Methods for preparing oligonucleotide conjugates

Abstract

The present disclosure relates to methods of preparing of oligonucleotide conjugates. Specifically, present disclosure relates to methods of preparing oligonucleotide conjugates wherein the oligonucleotide comprises an alkylamine group and an amine cation bound to or associated with the oligonucleotide.

Description

[0001] 123429-12420

[0002] METHODS FOR PREPARING OLIGONUCLEOTIDE CONJUGATES

[0003] RELATED APPLICATIONS

[0004] This application claims priority to U.S. Provisional Application No. 63 / 708,424, filed on October 17, 2024. The entire contents of the foregoing application are expressly incorporated herein by reference.

[0005] FIELD OF THE INVENTION

[0006] The present disclosure relates to methods of preparing oligonucleotide conjugates. Specifically, methods of preparing oligonucleotide conjugates wherein the oligonucleotide comprises an alkylamine group that can react with an amine-reactive group of a biomolecule, an agent, or a bifunctional linker to form the oligonucleotide conjugates.

[0007] BACKGROUND OF THE INVENTION

[0008] Oligonucleotides are short DNA and / or RNA oligomers that can be chemically synthesized for research and medical purposes. Oligonucleotides are typically prepared by a stepwise addition of nucleotide residues on a solid support to produce a specific sequence. In order to avoid cross-reactivity, often the reactive groups on the oligonucleotide chain are capped or protected using protecting groups. In order to free the completed oligonucleotide from the solid support and remove these protecting groups, the oligonucleotide is often submitted to cleavage / deprotection conditions, which often uses an ammonium ion, such as ammonium hydroxide. The use of these ammonium ions can cause the ammonium ion to be a cation to any negatively charged group on the oligonucleotide, such as the phosphate or phosphorothioate groups.

[0009] Often when making an oligonucleotide conjugate, the conjugation involves the reaction of an alkylamine with amine-reactive group, such as a carboxylic acid, acyl chloride, or activated ester. However, the presence of one or more ammonium ions can affect the reaction between the oligonucleotide and the amine-reactive group, thus reducing the conjugation efficiency.

[0010] As such, there is a need for new preparation methods of oligonucleotide conjugates which remove or reduce the number of ammonium ions present on the oligonucleotide to increase the conjugation efficiency.

[0011] 1

[0012] MEl\58529840.vl 123429-12420

[0013] SUMMARY OF THE INVENTION

[0014] The present disclosure provides methods for preparing an oligonucleotide conjugate. In a first aspect, the present disclosure relates to a method for preparing an oligonucleotide conjugate comprising the steps of: a) performing a salt exchange on an oligonucleotide using an aqueous salt solution to replace a NRH3 group bound to or associated with the oligonucleotide with a cation in the aqueous salt solution, wherein: the oligonucleotide comprises an alkylamine group;

[0015] R is H or Ci-4alkyl optionally substituted by 1 to 4 groups independently selected from halo and OH; and b) reacting the alkylamine group of the oligonucleotide with an amine-reactive group of a biomolecule, an agent, or a bifunctional linker to form the oligonucleotide conjugate.

[0016] BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Fig. 1 shows the reaction completion versus solution exchange graph for the different NaCl concentrations described in Example 3.

[0018] DETAILED DESCRIPTION OF THE INVENTION

[0019] The present disclosure provides methods for preparing an oligonucleotide conjugate. In some embodiments, the oligonucleotide comprises an alkylamine group and the method involves replacing a NRH3+ion (e.g., NH4+) bound to or associated with the oligonucleotide with a cation (e.g., Na+) in an aqueous salt solution by salt exchange. The oligonucleotide after salt exchange can then react with an amine-reactive group of a biomolecule, an agent, or a bifunctional linker through the alkylamine group to form the oligonucleotide conjugate.

[0020] Methods of Preparation

[0021] In a first embodiment, the present disclosure relates to a method for preparing an oligonucleotide conjugate comprising the steps of: a) performing a salt exchange on an oligonucleotide using an aqueous salt solution to replace a NRHs+group bound to or associated with the oligonucleotide with a cation in the aqueous salt solution, wherein: the oligonucleotide comprises an alkylamine group;

[0022] R is H or Ci-4alkyl optionally substituted by 1 to 4 groups independently selected from halo and OH; and

[0023] 2

[0024] MEl\58529840.vl 123429-12420 b) reacting the alkylamine group of the oligonucleotide with an amine-reactive group of a biomolecule, an agent, or a bifunctional linker to form the oligonucleotide conjugate.

[0025] In an alternative first embodiment, the present disclosure relates to a method for preparing an oligonucleotide conjugate comprising the steps of: a) performing a salt exchange on an oligonucleotide using an aqueous salt solution to replace a NRH3 group bound to the oligonucleotide with a cation in the aqueous salt solution, wherein: the oligonucleotide comprises an alkylamine group;

[0026] R is H or Ci-4alkyl optionally substituted by 1 to 4 groups independently selected from halo and OH; and b) reacting the alkylamine group of the oligonucleotide with an amine-reactive group of a biomolecule, an agent, or a bifunctional linker to form the oligonucleotide conjugate.

[0027] In a further alternative first embodiment, the present disclosure relates to a method for preparing an oligonucleotide conjugate comprising the steps of: a) performing a salt exchange on an oligonucleotide using an aqueous salt solution to replace an ammonium ion bound to the oligonucleotide with a cation in the aqueous salt solution, wherein: the oligonucleotide comprises an alkylamine group;

[0028] R is H or Ci-4alkyl optionally substituted by 1 to 4 groups independently selected from halo and OH; and b) reacting the alkylamine group of the oligonucleotide with an amine-reactive group of a biomolecule, an agent, or a bifunctional linker to form the oligonucleotide conjugate.

[0029] In some embodiments, the reaction completion percentage is 50% or greater for the conjugation reaction between the alkylamine group of the oligonucleotide and the aminereactive group of a biomolecule, an agent, or a bifunctional linker to form the oligonucleotide conjugate (i.e., step b) in the method described above). In some embodiments, the reaction completion percentage is 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.9% or greater. In some embodiments, the reaction completion percentage is 50-100%, 55-100%, 60-100%, 65-100%, 70-100%, 75-100%, 80-100%, 85-100%, 90-100%, 95-100%, or 99- 100%.

