosphates, 1-0 acyl ceramides, dihydroceramides, 2-hydroxy ceramides, sphingomyelin, glycosylated sphingolipids, sulfatides, gangliosides, phosphosphingolipids, and phytosphingosines of various lengths and saturation states and their derivatives, phospholipids such as phosphatidylcholines, lysophosphatidylcholines, phosphatidic acids, lysophosphatidic acids, cyclic LPA, phosphatidylethanolamines, lysophosphatidylethanolamines, phosphatidylglycerols, lysophosphatidylglycerols, phosphatidylserines, lysophosphatidylserines, phosphatidylinositols, inositol phosphates, LPI, cardiolipins, lysocardiolipins, bis(monoacylglycero) phosphates, (diacylglycero) phosphates, ether lipids, diphytanyl ether lipids, and plasmalogens of various lengths, saturation states, and their derivatives, sterols such as cholesterol, desmosterol, stigmasterol, lanosterol, lathosterol, diosgenin, sitosterol, zymosterol, zymostenol, 14-demethyl-lanosterol, cholesterol sulfate, DHEA, DHEA sulfate, 14-demethyl-14-dehydrlanosterol, sitostanol, campesterol, ether anionic lipids, ether cationic lipids, lanthanide chelating lipids, A-ring substituted oxysterols, B-ring substituted oxysterols, D-ring substituted oxysterols, side-chain substituted oxysterols, double substituted oxysterols, cholestanoic acid derivatives, fluorinated sterols, fluorescent sterols, sulfonated sterols, phosphorylated sterols, and polyunsaturated sterols of different lengths, saturation states, and their derivatives. As disclosed herein, a “lipid” refers to its conventional sense as a generic term encompassing fats, lipids, and alcohol-ether-soluble constituents of protoplasm, which are insoluble in water. Lipids usually consist of a hydrophilic and a hydrophobic moiety. In water lipids can self-organize to form bilayer membranes, where the hydrophilic moieties (head groups) are oriented towards the aqueous phase, and the lipophilic moieties (acyl chains) are #14509433v1 embedded in the hydrophobic region between the two hydrophilic layers comprised within the bilayer. Lipids can also comprise two hydrophilic moieties (bola amphiphiles). In that case, membranes may be formed from a single lipid layer, and not a bilayer. Typical non- limiting examples of lipids are fats, fatty oils, essential oils, waxes, steroids, sterols, phospholipids, glycolipids, sulpholipids, aminolipids, chromolipids, and fatty acids. The term encompasses both naturally occurring and synthetic lipids. In some embodiments, the lipids are steroids, sterols (e.g., cholesterol), phospholipids, including phosphatidyl, phosphatidylcholines and phosphatidylethanolamines and sphingomyelins. Where there are fatty acids, they could be about 12-24 carbon chains in length, containing up to 6 double bonds. The fatty acids are linked to a backbone, which may be derived from glycerol. The fatty acids within one lipid can be different (asymmetric), or there may be only 1 type of fatty acid chain present, e.g., lysolecithins. Mixed formulations are also possible, particularly when the non-cationic lipids are derived from natural sources, such as lecithins (phosphatidylcholines) purified from egg yolk, bovine heart, brain, liver or soybean. In some embodiments, the lipid delivery vehicle (e.g., LNP or liposome) includes a neutral lipid. The neutral lipid may be, for example, 1,2-dioleoyl-sn-glycero-3- phosphocholine (DOPC), 1,2-dimyristoyl-sn-phosphatidylcholine (DMPC), 1-palmitoyl-2- oleoyl-sn-phosphatidylcholine (POPC), 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DSPG), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DOPG), 1,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE), and 1,2- dihexadecanoyl-sn-glycero-3-phosphoethanolamine (DPPE), any related phosphatidylcholine or neutral lipids available from commercial vendors. Spacers In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more spacers and / or linkers. In some embodiments the spacer connects a TLR7 agonist (e.g., an ORN TLR7 agonist) to a TLR9 agonist (e.g., an ODN TLR9 agonist), e.g., within an oligonucleotide of the disclosure. In some embodiments the spacer connects two (or more) TLR7 agonists to one another, e.g., within an oligonucleotide of the disclosure. In some embodiments the spacer connects two (or more) TLR9 agonists to one another, e.g., within an oligonucleotide of the disclosure. In some embodiments, the spacer connects an agonist (e.g., a TLR7 or TLR9 agonist) to an aggregation motif, e.g., within an oligonucleotide of the disclosure. #14509433v1 In some embodiments, spacers comprise or consist of one or more moiety which connects the linker moiety to the oligonucleotide. In some embodiments, a linker moiety may be attached to either or both ends of an oligonucleotide (e.g., a synthetic oligonucleotide) disclosed herein, or a linker moiety may be attached to an intermediate position of an oligonucleotide. In certain embodiments, linker moieties attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, the linker is attached at the 3’ and / or 5’-end of the oligonucleotide. In some embodiments, the linker is attached at or near the 3’-end of the oligonucleotide. In certain embodiments, the linker is attached at or near the 5’-end of the oligonucleotide. In some embodiments, the synthetic oligonucleotide is attached to the spacer through a covalent bond (e.g., phosphodiester, phosphorodithioate or phosphorothioate bond). In some embodiments, the spacer comprises an oligonucleotide spacer. In some embodiments, the spacer does not comprise or consist of an oligonucleotide spacer. The spacer in some embodiments appears just once in the molecule or in some embodiments is incorporated several times (e.g., via phosphodiester, phosphorothioate, methylphosphonate, or amide linkages). In embodiments in which multiple spacer moieties are incorporated, the individual spacer moieties may be attached to one another and / or to the synthetic oligonucleotide via phosphodiester, phosphorothioate, methylphosphonate, or amide linkages. In certain embodiments, it is desirable for the spacer and / or the linker to be cleaved from the oligonucleotide. For example, in certain circumstances oligonucleotide compounds comprising a particular spacer and / or linker are better taken up by a particular cell type, but once the compounds have been taken up, it is desirable that the spacer and / or linker be cleaved to release the oligonucleotide. Thus, certain spacers and linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable bond is selected from an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide bond. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or #14509433v1 phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a spacer moiety or a linker moiety. In certain embodiments, a cleavable moiety comprises or consists of one or more nucleosides. In certain such embodiments, the one or more nucleosides are linked to one another and / or to the remainder of the oligonucleotide through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'- terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the spacer or linker moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'- deoxyadenosine. Modulation of TLR activity In some embodiments, administration of an oligonucleotide (e.g., synthetic oligonucleotide) or a composition thereof (e.g., pharmaceutical composition thereof, such as a pharmaceutical composition formulated with a lipid delivery vehicle) to a subject modulates TLR activity in a cell or subject. In some embodiments, the TLR activity is increased in the cell or subject by at least or about 50%, at least or about 100%, at least or about 200%, at least or about 300%, at least or about 400%, at least or about 500%, at least or about 600%, at least or about 700%, at least or about 800%, at least or about 900%, at least or about 1000%, at least or about 2000%, at least or about 3000%, at least or about 4000%, at least or about 5000%, at least or about 6000%, at least or about 7000%, at least or about 8000%, at least or about 9000%, at least or about 10,000%, or higher, or any range or combination thereof, relative to a reference level. As disclosed herein, a “reference level,” refers to a corresponding level in a subject with a disease or disorder (e.g., a subject with a cancer) who has been administered an oligonucleotide (e.g., a synthetic oligonucleotide disclosed herein) which is not formulated with a lipid delivery vehicle (e.g., an LNP); to a corresponding level in a subject with a disease or disorder who has not been administered an oligonucleotide; or to a corresponding level in a subject prior to treatment of the subject with an oligonucleotide. As disclosed herein, “a value that is less than” and equivalent phrases refer to values which are decreased or quantified to be smaller than a value or values to which they are compared (e.g., a reference value or reference values). As disclosed herein, “a value that is greater than” and equivalent phrases refer to values which are increased or quantified to be #14509433v1 larger than a value or values to which they are compared (e.g., a reference value or reference values). Methods of Use / Treatment As disclosed herein, a disease or disorder refers to a disease or disorder in a subject. In some embodiments, the disease or disorder is a cancer or infectious disease. Synthetic oligonucleotides disclosed herein and compositions comprising such oligonucleotides can in some embodiments be used in the treatment of a disease or disorder in a subject. Clearly there is a need for improved predictability considering the uselessness of mouse tumor models for predicting human efficacy of immunotherapies. There is general agreement in the field that induction of type 1 interferons is critical to the success of cancer immunotherapy, but there has been a lack of understanding about which interferons are most important, since there are more than a dozen different type 1 interferons, and they differ between rodents and humans. The general assumption in the field of cancer immunotherapy has been that these type I IFN may all be equally important for cancer immunotherapy. There has been little suggestion in the field to prefer inducing any of the type I IFN over any other. Methods of treatment of diseases or disorders (e.g., cancer or infectious disease) with the synthetic oligonucleotides or compositions disclosed herein are based, in some embodiments, on the concept of “in situ vaccination” or immunization, in which the synthetic oligonucleotide or composition is delivered into immune cells that either have already taken up a relevant antigen (e.g., a tumor or pathogen antigen), or will do so in conjunction with the synthetic oligonucleotide or composition, so that a CD8+ T cell response is induced against those antigens (e.g., cancer neoantigens or pathogen antigens), allowing for systemic responses to eradicate the disease or disorder (e.g., tumor or infection). In some embodiments tumor delivery includes intratumoral injection for tumors accessible to such injection, intraperitoneal injection / infusion for abdominal metastasis such as peritoneal carcinomatosis, intrapleural injection for lung or other cancer associated with pleural effusions, or IV infusion to tumors or metastases in tissues accessible to formulations for IV delivery (such as delivery into the liver, e.g., mediated by a lipid delivery vehicle). Liver metastasis is a huge unmet medical need for cancer immunotherapy, because of the very low response rate of such tumors to immunotherapies currently known in the art. Preferred forms of the synthetic oligonucleotides or compositions disclosed herein can be delivered IV to activate immune cells in the tumor microenvironment in the liver of patients with primary or metastatic tumors in the liver, leading to the induction of CD8+ T cells with systemic activity to control or eradicate tumors in the liver and elsewhere in the body. In some forms tumor-targeted #14509433v1 delivery vehicles are used to deliver the synthetic oligonucleotide or composition into tumor and / or immune cells in tumors outside of the liver. Because of the great potency of the compositions disclosed herein, they can be used at much lower doses than formulations of other nucleic acid therapeutics, acting via other mechanisms, such as FDA approved small interfering RNA (siRNA), commercially available siRNA products having approved dose of 30 mg. Other approaches for inducing immune responses to tumor neoantigens are known in the art, and include for example cancer vaccines. In some embodiments, synthetic oligonucleotides disclosed herein and compositions comprising such oligonucleotides can be used in methods of treatment of a disease or disorder by acting as an adjuvant. In such embodiments, synthetic