Methods for amplification of nucleic acids
By integrating positive controls within the same reaction tube using delayed amplification and blockers, the method addresses the inefficiencies of separate reactions, enhancing reliability and reducing costs in nucleic acid amplification processes.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- MEDIX BIOTECHNOLOGIES INC
- Filing Date
- 2025-10-20
- Publication Date
- 2026-04-23
AI Technical Summary
Current amplification methods for nucleic acids in molecular diagnostics require separate reactions for samples and positive controls, leading to increased costs, complexity, and risk of contamination, while traditional external positive controls fail to ensure optimal reaction conditions in the sample environment.
A method that allows the positive control to be used in the same tube as the sample by delaying its amplification, using amplification blockers like C3 spacers to differentiate between sample and control amplification, and measuring results multiple times to verify reaction integrity.
This approach reduces the number of required reactions, decreases contamination risk, and provides more reliable and accurate results by ensuring the reaction environment is suitable for the sample, thus improving diagnostic accuracy.
Smart Images

Figure US2025051688_23042026_PF_FP_ABST
Abstract
Description
Docket No. MDXB1002W001PATENT APPLICATIONMethods for Amplification of Nucleic AcidsREFERENCES
[0001] This application claims priority from U.S. provisional application serial no. 63 / 709,363, entitled "Multi-Dimensional Multiplexing Method," filed on October 18, 2024.
[0002] This application claims priority from U.S. provisional patent application serial no. 63 / 709,366, entitled "Delayed Amplification for PCR with Integrated Positive Controls," filed on October 18, 2024.
[0003] Each publication, patent, and / or patent application mentioned in this specification is herein incorporated by reference in its entirety to the same extent as if each individual publication and / or patent application was specifically and individually indicated to be incorporated by reference.BACKGROUNDTECHNICAL FIELD
[0004] The disclosed implementations relate generally to systems and methods used in molecular biology and biomedical applications, and in particular to those for amplification of DNA or RIMA sequences, such as used for diagnostics or, more generally, detection of pathogens and live materials.CONTEXT
[0005] In molecular diagnostics, particularly in amplification processes, sample DNA / RNA and positive controls are run in separate reactions to avoid interference.
[0006] The subject matter discussed in this section should not be assumed to be prior art merely as a result of its mention in this section. Similarly, a problem mentioned in this section or associated with the subject matter provided as background should not be assumed to have been previously recognized in the prior art. The subject matter in this section merely represents different approaches, which in and of themselves can also correspond to implementations of the claimed technology.BRIEF DESCRIPTION OF THE DRAWINGS
[0007] The technology will be described with reference to the drawings, in which:
[0008] FIG. 1 illustrates an example of the pathogen detection process using a conventional polymerase chain reaction (PCR).Docket No. MDXB1002W001
[0009] FIG. 2 illustrates an example method of copying a target nucleic acid sequence that uses delayed amplification.
[0010] FIG. 3A shows positive control sequence as an exact copy of the nucleic acid sequence in target region.
[0011] FIG. 3B shows an example positive control sequence (synthesized code) which has a blocker (an iSpC3 spacer) inserted.
[0012] FIGS. 3A-C show examples of how templates can be constructed based on the target region in the targeted pathogen genome strand.
[0013] In the figures, like reference numbers may indicate functionally similar elements. The systems and methods illustrated in the figures— and described in the Detailed Description below— may be arranged and designed in a wide variety of different implementations. Neither the figures nor the Detailed Description are intended to limit the scope as claimed. Instead, they merely represent examples of different implementations.DETAILED DESCRIPTION
[0014] In molecular biology, amplification processes are used to make millions of copies of specific DNA or RNA sequences (nucleic acid sequences). This can be used in several applications, including diagnostics, gene expression analysis, identification of genetic variations, biomarker discovery, and, more generally, detection of pathogens and live materials.
[0015] Examples are the detection and diagnosis of pathogens causing infectious disease, cancer causing mutations in oncology, and mutations involved in inherited disease. To test a sample, it is placed in an environment with one or more reagents (assays) to detect pathogen DNA. The pathogen DNA is amplified to increase sensitivity, and the test result can be read from, for example, a fluorescent marker using a fluorescence reader.