[0030] In some embodiments, the salt exchange step (i.e., step a) in the method described above) is carried out one or more times so that sufficient amount of the NRH3 group bound to or associated with the oligonucleotide is replaced with the cation from the aqueous salt solution. The “sufficient amount” of the NRH3 group replaced can be determined by the

[0031] 3

[0032] MEl\58529840.vl 123429-12420 reaction completion percentage of the conjugation reaction in step b), for example, 50% or greater for the reaction completion percentage. In some embodiments, the salt exchange step (i.e., step a) in the method described above) is carried out one or more times so that the reaction completion percentage for step b) is 50% or greater. In some embodiments, the salt exchange step is carried out a single time. In some embodiments the salt exchange step is carried out 2 or more times. In some embodiments the salt exchange step is carried out 2 to 20 times. In some embodiments, the salt exchange step is carried out 2 to 14 times. In some embodiments, the salt exchange step is carried out 2 to 12 times. In some embodiments, the salt exchange step is carried out 2 to 10 times. In some embodiments, the salt exchange step is carried out 2 to 8 times. In some embodiments, the salt exchange step is carried out 2 to 6 times. In some embodiments, the salt exchange step is carried out 2 to 4 times. In some embodiments the salt exchange step is completed 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 times.

[0033] In some embodiments, R of the NRH3+group is H.

[0034] In some embodiments, R of the NRH3+group is -C(CH2OH)3.

[0035] In some embodiments, R of the NRH3+group is -CH3.

[0036] In some embodiments, the aqueous salt solution comprises an alkali metal salt or an earth metal salt. Exemplary salts include, but are not limited to, NaCl, KC1, RbCl, CsCl, MgCl2, CuCl, CuCl2, ZnCl2, and CaCl2.

[0037] In some embodiments, the cation is Na+, K+, Rb+, Cs+, Mg2+, Cu+, Cu2+, Zn2+, or Ca2+. In some embodiment, the aqueous salt solution is a NaCl or KC1 solution.

[0038] In some embodiments, the aqueous salt solution comprises 0.05 M to 4.5 M of a salt (e.g., NaCl). In some embodiments, the aqueous salt solution comprises 0.1 M to 4.5 M of a salt (e.g., NaCl). In some embodiments, the aqueous salt solution comprises 0.1 M to 2 M of the salt (e.g., NaCl). In some embodiments, the aqueous salt solution comprises 0.1 M to 0.5 M of the salt (e.g., NaCl). In some embodiments, the aqueous salt solution comprises 0.1 M to 0.2 M of the salt (e.g., NaCl). In some embodiments, the aqueous salt solution comprises 0.5 M to 2 M of the salt (e.g., NaCl). In some embodiments, the aqueous salt solution comprises 0.05 M to 2 M, 0.05 M to 1 M, 0.05 M to 0.5 M, 0.1 M to 2 M, 0.1 M to 0.5 M, 0.1 to 0.2 M, 0.1 M to 1 M, 0.2 M to 1 M, 0.5 M to 1 M, 0.25 M to 0.75 M, 1 M to 2.5 M, 1 M to 2 M, or 0.5 M to 1.5 M of the salt (e.g., NaCl). In some embodiments, the aqueous salt solution comprises 0.05 M, 0.1 M, 0.25 M, 0.5 M, 0.75 M, I M, 1.5 M or 2 M of the salt.

[0039] In some embodiments, the molar ratio of the cation to the NRH3+group in the salt exchange step a) is 4,500: 1 or greater. In some embodiments, the molar ratio of the cation to the NRH3+group in the salt exchange step a) is about 450,000: 1 to 4,500: 1. In some

[0040] 4

[0041] MEl\58529840.vl 123429-12420 embodiments, the molar ratio of the cation to the NRHs+group is about 200,000: 1 to about 4,500:1. In some embodiments, the molar ratio of the cation to the NRHs+group is about 100,000:1 to about 4,500: 1. In some embodiments, the molar ratio of the cation to the NRH3+group is about 50,000: 1 to about 4,500: 1. In some embodiments, the molar ratio of the cation to the NRH3+group is about 20,000: 1 to about 4,500:1. In some embodiments, the molar ratio of the cation to the NRH3+group is about 450,000: 1 to about 9,000: 1. In some embodiments, the molar ratio of the cation to the NRH3+group is about 200,000: 1 to about 9,000: 1. In some embodiments, the molar ratio of the cation to the NRH3+group is about 100,000: 1 to about 9,000:1. In some embodiments, the molar ratio of the cation to the NRH3+group is about 50,000:1 to about 9,000: 1. In some embodiments, the molar ratio of the cation to the NRH3+group is about 20,000: 1 to about 9,000: 1. In some embodiments, the molar ratio of the cation to the NRH3+group is about 200,000: 1 to about 9,600: 1.

[0042] In some embodiments, the “salt exchange” comprises the steps of (1) adding the salt to the aqueous solution comprising the oligonucleotide, (2) exchanging the cation of the salt with the NRH3+group, and (3) removing the NRH3+group.

[0043] In some embodiments, the “salt exchange” comprises the steps of (1) adding the aqueous salt solution to the oligonucleotide bound on a solid support; (2) allowing the cation in the salt solution to replace the NRH3+group bound to or associated with the oligonucleotide; (3) removing the displaced NRH3+from the solid support by washing with the aqueous salt solution or other appropriate aqueous solution (e.g., water or an aqueous buffer solution).

[0044] In some embodiments the amount of NRH3+remaining in the solution is less than 0.1 mM. In some embodiments the amount of NRH3+remaining in the solution is less than 0.05 mM. In some embodiments the amount of NRH3+remaining in the solution is less than 0.01 mM. In some embodiments the amount of NRH3+remaining in the solution is less than 0.005 mM. In some embodiments the amount of NRH3+remaining in the solution is less than 0.001 mM. In some embodiments the amount of NRH3+remaining in the solution is less than 0.0005 mM. In some embodiments the amount of NRH3+remaining in the solution is less than 0.0001 mM. In some embodiments the amount of NRH3+remaining in the solution is less than 0.00005 mM. In some embodiments the amount of NRH3+remaining in the solution is less than 0.00001 mM.

[0045] In some embodiments, 50% or greater of the NRH3+is exchanged with the cation and removed from the solution. In some embodiments, 60% or greater of the NRH3+is exchanged with the cation and removed from the solution. In some embodiments, 70% or greater of the

[0046] 5

[0047] MEl\58529840.vl 123429-12420

[0048] NRHs+is exchanged with the cation and removed from the solution. In some embodiments, 80% or greater of the NRHs+is exchanged with the cation and removed from the solution. In some embodiments, 85% or greater of the NRH3+is exchanged with the cation and removed from the solution. In some embodiments, 90% or greater of the NRH3+is exchanged with the cation and removed from the solution. In some embodiments, 95% or greater of the NRH3+is exchanged with the cation and removed from the solution. In some embodiments, 99% or greater of the NRH3+is exchanged with the cation and removed from the solution. In some embodiments, 99.9% or greater of the NRH3+is exchanged with the cation and removed from the solution.

