Brain organoids
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- BRAINZELL AB
- Filing Date
- 2025-10-24
- Publication Date
- 2026-06-04
AI Technical Summary
Current methods for generating human cerebral organoids suffer from high variability in size, shape, and cellular composition, leading to unreliable results and hindering their widespread use in preclinical and clinical applications.
A method involving culturing pluripotent stem cells in specific glucose concentrations (1.5 mM to 10 mM) and using inhibitors of the TGF-β and Wnt signaling pathways to control differentiation, resulting in cerebral organoids with neuroepithelium and ventricular niches, enhancing reproducibility and physiological relevance.
The method produces highly reproducible cerebral organoids with low variance in size and cellular composition, suitable for drug screening and disease modeling, and potentially therapeutic applications.
Smart Images

Figure EP2025080841_04062026_PF_FP_ABST
Abstract
Description
[0001] BRAIN ORGANOIDS
[0002] TECHNICAL FIELD
[0003] The present disclosure relates to cerebral organoids and culturing methods for obtaining and maintaining said organoids. Medical use of the organoids and methods relating to drug screening using the organoids are also disclosed.
[0004] BACKGROUND
[0005] Human cerebral organoids are three-dimensional (3D) cell culture models that mimic the structure and function of the human brain. These organoids have gained significant attention in recent years due to their potential applications in drug discovery, disease modelling, and regenerative medicine. Human cerebral organoids are typically created based on our understanding of the embryonic development of the human brain, which is a complex series of dynamic and adaptive processes that are driven by molecular mechanisms as well as environmental inputs (Stiles J and Jenrigan TL. 2010. The Basics of Brain Development. Neuropsychol Rev 20:327-348.). Currently available human cerebral organoids, however, suffer from several limitations that hinder their widespread use in preclinical and clinical applications, such as large-scale industrial drug screening and development. The main limitations involve that known culturing methods for the generation of cerebral organoids lead to high variability in organoid size and shape as well as relative cell composition of the organoids (such as the number of neurogenic niches, relative number of mature neurons, astrocytes and / or other cell types typical for brain tissue). This low reproducibility poses a significant challenge for the use of existing cerebral organoids, as inconsistency between individual organoids, even if obtained by the same methods, will lead to unreliable and inconclusive results. The source of such inconsistencies may for example be the embedding of organoid spheres into hydrogels or Matrigel™ (Corning) in its hydrogel form, which is often employed by current methods for the generation of cerebral organoids. Such embedding is also considered labor-intensive. Additionally, the use of bioreactors in some protocols can also introduce inconsistencies that affect the reproducibility of the organoid culture, e.g. when transferring the organoids from bioreactors to assay plates. In summary, current methods for obtaining and maintaining cerebral organoids do not allow for the generation of organoids with high reproducibility and reliability, thereby, hindering the widespread use of human cerebral organoids in preclinical and clinical applications. It is of high importance to provide improved cerebral organoids, such as human cerebral organoids, since only highly reproducible and reliable systems can be valuable alternatives to animal models and other in vitro models for preclinical studies, and can be considered for clinical applications.
[0006] SUMMARY
[0007] It is an object of the present disclosure to provide in vitro methods for obtaining cerebral organoids, such as human cerebral organoids, while alleviating, at least in part, the abovementioned and other drawbacks of the prior art.
[0008] It is an object to provide methods for obtaining cerebral organoids, such as human cerebral organoids, that resemble physiologically relevant conditions of embryonic development.
[0009] It is an object of the present disclosure to provide cerebral organoids, such as human cerebral organoids, that are highly reproducible. It is an object of the present disclosure to provide cerebral organoids, such as human cerebral organoids, that are highly reproducible and exhibit low within-batch and in-between-batch variance. It is an object of the present disclosure to provide cerebral organoids, such as human cerebral organoids, that exhibit low within-batch and in-between-batch variance in organoid size and shape, as well as cellular composition.
[0010] It is an object to provide organoids that exhibit physiologically relevant structural and functional properties.
[0011] It is another object of the disclosure to provide methods for maintaining cerebral organoids, such as human cerebral organoids, that resemble or mimic physiologically relevant conditions or create suitable conditions for disease modelling in vitro.
[0012] It is a further object of the present disclosure to provide methods for test substance, such as drug, screening as well as methods for assessing the efficacy, the toxicity and / or the effect on neuronal function of test substances, such as drugs, using cerebral organoids. It is a particular object to provide such methods in a high-throughput format. It is an object of present disclosure to provide cerebral organoids, such as human cerebral organoids, for use as medicament.
[0013] It is also an object to provide cerebral organoids, such as human cerebral organoids, for use in the treatment of a disorder or injury of the central nervous system in a patient in need thereof.
[0014] These and other objects which are evident to the skilled person from the present disclosure are met by different aspects of the invention as claimed in the appended claims and as generally disclosed herein.
[0015] Thus, in a first aspect, there is provided an in vitro method for obtaining at least one cerebral organoid, comprising the steps a) and b),
[0016] wherein step a) comprises:
[0017] providing a population of pluripotent stem cells;
[0018] culturing said population of pluripotent stem cells in conditions permissive of formation of at least one embryonic body in a first cell culture medium; thereby obtaining at least one embryonic body;
[0019] and wherein step b) comprises:
[0020] providing said at least one embryonic body, such as the at least one embryonic body obtained in step a);
[0021] culturing said at least one embryonic body in conditions permissive of differentiation into at least one cerebral organoid comprising neuroepithelium, wherein said culturing is performed in a second cell culture medium comprising glucose in a concentration range from approximately 1.5 mM to approximately 10 mM, such as from approximately 2.0 mM to approximately 6.0 mM;
[0022] thereby obtaining at least one cerebral organoid comprising neuroepithelium.
[0023] In a second aspect of the present disclosure, an in vitro method of cultivation of at least one cerebral organoid is provided, wherein the method comprises obtaining at least one cerebral organoid according to the method as defined in any one the embodiments of the first aspect, and further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of from approximately 2.0 mM to approximately 6.0 mM or further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of from approximately 1 mM to approximately 3 mM. In a third aspect, another in vitro method of cultivation of at least one cerebral organoid is provided, wherein the method comprises obtaining at least one cerebral organoid according to the method as defined in any one the embodiments of the first aspect, and further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of from approximately 7.0 mM to approximately 25.0 mM, such as from approximately 7.0 mM to approximately 20.0 mM, such as from approximately 10.0 mM to approximately 20.0 mM, such as from approximately 15.0 mM to approximately 20.0 mM, such as approximately 17.5 mM or further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of at least approximately 17.5 mM. Methods according to the third aspect are considered suitable to model diabetic conditions, i.e. are considered suitable to evaluate brain structure and function in diabetes.
[0024] In a fourth aspect, there is provided a cerebral organoid obtainable or obtained by the method according to the first aspect of the present disclosure.
[0025] In a related aspect to said fourth aspect, there is provided a population of cerebral organoids obtainable or obtained by the method according to the first aspect of the present disclosure. In other words, in this related aspect, there is provided a population of cerebral organoids, wherein the cerebral organoids are as defined in any one of the embodiments relating to the fourth aspect.
[0026] In a fifth aspect, there is provided a method for test substance screening comprising the steps of:
[0027] providing at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure or providing at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure,
[0028] bringing said at least one cerebral organoid or said at least one population, respectively, into contact with a candidate substance; and
[0029] determining the effect of said candidate compound on one or more cell types comprised in said at least one cerebral organoid or said at least one population, respectively.