oligonucleotides can be administered in combination with a vaccine, e.g., a vaccine comprising or encoding an antigen associated with the disease or disorder to be treated. Examples of antigens useful with synthetic oligonucleotides of the present disclosure include cancer antigens and infectious disease antigens. For example, cancer antigens include tumor-associated antigens (TAAs) and tumor-specific antigens (TSAs), also known as neoantigens. These include antigens that are overexpressed in tumor cells relative to normal tissue, and those that are present only in tumor cells (e.g., based on a mutation present in the tumor but not in normal cells). Cancer vaccines are described in Liu, et al. “Cancer vaccines as promising immune-therapeutics: platforms and current progress” Journal of Hematology & Oncology 15:28 (2022) (doi: 10.1186 / s13045-022-01247-x) and Saxena, et al. “Therapeutic cancer vaccines” Nature Reviews Cancer 21:360-378 (2021) (doi: 10.1038 / s41568-021-00346-0), the entire contents of each of which are herein incorporated by reference for this purpose. Examples of cancer antigens and vaccines are provided, e.g., in US Patent 11,096,966 (“Cancer vaccines and vaccination methods”, filed 10 / 22 / 2018); US Patent 9,289,478 (“Formulations of tumour-associated peptides binding to human leukocyte antigen (HLA) class I or class II molecules for vaccine”, filed 4 / 23 / 2009); US Patent Application Publication 2019-0343942-A1 (“Rna encoding a tumor antigen”, filed 4 / 21 / 2017, published 11 / 14 / 2019); US Patent 11,156,617 (“Predicting T cell epitopes useful for vaccination”, filed 8 / 10 / 2017); US Patent 10,159,725 (“Composition of tumor-associated peptides and related anti-cancer vaccine for the treatment of gastric cancer and other cancers”, filed 1 / 10 / 2013); US Patent 10,155,031 (“Individualized vaccines for cancer”, filed 5 / 27 / 2015); US Patent 8,318,677 (“Composition of tumor-associated peptides and related anti-cancer vaccine for the treatment of glioblastoma (GBM) and other cancers”, filed 10 / 1 / 2009); the entire contents of each of which are herein incorporated by reference for this purpose. #14509433v1 Examples of pathogen (e.g., viral and bacterial) antigens include human immunodeficiency virus (HIV) antigens, human papilloma virus (HPV) antigens, influenza A virus antigens, influenza B virus antigens, adenovirus antigens, adeno-associated virus antigens, African Swine Fever Virus antigens, Crimean-Congo Hemorrhagic Fever Virus Antigens, Chikungunya virus antigens, CMV antigens, coronavirus antigens, Coxsackievirus antigens, Dengue virus antigens, Ebola virus antigens, EBV antigens, echovirus antigens, enterovirus antigens, Hepatitis A Virus antigens, Hepatitis B Virus antigens, Hepatitis C Virus antigens, Hepatitis D Virus antigens, Hepatitis E Virus antigens, Human Cytomegalovirus (HCMV) Antigens, Herpes Simplex Virus Antigens, Human T- lymphotropic Virus Antigens, Japanese encephalitis antigens, leukemia virus antigens, Marburg virus antigens, measles virus antigens, metapneumovirus antigens, molloscum contagiosum antigens, mumps virus antigens, Nipah virus antigens, norovirus antigens, Orf virus antigens, parainfluenza virus antigens, parvovirus antigens, poliovirus antigens, rabies virus antigens, respiratory syncytial virus (RSV) antigens, rhinovirus antigens, Rift Valley Fever virus antigens, rotavirus antigens, rubella virus antigens, Simian Immunodeficiency Virus (SIV) Antigens, Tick-Borne Encephalitis Virus (TBEV) Antigens, Tobacco Etch Virus (TEV) Antigens, Varicella Zoster Virus Antigens, Variola Antigens, Venezuelan Equine Encephalitis Virus Antigens, West Nile Virus Antigens, Yellow Fever Virus Antigens, and Zika Virus Antigens. Any one of these antigens can be administered in the form of a vaccine (e.g., a peptide vaccine, or a nucleic acid vaccine such as an RNA / mRNA vaccine encoding such a peptide). In some embodiments, synthetic oligonucleotides of the present disclosure can be administered in combination with (e.g., in advance of, following, or concurrently with) a vaccine (e.g., a cancer vaccine or an infectious disease vaccine). In some embodiments, synthetic oligonucleotides of the present disclosure can be administered in combination with an initial vaccine administration and / or in combination with a booster vaccination. It is envisioned that synthetic oligonucleotides of the present disclosure may in some embodiments be administered in any route effective to serve as an adjuvant for a vaccine, e.g., intratumorally, intravenously, by inhalation, intramuscularly, intraperitoneally, subcutaneously, etc. Drugs of the disclosure are expected to have some activity as monotherapies for the treatment of cancer, superior to the level of clinical activity previously reported for vidutolimod, a first-generation P1 pDC inducer. The compounds of the present disclosure, by overcoming some of the immunosuppressive effects limiting vidutolimod efficacy, are expected to provide superior safety and efficacy for the induction of anti-tumor CD8+ T cells able to mediate systemic tumor regression. Nonetheless, these T cells are #14509433v1 expected to express various checkpoint molecules, that are well known in the art, including for example PD-1, LAG-3, TIM-3, VISTA, etc., and therefore antibodies at approved doses able to block one or more of these suppressive pathways are preferentially used in combination therapy with the drugs of the current disclosure to extend the duration of response. The combination of PD-1 and LAG-3 blockade is especially preferred due to the role of these pathways in inhibiting P1 pDC induction and function. For clinical development, the compounds described in the disclosure can be administered to patients in conjunction with, or in combination with other therapeutic agents, in one or more of the following classes, which are listed in approximate order of priority (see also the relevant claim set below): 1. Checkpoint inhibitor(s) (CPI), such as PD-1 inhibitors (e.g., anti-PD-1 antibodies), LAG-3 inhibitors (e.g., anti-LAG-3 antibodies), CTLA-4 inhibitors (e.g., anti- CTLA-4 antibodies), TIM-3 inhibitors (e.g., anti-TIM-3 antibodies), and / or other immune inhibitors (e.g., other immune checkpoint inhibitor antibodies). 2. Suppressors of pDC (e.g., TGF-b, IL-10, PGE2) 3. Other molecules that de-repress myeloid cells (e.g., CSF1R, IL-12, IL-15) 4. Regulatory T cells (Tregs) 5. Molecules that trigger expansion of pDC (e.g., FLT3L) 6. Cell therapies (e.g., to promote tumor-trafficking of TIL, CAR-T) 7. Ablative therapies (e.g., radiofrequency, microwave, XRT) As used herein, “treat” refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal. As used herein, “therapeutically effective amount” refers to an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount may improve a symptom of a disease. In some embodiments, a therapeutically effective amount of a substance is an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition. As will be appreciated by those of ordinary skill in this art, the effective amount of a substance may vary depending on such factors as the desired biological endpoint, the substance to be delivered, the target cell or tissue, etc. For example, the effective amount of compound in a formulation to treat a disease, disorder, and / or condition may be the amount that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of and / or reduces incidence of one or more symptoms or features of the disease, #14509433v1 disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount. The synthetic oligonucleotides and compositions of the current disclosure are useful in the treatment of a proliferative disease selected from a benign or malignant tumor, solid tumor, carcinoma of the brain, kidney, liver, adrenal gland, bladder, breast, stomach, gastric tumors, ovaries, colon, rectum, prostate, pancreas, lung, vagina, cervix, testis, genitourinary tract, esophagus, larynx, skin, bone or thyroid, sarcoma, glioblastomas, neuroblastomas, multiple myeloma, gastrointestinal cancer, especially colon carcinoma or colorectal adenoma, a tumor of the neck and head, an epidermal hyperproliferation, psoriasis, prostate hyperplasia, a neoplasia, a neoplasia of epithelial character, adenoma, adenocarcinoma, keratoacanthoma, epidermoid carcinoma, large cell carcinoma, non-small-cell lung carcinoma, lymphomas, Hodgkins and Non-Hodgkins, a mammary carcinoma, follicular carcinoma, undifferentiated carcinoma, papillary carcinoma, seminoma, melanoma, smoldering of indolent multiple myeloma, or hematological malignancies (including leukemia, diffuse large B-cell lymphoma (DLBCL), ABC DLBCL, chronic lymphocytic leukemia (CLL), chronic lymphocytic lymphoma, primary effusion lymphoma, Burkitt lymphoma / leukemia, acute lymphocytic leukemia, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, Waldenstrom's macroglobulinemia (WM), splenic marginal zone lymphoma, multiple myeloma, plasmacytoma, or intravascular large B-cell lymphoma). The synthetic oligonucleotides and compositions of the current disclosure may be used for treating infectious diseases. The term “infection” or “infectious disease” relates to the invasion and multiplication of microorganisms such as bacteria, viruses, and parasites that are not normally present within the body. An infection may cause no symptoms and be subclinical, or it may cause symptoms and be clinically apparent. An infection may remain localized, or it may spread through the blood or lymphatic system to become systemic. Infectious diseases in this context, preferably include viral, bacterial, fungal or protozoological infectious diseases. In some embodiments, a dose disclosed herein is considered a fixed dose or a discrete dose. In some embodiments, a dose disclosed herein can be adjusted to depend on body weight or be made dependent on body weight. A non-limiting example includes a dose of 0.2 mg to 2 mg of an oligonucleotide (e.g., synthetic oligonucleotide), or a composition thereof (e.g., pharmaceutical composition thereof) disclosed herein, that can also be administered as 0.02 mg / kg body weight, which depends on kg of body weight. In some embodiments, a dose disclosed herein is independent of body weight. In some embodiments, a dose disclosed #14509433v1 herein can be adjusted to depend on body surface area (e.g., total body surface area, skin surface area to be treated, etc.) or be made dependent on body surface area. A non-limiting example includes a dose of 2 mg of an oligonucleotide (e.g., synthetic oligonucleotide), or a composition thereof (e.g., pharmaceutical composition thereof) disclosed herein, that can also be administered as 2 mg / m2body surface area, which depends on m2of body surface area (e.g., total body surface area). In some embodiments, a dose disclosed herein is independent of body surface area. In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide), or a composition thereof (e.g., pharmaceutical composition thereof) disclosed herein is administered once a day, once every three days, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nice weeks, once every 10 weeks, once every 12 weeks, once every 18 weeks, once every 24 weeks, once a month, once every two months, once every three months, once every four months, once every five months, once every six months, once every seven months, once every eight months, once every nine months, once every 10 months, once every 11 months, once a year, once every two years, once every three years, once every four years. In some embodiments administration may be weekly, every 2 weeks, every 3, monthly, or less often. In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide), or a composition thereof (e.g., pharmaceutical composition thereof) disclosed herein is administered to a subject once a week, twice a week or three times per week, for four weeks, six weeks, eight weeks, 10 weeks, 12 weeks, 14 weeks, 16 weeks, 18 weeks, 20 weeks, 24 weeks, one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, 10 months, 11 months, one year, two years, three years, four years, five years, six years. In some embodiments an oligonucleotide (e.g., synthetic oligonucleotide), or a composition thereof (e.g., pharmaceutical composition thereof) disclosed herein is administered to a subject every three weeks for four weeks, six weeks, eight weeks, 10 weeks, 12 weeks, 14 weeks, 16 weeks, 18 weeks, 20 weeks, 24 weeks, one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, 10 months, 11 months, one year, two years, three years, four years, five years, six years, seven years, eight years, nine years, or 10 years. In some embodiments, the composition is administered every three weeks. In some embodiments, the compound is administered about or at