[0049] In some embodiments, the oligonucleotide is attached to or associated with a solid support. The term “solid support” refers to any support that is compatible with oligonucleotide synthesis including, for example, glass, controlled pore glass, polymeric materials, polystyrene, beads, coated glass and the like. Such materials are known in the art and include, for example, beads, pellets, disks, fibers, gels, or particles such as cellulose beads, pore-glass beads, silica gels, polystyrene beads optionally cross-linked with divinylbenzene and optionally grafted with polyethylene glycol, poly-acrylamide beads, latex beads, dimethylacrylamide beads optionally cross-linked with N,N'-bis-acryloyl ethylene diamine, glass particles coated with hydrophobic polymer, and material having a rigid or semi-rigid surface. The solid supports optionally have functional groups such as amino, hydroxy, carboxy, or halo groups. In some embodiments, the solid support of the present disclosure is selected from cross-linked polystyrene beads or controlled pore glass beads. In some embodiments, the solid support of the present disclosure comprises a hydroxyl functional group. In some embodiments, the solid support of the present disclosure is selected from cross-linked polystyrene beads with hydroxyl functional group or controlled pore glass beads with hydroxyl functional group. In some embodiments, the solid support comprises a UnyLinker (e.g., NittoPhase Unylinker Solid Support from Kinovate Life Sciences).

[0050] In some embodiments, the step a) is carried out by hydrophobic interaction chromatography with the aqueous salt solution. In some embodiments, the aqueous salt solution comprises NaCl or KC1. In some embodiments, the aqueous salt solution comprises 0.05 M to 2 M, 0.05 M to 1 M, 0.05 M to 0.5 M, 0.5 M to 2 M, 0.5 M to 1.5 M, or 1 M to 2 M of NaCl or KC1. In some embodiments, the aqueous salt solution comprises 0.05 M, 0.1 M, 0.2 M, 0.5 M, I M, 1.5 M or 2 M or NaCl or KC1. In some embodiments, the aqueous salt solution is used with or without a buffer solution.

[0051] In some embodiments, the oligonucleotide is in an aqueous solution.

[0052] 6

[0053] MEl\58529840.vl 123429-12420

[0054] In some embodiments, step a) is carried out by subjecting the oligonucleotide to ultrafiltration / diafiltration (UF / DF) using the aqueous salt solution. In some embodiments, the aqueous salt solution is used with or without a buffer solution. In some embodiments, the aqueous salt solution comprises NaCl or KC1. In some embodiments, the aqueous salt solution comprises 0.05 M to 2 M, 0.05 M to 1 M, 0.05 M to 0.5 M, 0.25 M to 1 M, 0.5 M to 2 M, 0.5 M to 1.5 M, or 1 M to 2 M of NaCl or KC1. In some embodiments, the aqueous salt solution comprises 0.05 M, 0.1 M, 0.2 M, 0.25 M, 0.5 M, 0.75 M, I M, 1.5 M, or 2 M or NaCl or KC1.

[0055] In some embodiments, 2 or more diavolumes of the aqueous salt solution is used. In some embodiments, 3, 4, 5, 6, 7, 8, 9, or 10 or more diavolumes of the aqueous salt solution is used. In some embodiments 2 to 20 diavolumes of the aqueous salt solution are used. In some embodiments, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 diavolumes of the aqueous salt solution is used.

[0056] In some embodiments, the alkylamine groups of the oligonucleotide is -C2-2oalkylene- NH2. In some embodiments, the alkylamine groups is -C2-salkylene-NH2. In some embodiments, the alkylamine groups is -Cealkylene-NB .

[0057] In some embodiments, the oligonucleotide has the alkylamine group attached thereto through a 5’-phosphate or 5’-phosphorothiolate group. In some embodiments, the oligonucleotide comprises the following group: wherein:

[0058] X is O or S;

[0059] L is a spacer;

[0060] M+is H+Na+, K+, or NRH3+; and represents attachment site to the 5 ’-OH group of the oligonucleotide.

[0061] In some embodiments, L is C2-2oalkylene; and the remaining variables are as described in any one of the embodiments above. In some embodiments, L is -(CH2)m-; m is an integer from 2 to 8; and the remaining variables are as described in any one of the embodiments above. In some embodiments, L is -(CH2)-e; and the remaining variables are as described in any one of the embodiments above.

[0062] 7

[0063] MEl\58529840.vl 123429-12420

[0064] In some embodiments, before step a) the oligonucleotide is represented by the following formula: or a salt thereof, wherein:

[0065] R1, for each occurrence, is independently a nucleobase;

[0066] R2, for each occurrence, is independently selected from the group consisting of H, halo, OH, and Ci-ealkoxy optionally substituted with Ci-ealkoxy or -C(O)NHCi-3alkyl;

[0067] R3, for each occurrence, is independently H or forms a ring with the alkoxy group of R2; n is an integer from 2 to 10; q is an integer from 1 to 25;

[0068] X, for each occurrence, is independently O or S;

[0069] M+, for each occurrence, is independently H+, Na+, K+, or NRH3 .

[0070] In some embodiments, R3forms a ring with the alkoxy group of R2, wherein the ring is a 5 or 6-membered ring optionally substituted with 1 to 3 C1-4 alkyl groups. In some embodiments, the ring is a 5-membered ring optionally substituted with 1 C1-4 alkyl group. In some embodiments, R3and R2together is -CH(CH3)-O-*, wherein * indicates the correction point to the carbon atom from which R2is attached (also described herein as “2’ -constrained ethyl modified ribonucleotide”).

[0071] In some embodiments, all of the P=X groups in the oligonucleotide are P=S; and the remaining variables are as described in any one of the embodiments above. In some embodiments, all of the P=X groups in the oligonucleotide are P=O; and the remaining variables are as described in any one of the embodiments above. In some embodiments, greater than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the P=X groups in the

[0072] 8

[0073] MEl\58529840.vl 123429-12420 oligonucleotide are P=S and the remaining variables are as described in any one of the embodiments above.

[0074] In some embodiments, the nucleobase is selected from the group consisting of cytosine, guanine, adenine, thymine, uracil, hypoxanthine, xanthine, 7-methylguanine, 5,6- dihydrouracil, 5 -methylcytosine, and 5-hydroxymethylcytosine; and the remaining variables are as described in any one of the embodiments above. In some embodiments, the nucleobase is selected from the group consisting of cytosine, guanine, adenine, thymine, uracil, and 5- methylcytosine; and the remaining variables are as described in any one of the embodiments above.