[0016] Many methods of amplification are known in the art. They can be roughly divided into thermo-cycling (e.g., PCR, qPCR, RT-PCR, WGA, etc.), isothermal (LAMP, RPA, MDA, RCA, WGA, etc.), and hybrid (RT-LAMP, RT-RPA, WGA, MALBAC, etc.) technologies.
[0017] To reduce the chance of false positives, false negatives, and to know that a diagnostic test itself was performed correctly, amplification is usually performed on both a material with a control sequence (DNA or RNA) and a sample that may or may not include a target DNA or RNA sequence (the material to be tested). The control sequence can be one or more internal amplification controls (IACS) or external amplification controls. IACS monitor for false-negative results caused by sample inhibitors or other reaction failures. IACs use nontarget DNA / RNA and can be used in the same tube as the sample. For example, they can use a synthetic DNA molecule or a housekeeping gene from the sample organism that is expectedDocket No. MDXB1002W001 to always be present. External controls are run in separate tubes from the test samples and are typically used to check the general functionality of the reagents and equipment. External controls can be differentiated in positive controls and negative controls. External positive controls can be synthesized based on the template of the target DNA or target RNA. Because they lack inhibitors, when used in the same reaction mix as the sample (although in different tubes), they should react better and earlier than the sample DNA or RNA. External negative controls, e.g., no-template-controls (NTCs), contain all reaction components except the DNA / RNA template. It should not produce an amplification signal and can serve to measure the reaction noise level.
[0018] Amplification processes run the sample and the external positive control in separate reactions to avoid interference. This separation increases the number of reactions required, leading to higher costs, more complex workflows, and an increased risk of contamination due to increased pipetting. Traditional external positive controls also fail to provide assurance that the reaction conditions are optimal within the same environment as the sample.
[0019] The technology disclosed herein addresses these challenges and describes an amplification method that allows the positive control to be used in the same tube as the sample. By delaying amplification of the positive control, the positive control and the sample can be used in the same tube. The sample will respond first, and the control will respond later. The method requires that amplification be measured more than once, so that it can distinguish between the response for sample and the positive control.
[0020] Regular PCR performs its repeated temperature cycles first, after which it adds the probes to measure the amplification results. However, qPCR adds the probes in each temperature cycle, so that it can measure amplification results much more often. Thus, in the case of PCR, qPCR is the process that combines with our methodology. Similarly, for other amplification methods that conventionally don't measure repeatedly, our technology adds one or more measurement cycles, for instance by adding or binding probes repeatedly. This way, implementations of our technology can be combined with any conventional amplification processes.
[0021] Having both the sample and positive controls in the same reaction not only reduces the number of required reactions but also tests if the reaction is not inhibited by materials in the sample and that the enzyme, primers, and probes are functioning as intended. By running them together, this method provides verification that everything in the reaction works as expected and provides more reliable and accurate results.TERMINOLOGY
[0022] As used herein, the phrase "one of" should be interpreted to mean exactly one of the listed items. For example, the phrase "one of A, B, and C" should be interpreted to meanDocket No. MDXB1002W001 any of: only A, only B, or only C. When used in a claim, the phrase "A or B" means either A or B, but not both. When used elsewhere in this document, "A or B" can mean "A", "B", or "A and B".
[0023] As used herein, the phrases "at least one of" and "one or more of" should be interpreted to mean one or more items. For example, the phrase "at least one of A, B, or C" or the phrase "one or more of A, B, or C", and also the phrase "one of A, B, and / or C", should be interpreted to mean any combination of A, B, and / or C. The phrase "at least one of A, B, and C" means at least one of A and at least one of B and at least one of C.
[0024] Unless otherwise specified, the use of ordinal adjectives first, second, third, etc., to describe an object, merely refers to different instances or classes of the object and does not imply any ranking or sequence.
[0025] The terms "comprising" and "consisting" have different meanings in this patent document. An apparatus, method, or product "comprising" (or "including") certain features means that it includes those features but does not exclude the presence of other features. On the other hand, if the apparatus, method, or product "consists of" (or "contains") certain features, the presence of any additional features is excluded.