least about every four weeks, five weeks, six weeks, 2 months, three #14509433v1 months, six months, nine months, one year, 1.5 years, two years, 2.5 years, three years, 3.5 years, four years, 4.5 years, five years, 5.5 years, or six years. In some embodiments, the duration of the method for treating a disease or disorder with an oligonucleotide (e.g., synthetic oligonucleotide), or a composition thereof (e.g., pharmaceutical composition thereof) disclosed herein is for about or at least 3 months, for about or at least six months, for about or at least nine months, for about or at least one year, for about or at least 1.5 years, for about or at least two years, for about or at least 2.5 years, for about or at least 3 years, for about or at least 3.5 years, for about or at least 4 years, for about or at least 4.5 years, for about or at least 5 years, for about or at least 5.5 years, for about or at least 6 years, for about or at least 6.5 years, for about or at least 7 years, for about or at least 7.5 years, for about or at least 8 years, for about or at least 8.5 years, for about or at least 9 years, for about or at least 9.5 years, for about or at least 10 years, for about or at least 15 years, for about or at least 20 years or more than 20 years, or for the lifetime of the subject. In some embodiments, an effective amount is from about 0.1 μg to 10,000 mg per dose, at least about 1 μg to 8,000 mg per dose, or 10 μg to 100 μg per dose. In some embodiments the dose administered is about or at least about 1 microgram, about or at least about 5 microgram, about or at least about 10 microgram, about or at least about 50 microgram, about or at least about 100 microgram, about or at least about 200 microgram, about or at least about 350 microgram, about or at least about 500 microgram, about or at least about 1 milligram, about or at least about 5 milligram, about or at least about 10 milligram, about or at least about 50 milligram, about or at least about 100 milligram, about or at least about 200 milligram, about or at least about 350 milligram, about or at least about 500 milligram, about or at least about 1000 mg or more per dose, and any range or combination thereof. In non-limiting examples of a derivable range from the doses disclosed herein, a range of about 5 mg to about 100 mg, about 5 microgram to about 500 milligram, etc., can be administered based on the doses disclosed herein. Stated in terms of subject body weight, in some embodiments the dose administered is about or at least about 1 microgram / kg of body weight, about or at least about 5 microgram / kg of body weight, about or at least about 10 microgram / kg of body weight, about or at least about 50 microgram / kg of body weight, about or at least about 100 microgram / kg of body weight, about or at least about 200 microgram / kg of body weight, about or at least about 350 microgram / kg of body weight, about or at least about 500 microgram / kg of body weight, about or at least about 1 milligram / kg of body weight, about or at least about 5 milligram / kg of body weight, about or at least about 10 milligram / kg of body weight, about #14509433v1 or at least about 50 milligram / kg of body weight, about or at least about 100 milligram / kg of body weight, about or at least about 200 milligram / kg of body weight, about or at least about 350 milligram / kg of body weight, about or at least about 500 milligram / kg of body weight, to about or at least about 1000 mg / kg of body weight or more per administration, and any range or combination thereof. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg / kg of body weight to about 100 mg / kg of body weight, about 5 microgram / kg of body weight to about 500 milligram / kg of body weight, etc., can be administered, based on the numbers disclosed above. The absolute amount (e.g., a discrete dose) will depend upon a variety of factors including the concurrent treatment, the number of doses and the individual patient parameters including age, physical condition, size and weight. These are factors well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is preferred generally that a maximum dose be used, that is, the highest safe dose according to sound medical judgment. In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide),or composition thereof (e.g., pharmaceutical composition thereof) disclosed herein is administered at a dose between 0.1 mg and 10 mg, between 0.2 mg and 10 mg, between 0.3 mg and 10 mg, between 0.4 mg and 10 mg, between 0.5 mg and 10 mg, between 0.6 mg and 10 mg, between 0.7 mg and 10 mg, between 0.8 mg and 10 mg, between 0.9 mg and 10 mg, between 1 mg and 10 mg, between 1 mg and 1,000 mg, between 1 mg and 900 mg, between 1 mg and 800 mg, between 1 mg and 700 mg, between 1 mg and 600 mg, between 1 mg and 500 mg, between 1 mg and 450 mg, between 1 mg and 400 mg, between 1 mg and 350 mg, between 1 mg and 300 mg, between 1 mg and 250 mg, between 1 mg and 200 mg, between 1 mg and 150 mg, between 1 mg and 100 mg, between 1 mg and 90 mg, between 1 mg and 80 mg, between 1 mg and 70 mg, between 1 mg and 60 mg, between 1 mg and 60 mg, between 1 mg and 50 mg, between 1 mg and 49 mg, between 1 mg and 48 mg, between 1 mg and 47 mg, between 1 mg and 46 mg, between 1 mg and 45 mg, between 1 mg and 44 mg, between 1 mg and 43 mg, between 1 mg and 42 mg, between 1 mg and 41 mg, between 1 mg and 40 mg, between 1 mg and 39 mg, between 1 mg and 38 mg, between 1 mg and 37 mg, between 1 mg and 36 mg, between 1 mg and 35 mg, between 1 mg and 34 mg, between 1 mg and 33 mg, between 1 mg and 32 mg, between 1 mg and 31 mg, between 1 mg and 30 mg, between 1 mg and 29 mg, between 1 mg in 28 mg, between 1 mg and 27 mg, between 1 mg and 26 mg, between 1 mg and 25 mg, between 1 mg and 24 mg, between 1 mg and 23 mg, between 1 mg and 22 mg, between 1 mg and 21 mg, between 1 mg and 20 mg, between 1 mg and 19 mg, between 1 mg and 18 mg, between 1 mg and 17 mg, between 1 mg and 16 mg, between 1 mg #14509433v1 and 15 mg, between 1 mg and 14 mg, between 1 mg and 13 mg, between 1 mg and 12 mg, between 1 mg and 11 mg, between 1 mg and 10 mg, between 1 mg and 9 mg, between 1 mg and 8 mg, between 1 mg and 7 mg, between 1 mg and 6 mg, between 1 mg and 5 mg, between 1 mg and 4 mg, between 1 mg and 2 mg, between 1 mg and 1.5 mg, between 1 mg and 3 mg, between 3 mg and 5 mg, between 5 mg and 7 mg, between 7 mg and 9 mg, between 9 mg and 14 mg, between 15 mg and 17 mg, between 18 mg and 31 mg, between 31 mg and 33 mg, between 0.5 mg and 2 mg, between 2 mg and 4 mg, between 11 mg and 13 mg, between 23 mg and 25 mg, between 2 mg and 31 mg, between 2 mg and 30 mg, between 2 mg and 29 mg, between 2 mg and 28 mg, between 2 mg and 27 mg, between 2 mg and 26 mg, between 2 mg and 25 mg, between 2 mg and 24 mg, between 2 mg and 23 mg, between 2 mg and 22 mg, between 2 mg and 21 mg, between 2 mg and 20 mg, between 2 mg and 19 mg, between 2 mg and 18 mg, between 2 mg and 17 mg, between 2 mg and 16 mg, between 2 mg and 15 mg, between 2 mg and 14 mg, between 2 mg and 13 mg, between 2 mg and 12 mg, between 2 mg and 11 mg, between 2 mg and 10 mg, between 2 mg and 9 mg, between 2 mg and 8 mg, between 2 mg and 7 mg, between 2 mg and 6 mg, between 2 mg and 5 mg, between 2 mg and 3 mg. In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide), or composition thereof (e.g., pharmaceutical composition thereof) disclosed herein is administered at a dose of or about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, 1 mg, 1.1 mg, 1.2 mg, 1.3 mg, 1.4 mg, 1.5 mg, 1.6 mg, 1.7 mg, 1.8 mg, 1.9 mg, 2 mg, 2.1 mg, 2.2 mg, 2.3 mg, 2.4 mg, 2.5 mg, 2.6 mg, 2.7 mg, 2.8 mg, 2.9 mg, 3 mg, 3.1 mg, 3.2 mg, 3.3 mg, 3.4 mg, 3.5 mg, 3.6 mg, 3.7 mg, 3.8 mg, 3.9 mg, 4 mg, 4.5 mg, 5 mg, 5.5 mg, 6 mg, 6.5 mg, 7 mg, 7.5 mg, 8 mg, 8.5 mg, 9 mg, 9.5 mg, 10 mg, 10.5 mg, 11 mg, 11.5 mg, 12 mg, 12.5 mg, 30 mg, 13.5 mg, 40 mg, 14.5 mg, 50 mg, 15.5 mg, 60 mg, 16.5 mg, 70 mg, 70.5 mg, 18 mg, 18.5 mg, 19 mg, 19.5 mg, 20 mg, 20.5 mg, 21 mg, 21.5 mg, 22 mg, 22.5 mg, 23 mg, 23.5 mg, 24 mg, 24.5 mg, 25 mg, 25.5 mg, 26 mg, 26.5 mg, 27 mg, 27.5 mg, 28 mg, 28.5 mg, 29 mg, 29.5 mg, 30 mg, 30.5 mg, 31 mg, 31.5 mg, 32 mg, 32.5 mg, 33 mg, 33.5 mg, 34 mg, 34.5 mg, 35 mg, 35.5 mg, 36 mg, 36.5 mg, 37 mg, 37.5 mg, 38 mg, 38.5 mg, 39 mg, 39.5 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, 50 mg, 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 110 mg, 120 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 260 mg, 270 mg, 280 mg, 290 mg, 300 mg, 50 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, six and 50 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, or 1000 mg, or any range or combination thereof. #14509433v1 In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide), or composition thereof (e.g., pharmaceutical composition thereof) disclosed herein is administered at a dose of at least or at least about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, 1 mg, 1.1 mg, 1.2 mg, 1.3 mg, 1.4 mg, 1.5 mg, 1.6 mg, 1.7 mg, 1.8 mg, 1.9 mg, 2 mg, 2.1 mg, 2.2 mg, 2.3 mg, 2.4 mg, 2.5 mg, 2.6 mg, 2.7 mg, 2.8 mg, 2.9 mg, 3 mg, 3.1 mg, 3.2 mg, 3.3 mg, 3.4 mg, 3.5 mg, 3.6 mg, 3.7 mg, 3.8 mg, 3.9 mg, 4 mg, 4.5 mg, 5 mg, 5.5 mg, 6 mg, 6.5 mg, 7 mg, 7.5 mg, 8 mg, 8.5 mg, 9 mg, 9.5 mg, 10 mg, 10.5 mg, 11 mg, 11.5 mg, 12 mg, 12.5 mg, 30 mg, 13.5 mg, 40 mg, 14.5 mg, 50 mg, 15.5 mg, 60 mg, 16.5 mg, 70 mg, 70.5 mg, 18 mg, 18.5 mg, 19 mg, 19.5 mg, 20 mg, 20.5 mg, 21 mg, 21.5 mg, 22 mg, 22.5 mg, 23 mg, 23.5 mg, 24 mg, 24.5 mg, 25 mg, 25.5 mg, 26 mg, 26.5 mg, 27 mg, 27.5 mg, 28 mg, 28.5 mg, 29 mg, 29.5 mg, 30 mg, 30.5 mg, 31 mg, 31.5 mg, 32 mg, 32.5 mg, 33 mg, 33.5 mg, 34 mg, 34.5 mg, 35 mg, 35.5 mg, 36 mg, 36.5 mg, 37 mg, 37.5 mg, 38 mg, 38.5 mg, 39 mg, 39.5 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, 50 mg, 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 110 mg, 120 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 260 mg, 270 mg, 280 mg, 290 mg, 300 mg, 50 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, or 1000 mg, or any range or combination thereof. In some embodiments, an oligonucleotide (e.g., a synthetic oligonucleotide), or composition thereof (e.g., pharmaceutical composition) disclosed herein is administered at a dose greater than or greater than about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, 1 mg, 1.1 mg, 1.2 mg, 1.3 mg, 1.4 mg, 1.5 mg, 1.6 mg, 1.7 mg, 1.8 mg, 1.9 mg, 2 mg, 2.1 mg, 2.2 mg, 2.3 mg, 2.4 mg, 2.5 mg, 2.6 mg, 2.7 mg, 2.8 mg, 2.9 mg, 3 mg, 3.1 mg, 3.2 mg, 3.3 mg, 3.4 mg, 3.5 mg, 3.6 mg, 3.7 mg, 3.8 mg, 3.9 mg, 4 mg, 4.5 mg, 5 mg, 5.5 mg, 6 mg, 6.5 mg, 7 mg, 7.5 mg, 8 mg, 8.5 mg, 9 mg, 9.5 mg, 10 mg, 10.5 mg, 11 mg, 11.5 mg, 12 mg, 12.5 mg, 30 mg, 13.5 mg, 40 mg, 14.5 mg, 50 mg, 15.5 mg, 60 mg, 16.5 mg, 70 mg, 70.5 mg, 18 mg, 18.5 mg, 19 mg, 19.5 mg, 20 mg, 20.5 mg, 21 mg, 21.5 mg, 22 mg, 22.5 mg, 23 mg, 23.5 mg, 24 mg, 24.5 mg, 25 mg, 25.5 mg, 26 mg, 26.5 mg, 27 mg, 27.5 mg, 28 mg, 28.5 mg, 29 mg, 29.5 mg, 30 mg, 30.5 mg, 31 mg, 31.5 mg, 32 mg, 32.5 mg, 33 mg, 33.5 mg, 34 mg, 34.5 mg, 35 mg, 35.5 mg, 36 mg, 36.5 mg, 37 mg, 37.5 mg, 38 mg, 38.5 mg, 39 mg, 39.5 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, 50 mg, 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, #14509433v1 260 mg, 270 mg, 280 mg, 290 mg, 300 mg, 50 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, or 1000 mg, or any range or combination thereof. In certain embodiments, pharmaceutical compositions comprise one or more compositions and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, polysorbate 20, polysorbate 80, gelatin, lactose, dextrose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone. In certain embodiments, pharmaceutical compositions comprise one or more tissue- specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present disclosure to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include a tissue-specific antibody. As disclosed herein, “pharmaceutically acceptable salts” are physiologically and pharmaceutically acceptable salts of the nucleic acids (e.g., salts that retain the desired biological activity of the compound of interest and do not impart undesired toxicological effects thereto). Pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. Pharmaceutical compositions of the present disclosure comprise an effective amount of one or more agents, dissolved or dispersed in a pharmaceutically acceptable carrier. In some embodiments, a “pharmaceutical or pharmacologically acceptable” composition refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards. The compounds are generally suitable for administration to humans. This term requires that a compound or composition be #14509433v1 nontoxic and sufficiently pure so that no further manipulation of the compound or composition is needed