[0030] In a related aspect to the fifth aspect, there is provided a method for test substance screening comprising the steps of: obtaining at least one cerebral organoid by the method of any one of the embodiments of the first aspect of the present disclosure or obtaining at least one cerebral organoid by the method of any one of the embodiments of the second aspect or third aspect of the present disclosure,
[0031] bringing said at least one cerebral organoid into contact with a candidate substance; and
[0032] determining the effect of said candidate compound on one or more cell types comprised in said at least one cerebral organoid; or
[0033] obtaining at least one population of cerebral organoids by the method of any one of the embodiments of the first aspect of the present disclosure or obtaining at least one population of cerebral organoids by the method of any one of the embodiments of the second aspect or third aspect of the present disclosure,
[0034] bringing said at least one population of cerebral organoids into contact with a candidate substance; and
[0035] determining the effect of said candidate compound on one or more cell types comprised in said at least one population of cerebral organoids.
[0036] The test substance may be a drug substance (also referred to herein as "drug"). In a sixth aspect, there is provided a method for test substance, such as drug, screening comprising the steps of:
[0037] providing at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure or providing at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure,
[0038] bringing said at least one cerebral organoid or said at least one population, respectively, into contact with a candidate substance; and
[0039] determining the response of said at least one cerebral organoid or of said at least one population, respectively, brought into contact with a candidate substance in comparison to the response of a control cerebral organoid or population, respectively, that has not been in contact with said candidate compound. In a related aspect to the sixth aspect, there is provided a method for test substance, such as drug, screening comprising the steps of:
[0040] obtaining at least one cerebral organoid by the method of any one of the embodiments of the first aspect of the present disclosure or obtaining at least one cerebral organoid by the method of any one of the embodiments of the second aspect or third aspect of the present disclosure,
[0041] bringing said at least one cerebral organoid into contact with a candidate substance; and
[0042] determining the response of said at least one cerebral organoid brought into contact with a candidate substance in comparison to the response of a control cerebral organoid that has not been in contact with said candidate compound; or
[0043] obtaining at least one population of cerebral organoids by the method of any one of the embodiments of the first aspect of the present disclosure or obtaining at least one population of cerebral organoids by the method of any one of the embodiments of the second aspect or third aspect of the present disclosure,
[0044] bringing said at least one population of cerebral organoids into contact with a candidate substance; and
[0045] determining the response of said at least one population of cerebral organoids brought into contact with a candidate substance in comparison to the response of a control population of cerebral organoids that has not been in contact with said candidate compound.
[0046] The test substance may be a drug substance (also referred to herein as "drug"). In a seventh aspect, there is provided a method for assessing the efficacy of a test substance, such as drug substance, comprising the steps of:
[0047] providing at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure or providing at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure;
[0048] bringing said at least one cerebral organoid or said at least one population, respectively, into contact with said drug substance; and examining the effect of the drug substance on said at least one cerebral organoid or said at least one population, respectively, compared to the effect of a control compound.
[0049] In a related aspect to the seventh aspect, there is provided a method for assessing the efficacy of a test substance, such as drug substance, comprising the steps of: obtaining at least one cerebral organoid by the method of any one of the embodiments of the first aspect of the present disclosure or obtaining at least one cerebral organoid by the method of any one of the embodiments of the second aspect or third aspect of the present disclosure;
[0050] bringing said at least one cerebral organoid into contact with said drug substance; and
[0051] examining the effect of the drug substance on said at least one cerebral organoid compared to the effect of a control compound; or
[0052] obtaining at least one population of cerebral organoids by the method of any one of the embodiments of the first aspect of the present disclosure or obtaining at least one population of cerebral organoids by the method of any one of the embodiments of the second aspect or third aspect of the present disclosure;
[0053] bringing said at least one population of cerebral organoids into contact with said drug substance; and
[0054] examining the effect of the drug substance on said at least one population of cerebral organoids compared to the effect of a control compound.
[0055] The test substance in particular embodiments is a drug substance (also referred to herein as "drug").
[0056] In an eighth aspect, there is provided a method for assessing the toxicity and / or effect on neuronal function of a test substance, comprising the steps of:
[0057] providing at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure;
[0058] bringing said at least one cerebral organoid into contact with said test substance; and
[0059] examining the effect of the test substance on said at least one cerebral organoid compared to the effect of a control compound or compared to a control cerebral organoid that has not been in contact with said test compound; or
[0060] providing at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure;
[0061] bringing said at least one population into contact with said test substance; and
[0062] examining the effect of the test substance on said at least one population compared to the effect of a control compound or compared to a control population of cerebral organoids that has not been in contact with said test compound.
[0063] In a related aspect to the eight aspect, there is provided a method for assessing the toxicity and / or effect on neuronal function of a test substance, comprising the steps of:
[0064] obtaining at least one cerebral organoid by the method of any one of the embodiments of the first aspect of the present disclosure or obtaining at least one cerebral organoid by the method of any one of the embodiments of the second aspect or third aspect of the present disclosure;
[0065] bringing said at least one cerebral organoid into contact with said test substance; and
[0066] examining the effect of the test substance on said at least one cerebral organoid compared to the effect of a control compound or compared to a control cerebral organoid that has not been in contact with said test compound;
[0067] obtaining at least one population of cerebral organoids by the method of any one of the embodiments of the first aspect of the present disclosure or obtaining at least one population of cerebral organoids by the method of any one of the embodiments of the second aspect or third aspect of the present disclosure;
[0068] bringing said at least one population of cerebral organoids into contact with said test substance; and
[0069] examining the effect of the test substance on said at least one population of cerebral organoids compared to the effect of a control compound or compared to a control population of cerebral organoids that has not been in contact with said test compound.
[0070] In a ninth aspect, there is provided a use of at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure, or of at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure, for test substance, such as drug, screening.
[0071] In a tenth aspect, there is provided a cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure, or a population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure, for use as a medicament.
[0072] In an eleventh aspect, there is provided a cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure, or a population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure, for use in the treatment of a disorder or injury of the central nervous system in a patient in need thereof.
[0073] In a twelfth aspect, there is provided a pharmaceutical composition comprising at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure or a subset of cells derived from said organoid; or
[0074] at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure; and a pharmaceutically active agent.
[0075] In a thirteenth aspect, there is provided a method for treatment of a disease or a disorder of the central nervous system, wherein said method comprises: transplanting an effective dose of one or more cerebral organoid(s) according to any one of the embodiments of the fourth aspect of the present disclosure or an effective dose of a subset of cells derived from said organoid(s) into a brain of a patient in need thereof; or
[0076] transplanting an effective dose of one or more population(s) of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or an effective dose of a subset of cells derived from said population(s) into a brain of a patient in need thereof. In a fourteenth aspect, there is provided a method for treatment of a disorder or injury of the central nervous system, wherein said method comprises the steps of: obtaining at least one cerebral organoid according to the method of any one of the embodiments of the first aspect of the present disclosure; and
[0077] transplanting an effective dose of said at least one cerebral organoid according to any one of the embodiments of the fourth aspect of the present disclosure or an effective dose of a subset of cells derived from said organoid(s) into a brain of a patient in need thereof; or
[0078] obtaining at least one population of cerebral organoids according to the method of any one of the embodiments of the first aspect of the present disclosure; and transplanting an effective dose of said at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or an effective dose of a subset of cells derived from said population(s) into a brain of a patient in need thereof.