[0026] The term "configured" to perform a task or tasks is a broad recitation of structure generally meaning having circuitry that performs the task or tasks during operation. As such, the described item can be configured to perform the task even when the unit / circuit / component is not currently on or active. In general, various items may be described as performing a task or tasks, for convenience in the description. Such descriptions should be interpreted as including the phrase configured to.
[0027] As used herein, the term "based on" is used to describe one or more factors that affect a determination. This term does not foreclose the possibility that additional factors may affect the determination. That is, a determination may be solely based on specified factors or based on the specified factors as well as other, unspecified factors. Consider the phrase "determine A based on B". This phrase specifies that B is a factor that is used to determine A or that affects the determination of A. This phrase does not foreclose that the determination of A may also be based on some other factor, such as C. This phrase is also intended to cover an implementation in which A is determined based solely on B. The phrase based on is thus synonymous with the phrase "based at least in part on".
[0028] The terms "substantially", "close", "approximately", "near", and "about" refer to being within minus or plus 20% of an indicated value, unless explicitly specified otherwise.
[0029] The following terms or acronyms used herein are defined at least in part as follows:
[0030] "C3 spacer" — a three-carbon chain attached to the 3' end of an oligonucleotide.
[0031] "DNA" — deoxyribonucleic acidDocket No. MDXB1002W001
[0032] "dsDNA" — double-stranded DNA
[0033] "gBIock" — a double-stranded, synthetic DNA fragment, up to 3,000 base pairs long, used for gene construction and other molecular biology applications. The "oligo sequence" refers to the string of A, T, C, and G bases that make up a gBIock's sequence.
[0034] "LAMP" — loop-mediated isothermal amplification
[0035] "MALBAC" — multiple annealing and loop-based amplification
[0036] "MDA" — multiple displacement amplification
[0037] "Nucleotides" — DNA nucleotides are the basic building blocks of DNA and RNA, consisting of a phosphate group, a deoxyribose sugar, and one of four nitrogenous bases: adenine (A), thymine (T), guanine (G), or cytosine (C). These nucleotides link together to form the two strands of the DNA double helix, with base pairing always occurring between A and T, and G and C. A fifth nucleotide is uracil (U), which is only found in RNA. Thymine (T) is only found in DNA. Uracil replaces thymine and pairs with adenine.
[0038] "Oligonucleotides" or "oligos" — short strands of DNA or RNA used in research and therapeutics, with functions ranging from gene-specific binding to acting as primers for DNA replication. They are used in amplification techniques, where they serve as primers.
[0039] "PCR" — polymerase chain reaction
[0040] "qPCR" — quantitative polymerase chain reaction or real-time polymerase chain reaction
[0041] "RCA" — rolling circle amplification
[0042] "RNA" — ribonucleic acid; RNA is usually single stranded.
[0043] "RPA" — recombinase polymerase amplification
[0044] "RT-LAMP" — combines reverse transcription with LAMP for amplification of RNA at a single temperature
[0045] "RT-PCR" — reverse transcription polymerase chain reaction
[0046] "RT-qPCR" — a combination of real-time and reverse transcription polymerase chain reaction
[0047] "RT-RPA" — combines reverse transcription with RPA. This can be used to amplify RNA in a rapid, isothermal manner without a thermal cycler.
[0048] "ssDNA" — single-stranded DNA
[0049] "WGA" — whole genome amplification.Docket No. MDXB1002W001IMPLEMENTATIONSAn Example Thermo-cvclinq Amplification Process
[0050] FIG. 1 illustrates an example of the pathogen detection process 100 using a conventional polymerase chain reaction (PCR). PCR is a thermo-cycling technology. Pathogen detection process 100 comprises:
[0051] 110 - (Optional - box drawn with dashed lines). PCR first applies heat to separate original double-stranded DNA (dsDNA) into a strand and its copy, thus obtaining singlestranded DNA (ssDNA). This step is called "denaturing". For example, a thermocycler heats up the dsDNA sample to about 95°C causing the dsDNA to separate into single strands, that may include the targeted pathogen genome strand 101. Single strands are needed to allow primers 103A-B to bind in the next step. For single-stranded RNA this step can be skipped.