prior to administration to humans. In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.000001% (w / w) of an active agent (e.g., an oligonucleotide, such as a synthetic oligonucleotide). In other embodiments, the active compound may comprise between about 2% to about 75% of the weight of the unit (w / w), or between about 25% to about 60%, for example, and any range or combination thereof. In some embodiments, the active agent (e.g., an oligonucleotide, such as a synthetic oligonucleotide) disclosed herein comprises between 0.000001% and 0.00001%, between 0.00001% and 0.0001%, between 0.0001% and 0.001%, between 0.001% and 0.01%, between 0.01% and 0.1%, between 0.1% and 1%, between 1% and 5%, between 5% and 10%, between 10% and 15%, between 15% and 20%, between 20% and 25%, between 25% and 30%, between 30% and 40%, between 40% and 50% (w / w), and any range or combination thereof. In some embodiments, the active agent (e.g., oligonucleotide, such as a synthetic oligonucleotide) comprises 0.00007%, 0.007%, 0.01%, 0.1%, 1% (w / w). As used herein, “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art. The agent may comprise different types of carriers depending on whether it is to be administered in solid, liquid, gel, cream, or aerosol form, and whether it need to be sterile for such routes of administration as injection. An oligonucleotide (e.g., synthetic oligonucleotide), compositions thereof (e.g., pharmaceutical composition thereof) disclosed herein can be administered intravenously, intradermally, intraarterially, intralesionally, intratumorally, intracranially, intrathecally, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intramuscularly, intraperitoneally, subcutaneously, subconjunctival, intravascularly, mucosally, intrapericardially, intraumbilically, intraocularly, into cisterna magna, intracerebroventricularly via eyedrops, orally, topically (e.g., cutaneously), locally, via inhalation (e.g., aerosol inhalation), via injection, via infusion, via continuous infusion, via localized perfusion bathing target cells directly, via a catheter, or via a lavage. In some embodiments, it is useful to administer a combination of oligonucleotides that are each agonists of different TLRs. In some embodiments, a TLR7 agonist is administered with a TLR9 agonist. In some embodiments, a TLR7 agonist is administered #14509433v1 with a TLR8 agonist. In some embodiments, a TLR8 agonist is administered with a TLR9 agonist. In some embodiments, a TLR7 agonist is administered with a TLR8 agonist. In some embodiments, a TLR7 agonist is administered with a TLR8 agonist and a TLR9 agonist. In some embodiments, an oligonucleotide (e.g., synthetic oligonucleotide), or compositions thereof (e.g., pharmaceutical composition thereof) disclosed herein can be administered in creams, in gels, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art. In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intracisterna magna (ICM), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. In any case, the composition may comprise various antioxidants to retard oxidation of one or more components. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof. An oligonucleotide (e.g., synthetic oligonucleotide), or compositions thereof (e.g., pharmaceutical composition thereof) disclosed herein may be administered directly to a tissue. Direct tissue administration may be achieved by direct injection, topical application, or local application. The compounds may be administered once, or alternatively they may be administered in a plurality of administrations. If administered multiple times, the compounds may be administered via different routes. For example, the first (or the first few) #14509433v1 administrations may be made directly into the affected tissue while later administrations may be systemic. The formulations are administered in pharmaceutically acceptable compositions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, excipients, and optionally other therapeutic ingredients. A composition disclosed herein (e.g., synthetic oligonucleotide) may be administered in a pharmaceutical composition. In general, a pharmaceutical composition comprises the composition and a pharmaceutically-acceptable carrier. As used herein, a pharmaceutically-acceptable carrier means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Pharmaceutically acceptable carriers include, without limitation, diluents, fillers, salts, buffers, stabilizers, solubilizers and other materials which are well-known in the art. Such preparations may routinely contain salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the disclosure. Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts. A composition disclosed herein (e.g., oligonucleotide, synthetic oligonucleotide) may be formulated into preparations in solid, semi-solid, liquid or gaseous forms such as tablets, capsules, powders, granules, ointments, solutions, depositories, inhalants and injections, and usual ways for oral, parenteral or surgical administration. The disclosure also embraces pharmaceutical compositions which are formulated for local administration, such as by implants. A composition disclosed herein (e.g., synthetic oligonucleotide), when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. #14509433v1 Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer’s dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Lower doses will result from other forms of administration, such as intravenous administration. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day are contemplated to achieve appropriate systemic levels of compounds. Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety. Unless otherwise indicated, the following terms have the meanings indicated below. As used herein, “about” means within ±10% of a value. As a non-limiting example, statements in accordance with “about 70% inhibition of [target]” indicate that [target] levels are inhibited within a range of 60% and 80%. Similarly, statements in accordance with “about 100” indicate values within a range of 90 to 110. As used herein, “administration” or “administering” refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, intratumoral, or intramuscular injection or infusion, or intrathecal administration. Administration details are discussed in further detail herein. As used herein, “administered concomitantly” or “co-administration” means administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage #14509433v1 form, by the same route of administration, or in parallel. Co-administration encompasses both parallel and sequential administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. As used herein, “ameliorate” in reference to a treatment means improvement or lessening in at least one indicator, sign or symptom of a disease, disorder or condition relative to the same indicator, sign or symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of an indicator, sign or symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom. As used herein, “animal” means a human or non-human animal. As used herein, “chimeric oligonucleotide” or “chimeric nucleic acid” refers to an oligonucleotide or nucleic acid that has at least two chemically distinct regions. As used herein, “branching group” refers to a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 additional groups. In certain embodiments, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a spacer and / or a cleavable moiety. As used herein, “chemically distinct region” refers to a region of a compound that is in some way chemically different than another region of the same compound. For example, a region having 2’-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2’-O-methoxyethyl modifications. As used herein, “chirally enriched population” refers to a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules of a chirally enriched population are modified oligonucleotides or compounds comprising modified oligonucleotides. As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases means #14509433v1 nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine and guanine (G), 5-methyl cytosine (5-Me-C) and guanine (G). Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to oligonucleotides means that oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide. As used herein, “constrained ethyl” or “cEt” or “cEt modified sugar moiety” refers to a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed by a bridge connecting the 4’-carbon and the 2’-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4’-CH(CH3)-O-2’, and wherein the methyl group of the bridge is in the S configuration. As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” refers to nucleobases that are immediately adjacent to each other in a sequence. As used herein, “differently modified” means chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are “differently modified,” even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are “differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising one 2’-OMe modified sugar and one unmodified adenine nucleobase and a nucleoside comprising one 2’-OMe modified sugar and one unmodified thymine nucleobase are not differently modified. Chemical modifications are discussed in further detail herein. As used herein, “dose” means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where intratumoral administration is desired and the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month. #14509433v1 As used herein, “dosing regimen” is a combination of doses designed to achieve one or more desired effects. As used herein, “effective amount” means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual’s medical condition, and other relevant factors. As used herein, “efficacy” means the ability to produce a desired effect. As used herein, “expression” includes all the functions by which a gene’s coded information is converted into structures present and operating in a cell, tissue or animal. Such structures include, but are not limited to, the products of transcription and translation. As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson- Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. As used herein, the term “internucleoside linkage” refers to the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein “modified internucleoside linkage” refers to any such linkage other than a phosphodiester (PO) linkage. “Phosphorothioate internucleoside linkage” or (PS) is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. In some embodiments, the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with an organic or inorganic moiety selected from =S, =Se, =NR’, -SR’, -SeR’, -N(R’)2, B(R’)3, -S-, - Se-, and -N(R’)-, wherein each R’ is independently as defined and described in the present disclosure. In some embodiments, an internucleoside linkage is a phosphotriester linkage, or phosphorothioate triester linkage. In some embodiments, an internucleoside linkage is one of, e.g., PNA (peptide nucleic acid) or PMO (phosphorodiamidate morpholino oligomer) linkage. In some embodiments, a modified internucleoside linkage is a non-negatively charged internucleoside linkage. In some embodiments, a modified internucleoside linkage is a neutral internucleoside linkage. It is understood by a person of ordinary skill in the art that an internucleoside linkage may exist as an anion or cation at a given pH due to the existence of acid or base moieties in the linkage. Internucleoside linkages are discussed in further detail herein. #14509433v1 As used herein, “linked nucleosides” means adjacent nucleosides linked together by an internucleoside linkage. As used herein “linker”, or “linking moiety” and the like refer to any chemical moiety which connects one chemical moiety to another. As appreciated by those skilled in the art, a linker can be bivalent or trivalent or more, depending on the number of chemical moieties the linker connects. In some embodiments, a linker is a moiety which connects one oligonucleotide to another oligonucleotide in a multimer. In some embodiments, a linker is a moiety optionally positioned at the 3’ or 5’ end of the oligonucleotide. As used herein, “modulate” or “modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating TLR activity can mean to increase or decrease the level of activation of a TLR receptor and it’s downstream modulators in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. As used herein, “nucleic acid” refers to molecules composed of linked nucleosides. Nucleic acids include, but are not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids. Nucleic acids are discussed in further detail herein. As used herein, “single-stranded” in reference to a given nucleic acid compound means the compound has only