[0075] In some embodiments, n is an integer from 3 to 6; and the remaining variables are as described in any one of the embodiments above. In some embodiments, n is 6; and the remaining variables are as described in any one of the embodiments above.

[0076] In some embodiments, each R2is independently selected from the group consisting of H, F, and Ci-4alkoxy optionally substituted with Ci-4alkoxy or -C(O)NHCH3; and each R3is independently H or forms a ring with the alkoxy group of R2, wherein the ring is a 5 or 6-membered ring optionally substituted with 1 to 3 Ci-4 alkyl groups; and the remaining variables are as described in any one of the embodiments above.

[0077] In some embodiments, each R2is independently selected from the group consisting of H, F, -OCH3, -OCH2CH2OCH3, and -OCH2C(O)NHCH3; and each R3is independently H or forms a ring with the alkoxy group of R2, wherein the ring is a 5-membered ring; and the remaining variables are as described in any one of the embodiments above.

[0078] In some embodiments, each R3is independently H or together with the alkoxy group of R2form -CH2-O-; and the remaining variables are as described in any one of the embodiments above.

[0079] In some embodiments, each R2is independently selected from H, -OCH2CH2OCH3 and -OCH2C(O)NHCH3; and each R3is H; and the remaining variables are as described in any one of the embodiments above.

[0080] In some embodiments, at least one of the M+in formula (I) is NRH3+; and the remaining variables are as described in any one of the embodiments above In some embodiments, at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of M+in formula (I) is NRH3+. In some embodiments, each M+is NRH3+.

[0081] 9

[0082] MEl\58529840.vl 123429-12420

[0083] In some embodiments, R is H or -C(CH2OH)3; and the remaining variables are as described in any one of the embodiments above. In some embodiments, R is H; and the remaining variables are as described in any one of the embodiments above. In some embodiments, R is H or -CH3; and the remaining variables are as described in any one of the embodiments above.

[0084] In some embodiments, the amine-reactive group is -COOH, -COX’, an activated isocyanate group, or an activated ester group or an isothiocyanate group, wherein X’ is a halide. In some embodiments, the amine-reactive groups is an activated ester. In some embodiments, the amine-reactive groups is N-hydroxysuccinimide ester In some embodiments, the amine-reactive groups is an isothiocyanate group.

[0085] Definitions

[0086] The use of “a” or “an” to describe the various elements and components herein is merely for convenience and to give a general sense of the disclosure. This description should be read to include one or at least one and the singular also includes the plural unless it is clear that it is otherwise intended. For example, replacing “a NRH3+group” refers to both replacing one single NRH3+group as well as replacing multiple NRH3+groups.

[0087] As used herein, the term “alkyl” refers to a fully saturated branched or unbranched hydrocarbon moiety. The term “Ci-4alkyl” refers to an alkyl having 1 to 4 carbon atoms. Preferably the alkyl comprises 1 to 20 carbon atoms, more preferably 1 to 16 carbon atoms, 1 to 10 carbon atoms, 1 to 6 carbon atoms, or 1 to 4 carbon atoms. In some embodiments, an alkyl comprises from 6 to 20 carbon atoms. Representative examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl, tert-butyl, n- pentyl, isopentyl, neopentyl, n-hexyl, 3 -methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n-nonyl, or n-decyl.

[0088] As used herein, the term “alkylene” refers to a fully saturated branched or unbranched divalent hydrocarbon radical. The term “C2-2oalkylene” refers to an alkylene having 2 to 20 carbon atoms. The terms “C2-salkylene” and “Cealkylene” are to be construed accordingly. Representative examples of “C2-42oalkylene” include, but are not limited to, ethylene, n- propylene, iso-propylene, n-butylene, sec-butylene, iso-butylene, and tert-butylene.

[0089] As used herein, the term “alkoxy” refers to a fully saturated branched or unbranched alkyl moiety attached through an oxygen bridge (i.e. a — O— C1-6 alkyl group wherein C1-6

[0090] 10

[0091] MEl\58529840.vl 123429-12420 alkyl is as defined herein). The term “ Ci-4 alkoxy” is to be construed accordingly. Representative examples of alkoxy include, but are not limited to, methoxy, ethoxy, propoxy, 2-propoxy, butoxy, tert-butoxy and the like.

[0092] As used herein, the term “alkylamine” refers to a fully saturated branched or unbranched alkyl moiety substituted by one or more amine group(s).

[0093] As used herein, the term “halogen” or “halo” refers to the atoms fluorine, chlorine, bromine or iodine.

[0094] As used herein, the term “spacer” refers to a chemical group which links two atoms and / or moieties. In some cases the spacer is used to add sufficient distance between the two linked atoms and / or moieties.

[0095] As used herein, the term “ammonium ion” refers to NH or a derivative thereof in which one, two, three or four of the hydrogens bonded to the nitrogen have been replaced with an alkyl (e.g., Ci-ealkyl, Ci-4alkyl) group optionally substituted with one or more (e.g., 1 to 4) substituents independently selected from halo and OH. Examples of “ammonium ion” include, but are not limited to NH4+, NH3CH3+, NH3C(CH2OH)3+, NH(CH2CH3)3+, and N(CH2CH3)4+. In some embodiments, the ammonium ion is NRH3+wherein R is H or an optionally substituted alkyl group (e.g., Ci-4alkyl is optionally substituted by 1 to 4 groups independently selected from halo and OH).

[0096] As used herein, the term “amine-reactive group” refers to a chemical moiety which reacts with an amine to form a new chemical entity. Examples of “amine-reactive groups” include, but are not limited to, carboxylic acid, acyl chloride, isocyanate, isothiocyanate, and activated ester.

[0097] As used herein, the term “activated ester” refers to an ester group that is readily displaced by an amine group. Exemplary activated esters include, but are not limited to nitrophenyl (e.g., 2 or 4-nitrophenyl) ester, dinitrophenyl (e.g., 2,4-dinitrophenyl) ester, sulfo- tetraflurophenyl (e.g., 4-sulfo-2,3,5,6-tetrafluorophenyl) ester, pentafluorophenyl ester, nitropyridyl (e.g., 4-nitropyridyl) ester, trifluoroacetate, and acetate.

[0098] As used herein, the term “oligonucleotide” means a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA). In certain embodiments, the oligonucleotide includes only RNA, only DNA or includes both RNA and DNA. In a particular embodiment, the target oligonucleotide is a gapmer.