[0052] 120 - In a second step, "annealing" or "binding", PCR lowers the temperature to anneal the primers to the range of 45°C - 65°C so that single stranded primers anneal (bind) to their complementary sequences on an available target region 102 of the targeted pathogen genome strand 101. The target region may also be called an "amplicon". To detect the target region 102, forward primer 103A and reverse primer 103B move along the targeted pathogen genome strand 101, and bind to it when they encounter and area with complementary genetic code. Once a primer 103A or B has annealed to a target sequence, that part of the target sequence is double stranded, whereas other parts may still be single stranded.
[0053] Primers are selected to meet several criteria in the pathogen detection process. For example, a primer's length may need to be in a range of 15 to 150 base pairs, so that replication is sufficiently reliable. It may need to be stable at 60 degrees so that the test can be done in laboratory conditions. The primers cannot repeat inside the amplicon. The first five and the last three nucleotides in the primers are the most important. They are called the 5' end and the 3' end of the primer, respectively. The 5' end is the end of a DNA or RNA strand with a phosphate group attached to the 5' carbon atoms in the sugar ring of the nucleotide. The 3' end is an end with a free hydroxyl (-OH) group on the 3' carbon atoms in the sugar ring of the nucleotide. The 3' ends of forward primers 103A and reverse primers 103B are oriented towards the inner part of target region 102, whereas the 5' ends coincide with the ends of target region 102. There are thousands of possible pathogens, and the amplicon must be unique and detect only the target, and none of the other pathogens.
[0054] 130 - In a third step ("extension" or "elongation" of the dsDNA or copy RNA in between the primers 103A-B), PCR may raise the temperature to the range of 65°C - 75°C. This allows a polymerase enzyme in the reagent to add copy nucleotides 104 starting from the 3' ends of the primers 103A-B, copying the remaining DNA or RNA of target region 102. Successive thermal cycles ("PCR cycles") each double the DNA or RNA, allowing forDocket No. MDXB1002W001 exponential amplification. The copies generated by the polymerase are called amplified amplicons 106.
[0055] The amplification process uses a forward primers 103A and reverse primers 103B that complement both strands from a matched pair of single nucleic acid strands. For example, the forward primer has the same nucleotides as the corresponding nucleotides in target region 102 whereas the reverse primer has the complementary nucleotides from the corresponding part of target region 102.
[0056] In case of PCR, during the elongation (or extension) phase, polymerase does not continue extending indefinitely. For the positive control, the extension length is limited by the length of the template. For the (natural) sample, elongation continues until the process runs out of nucleotides to pair with, or until an external factor such as the temperature in a thermos-cycling amplification process disables the polymerase. A thermal cycle must be long enough to copy the whole amplicon. If not, amplified amplicons are incomplete, which means that in the next cycle no amplification can take place since the opposite-end primer will not be able to bind to the incomplete amplified amplicon. After two cycles, the reaction produces a majority of precisely defined fragments— limited by the two primer binding sites.
[0057] To detect the amplicons and amplified amplicons 106, implementations may use various types of probe 105 known in the art, e.g., hydrolysis probes (e.g., Taqman), molecular beacons, dual hybridization probes (e.g., FRET), molecular inversion probes (MIPs), sequence-specific oligonucleotides (SSO) probes, mini groove binder probes (e.g., Eclipse), combined primer / probe molecules (e.g., Scorpion), dyes (e.g., SYBR Green), etc. Probes may be less or more sequence specific. Probes may be based on fluorescence, radiation, or other signals. In one implementation, a fluorescent reporter is attached to the 5' end and a quencher to the 3' end. During extension, a Taq polymerase cleaves the probe, separating the reporter and quencher, resulting in fluorescence proportional to the amplified product.
[0058] Jointly, the genetic code of target region 102, including primers 103A-B and probe 105 are called a PCR blueprint 107.Delaved Amplification
[0059] Implementations of the technology disclosed herein run material with a positive control sequence and a sample that may include the target nucleic acid sequence in the same amplification reaction, but delay amplification of the positive control. The target nucleic acid sequence can be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA).