[0079] In other words, in the fourteenth aspect, there is provided a method for treatment of a disorder or injury of the central nervous system, wherein said method comprises the steps of:
[0080] obtaining at least one cerebral organoid according to the method of any one of the embodiments of the first aspect of the present disclosure; and
[0081] transplanting an effective dose of said at least one cerebral organoid or an effective dose of a subset of cells derived from said organoid(s) into a brain of a patient in need thereof; or
[0082] obtaining at least one population of cerebral organoids according to the method of any one of the embodiments of the first aspect of the present disclosure; and transplanting an effective dose of said at least one population of cerebral organoids or an effective dose of a subset of cells derived from said population(s) into a brain of a patient in need thereof.
[0083] In a fifteenth aspect, there is provided a use of
[0084] at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure or of a subset of cells derived from said organoid(s); or or a population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or of a subset of cells derived from said population(s);
[0085] for the manufacture of a medicament for the treatment of a disorder or injury of the central nervous system.
[0086] In a sixteenth aspect, there is provided a kit of parts comprising
[0087] at least one cerebral organoid according to any one of the embodiments of the fourth aspect of the present disclosure or at least one cerebral organoid obtainable or obtained by the method as defined in any one of the embodiments of the first aspect of the present disclosure; or
[0088] at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or at least one population of cerebral organoids obtainable or obtained by the method as defined in any one of the embodiments of the first aspect of the present disclosure;
[0089] and instructions for use.
[0090] DETAILED DESCRIPTION
[0091] Aspects of the present disclosure will be described more fully hereinafter with reference to the accompanying drawings and Examples. The terminology used herein is for the purpose of describing particular aspects of the disclosure only, and is not intended to limit the disclosure.
[0092] As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.
[0093] As used herein, the terms "substance" and "compound" are used interchangeably. As discussed above, available culturing methods in the art do not allow for the generation of cerebral organoids with high reproducibility and low (within-batch and / or in-between batch) variance. Additionally, the present inventors have surprisingly found that typically used culture conditions may also affect negatively the structural and / or functional characteristics of the organoids. As such, high glucose concentrations, do not accurately reflect the physiological environment in the human brain. These can cause irregularities in the development and affect the overall composition and ratio of cell types within the organoids. The inventors demonstrate in the appended Examples that such non-physiological conditions, e.g. culturing of organoids in media that comprise high glucose concentrations, alter functional characteristics of the organoids. On the other hand, physiological conditions, such as culturing of organoids in media that comprise glucose at physiological concentrations, can be particularly beneficial in methods for the generation and maintenance of cerebral organoids, such as human cerebral organoids. Accordingly, in the first aspect of the present disclosure, there is provided an in vitro method for obtaining at least one cerebral organoid, comprising the steps a) and b),
[0094] wherein step a) comprises:
[0095] providing a population of pluripotent stem cells;
[0096] culturing said population of pluripotent stem cells in conditions permissive of formation of at least one embryonic body in a first cell culture medium; thereby obtaining at least one embryonic body;
[0097] and wherein step b) comprises:
[0098] providing said at least one embryonic body, such as the at least one embryonic body obtained in step a);
[0099] culturing said at least one embryonic body in conditions permissive of differentiation into at least one cerebral organoid comprising neuroepithelium, wherein said culturing is performed in a second cell culture medium comprising glucose in a concentration range from approximately 1.5 mM to approximately 10 mM, such as from approximately 2.0 mM to approximately 6.0 mM;
[0100] thereby obtaining at least one cerebral organoid comprising neuroepithelium.
[0101] In one particular embodiment, said at least one cerebral organoid obtained in step b) is characterized by the presence of at least one ventricular niche.
[0102] As apparent from the context of the present disclosure, the cerebral organoid may be any type of cerebral organoid depending on the origin of starting cells. For example, cells originating from mammalian species, such as primates, such as human, may be used. For certain experimental models it may be beneficial to use cells that originate from other mammalian species, such as mouse or rat. In some particular embodiments, the cerebral organoid is a human cerebral organoid. In some embodiments, the pluripotent stem cell population may be an induced pluripotent stem cell (I PSC) population, such as a human IPSC population. For example, the IPSC population may be an IPSC cell line. As demonstrated in the Examples, the IPSC population may be selected from the group consisting of cell lines CW60314EE1, CW60441EE1 and CW60520FF1, e.g. obtainable from Fujifilm Cellular Dynamics. In a particular embodiment, the IPSC cell line is CW60520FF1. The skilled person will also appreciate that pluripotent stem cell populations different from the ones tested herein may also be used in methods of the present disclosure. The skilled person is familiar with suitable IPSC lines. For example, pluripotent stem cell populations may be obtained from a subject. As such the cells can for example be de-differentiated cells from the subject, such as a subject-specific IPSC population, or certain type of undifferentiated adult stem cells, such as neural stem cells. The subject may be a healthy subject or may be a patient, i.e. a subject suffering from a disease or a disorder, such as a disease or a disorder of the central nervous system (CNS), in other words suffering from a pathological condition of the CNS. It may be beneficial that the IPSC population is derived from a healthy subject, at least as assessed by the absence of pathological condition(s) of the CNS, for example if the aim is to study the non-pathological responses to factors or for the purpose of medical use of the organoids obtained. If the aim is to study the responses to factors relevant for a pathological condition of the CNS, it may be beneficial to obtain IPSCs from a subject suffering from the relevant pathological CNS condition. Furthermore, it may be of interest to obtain IPSCs from subjects who exhibit functional variations of the CNS, such as pathological or non-pathological functional variations, including but not limited to attention-deficit / hyperactivity disorder and autism spectrum disorders. Considering the below discussed therapeutic aspects of the present disclosure, the cells may be autologous or allogeneic to a subject that receives an effective dose of one or more cerebral organoid(s) obtained or obtainable by the methods according to any one of the embodiments of the first aspect of the present disclosure or an effective dose of a subset of cells derived from said organoid(s). In addition, the population of the pluripotent stem cells, in certain embodiments, is an embryonic stem cell (ESC) population, such as a human ESC population. The ESC population may for example be selected from the group consisting of HS980 cells, Hl cells and H9 cells. The skilled person is familiar with suitable human ESC lines.
[0103] In step a), culturing of the pluripotent stem cell population is normally initiated by seeding of a number of cells into a culturing vessel, such as well. As demonstrated in Example 2, certain cell densities may be preferably used in a method according to the present disclosure for further improving characteristics of the obtained cerebral organoids. Accordingly, certain seeding concentrations may be useful to achieve lower variance in the size and / or the shape of the organoids. Thus, in some embodiments, said step a) comprises seeding from approximately 2000 to approximately 3000 pluripotent cells, such as from approximately 2200 to approximately 2800 pluripotent cells, from approximately 2400 to approximately 2600 pluripotent cells, such as approximately 2500 pluripotent cells, per culture well. As shown in Example 2, the above discussed densities may be applied for 384-well plates. The skilled person will appreciate that cell culture plates are produced in different formats with different well volumes (e.g. 6-well, 24-well and 96-well plates) and the above listed cell numbers can be scaled according to the differences in the volumes to obtain the corresponding densities.