one oligonucleotide or nucleic acid strand. A compound consisting of one oligonucleotide or nucleic acid molecule, wherein the oligonucleotide of the compound is self-complementary, is a single-stranded compound. A single-stranded compound may be capable of binding to a complementary compound to form a duplex. As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methyl cytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. Modified and unmodified nucleobases are discussed in further detail herein. As used herein, “nucleobase sequence” or “nucleic acid sequence” refers to the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or linkage modification(s). As used herein, “nucleoside” refers to a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “modified nucleoside” refers to a nucleoside comprising a #14509433v1 modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are present between those that are linked). Nucleosides are discussed in further detail herein. As used herein, “oligomeric compound” refers to an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “single-stranded oligomeric compound” is an unpaired oligomeric compound. The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.” As disclosed herein, an “oligonucleotide” refers to a strand of nucleosides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to an exchangeable organic base, such as pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a purine (e.g., adenine (A) or guanine (G))) which are linked, having a length of typically between eight and 100 nucleobases. Each nucleoside and internucleoside linkage of an oligonucleotide may be modified or unmodified, relative to a reference nucleoside sequence. As disclosed herein, a “modified oligonucleotide” refers to an oligonucleotide wherein at least one nucleoside or internucleoside linkage is modified relative to a naturally-occurring strand of linked nucleosides. As used herein, an “unmodified oligonucleotide” refers to an oligonucleotide that does not comprise any nucleoside modifications or internucleoside linkage modifications. Oligonucleotides are discussed in further detail herein. As used herein, “parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, intracranial administration, intrathecal administration, intracisterna magna administration, and intracerebroventricular administration. As used herein, “pharmaceutical agent” refers to a compound that provides a therapeutic benefit when administered to a subject. As used herein “pharmaceutical composition” refers to a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution (i.e., a pharmaceutically acceptable carrier). In certain embodiments, a pharmaceutical composition shows activity in free uptake assays in certain cell lines. Pharmaceutical agents and compositions are discussed in further detail herein. #14509433v1 As used herein, “pharmaceutically acceptable carrier or diluent” refers to any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, or sterile buffer solution. As used herein, “phosphorothioate linkage” refers to a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage. Internucleoside linkages are discussed in further detail herein. As used herein, “phosphorus moiety” refers to a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate. As used herein, “portion” when used in the context of a nucleic acid refers to a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound. As used herein, “prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. As used herein, a “region” of a nucleic acid sequence is a portion of the nucleic acid having at least one identifiable structure, function, or characteristic, including a particular sequence. As used herein, “segments” when used in the context of nucleic acids refers to contiguous regions within a nucleic acid or sub-portions of a nucleic acid. As used herein, “RNA” refers to an RNA transcript that encodes a protein and includes pre-mRNA and mature mRNA unless otherwise specified. As used herein, “self-complementary” in reference to an oligonucleotide means that the oligonucleotide at least partially hybridizes to itself or is at least partially capable of hybridizing to itself. As used herein, “side effects” refers to physiological diseases and / or conditions attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function test abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. #14509433v1 As used herein, “spacer” refers to a group of atoms that connect two moieties, such as a linker and an oligonucleotide, two agonist motifs of an oligonucleotide, or an agonist motif of an oligonucleotide to an aggregation motif of the oligonucleotide. As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the results of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage. As used herein, “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. A nucleobase sequence which is substantially complementary to a second sequence is not required to be identical to the reverse complement of the second sequence, but is mostly or nearly identical to the reverse complement of the second sequence. In addition, one of ordinary skill in the biological and / or chemical arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena. As used herein, “sugar moiety” refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2’-OH(H) ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate. Sugar moieties are discussed in further detail herein. As discussed herein, an individual who is “susceptible to” a disease, disorder and / or condition is one who has a higher risk of developing the disease, disorder and / or condition than does a member of the general public. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition is predisposed to have that disease, disorder and / or condition, due to genetic factors such as one or more mutations or deletion in #14509433v1 the individual’s genome. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition may not have been diagnosed with the disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition may exhibit symptoms of the disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition may not exhibit symptoms of the disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition. As used herein, “symptom” or “hallmark” refers to any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. In certain embodiments, a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests. As used herein, “synergy” or “synergize” mean an effect of a combination of two or more components that is greater than the additive effects of each component alone at the same doses. EXAMPLES The examples below illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif, as outlined in the present disclosure. As explained above, compositions which use minimal RNA and DNA motifs that are optimized agonists for TLR7 and TLR9 respectively, assembled into an aggregate using for example polyG motifs are provided herein. In some instances, aggregates are two or more separate oligonucleotides that interact noncovalently with each other through an aggregation motif(s). Example 1. Induction of IFN-α by compounds of the present disclosure in a human PBMC assay. Table 7. Examples of oligonucleotides useful in the present disclosure #14509433v1 Lowercase letters in sequences and ‘d’ in modification pattern represent a deoxyribonucleoside; Capital letters in sequences and ‘r’ in modification pattern represent a ribonucleoside; * indicates phosphorothioate (PS) internucleoside linkage (all other internucleoside linkages are PO) All oligonucleotides were synthesized and purified using standard methods well known in the art at Axolabs GmbH, Kulmbach, Germany. The in vitro assays shown also were performed there. Experimental conditions for in vitro assay: PBMC were isolated from three different normal human donors by Ficoll gradient centrifugation and cultured in flat bottom 96 well plates in standard culture medium at 100,000 cells / well for 24 hr. supernatants were harvested and assayed using MESO SCALE DISCOVERY (MSD) immunoassay for IFN-α concentration. IFN-α efficacy was graded according to the concentration of the oligonucleotide required to achieve at least 400 pg / mL in IFN-α secretion under the culture conditions in at least 1 of the 3 donors tested as follows, where the most potent oligonucleotides are active at the lowest concentration tested, and are graded as ++++: 1. + 3 µg / mL 2. ++ 1 µg / mL 3. +++ 0.33 µg / mL 4. ++++ 0.11 µg / mL The nuclease-resistant CpG-A DNA is shown without transfection – the other oligonucleotides contain nuclease-sensitive RNA motifs and therefore were transfected into the PBMC using DOTAP. Considering that in the literature CpG-A ODN are the strongest #14509433v1 known inducers of IFN-α secretion, these results showing superior efficacy with TLR7 and TLR7 / 9 dual agonists are surprising and unexpected. The increased efficacy of the TLR7 agonist motifs containing GUGU compared to those containing UUUUUUUUUU (SEQ ID NO: 160) is believed to be due to the release of G during RNAse digestion in the pDC endosomes, allowing this G to bind the TLR71stsite, and the UUU to bind the 2ndsite as identified in structural studies of TLR7 (Zhang et al., Immunity, 2016). Example 2. The oligonucleotides in Table 7 above were used together with standard positive and negative controls to induce IFN-α secretion in normal human peripheral blood mononuclear cells (PBMC) from three different donors, as described above. Selected data are shown in FIG. 1 for two of the most potent oligonucleotides tested, AMK4 and AMK7, showing the surprising and unexpected increase in both potency and peak induction of IFN-α compared to the CpG-A DNA positive control 2216, which is routinely used in experiments as the strongest reported inducer of IFN-α. Other controls used in the experiment included polyIC (TLR3 agonist positive control), XD-1024 (immune stimulatory RNA [isRNA] positive control), and the sequence of CpG-A 2216 in which the C have been replaced with 5-methyl cytidine to prevent TLR9 activation (negative control). Further dose-response experiments and more sophisticated studies using techniques known in the art such CyTOF, RNA Seq, single cell RNA Seq, and similar in vitro methods will be performed to more fully characterize these novel classes of compounds, which may, for instance, mimic retroviral and viral replicative forms. Such assays also will be performed in tumor-associated cells (e.g., ascites from patients with peritoneal carcinomatosis, as we have reported for vidutolimod in Miller et al. Ann Surg Oncol, 2020) in which myeloid suppression of the pDC-induced IFN-α secretion may be studied, and overcome. Example 3. Induction of cytokines (IFN-α, IL-6, and TNF-α) by TLR7 / 8 and TLR9 agonists in a human PBMC assay. PBMC were isolated from a normal human donor by Ficoll gradient centrifugation and cultured in flat bottom 96 well plates in standard culture medium at 100,000 cells / well for 24 hr. with R848, Z009 (TLR9 agonist; sequence of AMK17), Z007 (TLR7 / 8 agonist; sequence of AMK1), or Z007 and Z009 at various concentrations. Supernatants were harvested and assayed using MSD for IFN-α, IL-6, and TNF-α concentration. #14509433v1 The data in FIG. 2A-2C show that the combination of a TLR7 / 8 agonist with a TLR9 agonist results in the best induction of IFN-α (FIG. 2A) when compared with TLR7 / 8 or TLR9 agonists alone, while avoiding induction of an inflammatory NFκB response, indicated by induction of IL-6 (FIG. 2B) and TNF-α (FIG. 2C). The results also show the oligonucleotide TLR7 / 8 agonist (Z007) stimulates IFN-α without stimulating IL-6 or TNF-α, whereas the conventional small molecule TLR7 agonist (R848) fails to stimulate IFN-α while it does stimulate IL-6 and TNF-α. Example 4. Induction of IFN-α and TNF-α by TLR7 / 8 and TLR9 agonists in a human PBMC assay. For samples labeled with “AMK” prefix in the labels of FIGs. 3A and 3B, TLR agonists were diluted in Hanks' Balanced Salt Solution (HBSS) and transferred to 96-well U- bottom plates in 20 uL at the indicated concentration (0.2, 0.25, 0.5, or 1.0 ug / mL). DOTAP (1 mg / mL) was diluted 1:5 in HBSS and 5uL was added to each well. These solutions were incubated for 15 minutes at room temperature, after which 75 uL of growth media and 100 uL containing 150,000 cells of frozen normal human donor PBMC (StemCells Cat# 70025.1, Lot# 2312421005), to result in 200 uL total volume per well. For samples labeled with “ZT” prefix in the labels of FIGs. 3A, 3B, 3C, and 3D, TLR agonists were formulated in MC3 lipid nanoparticles (LNP) or DOTAP liposomes using standard methods. TLR agonist-containing LNPs and liposomes were added to PBMCs at the indicated concentration (0.125, 0.25, 0.5, or 1.0 ug / mL). ZT024 