[0060] Implementations may use any amplification process known in the art, including, but not limited to, PCR, qPCR, RT-PCR, LAMP, RPA, MDA, RCA, RT-LAMP, RT-RPA, MALBAC, and WGA. In some implementations, reagents include a forward primer, a reverse primer, a polymerase enzyme, and one or more probes that provide a signal that depends on the amplification results. A probe may be DNA-based or dye based. The signal may be aDocket No. MDXB1002W001 luminescence signal, or any other signal. The signal may be proportional to the amplification results, or it may have a non-linear relation to the amplification results, for example a threshold function.
[0061] The positive control sequence may be synthesized based on a template of the target nucleic acid sequence. Alternatively, it may be a naturally occurring sequence such as a sequence always present in a potential host of the target nucleic acid sequence but not related to the target nucleic acid sequence.
[0062] Implementations delay amplification of the positive control sequence material by including one or more amplification blockers. Examples of blockers are a blocking primer, a peptide nucleic acid (PNA) clamp, a polymerase inhibitor, and an oligonucleotide blocker. Implementations may measure amplification results repeatedly, but at least a first time and a second time. The first time occurs after a target sequence amplification threshold and before a positive control sequence amplification threshold. The second time occurs after the positive control sequence amplification threshold. For thermos-cycling amplification processes, the target sequence amplification threshold and the positive control sequence amplification threshold may be related to numbers of thermal cycles performed in the amplification process. For isothermal amplification processes, the target sequence amplification threshold and the positive control sequence amplification threshold may be related to elapsed time.
[0063] By delaying amplification for the positive control, early amplification can be attributed to the target sequence, significantly reducing the likelihood of false positives and negatives. Moreover, running both samples and positive controls in the same reaction improves consistency in the reaction environment, verifying that the sample is not inhibited by any substances and that the enzymes, primers, and probes are functioning correctly.
[0064] In some implementations, the environment includes a no-template control (NTC). This can help determine the reaction's noise level and thus prevent false positives.
[0065] An implementation may use one or more C3 spacers (3-carbon chains) as amplification blockers. The C3 spacers are directly incorporated or inserted at either or both 3' ends of the positive control. This creates a structural hindrance that initially prevents polymerase activity. Over time, the polymerase bypasses the blocker, leading to delayed elongation and subsequent amplification.
[0066] The C3 spacer (three-carbon chain, e.g., / iSpC3 / in a gBIock oligonucleotide sequence), is a synthetic modification of a template. This chemical group physically blocks enzymatic extension and hybridization at the blocked end. These modifications are placed or incorporated at the 3' end of the oligonucleotide.
[0067] FIG. 2 illustrates an example method 200 of copying a target nucleic acid sequence that uses delayed amplification. Method 200 starts in Molecular assay development platform 210 and ends in 280 and comprises the following actions:Docket No. MDXB1002W001
[0068] 220 - Placing a material with a positive control sequence and a sample including the target nucleic acid sequence in an environment with one or more reagents, wherein the positive control sequence includes one or more amplification blockers selected to delay amplification of the positive control sequence.
[0069] 230 - Amplifying the target nucleic acid sequence and the positive control sequence.
[0070] 240 - Measuring first amplification results after a target sequence amplification threshold and before a positive control sequence amplification threshold. Some implementations measure the first amplification results at a first time that is related to a number of amplification cycles (e.g., in thermos-cycling amplification processes such as qPCR) and other implementations measure the first amplification results at a first time that is an elapsed time (e.g., in an isothermic amplification process).
[0071] 250 - Measuring second amplification results after the positive control sequence amplification threshold. Some implementations measure the second amplification results at a second time that is related to a number of amplification cycles (e.g., in thermos-cycling amplification processes such as qPCR) and other implementations measure the second amplification results at a second time that is an elapsed time (e.g., in an isothermic amplification process).
[0072] 260 - (Optional) inspecting the second amplification results to determine if the method functioned as expected. Some implementations include a no-template control (NTC) in the environment to determine the reactions' noise level and compare the first amplification results and the second amplification results with the noise level. If the second amplification results exceed the noise level, then the method has functioned as expected. If the first amplification results also exceed the noise level, the target nucleic acid sequence was found and amplified.