[0104] The term "embryonic body" in the context of the present disclosure refers to 3D aggregates formed by pluripotent stem cells, wherein clear structures can be observed along the rim by light microscopy (as shown in Fig. 1 in the image corresponding to day 6 in culture). Embryonic bodies comprise precursors of the three embryonic germ layers and they mimic the characteristics seen in early-stage embryos. Step a) of the herein disclosed method comprises obtaining at least one embryonic body, and, as further explained in Example 1, this may be formed by about the fourth day (about 96 hours) in culture according to the present method. It will be appreciated that the time needed for the formation of embryonic bodies in the present method may slightly vary, but nevertheless can easily be controlled by light microscopy, based on the hereby provided description. In some embodiments, the culture time in step a) in said first cell culture medium is from approximately 84 hours to approximately 168 hours, such as approximately 84 hours to approximately 156 hours, such as approximately 84 hours to approximately 144 hours, such as approximately 84 hours to approximately 132 hours, such as approximately 84 hours to approximately 120 hours, such as approximately 84 hours to approximately 108 hours, such as approximately 90 hours to approximately 102 hours, such as approximately 92 hours to approximately 100 hours, such as approximately 94 hours to approximately 98 hours, such as approximately 96 hours.
[0105] Step b) of the herein disclosed method comprises the differentiation of at least one embryonic body into at least one cerebral organoid comprising neuroepithelium. It is to be understood that the at least one embryonic body in step b) is the embryonic body obtained in step a). The term "neuroepithelium" as used herein refers to a layer of cells that comprises neuroepithelial cells, which are stem cells of the CNS, known as neural stem cells, and generate the intermediate progenitor cells known as radial glial cells, that differentiate into neurons and glia in the process of neurogenesis. Accordingly, in some embodiments, the cerebral organoid obtained in step b) is characterized by the presence of radial glial cell or radial glial progenitors cell. As indicated in appended Fig. 1 in the image taken on day 10, bright neural ectodermal tissue and structure formation of epithelium may be already observed on day 10 of the herein disclosed method, and by day 13, cerebral organoids comprising epithelium may be formed. As it is shown in Fig. 1 in the image of day 13, the cerebral organoid obtained in step b) are characterized by the presence of at least one ventricular niche. Thus, in one embodiment of the method disclosed herein, said at least one cerebral organoid obtained in step b) is characterized by the presence of at least one ventricular niche. It will be appreciated that the time needed for the formation of cerebral organoids comprising neuroepithelia in the present method may slightly vary, but nevertheless can easily be controlled by light microscopy, based on the hereby provided description. In some embodiments, cerebral organoids in step b) are obtained after a culture time in said second cell culture medium of from approximately 6 to approximately 12 days, such as from approximately 7 to approximately 11 days, such as from approximately 7 to approximately 10 days, such as from approximately 8 to approximately 10 days, such as from approximately 8 to approximately 9 days or such as from approximately 9 to approximately 10 days, such as approximately 9 days. In some embodiments of the method, cerebral organoid(s) that comprise(s) neuroepithelium are obtained from the population of pluripotent stem cells after a culture time in said first and said second cell culture media of from approximately 10 days to approximately 16 days, such as from approximately 11 days to approximately 15 days, such as from approximately 12 days to approximately 14 days, such as approximately 13 days. As discussed extensively in the appended Examples, physiologically relevant glucose concentrations are particularly beneficial in methods according to first aspect of the present disclosure. In particular, the present inventors have found that physiologically relevant glucose concentrations can be especially useful in the culturing method during the developmental stages after embryonic body formation, such as for obtaining cerebral organoids that comprise neuroepithelium. In one embodiment, thus, the second cell culture medium comprises glucose in a concentration range from approximately 2.0 mM to approximately 10.0 mM, approximately 2.0 mM to approximately 8.0 mM, approximately 2.0 mM to approximately 7.0 mM, approximately 2.0 mM to approximately 6.0 mM, such as approximately 2.0 mM to approximately 5.5 mM, such as approximately 2.0 mM to approximately 5.0 mM, such as approximately 2.0 mM to approximately 4.5 mM, such as approximately 2.0 mM to approximately 4.0 mM, such as approximately 2.0 mM to approximately 3.5 mM, such as approximately 2.25 mM to approximately 3.25 mM, such as approximately 2.5 mM to approximately 3.0 mM, such as approximately 2.75 mM. In another embodiment, said second cell culture medium comprises glucose in a concentration of at most approximately 10.0 mM, such as at most approximately 8.0 mM, such as at most approximately 7.0 mM, such as at most approximately 6.0 mM, such as at most approximately 5.5 mM, such as at most approximately 5.0 mM.
[0106] The present inventors envision that the addition of inhibitors of the transforming growth factor-beta (TGF- ) signaling pathway and / or of the Wnt signalling pathway, during the culturing process increases the reproducibility of the protocol, such as the addition of inhibitors of the transforming growth factor-beta (TGF- ) signaling pathway and of the Wnt signalling pathway. Without being bound by theory, the present inventors envision this may lead to more consistent results and improved organoid development, as the inhibitors can help regulate the differentiation and proliferation of cells within the organoids. By controlling such cellular processes, the inventors consider that said inhibitors can contribute to the formation of more uniform and well-developed cerebral organoids. This is considered to be beneficial for various applications, such as drug screening and disease modeling as discussed herein, as well as in therapeutic application.
[0107] In some embodiments, the second cell culture medium comprises an inhibitor of the transforming growth factor-beta (TGF-P) signaling pathway. Tgfp super family ligands bind to a type II receptor, which recruits and phosphorylates a type I receptor. The type I receptor then phosphorylates receptor-regulated SMADs (R-SMADs) which can then bind the coSMAD SMAD4. R-SMAD / coSMAD complexes accumulate in the nucleus where they act as transcription factors and participate in the regulation of target gene expression. An inhibitor of the TGF-P signaling pathway may act to inhibit signaling at any level of the pathway. The skilled person is familiar with various inhibitors of the TGF-P signaling pathway and their suitability for use in a method according to the present invention.
[0108] In some embodiments, the second cell culture medium comprises an inhibitor of the Wnt signaling pathway. It is known in the art that the conserved Wnt / P-Catenin pathway regulates stem cell pluripotency and cell fate decisions during development. Upon binding of a Wnt ligand to its receptor FZD and co-receptors LRP 5 / 6, the cytoplasmic complex containing GSK-3P, Axin, APC and p-catenin undergoes inactivated phosphorylation by Dvll. Next, cytoplasmic free p-catenin is translocated into the nucleus to form a transcription complex with LEF and TCF, which complex upregulates the expression levels of Wnt target genes. When Wnt is absent, p-catenin is targeted for degradation resulting in negative regulation of expression of Wnt target genes. An inhibitor of the Wnt signaling pathway may act to inhibit signaling at any level of the pathway. The skilled person is familiar with various inhibitors of the Wnt signaling pathway and their suitability for use in a method according to the present invention.
[0109] In certain embodiments, the second cell culture medium comprises both an inhibitor of the transforming growth factor-beta (TGF-P) signaling pathway and an inhibitor of the Wnt signaling pathway. In some embodiments, the inhibitor of the TGF-P signaling pathway is selected from the group consisting of vactosertib, LY2157299 (a.k.a galunisertib), SD-208, RepSox, A-83-01, TGF-p-directed monoclonal antibodies, ligand trap inhibitors, luspatercept, antisence oligonuclaotides and SB431542; such as selected from the group consisting of vactosertib, LY2157299, SD-208, RepSox, A-83-01 and SB431542. The TGF-p-directed monoclonal antibodies may be TGF-P- directed chimeric monoclonal antibodies. A non-limiting example of a ligand trap inhibitor of the TGF- signalling pathway is bintrafusp alpha. In one embodiment, said ligand trap inhibitor of the TGF- signalling pathway is bintrafusp alpha.