formulation tested in FIGs. 3C and 3D was stored at 4°C for 2 months prior to testing with PBMCs. Cells were incubated at 3°C for 24 hours and cell supernatants were harvested for LUMINEX assay of TNF-α and IFN-α. Analytic results are shown in FIGs. 3A, 3B, 3C, and 3D. Details regarding the various compounds tested in this Example are provided in Table 8. Table 8. TLR agonist formulations “monomer” indicates that the oligonucleotide of the formulation did not undergo an aggregation procedure prior to formulating; “Heat Ramp” indicates the oligonucleotide of the formulation underwent an aggregation procedure involving a gradual heat ramp; “Salt Spike” indicates the oligonucleotide of the formulation underwent an aggregation procedure involving a sharp increase in salt concentration; “Aggregated” indicates the oligonucleotide of the formulation underwent an aggregation procedure involving standard methods; #14509433v1 “Frozen” indicates the oligonucleotide was frozen prior to being formulated. “N / A” indicates data not available. #14509433v1 #14509433v1 #14509433v1 #14509433v1 *F / T = freeze / thaw cycle The results shown in FIGs. 3A-3D demonstrate the surprising efficacy of the TLR agonist molecules of the present disclosure. The data in FIGs. 3A and 3B demonstrate several beneficial properties of the formulations tested. First, the data shown for AMK17 and AMK29 demonstrate: a.) GU-rich dsRNA oligonucleotides showed superior IFN-α induction (indicative of P1 pDC induction through IRF7) if they were capable of forming a stem loop hairpin with more than 5 bp dsRNA, as demonstrated by comparing the much higher IFN-α induction of AMK17 transfected into human PBMC with DOTAP (“AMK17 w / 5ul DOTAP” in FIGs. 3A and 3B) to AMK29 (“AMK29-P1 w / 5ul DOTAP” in FIGs. 3A and 3B), which features increased GU content, but a reduced length of dsRNA to only 5 base pairs adjacent to the loop, and another 4 base pairs at the blunt end of the hairpin (dsRNA indicated by underlining in the AMK29 sequence in Table 4). b.) GU-rich ssRNA of 9 bases in a hairpin oligo (AMK29 sequence, ssRNA region is indicated by italics in the AMK29 sequence in Table 4) shifts the cytokine induction from the IRF7 pathway (readout with IFN-α) to the NFκB pathway (readout by TNF-α and other #14509433v1 inflammatory cytokines, as reported in Forsbach et al., J. Immunol., 2008; Forsbach et al., Nucleic Acid Ther. 2011; and Tong et al., JEM 2024. c.) These data support the surprising and unexpected finding that although every review article on TLR7 / 8 describes them as receptors for ssRNA, in fact this is only true for the induction of inflammatory cytokines, and not for the induction of IFN-α secretion, in which case the GU-rich motifs instead should be presented in the context of a dsRNA structure. Given that induction of maximal IFN-α is greatly preferred for cancer immunotherapy, the present disclosure provides for compositions of dsRNA > 5 base pairs in length containing GU-rich sequences as TLR7 (and TLR8) agonists. dsRNA is well known in the art and can be synthesized either as 2 different oligoribonucleotides that are hybridized to each other, or in the form of a stem loop design (such as AMK17), using either a tetraloop or other loop to allow hybridization of the complementary RNA sequences. Second, the data for AMK26, AMK28, AMK27, and ODN 2216 in FIG. 3A demonstrate: a.) The efficacy of CpG-A DNA such as ODN 2216 (featuring a 10 base palindrome that is believed to form a 10 bp dsDNA CpG domain) for IFN-α induction is greatly increased by formulation in DOTAP (FIG. 3A) b.) Reduction of the length of the palindrome from 10 bases to 8 bases (AMK26), or shorter than 6 bases (AMK27, AMK28) progressively reduces the IFN-α induction (FIG. 3A). The data in FIGs. 3C and 3D demonstrate several beneficial properties of the formulations tested. First, the data shown for LNP- and DOTAP liposome-formulated TLR7 / 8 agonists (e.g., ZT024, ZT039, ZT040) demonstrate: a.) TLR7 / 8 agonist formulations induced significantly higher IFN-α production in human PBMC compared to TLR9 agonists, which heretofore were the strongest known IFN- α inducers. b.) Addition of a low concentration (0.5 ug / mL) of CpG-A DNA agonist AMK1 in DOTAP (e.g., ZT046) to either of the TLR7 / 8 formulations significantly enhanced the IFN-α response to low RNA concentrations. With the DOTAP formulation, there was also an increase in the maximal IFN- α response achieved, indicating synergy. This is a surprising and unexpected result, since synergy of TLR7, TLR8, and TLR9 agonists has not previously been reported (see, e.g., Forsbach et al., Nucleic Acid Ther. 2011). c.) Formulation in LNP / liposome confers stability to the TLR agonists, with ZT024 showing strong activity after 2 months stored at 4°C (FIG. 3C). #14509433v1 These data support the development of combination approaches to TLR7 / 8 and TLR9 agonists, and novel compositions of the same. Example 5. TLR 7 / 8 and TLR9 agonists were tested for activation of appendiceal tumor- associated cells (ascites cells) or used for supernatant analysis. Studies of interferon release, chemokine production, and cytokine production in cell supernatants following 16 hours of culture with vehicle (PBS control) or various TLR agonists were performed. Conditions included PBS control; R848 small molecule TLR7 / 8 agonist (at 0.5 µg / mL); CpG-A 2216 TLR9 agonist (1 µg / mL); ZT045 RNA / DNA agonist for TLR7 / 8 / 9; ZT057 RNA agonist for TLR7 / 8; and ZT065 CpG-POP TLR9 agonist. Studies of transcriptional responses in cells treated with agonists by bulk RNA- sequencing were also performed. Conditions included PBS control; R848 (0.5 µg / mL); ZT045 (0.5 µg / mL); ZT057 (0.5 µg / mL); ZT065 (0.5 µg / mL). The TLR7 / 8 small molecule agonist R848 induced inflammatory responses with minimal IFN-α secretion, indicating a potentially inferior immune profile for cancer immunotherapy. CpG-A 2216 (referred to as “2216” or “CpG-A”) was noninflammatory and did not induce IFN-α secretion from ascites cells. By contrast, CpG-POP TLR9 agonist (referred to as “CpG-POP” or “ZT065”) was ten times more potent than CpG-A 2216 for IFN-α induction (FIGs. 4A-4M). For bulk RNA-sequencing, ascites cells were collected from a patient with an appendiceal malignancy and cultured for 16 hours in biological triplicates with the indicated treatments (PBS; R848, “TLR7 / 8 small molecule”; ZT045, “TLR 7 / 8 / 9 RNA / DNA”; ZT057, “TLR7 / 8 RNA”; ZT065, “TLR9 DNA”). Data clustering showed strong reproducibility between replicates and distinct transcriptional patterns. The small molecule R848 induced a markedly different transcriptional profile compared to ZT057 (“TLR 7 / 8 RNA”), indicating different biologic effects. ZT045 (“TLR7 / 8 / 9 RNA / DNA”) clustered between ZT065 (“TLR9 DNA) and ZT057, indicating that each of these treatments has distinct effects, with the triple agonist being intermediate between the others. The polyG motifs in CpG-A DNA are not required for the desired immune stimulatory effects on TLR9, which was achieved using ZT065 (“TLR9 DNA”, the CpG-POP agonist design) (FIG. 5). Differentially expressed genes (DEGs) induced by treatment with TLR agonists delivered via lipid nanoparticles (LNPs) were next evaluated. For each treatment condition, the DEGs from bulk RNA-sequencing data were determined using standard methods with a log2 fold change (FC) cutoff of >1, and an adjusted p-value of < 0.05. For each DEG, the #14509433v1 overlap was determined between treatment conditions to determine the presence and magnitude of stimulus-specific gene induction. Each of the TLR agonists induced both shared and unique changes in gene expression (FIGs. 6A-6B), with ZT065 inducing the smallest number of unique transcriptional changes, consistent with more limited expression of TLR9 compared to TLR7 / 8. Induction of M1 type macrophage signatures was evaluated using immune cell gene signatures and methods from TIMER, CIBERSORT, QUANTISEQ, xCELL, MCP-counter, and EPIC. Of these methods, CIBERSORT, QUANTISEQ, and xCELL had signatures for M1 type macrophages and were used to determine whether TLR agonist treatments via LNP delivery had superior biologic effects for induction of M1 signatures associated with improved tumor response and survival. Human “M1” signatures were strongly induced by all three agonists, but not by R848, indicating anti-tumor efficacy. “M1” gene signature induction by ZT065 was slightly lower than the other TLR agonists, indicating that activation of TLR7 / 8 with an RNA agonist in addition to TLR9 stimulation using a CpG DNA agonist could improve therapeutic outcomes (FIGs. 7A-7C). Induction of immune response genes by TLR agonists was evaluated, including genes implicated in antigen-presenting cell (APC) activation (supporting cross-priming of CD8+ T cells), T cell recruitment (e.g., to tumor), T cell activation (indicated by IFN-γ production), cytotoxic function (tumor cell killing), and adaptive resistance (rationale for checkpoint inhibitor combinations). Common immune activation genes involved in anti-tumor immunotherapy were induced by TLR agonists ZT045, ZT057, and ZT065 much more potently than by R848 (FIGs. 8A-8I). Evaluation of gene signatures across treatments revealed that TLR agonists delivered via LNP reduced immunosuppressive MDSC signatures (“Akkari_MDSC”, see Akkari et al., Nature Rev Immunol, 2024, FIG. 9A) and induced clinical response signatures (“Ayers_IFNg”, FIG. 9B; “Ayers_IFNg_expanded_18”, FIG. 9C; and “MSigDB_GOBP_COPII_VESICLE_core_com”, FIG. 9D) compared to R848. TLR agonists ZT045, ZT057, and ZT065 were also shown to strongly induce IFN-α / IFN-β gene transcription, while R848 did not (FIGs. 10A-10M). Additionally, TLR agonists ZT045, ZT057, and ZT065 induced strong inflammatory or immunomodulatory gene expression associated with tumor immunosuppression compared to R848 (FIGs. 11A-11D). Differential gene expression was also compared between R848; TLR agonists ZT045, ZT057, and ZT065; and PBS control. Marked transcriptional differences across treatments from PBS control were observed (FIGs. 12A (R848), 12B (ZT045), 12C (ZT057), and 12D (ZT065)). DEGs were also compared between treatment with TLR agonists ZT045, ZT057, #14509433v1 and ZT065 and showed limited differences between the various treatments (FIGs. 13A (ZT045 vs ZT057), 13B (ZT045 vs ZT065), and 13C (ZT057 vs ZT065)). Finally, DEGs induced by TLR agonists ZT045, ZT057, and ZT065 were compared to those induced by R848. Marked transcriptional differences were observed between the various TLR agonists and the small molecule agonist R848 (FIGs. 14A (ZT045 vs R848), 14B (ZT057 vs R848) and 14C (ZT065 vs R848)). Taken together, the data show that TLR agonists designed and tested in these Examples robustly induce immune responses, especially with respect to desirable anti-tumor signatures and without inducing undesirable inflammation, indicating that they may offer potent, novel immunotherapeutic agents. EQUIVALENTS While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure. This present disclosure is not limited in its application to the details of construction and the arrangement of components set forth in the Detailed Description. The disclosure is capable of other embodiments and of being practiced or of being carried out in various ways. Also, the phraseology and terminology used herein is for the purpose of description and #14509433v1 should not be regarded as limiting. The use of “including,” “comprising,” or “having,” “containing,” “involving,” and variations thereof herein, is meant to encompass the items listed thereafter and equivalents thereof as well as additional items. All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms. The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc. As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law. As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also #14509433v1 allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc. It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited. In the claims, as well as in the specification, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of” and “consisting essentially of” the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B,” the disclosure also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B.” Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments disclosed herein. Such equivalents are intended to be encompassed by the following claims. All references, including patent documents, disclosed herein are incorporated by reference in their entirety. #14509433v1
Claims
CLAIMS What is claimed is:
1. A method of inducing an immune response in a cell, the method comprising contacting the cell with (a) a TLR7 agonist, and (b) a TLR9 agonist.