[0073] 270 - (Optional) in response to determining that the second amplification results were negative or did not exceed the noise level, discarding the first and second amplification results.
[0074] FIGS. 3A-C show examples of how templates can be constructed based on the target region 102 in the targeted pathogen genome strand 101. The positive control sequence 302A-C is synthesized based on the nucleic acid sequence in target region 102.
[0075] FIG. 3A shows positive control sequence 302A as an exact copy of the nucleic acid sequence in target region 102. Its genetic code is AGTATGTACTGGAACCGGCAGTAGAATCGATTGGCTGCATACTGCTGGTATCAACACGCACGACCAT ATCGTGTAACTGTTTGTCCGTTATAGGGTGTCG (the exact sequence doesn't matter because it is an example, but this is an Escherichia coli (E. coli) amplicon). Its first 23 molecules have been selected as the forward primer target 310 for the forward primer 103A, which has theDocket No. MDXB1002W001 same genetic code AGTATGTACTGGAACCGGCAGTA. Its final 27 molecules have been selected as the reverse primer target 320 for the reverse primer 103B, which has a complementing genetic code ATTGACAAACAGGCAATATCCCACAGC. By making one primer match one end of target region 102 at unchanged code and the other primer match the other end of target region 102 at complementary code, the primers can address both strands of a pair of doublestranded nucleic acid. The remaining molecules 330 along with the opposite end forward primer target 310 or reverse primer target 320 are to be copied by polymerase. Because the genetic code of positive control sequence 302A is identical to the genetic code of target region 102 in the sample, they cannot be distinguished. Thus, with the unmodified template of FIG. 3A, positive control sequence 302A can only be used as an external control— in other words, its reactive environment cannot be the same as for targeted pathogen genome strand 101.
[0076] FIG. 3B shows an example positive control sequence 302B (synthesized code) which has a blocker 340A (an iSpC3 spacer) inserted. This means that the synthesized positive control is no longer identical to the E. coli amplicon. In a qPCR amplification process, blocker 340A will delay the polymerase enzyme from copying the genetic code between the two ends that are bound to the primers 103A-B. However, the blocker won't completely prevent it, and copying will start multiple PCR cycles later than for the natural sample's target region 102. This amplification delay enables use of the synthesized positive control sequence 302B in the same environment as the natural targeted pathogen genome strand 101.
[0077] The inventors have researched the performance of C3 blockers in several locations of the positive control sequence. While in FIG. 3B blocker 340A is inserted after the 3' end of the genetic code that aligns with forward primer 103A, FIG. 3B shows an example with two blockers, blocker 340A at the same location, and blocker 340B inserted before the 3' end of the genetic code that aligns with reverse primer 103B. Again, since the synthesized code sequence is not identical to the natural nucleic acid sequence, and it behaves differently during amplification, the synthesized material and the natural material can be used in a single reactive environment.