[0110] Accordingly, in some embodiments, the inhibitor of the TGF- signaling pathway is selected from the group consisting of small molecule inhibitors, such as vactosertib, LY2157299, SD-208, RepSox, A-83-01 and SB431542. In one particular embodiment, the inhibitor of the TGF- signaling pathway is SB431542. In some embodiments, said SB431542 is present in said second cell culture medium in a concentration range from approximately 2.5 pM to approximately 7.5 pM, such as approximately 3 pM to approximately 7 pM, such as approximately 3.5 pM to approximately 6.5 pM, such as approximately 4 pM to approximately 6 pM, such as approximately 4.5 pM to approximately 5.5 pM. In specific embodiments, said SB431542 is present in said second cell culture medium in a concentration of approximately 5 pM. In some embodiments, said SB431542 is present in said second cell culture medium in the concentration of at most approximately 7.5 pM, such as at most approximately 7.0 pM, such as at most approximately 6.5 pM such as at most approximately 6.0 pM, such as at most approximately 5.5 pM, such as at most approximately 5.0 pM. In some embodiments, said SB431542 is present in said second cell culture medium in the concentration of at least approximately 2.5 pM, such as at least approximately 3.0 pM, such as at least approximately 3.5 pM such as at least approximately 4.0 pM, such as at least approximately 4.5 pM, such as at least approximately 5.0 pM. In certain embodiments, the inhibitor of the Wnt signaling pathway is selected from the group consisting of IWP-1, IWP-L6, IWR-1, Wnt-directed monoclonal antibodies, ligand trap inhibitors and IWP-2, such as selected from the group consisting of IWP-1, IWP-L6, IWR-1 and IWP-2. The Wnt-directed monoclonal antibodies may be Wnt-directed chimeric monoclonal antibodies. Non limiting examples of Wnt-directed monoclonal antibodies are LY3022859 or 1D11. Thus, in one embodiment, said Wnt-directed monoclonal antibodies is selected from LY3022859 and 1D11. A non limiting example of a ligand trap inhibitor of the Wnt signalling pathway is AVID200.ln one embodiment, said ligand trap inhibitor of the Wnt signalling pathway is AVID200. In one particular embodiment, the inhibitor of the Wnt signaling pathway is IWP-2. In certain embodiments, said IWP-2 is present in said second cell culture medium in a concentration range from approximately 2.5 pM to approximately 4.0 pM, such as approximately 2.9 pM to approximately 3.7 pM, such as approximately 3.0 pM to approximately 3.6 pM, such as approximately 3.1 pM to approximately 3.5 pM, such as approximately 3.2 pM to approximately 3.4 pM, such as approximately 3.3 pM. In some embodiments, said IWP-2 is present in said second cell culture medium in the concentration of at most approximately 4.0 pM, such as at most approximately 3.7 pM, such as at most approximately 3.6 pM such as at most approximately 3.5 pM, such as at most approximately 3.4 pM, such as at most approximately 3.3 pM. In some embodiments, IWP-2 is present in said second cell culture medium in the concentration of at least approximately 2.5 pM, such as at least approximately 2.6 pM, such as at least approximately 2.7 pM, such as at least approximately 2.8 pM, such as at least approximately 2.9 pM, such as at least approximately 3.0 pM such as at least approximately 3.1 pM, such as at least approximately 3.2 pM, such as at least approximately 3.3 pM.
[0111] In one embodiment of this first aspect, there is provided an in vitro method for obtaining at least one cerebral organoid as disclosed herein, wherein said one or both inhibitors are present in the second culture medium from during the whole culture time of step b). Thus, in one embodiment, said inhibitor of the TGF-|3 signaling pathway is present in the second culture medium from during the whole culture time of step b). Thus, in one embodiment, said inhibitor of the Wnt signaling pathway is present in the second culture medium from during the whole culture time of step b).
[0112] In certain embodiments, said second cell culture medium comprises a basement membrane extract (BME) or comprises extracellular matrix proteins, such as wherein extracellular matrix proteins are selected from the group consisting of laminins, collagen and entactin and fragments thereof, such as selected from the group consisting of laminins, collagen and entactin. It should be understood that one of several different laminins may be comprised in the media. In one embodiment, the second culture medium comprises a BME. The BME may be added to the medium at a specific time point and concentration to enhance the growth and development of the cerebral organoids. It is envisioned that the addition of BME to the medium may be beneficial for increased reproducibility of organoid size and cell composition. The BME may be present in the second cell culture medium at a concentration of from approximately 4% to approximately 12%, such as from approximately 4% to approximately 10%, such as from approximately 5% to approximately 10%, such as from approximately 5% to approximately 8%, such as from approximately 5% to approximately 7%, such as approximately 5%. Alternatively, the BME may be present in the second cell culture medium at a concentration of from approximately 2% to approximately 12%, such as from approximately 2% to approximately 10%, such as from approximately 2% to approximately 10%, such as from approximately 2% to approximately 8%, such as from approximately 2% to approximately 7%, such as from approximately 2% to approximately 5%, such as from approximately 2% to approximately 3%, such as approximately 2.5%.
[0113] In some embodiments, said second culture medium does not comprise a BMP (bone morphogenetic protein) pathway inhibitor. Said BMP pathway inhibitor may for example be dorsomorphin or LDN-193189. The BMP pathway inhibitor may also be a dual inhibitor, which blocks the BMP pathway and at least another signaling pathway. Such dual inhibitor may for example be a dual SMAD inhibitor. Dual SMAD inhibitors are known to block the signaling pathways of the TGF- and BMP families. Thus, in one embodiment, said second culture medium does not comprise a dual inhibitor, which blocks the BMP pathway and at least another signaling pathway; such as does not comprise a dual SMAD inhibitor.