2. The method of claim 1, wherein the TLR7 agonist is a TLR7 / 8 agonist.
3. The method of claim 1 or 2, wherein the TLR7 agonist and the TLR9 agonist are each independently formulated with a lipid nanoparticle (LNP) or a liposome.
4. The method of claim 3, wherein the LNP comprises an ionizable or cationic lipid, a non-cationic lipid, a structural lipid, and a polymer conjugated lipid.
5. The method of claim 4, wherein the lipids of the LNP comprise a molar ratio of about 20-60% cationic or ionizable lipid, about 5-25% non-cationic lipid, about 25-55% structural lipid and about 0.5-15% polymer conjugated lipid, optionally wherein the structural lipid is a sterol, and optionally wherein the non-cationic lipid is a phospholipid.
6. The method of claim 3, wherein the liposome comprises DOTAP.
7. A synthetic oligonucleotide comprising a CpG motif and a self- complementary palindrome motif, wherein the CpG motif comprises a cytidine deoxyribonucleoside (C) linked to a guanosine deoxyribonucleoside (G) by a phosphodiester internucleoside linkage, and wherein the self-complementary palindrome motif comprises a 5′ segment of 2-15 nucleosides and a 3′ segment of 2-15 nucleosides, wherein the 5′ segment and the 3′ segment are complementary, such that the self-complementary palindrome motif is capable of forming a double-stranded segment.
8. The synthetic oligonucleotide of claim 7, further comprising a tetraloop sequence. #14509433v19. The synthetic oligonucleotide of claim 8, wherein the tetraloop sequence is located between the 5′ segment of the self-complementary palindrome motif and the 3′ segment of the self-complementary palindrome motif.
10. The synthetic oligonucleotide of claim 8, wherein the tetraloop sequence is located adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif, optionally wherein the tetraloop sequence is directly adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif.
11. The synthetic oligonucleotide of claim 8, wherein the tetraloop sequence is located adjacent the 3′ end of the 3′ segment of the self-complementary palindrome motif, optionally wherein the tetraloop sequence is directly adjacent the 3′ end of the 3′ segment of the self-complementary palindrome motif, optionally wherein the tetraloop sequence comprises a nucleobase sequence of GNRA, ANYA, CUYG, UNAC, or UNCG, wherein N is any nucleobase, R is A or G; and Y is C, U, or T, further optionally wherein the tetraloop sequence comprises a nucleobase sequence of UUCG or GCAA.
12. The synthetic oligonucleotide of any one of claims 7 to 11, wherein the CpG motif is located between the 5′ segment of the self-complementary palindrome motif and the 3′ segment of the self-complementary palindrome motif.
13. The synthetic oligonucleotide of any one of claims 7 to 11, wherein the CpG motif is located adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif, optionally wherein the CpG motif is directly adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif.
14. The synthetic oligonucleotide of any one of claims 7 to 11, wherein the CpG motif is located adjacent the 3′ end of the 3′ segment of the self-complementary palindrome motif, optionally wherein the CpG motif is directly adjacent the 3′ end of the 3′ segment of the self-complementary palindrome motif. #14509433v115. The synthetic oligonucleotide of any one of claims 7 to 14, wherein the 5′ segment of the self-complementary palindrome motif is 3-8 nucleosides in length, and / or the 3′ segment of the self-complementary palindrome motif is 3-8 nucleosides in length.
16. The synthetic oligonucleotide of any one of claims 7 to 15, wherein the 5′ segment of the self-complementary palindrome motif is 4-6 nucleosides in length, and / or the 3′ segment of the self-complementary palindrome motif is 4-6 nucleosides in length.
17. The synthetic oligonucleotide of any one of claims 7 to 16, wherein the synthetic oligonucleotide comprises 8 or fewer modified internucleoside linkages, optionally wherein the synthetic oligonucleotide comprises 6 or fewer modified internucleoside linkages, further optionally wherein the synthetic oligonucleotide comprises 5, 4, 3, 2, 1, or no modified internucleoside linkages.
18. The synthetic oligonucleotide of any one of claims 7 to 17, wherein the synthetic oligonucleotide comprises a nucleobase sequence selected from the group consisting of: GGGGUUUUUUUGUGUACGACGUCGUGGGGGGG (SEQ ID NO: 169), GGGGUCGACGUCGUGGGGGGG (SEQ ID NO: 177), GGGGACGUCGUCGUGGGGGGG (SEQ ID NO: 178), CGUGUAAACGUUAACGUGUGUUCGCACACGUUAACGUUUACACG (SEQ ID NO: 181), ACGACGUCGUUUUGUGUGUUCGCACACAAAACGACGUCGUG (SEQ ID NO: 182), ACGACGUCGUUUUGUGUGUUCGCACACAAAACGACGUCGUGGGGG (SEQ ID NO: 183), UUUUUUUGUGUACGACGUCGUG (SEQ ID NO: 184), ACGACGUCGUUGUGUGUUUUUUUUG (SEQ ID NO: 185), ACGACGUCGUUUUGGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAAC ACACCUUUACGACGUCGUGGGGG (SEQ ID NO: 186), GGGGACGACGUCGUGGGGGGG (SEQ ID NO: 188), ACGACGUCGUCAACGUUG (SEQ ID NO: 189), and ACGACGUCGUUUUUCAUCGAUG (SEQ ID NO: 197), wherein each U nucleobase may optionally and independently be a T nucleobase. #14509433v119. The synthetic oligonucleotide of any one of claims 7 to 18, wherein the synthetic oligonucleotide comprises a structure selected from the group consisting of: g*g*GGUUUUUUUGUGUacgacgtcgtggg*g* g*g*g (SEQ ID NO: 169), g*g*ggtcgacgtcgtggg*g*g*g*g (SEQ ID NO: 177), g*g*ggacgtcgtcgtggg*g*g*g*g (SEQ ID NO: 178), CGUGUAAACGUUAACGUGUGUUCGCacacgttaacgtttacacg (SEQ ID NO: 181), acgacgtcgtUUUGUGUGUUCGCACACAAAacgacgtcgtg (SEQ ID NO: 182), acgacgtcgtUUUGUGUGUUCGCACACAAAacgacgtcgtggg*g*g (SEQ ID NO: 183), UUUUUUUGUGUacgacgtcgtg (SEQ ID NO: 184), acgacgtcgttGUGUGUUUUUUUU*g (SEQ ID NO: 185), acgacgtcgttttGGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACCttt acgacgtcgtggg*g*g (SEQ ID NO: 186), ggggacgacgtcgtggggggg (SEQ ID NO: 188), acgacgtcgtcaacgttg (SEQ ID NO: 189), and acgacgtcgtttttcatcgatg (SEQ ID NO: 197), wherein lower case letters represent deoxyribonucleosides, upper case letters represent ribonucleosides, ‘ppp’ represents a triphosphate, ‘*’ represents a phosphorothioate internucleoside linkage, and the absence of a ‘*’ between two letters represents a phosphodiester internucleoside linkage.
20. A synthetic oligonucleotide comprising a TLR7 agonist motif, a tetraloop sequence, and a self-complementary palindrome motif, wherein the self-complementary palindrome motif comprises a 5′ segment of 2-30 nucleosides and a 3′ segment of 2-30 nucleosides, wherein the 5′ segment and the 3′ segment are complementary, such that the self-complementary palindrome motif is capable of forming a double-stranded segment.
21. The synthetic oligonucleotide of claim 20, wherein the tetraloop sequence is located between the 5′ segment of the self-complementary palindrome motif and the 3′ segment of the self-complementary palindrome motif.
22. The synthetic oligonucleotide of claim 20, wherein the tetraloop sequence is located adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif, optionally wherein the tetraloop sequence is directly adjacent the 5′ end of the 5′ segment of the self-complementary palindrome motif. #14509433v123. The synthetic oligonucleotide of claim 20, wherein the tetraloop sequence is located adjacent the 3′ end of the 3′ segment of the self-complementary palindrome motif, optionally wherein the tetraloop sequence is directly adjacent the 3′ end of the 3′ segment of the self-complementary palindrome motif.
24. The synthetic oligonucleotide of any one of claims 20 to 23, wherein the 5′ segment of the self-complementary palindrome motif is 3-20 nucleosides in length, and / or the 3′ segment of the self-complementary palindrome motif is 3-20 nucleosides in length.