[0099] 11

[0100] MEl\58529840.vl 123429-12420

[0101] As used herein, the term “oligonucleotide conjugate” refers to an oligonucleotide which has been chemically attached to a separate compound, such as a biomolecule, an agent, or a bifunctional linker. Examples of “oligonucleotide conjugates” include, but are not limited to, an antibody-oligonucleotide conjugate, a peptide-oligonucleotide conjugate, or a lipid-oligonucleotide conjugate.

[0102] As used herein, the term “gapmer” means a chimeric compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. In certain embodiments, the target oligonucleotide comprises 10 to 100, 10 to 50, 10 to 25, 15 to 100, 15 to 50, or 15 to 25 nucleotides.

[0103] As used herein, the term “nucleoside” means a compound comprising a nucleobase and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides, modified nucleosides, and nucleosides having mimetic bases and / or sugar groups. “Modified nucleoside” a nucleoside comprising at least one modification compared to naturally occurring RNA or DNA nucleosides. Such modification may be at the sugar moiety and / or at the nucleobase. Nucleosides may be modified with any of a variety of substituents on either the nucleobase or the sugar moiety.

[0104] As used herein, the term “nucleotide” refers to a nucleoside comprising a linking group, which links two nucleosides together as part of the oligonucleotide. The two main classes of linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing linkages include, but are not limited to, phosphodiesters (P=O), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (P=S). Representative non-phosphorus containing linking groups include, but are not limited to, methylenemethylimino ( — CH2-N(CH3)-O — CH2-), thiodiester ( — O — C(O) — S — ), thionocarbamate ( — O — C(O)(NH) — S — ); siloxane ( — O — Si(H)2-0 — ); and N,N'-dimethylhydrazine ( — CH2-N(CH3)-N(CH3)-). In a particular embodiment, the linking group is a phosphodiester (P=O) or a phosphorothioate (P=S). In certain embodiments, the target oligonucleotide of the methods described for the first and second embodiments includes only phosphodiesters (P=O), phosphorothioates (P=S), or a combination thereof as the linking group.

[0105] As used herein, the term “nucleobase” means the heterocyclic base portion of a nucleoside. In certain embodiments, a nucleobase may comprise any atom or group of atoms capable of hydrogen bonding to a nucleobase of another nucleic acid. Nucleobases may be

[0106] 12

[0107] MEl\58529840.vl 123429-12420 naturally occurring or may be modified. In addition to “unmodified” or “natural” nucleobases such as the purine nucleobases adenine (A) and guanine (G), and the pyrimidine nucleobases thymine (T) (or 5-methyl uracil), cytosine (C) and uracil (U), many modified nucleobases or nucleobase mimetics known to those skilled in the art are amenable to incorporation into the target oligonucleotides as separated by either the method described in the first or second embodiments, including, for example, hypoxanthine, xanthine, 7-methyl guanine, 5,6- dihydrouracil, 5 -methylcytosine, 7-deaza purine and 5-hydroxymethylcytosine. In certain embodiments, the method is as described for the first or second embodiment, and the nucleobase is selected from adenine, guanine, thymine (5-methyl uracil), and 5- methylcytosine.

[0108] As used herein, the term “sugar moiety” means a natural or modified sugar or sugar surrogate.

[0109] As used herein, the term “natural sugar” means a ribofuranose moiety of DNA (2'-H) or RNA (2'-OH).

[0110] As used herein, the term “modified sugar” means a ribofuranose moiety comprising at least one substituent other than that of a natural sugar. Such modifications include without limitation, addition of substituent groups, bridging of non-geminal ring atoms to form a bicyclic nucleic acid (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or CR2 (R=H, C1-C12 alkyl or a protecting group) and combinations of these such. In certain embodiments, the sugar is modified at the 2'-position to include a substituent other than H or OH (“2'-modified” or “2'-substituted”). Alternatively, the modification is at the 5 '-position of the sugar. In certain embodiments, the sugar is modified at the 2'-position and the 5 '-position of the sugar.

[0111] Examples of sugar modifications useful in this invention include, but are not limited to compounds comprising a sugar substituent group selected from: OH, F, O-alkyl, S-alkyl, N-alkyl, or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to C10 alkyl or C2 to C10 alkenyl and alkynyl. In certain embodiments, such substituents are selected from among: a halide (including, but not limited to F), allyl, amino, azido, thio, O-allyl, O— C1-C10 alkyl, — OCF3, O— (CH2)2— O— CH3, 2'-O(CH2)2SCH3, O— (CH2)2— O— N(Rm)(Rn), or O— CH2-C(=O)— N(Rm)(Rn), where each Rmand Rnis, independently, H or substituted or unsubstituted C1-C10 alkyl. In particular, the modified nucleosides suitable for use in the methods described in the first and second embodiments are: 2 '-methoxy ethoxy (“MOE” or “2'-M0E” or “2'-OCH2CH2OCH3), 2'-O-methyl (“2'- OMe” or 2'-O— CH3), 2'-fluoro (2'-F) or 2’-OCH2C(O)NHCH3.

[0112] 13

[0113] MEl\58529840.vl 123429-12420

[0114] In certain embodiments, modified nucleosides having a substituent group at the 2'- position selected from: O[(CH2)nO]mCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, OCH2C(=O)N(H)CH3, and O(CH2)nON[CH2)nCH3]2, where n and m are independently from 1 to about 10. Other 2'-sugar substituent groups include: Ci to Cio alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocyclyl, and aminoalkylamino.

[0115] As used herein, the term “cation” refers to a positively charged ion. A “cation” can be a single element, or a positively charged ion which is part of a larger molecule. Examples of “cations” include, but are not limited to Na+, K+, Rb+, Cs+, Mg2+, Cu+, Cu2+, Zn2+, or Ca2+, NH4+, NH3C(CH2OH3)+, N(CH2CH3)4+, and NH(CH2CH3)4+.

[0116] As used herein, the term “the cation” refers to the cation which is being exchanged with the NRH3+group or ammonium ion initially bound to or associated with the oligonucleotide.

[0117] As used herein, the term “anion” refers to a negatively charged ion. An “anion” can be a single element, or a positively charged ion which is part of a larger molecule. Examples of “anions” include, but are not limited to "OH, [P(O)4]"3, [P(O)3OCH2CH3]"2, or - . Often a cation and an anion are bound together via an ionic bond.

[0118] As used herein, the term “salt” refers to an ionic compound comprising one or more cation(s) bound via an ionic bond to one or more anion(s). If more than one cations and anions is present, each cation and each ion can be the same or different.

[0119] As used herein, the term “salt exchange” refers to replacing one cation or anion for a different cation or anion. This salt exchange can be completed on molecules free in solution or molecules bound to or associated with a solid support, column, or other entity. A nonlimiting example of a salt exchange is replacing a NH4+cation with a Na+cation.