[0114] In certain embodiments, said first culture medium comprises basic fibroblast growth factor (bFGF) or an agonist thereof, such as wherein said first cell culture medium comprises bFGF. Basic fibroblast growth factor (bFGF), also known as fibroblast growth factor 2 (FGF-2) and FGF- , is a growth factor and signaling protein encoded by the FGF2 gene. bFGF exhibits broad mitogenic and cell survival activities, and is involved in a variety of biological processes, including embryonic development and maintenance of various tissues, including the nervous system, and is known to be an important component of cell culture medium for pluripotent cells. The addition of bFGF to the culture medium is envisioned to promote the growth and differentiation of neural progenitor cells, leading to the formation of more mature and functional cerebral organoids. Without being bound by theory, the present inventors envision that bFGF may promote the proliferation and differentiation of neural progenitor cells, leading to the formation of more complex and mature neural structures within the organoids, resulting in cerebral organoids with a higher degree of cellular diversity and organization. In this way organoids closely resembling the cellular composition and architecture of the human brain are obtained. Furthermore, the presence of bFGF in the culture medium may enhance the survival and growth of neural cells within the organoids, leading to more robust organoids that are better suited for various applications, such as drug screening, disease modeling and / or therapeutic applications. Thus, said bFGF may be present in the first cell culture medium at a concentration of at most 5 ng / ml, such as approximately at most 4.5 ng / ml, such as approximately at most 4 ng / ml. In some embodiments, said bFGF is present in the first cell culture medium during a first phase of step a), such as is present in the first cell culture medium during approximately the first half of step a) culture time, at a concentration of at most 5 ng / ml, such as approximately at most 4.5 ng / ml, such as approximately at most 4 ng / ml. In some embodiments, said bFGF is present in the first cell culture medium from approximately 0 hours to approximately 36-78 hours of culture, such as from 0 hours to approximately 36-72 hours of culture, such as from approximately 0 hours to approximately 36-66 hours of culture, such as from approximately 0 hours to approximately 36-60 hours of culture, such as from approximately 0 hours to approximately 40-56 hours of culture, such as from approximately 0 hours to approximately 42-54 hours of culture, such as from approximately 0 hours to approximately 44-52 hours of culture, such as from approximately 0 hours to approximately 46-50 hours of culture, such as from approximately 0 hours to approximately 48 hours of culture, at a concentration of at most 5 ng / ml. In one embodiment, said concentration is approximately at most 4.5 ng / ml. In one embodiment, said concentration is approximately at most 4 ng / ml. In other embodiments, said bFGF is present in the first cell culture medium during a second phase of step a), such as is present in the first cell culture medium during approximately the second half of step a) culture time, at a concentration of at most approximately 3 ng / ml, such as at most approximately 2.5 ng / ml, such as at most approximately 2 ng / ml. In some embodiments, said bFGF is present in the first cell culture medium from approximately 36-78 hours of culture, such as from approximately 36-72 hours of culture, such as from approximately 36-66 hours of culture, such as from approximately 36-60 hours of culture, such as from approximately 40-56 hours of culture, such as from approximately 42-54 hours of culture, such as from approximately 44-52 hours of culture, such as from approximately 46-50 hours of culture, such as from approximately 48 hours of culture, at a concentration of from approximately 1.5 ng / ml to approximately 2.5 ng / ml. In one embodiment, said concentration is approximately 2 ng / ml. The specific timing and concentration of bFGF addition may be adjusted based on the desired outcomes of the culturing process, such as the size, morphology, and cellular composition of the resulting cerebral organoids. By optimizing the bFGF concentration and timing as disclosed herein, the present inventors consider that the present method provides more consistent and reproducible results, leading to the generation of cerebral organoids with improved physiological relevance and utility in various applications.
[0115] Rho-kinase inhibitors (rho-associated protein kinase inhibitor or ROCK inhibitor) are a series of compounds that target rho kinase (ROCK) and inhibit the ROCK pathway. In the art, ROCK inhibitors are used in cell culture, to aid to limit cellular death and limited dedifferentiation and are thus often used in cultures of IPS cells and ES cells. The skilled person is familiar with various ROCK inhibitor and / or ROCK antagonist and their suitability for use in the method of the present disclosure. In some embodiments, a ROCK inhibitor and / or ROCK antagonist is present in the first culture medium, such as in the first culture medium during the first phase of step a), such as in the first culture medium during approximately the first half of step a) culture time. In some embodiments, said ROCK inhibitor and / or ROCK antagonist is selected from the group consisting of Y27632, fasudil, Y-39983, RKI-1447, GSK429286A, H-1152, SLx-2119 and TC-S 7001, such as the group consisting of fasudil and Y27632. In a particular embodiments, said ROCK inhibitor and / or ROCK antagonist is Y27632. In some embodiments, the ROCK inhibitor and / or ROCK antagonist, such as said Y27632, is present at a concentration of at most approximately 75 pM, such as at most approximately 50 pM. In some embodiments, said ROCK inhibitor or ROCK antagonist is present in the first cell culture medium from approximately 0 hours to approximately 36-78 hours of culture, such as from approximately 0 hours to approximately 36-72 hours of culture, such as from approximately 0 hours to approximately 36-66 hours of culture, such as from approximately 0 hours to approximately 36-60 hours of culture, such as from approximately 0 hours to approximately 40-56 hours of culture, such as from approximately 0 hours to approximately 42-54 hours of culture, such as from approximately 0 hours to approximately 44-52 hours of culture, such as from approximately 0 hours to approximately 46-50 hours of culture, such as from approximately 0 hours to approximately 48 hours of culture.
[0116] In certain embodiments, said first culture medium comprises glucose in a concentration of from approximately 7.0 mM to approximately 25.0 mM, such as from approximately 7.0 mM to approximately 20.0 mM, such as from approximately 10.0 mM to approximately 20.0 mM, such as from approximately 15.0 mM to approximately 20.0 mM, such as approximately 17.5 mM. In certain embodiments, said first culture medium comprises glucose in a concentration of at least approximately 17.5 mM.
[0117] In one embodiment of the present method, the culture time in step a) in said first cell culture medium is from approximately 84 hours to approximately 168 hours, such as approximately 84 hours to approximately 156 hours, such as approximately 84 hours to approximately 144 hours, such as approximately 84 hours to approximately 132 hours, such as approximately 84 hours to approximately 120 hours, such as approximately 84 hours to approximately 108 hours, such as approximately 90 hours to approximately 102 hours, such as approximately 92 hours to approximately 100 hours, such as approximately 94 hours to approximately 98 hours, such as approximately 96 hours. In one embodiment of the present method the cerebral organoids in step b) are obtained after a culture time in said second cell culture medium of from approximately 6 to approximately 12 days, such as from approximately 7 to approximately 11 days, such as from approximately 7 to approximately 10 days, such as from approximately 8 to approximately 10 days, such as from approximately 8 to approximately 9 days or such as from approximately 9 to approximately 10 days, such as approximately 9 days. In one embodiment, the thus in step b) obtained at least one cerebral organoid is characterized the presence of radial glial cells or radial glial progenitor cells. As discussed in detail in the sections below, the cerebral organoids obtained in step b) may be characterized by a marker expression profile, which encompasses expression of certain markers or lack of expression of markers, which profile is characteristic of the cell types present in said cerebral organoid.
[0118] In some embodiments, said first culture medium comprises DMEM / F12, Knock-Out Serum Replacement (KOSR) and Non Essential Amino Acid Solution. In some embodiments, said second culture medium comprises DMEM / F12, N2 supplement, GlutaMAX supplement or glutamine, Heparin and Non Essential Amino Acid Solution. The skilled person is familiar various cell culture media components and knows of suitable replacements where applicable.
[0119] It will be appreciated that in some applications, it may be desirable to further culture the cerebral organoid obtained in step b) to obtain organoids which comprise more mature neurons and glial cells. Such matured cerebral organoids obtained may be characterized by a marker expression profile, which encompasses expression of certain markers or lack of expression of markers, which profile is characteristic of the cell types present in said matured cerebral organoid.
[0120] Thus in some embodiments, the in vitro method for obtaining at least one cerebral organoid according to the first aspect of the disclosure, further comprises step c) of providing at least one cerebral organoid obtained in step b);
[0121] culturing said at least one cerebral organoid in conditions permissive of differentiation into at least one matured cerebral organoid using a third cell culture medium,
[0122] thereby obtaining at least one matured cerebral organoid, characterized by the expression of at least one marker, such as a marker selected from the group consisting of EOMES, TBR1, DCX, MAP2, TUBB3, SNAP25, SIX3, SLC6A1, GAD1, GAD2, SLC1A2, GLS and GRIA1.
[0123] In one embodiment, said at least one matured cerebral organoid is characterized by expression of at least one neuronal marker, such as a neuronal marker selected from the group consisting of TUBB3A and MAP2. In one embodiment, said at least one matured cerebral organoid is characterized by the presence of mature neuronal cells, wherein said mature neuronal cells express MAP2 and at least one marker selected from the group consisting of GAD1 and GRIA1. As appreciated by those skilled in the art, the cells which express GAD1 are GABAergic neurons and the cells which express GRIA1 are glutamatergic neurons.