[0078] It was found that the configuration in FIG. 3C performs strongly. In experiments, the natural pathogen (the E. coli DNA) showed clear amplification results at 22 PCR cycles, and the positive control sequence showed clear amplification results at 36 cycles. Thus, a first amplification results measurement could comfortably be taken at, say, 25 cycles, and a second amplification results measurement could comfortably be taken at, say 40 cycles. The experiments showed that the C3 blocker is reliable, and the whole process of delayed amplification has several benefits over the conventional method, without introducing issues or increasing costs.Docket No. MDXB1002W001PARTICULAR IMPLEMENTATIONS
[0079] Described implementations of the subject matter can include one or more features, alone or in combination, as described in the following clauses.Clause 1. A method of copying a target nucleic acid sequence (102), comprising: placing a material with a positive control sequence (302) and a sample including the target nucleic acid sequence (101) in an environment with one or more reagents, wherein the positive control sequence (302) includes one or more amplification blockers (340) selected to delay amplification of the positive control sequence (302); amplifying the target nucleic acid sequence (102) and the positive control sequence (302); measuring first amplification results at a first time, wherein the first time occurs after a target sequence amplification threshold and before a positive control sequence amplification threshold; and measuring second amplification results at a second time, wherein the second time occurs after the positive control sequence amplification threshold.Clause 2. The method of clause 1, further comprising: inspecting the second amplification results to determine if the method functioned as expected.Clause 3. The method of clause 1 or clause 2, wherein: the first amplification results include a target amplification result.Clause 4. The method of any of the clauses 1 to 3, wherein the environment is a single environment.Clause 5. The method of any of the clauses 1 to 4, wherein the target nucleic acid sequence (102) includes one of a deoxyribonucleic acid (DNA) and a ribonucleic acid (RIMA).Clause 6. The method of any of the clauses 1 to 5, wherein amplifying the target nucleic acid sequence (102) and the positive control sequence (302) includes at least one of: polymerase chain reaction (PCR), quantitative polymerase chain reaction (qPCR), reverse transcription polymerase chain reaction (RT-PCR), loop-mediated isothermal amplification (LAMP),Docket No. MDXB1002W001 multiple-annealing and loop-based amplification (MALBAC), recombinase polymerase amplification (RPA), multiple displacement amplification (MDA), rolling circle amplification (RCA), reverse transcription with LAMP (RT-LAMP), reverse transcription with RPA (RT-RPA), or whole-genome amplification (WGA).Clause 7. The method of any of the clauses 1 to 6, wherein the one or more reagents include a forward primer (103A), a reverse primer (103B), a polymerase enzyme, and one or more probes (105) that provide a signal that depends on the first amplification results and / or the second amplification results.Clause 8. The method of clause 7, wherein: the signal that depends on the first amplification results and / or the second amplification results is a fluorescence signal.Clause 9. The method of any of the clauses 1 to 8, wherein: the positive control sequence (302) is synthesized based on a template of the target nucleic acid sequence (102).Clause 10. The method of any of the clauses 1 to 9, wherein: the one or more amplification blockers (340) include at least one of a blocking primer, a peptide nucleic acid (PNA) clamp, a polymerase inhibitor, or an oligonucleotide blocker.Clause 11. The method of any of the clauses 1 to 10, wherein one of the one or more amplification blockers (340) includes a first C3 spacer.Clause 12. The method of clause 11, wherein: the first C3 spacer aligns with a 3' end of a forward primer (103A); and a second of the one or more amplification blockers (340) includes a second C3 spacer aligned with a 3' end of a reverse primer (103).Docket No. MDXB1002W001Clause 13. The method of any of the clauses 1 to 12, wherein a second environment comprises a no-template control (NTC) and the method comprises comparing the first amplification results and the second amplification results with a noise level found from amplification results measurements taken in the second environment.Clause 14. The method of any of the clauses 1 to 13, wherein the target sequence amplification threshold is related to a first number of amplification cycles and the positive control sequence amplification threshold is related to a second number of amplification cycles.CONSIDERATIONS
[0080] We describe various implementations of a method of amplification of a nucleic acid sequence.
[0081] The technology disclosed can be practiced as an apparatus, method, composition of matter, or article of manufacture. One or more features of an implementation can be combined with the base implementation. Implementations that are not mutually exclusive are taught to be combinable. One or more features of an implementation can be combined with other implementations. This disclosure periodically reminds the user of these options. Omission from some implementations of recitations that repeat these options should not be taken as limiting the combinations taught in the preceding sections - these recitations are hereby incorporated forward by reference into each of the implementations described herein.
[0082] Although the description has been described with respect to specific implementations thereof, these specific implementations are merely illustrative, and not restrictive. The description may reference specific structural implementations and methods and does not intend to limit the technology to the specifically disclosed implementations and methods. The technology may be practiced using other features, elements, methods and implementations. Implementations are described to illustrate the present technology, not to limit its scope, which is defined by the claims. Those of ordinary skill in the art recognize a variety of equivalent variations on the description above.
[0083] All features disclosed in the specification, including the claims, abstract, and drawings, and all the steps in any method or process disclosed, may be combined in any combination, except combinations where at least some of such features and / or steps are mutually exclusive. Each feature disclosed in the specification, including the claims, abstract, and drawings, can be replaced by alternative features serving the same, equivalent, or similar purpose, unless expressly stated otherwise.