[0120] As used herein, the term “reaction completion percentage” refers to the percentage of the starting material (e.g., the oligonucleotide having an alkylamine group) which is converted to product (e.g., the conjugated oligonucleotide) during the reaction.

[0121] As used herein, the term “molar ratio” refers to the ratio of the number of moles of a first substance in the reaction or solution compared to the number of moles of a second substance in the reaction or solution.

[0122] 14

[0123] MEl\58529840.vl 123429-12420

[0124] As used herein, the term “associated with” comprises atoms, molecules, or groups which are (a) bound together via ionic bonds, (b) associated via solvates or hydrates, (c) associated within the same solution, or associated via other means known to one of ordinary skill in the art.

[0125] As used herein, the term “about” means approximately, in the region of, roughly, or around. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” is used herein to modify a numerical value above and below the stated value by a variance of 20% (z.e., ± 20%), a variance of 10% (z.e., ± 10%), a variance of 5% (z.e., ± 5%), a variance of 3% (z.e., ± 3%), or a variance of 1% (z.e., ± 1%).

[0126] EXEMPLIFICATION

[0127] During process development of two separate oligonucleotides comprising an alkylamine, low yields were observed when conjugating the alkylamine to the amine-reactive group of the conjugation partner. In response, two separate experiments were run to test whether removing / reducing the amount of ammonium ions would increase conjugation yields.

[0128] Example 1

[0129] 15

[0130] MEl\58529840.vl 123429-12420

[0131] Two comparative tests were completed to test the efficiency of oligonucleotides comprising alkylamine coupling with a isothiocyanate, as shown in the scheme above. Trial 1 used a high concentration (2M) of NaCl to displace one or more NHZ ions prior to conjugation, while Trial 2 would employ a wash without NaCl, thus maintaining or not significantly altering the NHZ concentration. Both oligonucleotides were then reacted with p- SCN-Bn-Deferoxamine using identical conditions and conjugation yield assessed.

[0132] The anti-sense oligonucleotide used in Trials 1 and 2 has a sequence of (from 5' to 3'):

[0133] CCGUUTTCTTACCACCCU (SEQ ID NO: 1)

[0134] SEQ ID NO: 1 is described by the following chemical notation: wherein:

[0135] Underline = 2’ -methoxy ethyl ribonucleotide (and no underline is 2’-H ribonucleotide) G = guanine

[0136] MeC = 5-methylcytosine

[0137] T = thymine A = adenine MeU = 5 -methyluracil (also known as thymine) o = phosphodiester internucleoside linkage (and no o represents phosphorothioate intemucleoside linkage)

[0138] SEQ ID. NO: 1 is also known as BIIB080 or ASO 9, and is described in WO 2020 / 227618, the teachings of which are incorporated herein by reference.

[0139] The experimental conditions of Trials 1 and 2 are shown in the table below. For conjugation preparation the oligonucleotide was subjected to two separate buffer exchanges using a 3 kDa spin filter. The oligonucleotide solution was centrifuged in 3 kDa spin filters at 14,000rcf, for 30 min, and then brought up to its original volume using the buffer of choice (Borate + NaCl, or solely Borate). This was carried out twice for each trial, such that each sample was exchanged twice into a new solution. The solutions the oligonucleotides were exchanged into contained either 2M NaCl and borate (Trial 1), or solely borate (Trial 2). Note, borate was only present for pH control. After preparation, conjugation of the oligonucleotide was carried out using 3 eq. of p-SCN-Bn-Deferoxamine at 40 °C for 180 minutes. In order to test conjugation efficiency, reaction progress was analyzed at 15 minutes.

[0140] As shown in the table below, Trial 1 showed significantly better conjugation yield than Trial 2, with > 60% completion in 15 min and 90% completion after 180 minutes. Trial

[0141] 16

[0142] MEl\58529840.vl 123429-12420

[0143] 2 showed significantly impaired conjugation, with only 28% completion in 15 minutes. In fact, after 180 minutes the reaction remained at 28% completion. The results of Trials 1 and 2 demonstrated that the NHZ ions bound to or associated with the oligonucleotide would compete for amine-reactive chemistry (such as conjugation reactions) if not properly removed by displacement with a different cation species prior to conjugation.

[0144] Table 1: Conditions and Results of Trials 1 and 2

[0145] Example 2 Two comparative tests were completed to test the efficiency of oligonucleotides comprising alkylamine coupling with an activated ester, as shown in the scheme above. Trial 3 utilized Tangential Flow Filtration (TFF) to wash the oligonucleotide solution with 0.5 M NaCl prior to conjugation, thus displacing one or more NHZ ions prior to conjugation, while no wash was carried out prior to conjugation in Trial 4, thus maintaining or not significantly altering the NHZ concentration. The oligonucleotide in both trials was then reacted with N- - maleimidopropyl-oxysuccinimide ester (BMPS) using similar conditions and conjugation yield assessed. The experimental conditions of Trials 3 and 4 are shown in the table below. The TFF process was carried out using a 3kDa membrane, with TMP ranging from 5-35 psi,

[0146] 17

[0147] MEl\58529840.vl 123429-12420 and crossflow ranging from 1-5 L / (m2*min) (LMM). The solution for buffer exchange contained 0.5 M NaCl and sodium phosphate (Trial 3), with no buffer exchange carried out prior to Trial 4. Sodium phosphate was only present for pH control.

[0148] The anti-sense oligonucleotide used in Trials 3 and 4 was a mixed-backbone gapmer with 2’ modifications comprising 2’ -constrained ethyl modified ribonucleotides (2’-OH linked to 4’-ethyl to form -CH(CH3)-O-), 2 ’-methoxy ethyl ribonucleotides, 2’ deoxy ribonucleotide and 2’-O-methyl modified ribonucleotides.

[0149] As shown in the table below, the difference in reaction yield was significant, with 100% completion observed after 30 min for Trial 3, which utilized salt wash preparation step. In contrast, Trial 4 showed 18% completion after 30 min, with no additional conjugation observed after 60 min. The results of Trials 3 and 4 demonstrated that the NH4+ions bound to or associated with the oligonucleotide would compete for amine-reactive chemistry (such as conjugation reactions) if not properly removed by displacement with a different cation species prior to conjugation.