[0124] In some embodiments, the third culture medium comprises a retinoic acid inhibitor and / or does not comprise vitamin A or any of its derivatives. In one embodiment, the third culture medium does not comprise Vitamin A or any derivatives thereof, such as Vitamin A. The retinoic acid inhibitor may for example be a pan-retinoic acid receptor antagonist or an inhibitor of retinoic acid synthesis. In some embodiments, the pan-retinoic acid receptor antagonist is selected from the group consisting of BMS493 and AGN193109. The retinoic acid synthesis inhibitor may be an aldehyde, such as Citral. Vitamin A and derivatives of vitamin A may be selected from retinol, retinal and retinoic acid.
[0125] In some embodiments, said third culture medium does not comprise a BMP pathway inhibitor. As discussed previously, said BMP pathway inhibitor may for example be dorsomorphin or LDN-193189. The BMP pathway inhibitor may also be a dual inhibitor, which blocks the BMP pathway and at least another signaling pathway. Such dual inhibitor may for example be a dual SMAD inhibitor. Dual SMAD inhibitors are known to block the signaling pathways of the TGF- and BMP families. Thus, in one embodiment, said third culture medium does not comprise a dual inhibitor, which blocks the BMP pathway and at least another signaling pathway; such as does not comprise a dual SMAD inhibitor.
[0126] In some embodiments, said third culture medium comprises DMEM / F12, N2 supplement, insulin, GlutaMAX supplement or glutamine, 2-Mercaptoethanol, B27 supplement without vitamin A and Non Essential Amino Acid Solution; such as DMEM / F12, N2 supplement, insulin, GlutaMAX supplement or glutamine, Penicillin / Streptomycin, 2-Mercaptoethanol, B27 supplement without vitamin A and Non Essential Amino Acid Solution. The skilled person is familiar various cell culture media components and knows of suitable replacements where applicable.
[0127] In some embodiments, the cerebral organoids in step c) are obtained after a culture time in said third cell culture medium of approximately from 7 to approximately 22 days, such as approximately from 9 to approximately 22 days, such as approximately from 12 to approximately 22 days, such as approximately from 13 to approximately 21 days, such as approximately from 14 to approximately 20 days, such as approximately from 15 to approximately 19 days, such as approximately from 16 to approximately 18 days, such as approximately 17 days.
[0128] In some embodiments, matured cerebral organoid(s) are obtained from the population of pluripotent stem cells after a total culture time (in other words a culture time comprising the culture time of step a), b) and c) in said first, said second and said third cell culture media, respectively) of from approximately 14 days to approximately 35 days, such as from approximately 15 days to approximately 35 days, such as from approximately 16 days to approximately 35 days, such as from approximately 17 days to approximately 35 days, such as from approximately 18 days to approximately 35 days, such as from approximately 19 days to approximately 35 days, such as from approximately 20 days to approximately 35 days, such as from approximately 21 days to approximately 35 days, such as from approximately 22 days to approximately 35 days, such as from approximately 23 days to approximately 35 days, such as from approximately 24 days to approximately 35 days, such as from approximately 25 days to approximately 35 days, such as from approximately 26 days to approximately 34 days, such as from approximately 27 days to approximately 33 days, such as from approximately 28 days to approximately 32 days, such as from approximately 29 days to approximately 31 days, such as approximately 30 days.
[0129] In some applications, it may be desirable to even further culture the cerebral organoid obtained in step c) to obtain organoids which comprise more mature neurons and glial cells, such as functional cerebral organoids as disclosed herein. Such functional cerebral organoids obtained may be characterized by a marker expression profile, which encompasses expression of certain markers or lack of expression of markers, which profile is characteristic of the cell types present in said functional cerebral organoid. In some embodiments, the in vitro method for obtaining at least one cerebral organoid according to the first aspect of the disclosure, further comprises step d) of
[0130] providing at least one maturated cerebral organoid obtained in step c); culturing said at least one maturated cerebral organoid in conditions permissive of differentiation into functional cerebral organoids using a fourth cell culture medium, and
[0131] thereby obtaining said functional cerebral organoids, characterized by ability to produce Ca2+ oscillatory waves.
[0132] In some embodiments, said functional cerebral organoids in step d) are obtained after a culture time in said fourth culture medium of at least approximately 30 days, such as at least approximately 35 days, such as at least approximately 40 days or longer. In some embodiments, said functional cerebral organoids in step d) are obtained after a culture time in said fourth culture medium of at least approximately 30 days, such as at least approximately 35 days, such as at least approximately 40 days, such as at least approximately 45 days, such as at least approximately 50 days, such as at least approximately 55 days, such as at least approximately 60 days, such as at least approximately 65 days, such as at least approximately 70 days, such as at least approximately 75 days, such as at least approximately 80 days. In one embodiment, said functional cerebral organoids in step d) are obtained after a total culture time of about 112 days. In some embodiments, said functional cerebral organoids in step d) are further cultured in said fourth cell culture medium for at least 20 days, such as for at least 30 days, such as for at least 50 days, such as for at least 60 days, such as at least 90 days or longer.
[0133] In some embodiments, said fourth culture medium does not comprise a BMP pathway inhibitor. As discussed previously, said BMP pathway inhibitor may for example be dorsomorphin or LDN-193189. The BMP pathway inhibitor may also be a dual inhibitor, which blocks the BMP pathway and at least another signaling pathway. Such dual inhibitor may for example be a dual SMAD inhibitor. Dual SMAD inhibitors are known to block the signaling pathways of the TGF- and BMP families. Thus, in one embodiment, said fourth culture medium does not comprise a dual inhibitor, which blocks the BMP pathway and at least another signaling pathway; such as does not comprise a dual SMAD inhibitor.
[0134] As it is evident from the above, in some embodiments, all of said second, said third and said fourth culture medium do not comprises a BMP pathway inhibitor, such as a dual inhibitor, which blocks the BMP pathway and at least another signaling pathway; such as all of said second, said third and said fourth culture medium do not comprises a dual SMAD inhibitor.
[0135] In certain embodiments, said fourth cell culture medium comprises DMEM / F12, N2 supplement, insulin, GlutaMAX supplement or glutamine, 2-Mercaptoethanol, B27 supplement with vitamin A and Non Essential Amino Acid Solution, such as DMEM / F12, N2 supplement, insulin, GlutaMAX supplement or glutamine, Penicillin / Streptomycin, 2-Mercaptoethanol, B27 supplement with vitamin A and Non Essential Amino Acid Solution. The skilled person is familiar various cell culture media components and knows of suitable replacements where applicable.
[0136] In certain embodiments, said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of RBFOX3, MAP2, TUBB3, DCX, SYN1, SNAP25, SYP, DLG4, VIM, NES, GLI3, SOX2, PROMI, HES1, TOP2A, MKI67, AURKB, SLC6A1, GAD1, GAD2, SLC32A1, SST, VIP, SLC1A2, SLC2A1, GLS, GRIA1, CAM2A and GRIN1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, SYP, DLG4, VIM, NES, S0X2, T0P2A, MKI67, SLC6A1, GAD1, GAD2, SLC32A1, GLS and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, SYP, NES, S0X2, GAD1, GAD2, SLC32A1, GLS and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, S0X2, GAD1, GAD2, SLC32A1 and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, S0X2 and GAD1; or wherein said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of VIM, NES, Gli3, DCX, MAP2, TUBB3, SNAP25, SIX3, SLC6A1, GAD1, GAD2, SLC1A2, GLS and GRIA1.