[0084] Although the description has been described with respect to specific implementations thereof, these specific implementations are merely illustrative, and not restrictive.Docket No. MDXB1002W001
[0085] It will also be appreciated that one or more of the elements depicted in the drawings / figures can also be implemented in a more separated or integrated manner, or even removed or rendered as inoperable in certain cases, as is useful in accordance with a particular application.
[0086] Thus, while specific implementations have been described herein, latitudes of modification, various changes, and substitutions are intended in the foregoing disclosures, and it will be appreciated that in some instances some features of specific implementations will be employed without a corresponding use of other features without departing from the scope and spirit as set forth. Therefore, many modifications may be made to adapt a particular situation or material to the essential scope and spirit.
Claims
Docket No. MDXB1002W001CLAIMS1. A method of copying a target nucleic acid sequence, comprising: placing a material with a positive control sequence and a sample including the target nucleic acid sequence in an environment with one or more reagents, wherein the positive control sequence includes one or more amplification blockers selected to delay amplification of the positive control sequence; amplifying the target nucleic acid sequence and the positive control sequence; measuring first amplification results at a first time, wherein the first time occurs after a target sequence amplification threshold and before a positive control sequence amplification threshold; and measuring second amplification results at a second time, wherein the second time occurs after the positive control sequence amplification threshold.
2. The method of claim 1, further comprising: inspecting the second amplification results to determine if the method functioned as expected.
3. The method of claim 1, wherein: the first amplification results include a target amplification result.
4. The method of claim 1, wherein the environment is a single environment.
5. The method of claim 1, wherein the target nucleic acid sequence includes one of a deoxyribonucleic acid (DNA) and a ribonucleic acid (RIMA).
6. The method of claim 1, wherein amplifying the target nucleic acid sequence and the positive control sequence includes at least one of: polymerase chain reaction (PCR), quantitative polymerase chain reaction (qPCR), reverse transcription polymerase chain reaction (RT-PCR), loop-mediated isothermal amplification (LAMP), multiple-annealing and loop-based amplification (MALBAC), recombinase polymerase amplification (RPA), multiple displacement amplification (MDA),Docket No. MDXB1002W001 rolling circle amplification (RCA), reverse transcription with LAMP (RT-LAMP), reverse transcription with RPA (RT-RPA), or whole-genome amplification (WGA).
7. The method of claim 1, wherein the one or more reagents include a forward primer, a reverse primer, a polymerase enzyme, and one or more probes that provide a signal that depends on the first amplification results and / or the second amplification results.
8. The method of claim 7, wherein: the signal that depends on the first amplification results and / or the second amplification results is a fluorescence signal.
9. The method of claim 1, wherein: the positive control sequence is synthesized based on a template of the target nucleic acid sequence.
10. The method of claim 1, wherein: the one or more amplification blockers include at least one of a blocking primer, a peptide nucleic acid (PNA) clamp, a polymerase inhibitor, or an oligonucleotide blocker.
11. The method of claim 1, wherein one of the one or more amplification blockers includes a first C3 spacer.
12. The method of claim 11, wherein: the first C3 spacer aligns with a 3' end of a forward primer; and a second of the one or more amplification blockers includes a second C3 spacer aligned with a 3' end of a reverse primer.
13. The method of claim 1, wherein a second environment comprises a no-template control (NTC) and the method comprises comparing the first amplification results and the second amplification results with a noise level found from amplification results measurements taken in the second environment.Docket No. MDXB1002W00114. The method of claim 1, wherein the target sequence amplification threshold is related to a first number of amplification cycles and the positive control sequence amplification threshold is related to a second number of amplification cycles.
Citation Information
Patent Citations
Positive control real-time RT-PCR to prevent the occurrence of false positive
KR102231876B1
Sequence Conversion and Signal Amplifier DNA Having Locked Nucleic Acids and Detection Methods Using Same
US20160102339A1
Method for suppressing non-specific amplification products in nucleic acid amplification technologies
US20200224260A1
Compositions and methods for quantifying a nucleic acid sequence in a sample
US20200239947A1
Asymmetric hairpin probes for nucleic acid detection
WO2024118922A1