[0150] Table 2: Conditions and Results of Trials 3 and 4

[0151] Example 3

[0152] Additional tests were completed to determine the required concentration of the salt / the amount of the cation required to provide sufficient exchange with the NR.H3 group. Specifically, this example tested the number of solution exchanges required using 0.05 M, 0.1 M, and 0.2 M NaCl solutions in order to achieve high reaction completion. The reaction

[0153] 18

[0154] MEl\58529840.vl 123429-12420 monitored was the conjugation efficiency of a MALAT1 oligonucleotide comprising an alkylamine (MALAT1-AH) coupling with an isothiocyanate NCS-DFO, as shown in the scheme of Example 1. The structure for MALAT1-AH is shown in the scheme of Example 1 with following anti-sense oligonucleotide sequence of (from 5' to 3'):

[0155] GCCAGGCTGGTTATGACTCA (SEQ ID NO: 2)

[0156] SEQ ID NO: 2 is described by the following chemical notation: GMeCoMeCoAoGoGMeCTGGTTATGAoCoTMeCA wherein:

[0157] Underline = 2’ -methoxy ethyl ribonucleotide (and no underline is 2’-H ribonucleotide) G = guanine

[0158] MeC = 5-methylcytosine

[0159] T = thymine

[0160] A = adenine

[0161] MeU = 5 -methyluracil (also known as thymine) o = phosphodiester internucleoside linkage (and no o represents phosphorothioate intemucleoside linkage)

[0162] The samples for this experiment were all prepared according to the procedure below using an Beckman Coulter Microfuge 20 Centrifuge ultrafiltration device:

[0163] • 6 Spin filter tubes were filled with 500pL each of a MALAT1-AH oligonucleotide in a 50mM borate, IM NaCl, pH 9 solution.

[0164] • The solution above was spun at 14000 relative centrifugal factor (ref) for 15 minutes to reduce the volume to 50 pL (spin 1).

[0165] • To the 50 pL solution above was added 450 pL of a 2M ammonium sulfate, 50 mM tris solution and mixed.

[0166] • The solution above was spun at 14000rcf for 15 minutes to reduce the volume to 50 pL (spin 2).

[0167] • To the solution above was added 450 pL of water.

[0168] • The solution above was spun at 14000rcf for 15 minutes to reduce the volume to 50 pL (spin 3).

[0169] • To the solution above was added 450 pL of water.

[0170] 19

[0171] MEl\58529840.vl 123429-12420

[0172] • The solution above was spun at 14000rcf for 15 minutes to reduce the volume to 50 pL (spin 4)

[0173] Once the samples were prepared, the solution was exchanged using a 0.05 M, 0.1 M, or 0.2 M NaCl solution. Specifically, 450 pL of a 0.05 M, 0.1 M, or 0.2 M NaCl, 5 mM sodium phosphate buffer (referred herein as “Phosphate”), pH 9.7 solution was added to the prepared 50 pL sample and mixed. The solution above was spun at 14000rcf for 15 minutes to reduce the volume to 50 pL (spin 5).

[0174] This salt addition and spinning process was repeated a number of times, with samples taken after the spinning to test the conjugation reaction completion. Specifically, for 0.05 M NaCl, the salt addition and spinning process was repeated for a total of 12 times (spins 5-16), with samples taken after spins 8, 12, and 16 (corresponding to 4, 8, and 12 NaCl exchanges) to test conjugation reaction completion. For 0.1 M NaCl, the salt addition and spinning process was repeated for a total of 8 times (spins 5-12), with samples taken after spins 5, 6, 8, 10, and 12 (corresponding to 1, 2, 4, 6 and 8 NaCl exchanges). For 0.2 M NaCl, the salt addition and spinning process was repeated for a total of 6 times (spins 5-10), with samples taken after spins 5, 6, 8, and 10 (corresponding to 1, 2, 4, and 6 NaCl exchanges). The results are shown in Fig. 1. After the final spin, the solution was added 450 pL of 0.05 M NaCl, 5 mM Phosphate, pH 9.7 with mixing.

[0175] The conjugation reaction was completed using 5 molar equivalents of isothiocyanate functionalized deferoxamine (NCS-DFO), 50% (v / v) dimethylsulfoxide (DMSO), at a pH of 9.7 and a temperature of 37° C. The MALAT1-AH was added to this mixture and allowed to incubate for 30 min at 37° C.

[0176] Analysis of conversion was completed by Liquid Chromatography with Ultraviolet Mass Spectrometer Detection (LC-UV-MS). All samples were analyzed using an Agilent UPLC 1290 series system (Agilent, Santa Clara, CA). The UPLC column was an Acquity BEH C18, 1.7 pm particle size, 2.1 mm internal diameter x 100 mm column from Waters.

[0177] 20

[0178] MEl\58529840.vl 123429-12420

[0179] Mobile phase A consisted of 10% acetonitrile, 5 mM tributylammonium acetate and 1 pM EDTA. Mobile phase B consisted of 80% ACN, 5 mM tributylammonium acetate, 1 pM EDTA in water. The chromatographic gradient was programmed: 45-80% B from 0 to 14.7 min; 80% B from 14.7 to 16.7 min; 80-45% B from 16.7 to 17.3 min, kept constant at 45% B until 20.0 min. The post-run time was 3 min, and the flow rate was 0.25 mL / min. The temperature of the heated column chamber was 50 °C. The sample volume injected was 25 pL. A diode array detector at 260 nm was used for UV detection of oligonucleotide. For MS detection, an Agilent 6130 quadrupole mass spectrometer equipped with a nebulizer ESI source was used. Nitrogen was used as both drying and nebulizing gas. The drying gas flow was 12 L / min and the temperature 275 °C. The nebulizer pressure was 30 psig. The needle voltage was set to 4000 V and the fragmentor to 100 V. The skimmer voltage was 50 V.

[0180] As shown in Fig. 1, the higher the salt concentration, the less exchanges were required to reach higher levels of reaction completion (0.2 M NaCl solution achieving >90% completion with only 6 exchanges versus 8 exchanges for the 0.1 M NaCl solution). Further, it was discovered that the 0.05 M NaCl solution was unable to achieve a conversion of 50%, even with up to 12 exchanges.

[0181] Example 4. Comparison with Salt Spiking

[0182] In order to determine whether the removal of the NRH3+ions were required to achieve high conjugation completion, two test conjugation reactions were carried out with the simple addition of NaCl solutions, but without the removal or reduction in the amount the NRH3+ions during conjugation reaction.