25. The synthetic oligonucleotide of any one of claims 20 to 24, wherein the 5′ segment of the self-complementary palindrome motif is 12-18 nucleosides in length, and / or the 3′ segment of the self-complementary palindrome motif is 12-18 nucleosides in length.
26. The synthetic oligonucleotide of any one of claims 20 to 25, wherein the synthetic oligonucleotide comprises 8 or fewer modified internucleoside linkages, optionally wherein the synthetic oligonucleotide comprises 6 or fewer modified internucleoside linkages, further optionally wherein the synthetic oligonucleotide comprises 5, 4, 3, 2, 1, or no modified internucleoside linkages.
27. The synthetic oligonucleotide of any one of claims 20 to 26, wherein the synthetic oligonucleotide comprises a nucleobase sequence selected from the group consisting of: GGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC (SEQ ID NO: 164), GGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 165), GACACUAUUUUUGUGUGGUUCGCACACAAAAAUAGUGUCC (SEQ ID NO: 166), GGUGUUUUUGUGUGUUCGCACACAAAAACACC (SEQ ID NO: 167), GGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 168), GGUGUGUUUUUUUGUGUGGCAACACACAAAAAAACACACC (SEQ ID NO: 192), CCACACAAAUUUUGUGUGUUCGCACACAAAAUUUGUGUGG (SEQ ID NO: 194), and GGUUUUUGUGUGUUCGCACACAAAAACC (SEQ ID NO: 195), #14509433v1wherein each U nucleobase may optionally and independently be a T nucleobase.
28. The synthetic oligonucleotide of any one of claims 20 to 27, wherein the synthetic oligonucleotide comprises a structure selected from the group consisting of: pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC (SEQ ID NO: 164), pppGGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 165), pppGACACUAUUUUUGUGUGGUUCGCACACAAAAAUAGUGUCC (SEQ ID NO: 166), pppGGUGUUUUUGUGUGUUCGCACACAAAAACACC (SEQ ID NO: 167), GGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 168), GGUGUGUUUUUUUGUGUGGCAACACACAAAAAAACACACC (SEQ ID NO: 192), GGΨGΨGΨΨΨΨΨΨΨGΨGΨGUUCGCACACAAAAAAACACACC (SEQ ID NO: 193), CCACACAAAUUUUGUGUGUUCGCACACAAAAUUUGUGUGG (SEQ ID NO: 194), and GGUUUUUGUGUGUUCGCACACAAAAACC (SEQ ID NO: 195), wherein each nucleoside is a ribonucleoside and each internucleoside linkage is a phosphodiester linkage, Ψ represents pseudouridine or N1-methyl-pseudouridine, ‘ppp’ represents a triphosphate.
29. A synthetic oligonucleotide comprising a nucleobase sequence selected from the group consisting of: GGGGGUGUGUUUUUUGGGGG (SEQ ID NO: 161), GGGGGUUUUUUUUUUGGGGG (SEQ ID NO: 163), GGGGGUCUUCUUCUUGGGGG (SEQ ID NO: 170), GGGGGCCACGCACCAGGGGG (SEQ ID NO: 171), GGGGGUUUUUGGGGG (SEQ ID NO: 172), GGGGGCUCUCUCUCUGGGGG (SEQ ID NO: 173), GGGGGAUAUAUAUAUGGGGG (SEQ ID NO: 174), GGGGGGUGUGUGUGUGGGGG (SEQ ID NO: 175), GGGGGUIUUIUUIUUGGGGG (SEQ ID NO: 176), #14509433v1GGUGUGUUUUUUUGUGUGUUCGCACACUUGUUGUUUCACC (SEQ ID NO: 180), GGUGUGUUUUUUUGUGUG (SEQ ID NO: 190), and CACACAAAAAAACACACC (SEQ ID NO: 191), wherein each U nucleobase may optionally and independently be a T nucleobase.
30. The synthetic oligonucleotide of claim 29, wherein the synthetic oligonucleotide comprises a structure selected from the group consisting of: g*gGGGUGUGUUUUUUGGg*g*g (SEQ ID NO: 161), ggGGGUUUUUUUUUUGGGgg (SEQ ID NO: 162), GGGGGUUUUUUUUUUGGGGG (SEQ ID NO: 163), GGGGGUCUUCUUCUUGGGGG (SEQ ID NO: 170), GGGGGCCACGCACCAGGGGG (SEQ ID NO: 171), GGGGGUUUUUGGGGG (SEQ ID NO: 172), GGGGGCUCUCUCUCUGGGGG (SEQ ID NO: 173), GGGGGAUAUAUAUAUGGGGG (SEQ ID NO: 174), GGGGGGUGUGUGUGUGGGGG (SEQ ID NO: 175), GGGGGUIUUIUUIUUGGGGG (SEQ ID NO: 176), GGUGUGUUUUUUUGUGUGUUCGCACACUUGUUGUUUCACC (SEQ ID NO: 180), GGUGUGUUUUUUUGUGUG (SEQ ID NO: 190), and CACACAAAAAAACACACC (SEQ ID NO: 191), wherein lower case letters represent deoxyribonucleosides, upper case letters represent ribonucleosides, Ψ represents pseudouridine or N1-methyl-pseudouridine, ‘ppp’ represents a triphosphate, ‘*’ represents a phosphorothioate internucleoside linkage, and the absence of a ‘*’ between two letters represents a phosphodiester internucleoside linkage.
31. A synthetic oligonucleotide comprising a structure selected from the group consisting of: g*g*GGUUUUUUUGUGUacgacgtcgtggg*g* g*g*g (SEQ ID NO: 169), g*g*ggtcgacgtcgtggg*g*g*g*g (SEQ ID NO: 177), g*g*ggacgtcgtcgtggg*g*g*g*g (SEQ ID NO: 178), CGUGUAAACGUUAACGUGUGUUCGCacacgttaacgtttacacg (SEQ ID NO: 181), acgacgtcgtUUUGUGUGUUCGCACACAAAacgacgtcgtg (SEQ ID NO: 182), acgacgtcgtUUUGUGUGUUCGCACACAAAacgacgtcgtggg*g*g (SEQ ID NO: 183), #14509433v1UUUUUUUGUGUacgacgtcgtg (SEQ ID NO: 184), acgacgtcgttGUGUGUUUUUUUU*g (SEQ ID NO: 185), acgacgtcgttttGGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACCttt acgacgtcgtggg*g*g (SEQ ID NO: 186), ggggacgacgtcgtggggggg (SEQ ID NO: 188), acgacgtcgtcaacgttg (SEQ ID NO: 189), acgacgtcgtttttcatcgatg (SEQ ID NO: 197), g*gGGGUGUGUUUUUUGGg*g*g (SEQ ID NO: 161), ggGGGUUUUUUUUUUGGGgg (SEQ ID NO: 162), GGGGGUUUUUUUUUUGGGGG (SEQ ID NO: 163), pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC (SEQ ID NO: 164), pppGGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 165), pppGACACUAUUUUUGUGUGGUUCGCACACAAAAAUAGUGUCC (SEQ ID NO: 166), pppGGUGUUUUUGUGUGUUCGCACACAAAAACACC (SEQ ID NO: 167), GGUGUGUUUUUUUGUGUGUUCGCACACAAAAAAACACACC (SEQ ID NO: 168), GGGGGUCUUCUUCUUGGGGG (SEQ ID NO: 170), GGGGGCCACGCACCAGGGGG (SEQ ID NO: 171), GGGGGUUUUUGGGGG (SEQ ID NO: 172), GGGGGCUCUCUCUCUGGGGG (SEQ ID NO: 173), GGGGGAUAUAUAUAUGGGGG (SEQ ID NO: 174), GGGGGGUGUGUGUGUGGGGG (SEQ ID NO: 175), GGGGGUIUUIUUIUUGGGGG (SEQ ID NO: 176), GGUGUGUUUUUUUGUGUGUUCGCACACUUGUUGUUUCACC (SEQ ID NO: 180), GGUGUGUUUUUUUGUGUG (SEQ ID NO: 190), CACACAAAAAAACACACC (SEQ ID NO: 191), GGUGUGUUUUUUUGUGUGGCAACACACAAAAAAACACACC (SEQ ID NO: 192), GGΨGΨGΨΨΨΨΨΨΨGΨGΨGUUCGCACACAAAAAAACACACC (SEQ ID NO: 193), CCACACAAAUUUUGUGUGUUCGCACACAAAAUUUGUGUGG (SEQ ID NO: 194), and #14509433v1GGUUUUUGUGUGUUCGCACACAAAAACC (SEQ ID NO: 195), wherein lower case letters represent deoxyribonucleosides, upper case letters represent ribonucleosides, Ψ = pseudouridine or N1-methyl-pseudouridine, ‘ppp’ represents a triphosphate, ‘*’ represents a phosphorothioate internucleoside linkage, and the absence of a ‘*’ between two letters represents a phosphodiester internucleoside linkage.
32. A composition comprising the synthetic oligonucleotide of any one of claims 7 to 31 and a delivery vehicle.
33. A composition comprising a first population comprising a plurality of a first oligonucleotide and a second population comprising a plurality of a second oligonucleotide, wherein the first oligonucleotide and the second oligonucleotides are each a distinct synthetic oligonucleotide of any one of claims 7 to 31.
34. The composition of claim 33, wherein the first population and the second population are each independently formulated in a delivery vehicle.
35. The composition of claim 32 or 34, wherein the delivery vehicle comprises a liposome.
36. The composition of claim 32 or 34, wherein the delivery vehicle comprises a lipid nanoparticle (LNP).
37. The composition of claim 36, wherein the LNP comprises an ionizable or cationic lipid, a non-cationic lipid, a structural lipid, and a polymer conjugated lipid.
38. The composition of claim 37, wherein the lipids of the LNP comprise a molar ratio of about 20-60% cationic or ionizable lipid, about 5-25% non-cationic lipid, about 25- 55% structural lipid and about 0.5-15% polymer conjugated lipid, optionally wherein the structural lipid is a sterol, and optionally wherein the non-cationic lipid is a phospholipid.
39. A method of vaccinating a subject in need thereof, the method comprising administering a vaccine to the subject and administering a synthetic oligonucleotide of any one of claims 7 to 31 or a composition of any one of claims 32 to 38 to the subject. #14509433v140. The method of claim 39, wherein the vaccine is an infectious disease vaccine.
41. The method of claim 39, wherein the vaccine is cancer vaccine.
42. The method of any one of claims 39 to 41, wherein the administering of the synthetic oligonucleotide or composition to the subject increases an immune response in the subject to the vaccine. #14509433v1
Citation Information
Patent Citations
Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
US20110244025A1
Immunostimulatory g, u-containing oligoribonucleotides
US20140135487A1
Combination tumor immunotherapy
US20180000851A1
Compositions and methods of the delivery of active agents including nucleic acids
WO2023070133A2
Nanoparticulate formulation
WO2024137455A1