[0183] The samples were prepared as described in Example 3 above with the exception of the final spin step (spin 4). For one sample, 150 pL of the prepared sample was aliquoted into a 2 mL tube, and then 50 pL of 4 M NaCl, 25 mM sodium phosphate, at pH 9.7 were also added to the tube, for a mixed NaCl concentration of 1 M. For the second sample, 190 pL of the prepared sample was aliquoted into a 2 mL tube, and then 10 pL of 4 M NaCl, 25 mM sodium phosphate, at pH 9.7 were also added to the tube, for a mixed NaCl concentration of 0.2 M. These solutions were mixed with 5 equivalents of NCS-DFO and allowed to incubate at 37°C, and then directly tested for conjugation completion as described in Example 3. After 30 minutes, the 1 M NaCl sample achieved only 14% completion, and the 0.2 M NaCl sample achieved only 7% completion. This showed that removal of the NRH3 ions from

[0184] 21

[0185] MEl\58529840.vl 123429-12420 conjugation reaction solution is crucial as the presence of these ions leads to lower yield likely due to competition with the amine group on the oligonucleotide.

[0186] 22

[0187] MEl\58529840.vl

Claims

123429-12420CLAIMSWhat is claimed is:

1. A method for preparing an oligonucleotide conjugate comprising the steps of: a) performing a salt exchange on an oligonucleotide using an aqueous salt solution to replace a NR.H3 group bound to or associated with the oligonucleotide with a cation in the aqueous salt solution, wherein: the oligonucleotide comprises an alkylamine group;R is H or Ci-4alkyl optionally substituted by 1 to 4 groups independently selected from halo and OH; b) reacting the alkylamine group of the oligonucleotide with an amine-reactive group of a biomolecule, an agent, or a bifunctional linker to form the oligonucleotide conjugate.

2. The method of claim 1, wherein R is H.

3. The method of claim 1, wherein R is -C(CH2OH)3.

4. The method of any one of claims 1-3, wherein the aqueous salt solution comprises an alkali metal salt or an earth metal salt.

5. The method of any one of claims 1-4, wherein the cation is Na+, K+, Rb+, Cs+, Mg2+, Cu+, Cu2+, Zn2+, or Ca2+.

6. The method of any one of claims 1-3, wherein the aqueous salt solution is a NaCl or KC1 solution.

7. The method of any one of claims 1-6, wherein the aqueous salt solution comprises 0.1 M to 4.5 M of a salt.

8. The method of claim 7 wherein the aqueous salt solution comprises 0.5 M to 2 M of the salt.

9. The method of claim 7 wherein the aqueous salt solution comprises 0.1 M to 2 M of the salt.23MEl\58529840.vl123429-1242010. The method of any one of claims 1-9, wherein the step a) is carried out by hydrophobic interaction chromatography with the aqueous salt solution.

11. The method of any one of claims 1-9, wherein the step a) is carried out by subjecting the oligonucleotide to ultrafiltration / diafiltration (UF / DF) using the aqueous salt solution.

12. The method of any one of claims 1-11, wherein the oligonucleotide has the alkylamine group attached thereto through a 5’-phosphate or 5’-phosphorothiolate group.

13. The method of claim 12, wherein the oligonucleotide comprises the following group:wherein:X is O or S;L is a spacer;M+is H+Na+, K+, or NRH3+; and represents attachment site to the 5 ’-OH group of the oligonucleotide.

14. The method of claim 13, wherein L is C2-2oalkylene.

15. The method of claim 14, wherein L is -(CH2)m- and m is an integer from 2 to 8.

16. The method of claim 15, wherein L is -(CFhje-17. The method of any one of claims 1-11, wherein before step a) the oligonucleotide is represented by the following formula:24MEl\58529840.vl123429-12420or a salt thereof, wherein:R1, for each occurrence, is independently a nucleobase;R2, for each occurrence, is independently selected from the group consisting of H, halo, OH, and Ci-ealkoxy optionally substituted with Ci-ealkoxy or -C(O)NHCi-3alkyl;R3, for each occurrence, is independently H or forms a ring with the alkoxy group of R2; n is an integer from 2 to 10; q is an integer from 1 to 25;X, for each occurrence, is independently O or S;M+, for each occurrence, is independently H+, Na+, K+, or NRH3 .

18. The method of claim 17, wherein all of the P=X groups in the oligonucleotide are P=S.

19. The method of claim 17, wherein all of the P=X groups in the oligonucleotide are P=O.

20. The method of claim 17, wherein greater than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the P=X groups in the oligonucleotide are P=S.

21. The method of any one of claims 17-20, wherein the nucleobase is selected from the group consisting of cytosine, guanine, adenine, thymine, uracil, hypoxanthine, xanthine, 7- methylguanine, 5,6-dihydrouracil, 5-methylcytosine, and 5-hydroxymethylcytosine.25MEl\58529840.vl123429-1242022. The method of claim 21, wherein the nucleobase is selected from the group consisting of cytosine, guanine, adenine, thymine, uracil, and 5-methylcytosine.

23. The method of any one of claims 17-22, wherein n is an integer from 3 to 6.

24. The method of claim 23, wherein n is 6.

25. The method of any one of claims 17-24, wherein: each R2is independently selected from the group consisting of H, F, and Ci-4alkoxy optionally substituted with Ci-4alkoxy or -C(O)NHCH3; and each R3is independently H or forms a ring with the alkoxy group of R2, wherein the ring is a 5 or 6-membered ring optionally substituted with 1 to 3 Ci-4 alkyl groups.

26. The method of claim 25, wherein: each R2is independently selected from the group consisting of H, F, -OCH3, -OCH2CH2OCH3, and -OCH2C(O)NHCH3; and each R3is independently H or forms a ring with the alkoxy group of R2, wherein the ring is a 5-membered ring.

27. The method of claim 25 or 26, wherein each R3is independently H or together with the alkoxy group of R2form -CH2-O-.

28. The method of claim 25, wherein: each R2is independently selected from H, -OCH2CH2OCH3 and -OCH2C(O)NHCH3; and each R3is H.

29. The method of any one of claims 13-28, wherein each M+is NRH3+.

30. The method of claim 29, wherein R is H or -C(CH2OH)3.26MEl\58529840.vl123429-1242031. The method of any one of claims 1 -30, wherein the amine-reactive group is -COOH, - COX’, or an activated ester group, an isocyanate group, or an isothiocyanate group, wherein X’ is a halide.

32. The method of claim 31, wherein the amine-reactive group is N-hydroxysuccinimide ester33. The method of claim 31, wherein the amine-reactive group is an isothiocyanate group.

34. The method of any one of claims 1-33, wherein the reaction completion percentage is 50% or greater.

35. The method of any one of claims 1-34, wherein the ratio of the cation to the NRH3+group in step a) is about 450,000: 1 to about 4,500: 1.

36. The method of any one of claims 1-35, wherein 80% or greater of the NRH3+is exchanged with the cation and removed from the solution.27MEl\58529840.vl

Images