[0137] In the context of the present disclosure at least the following markers are considered stem cell markers, including markers for proliferating stem cells: VIM, NES, GLI3, S0X2, PROMI, HES1 TOP2A, MKI67 and AURKB.
[0138] In certain embodiments, said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of VIM, NES, GLI3, S0X2, PROMI and HES1; such as the group consisting of VIM, NES, GLI3, S0X2 and PROMI; such as the group consisting of VIM, NES, GLI3 and S0X2; such as the group consisting of VIM, NES and Gli3 or the group consisting of VIM, NES and S0X2; such as the group consisting of VIM and NES or the group consisting of VIM and S0X2 or the group consisting of NES and S0X2.
[0139] In the context of the present disclosure at least the following markers are considered neuronal markers: RBF0X3, MAP2, TUBB3, DCX, SYN1, SNAP25, SYP and DLG4. In some embodiments, said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of RBF0X3, MAP2, TUBB3, DCX, SYN1, SNAP25, SYP and DLG4.
[0140] In some embodiments, said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of DCX, MAP2, TUBB3, SNAP25 and SIX3 or the group consisting of RBF0X3, MAP2, TUBB3, DCX, SYN1, SNAP25, SYP and DLG4; such as the group consisting of MAP2, TUBB3, DCX, SNAP25 and SYP; such as group consisting of MAP2, TUBB3, DCX and SNAP25; such as the group consisting of MAP2, TUBB3 and DCX.
[0141] In the context of the present disclosure at least the following markers are considered markers for GABAergic neurons: SLC6A1, GAD1, GAD2, SLC32A1, SST and VIP. In some embodiments, said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of SLC6A1, GAD1, GAD2, SLC32A1, SST and VIP; such as the group consisting of SLC6A1, GAD1, GAD2, SLC32A1; such as the group consisting of GAD1, GAD2, SLC32A1 or such as the group consisting of SLC6A1, GAD1 and GAD2; such as the group consisting of GAD1 and GAD2.
[0142] In the context of the present disclosure at least the following markers are considered markers for glutaminergic neurons: SLC1A2, SLC2A1, GLS, GRIA1 CAM2A and GRINl.
[0143] In some embodiments, said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of SLC1A2, SLC1A1, GLS, GRIA1, CAM2A and GRIN1; such as the group consisting of SLC1A2, GLS and GRIA1; such as the group consisting of SLC1A2 and GRIA1 or the group consisting of GLS and GRIA1 or the group consisting of SLC1A2 and GLS.
[0144] In the context of the present disclosure the following markers are considered markers for proliferating stem cells: TOP2A, MKI67 and AURKB. In one embodiment, said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of TOP2A, MKI67 and AURKB; such as the group consisting of TOP2A and MKI67.
[0145] In certain embodiments, said at least one cerebral organoid obtained in step c) is characterized by the expression of at least one marker selected from the group consisting of RBF0X3, MAP2, TUBB3, DCX, SYN1, SNAP25, SYP, DLG4, VIM, NES, GLI3, S0X2, PROMI, HES1, TOP2A, MKI67, AURKB, SLC6A1, GAD1, GAD2, SLC32A1, SST, VIP, SLC1A2, SLC1A1, GLS, GRIA1, CAM2A and GRIN1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, SYP, DLG4, VIM, NES, S0X2, TOP2A, MKI67, SLC6A1, GAD1, GAD2, SLC32A1, GLS and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, SYP, NES, S0X2, GAD1, GAD2, SLC32A1, GLS and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, S0X2, GAD1, GAD2, SLC32A1 and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, S0X2 and GAD1; or wherein said at least one cerebral organoid obtained in step c) is characterized by the expression of at least one marker selected from the group consisting of VIM, NES, Gli3, DCX, MAP2, TUBB3, SNAP25, SIX3, SLC6A1, GAD1, GAD2, SLC1A2, GLS and GRIA1. In certain embodiments, said at least one cerebral organoid obtained in step c) is characterized by the expression of at least one marker selected from the group consisting of VIM, NES, GLI3, S0X2, PROMI and HES1; such as the group consisting of VIM, NES, GLI3, S0X2 and PROMI; such as the group consisting of VIM, NES, GLI3 and S0X2; such as the group consisting of VIM, NES and Gli3 or the group consisting of VIM, NES and SOX2; such as the group consisting of VIM and NES or the group consisting of VIM and SOX2 or the group consisting of NES and SOX2. In some embodiments, said at least one cerebral organoid obtained in step c) is characterized by the expression of at least one marker selected from the group consisting of DCX, MAP2, TUBB3, SNAP25 and SIX3 or the group consisting of RBF0X3, MAP2, TUBB3, DCX, SYN1, SNAP25, SYP and DLG4; such as the group consisting of MAP2, TUBB3, DCX, SNAP25 and SYP; such as group consisting of MAP2, TUBB3, DCX and SNAP25; such as the group consisting of MAP2, TUBB3 and DCX. In some embodiments, said at least one cerebral organoid obtained in step c) is characterized by the expression of at least one marker selected from the group consisting of SLC6A1, GAD1, GAD2, SLC32A1, SST and VIP; such as the group consisting of SLC6A1, GAD1, GAD2, SLC32A1; such as the group consisting of GAD1, GAD2, SLC32A1 or such as the group consisting of SLC6A1, GAD1 and GAD2; such as the group consisting of GAD1 and GAD2. In some embodiments, said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of SLC1A2, SLC1A1, GLS, GRIA1, CAM2A and GRIN1; such as the group consisting of SLC1A2, GLS and GRIA1; such as the group consisting of SLC1A2 and GRIA1 or the group consisting of GLS and GRIA1 or the group consisting of SLC1A2 and GLS. In one embodiment, said at least one cerebral organoid obtained in step c) is characterized by the expression of at least one marker selected from the group consisting of TOP2A, MKI67 and AURKB; such as the group consisting of TOP2A and MKI67.
[0146] In certain embodiments, said at least one cerebral organoid obtained in step d) is characterized by the expression of at least one marker selected from the group consisting of RBF0X3, MAP2, TUBB3, DCX, SYN1, SNAP25, SYP, DLG4, VIM, NES, GLI3, SOX2, PROMI, HES1, TOP2A, MKI67, AURKB, SLC6A1, GAD1, GAD2, SLC32A1, SST, VIP, SLC1A2, SLC1A1, GLS, GRIA1, CAM2A and GRIN1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, SYP, DLG4, VIM, NES, SOX2, TOP2A, MKI67, SLC6A1, GAD1, GAD2, SLC32A1, GLS and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, SYP, NES, S0X2, GAD1, GAD2, SLC32A1, GLS and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, S0X2, GAD1, GAD2, SLC32A1 and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, S0X2 and GAD1; or wherein said at least one cerebral organoid obtained in step d) is characterized by the expression of at least one marker selected from the group consisting of VIM, NES, Gli3, DCX, MAP2, TUBB3, SNAP25, SIX3, SLC6A1, GAD1, GAD2, SLC1A2, GLS and GRIA1. In certain embodiments, said at least one cerebral organoid obtained in step d) is characterized by the expression of at least one marker selected from the group consisting of VIM, NES, GLI3, S0X2, PROMI and HES1; such as the group consisting of VIM, NES, GLI3, S0X2 and PROMI; such as the group consisting of VIM, NES, GLI3 and S0X2; such as the group consisting of VIM, NES and Gli3 or the group consisting of VIM, NES and S0X2; such as the group consisting of VIM and NES or the group consisting of VIM and S0X2 or the group consisting of NES and S0X2. In some embodiments, said at least one cerebral organoid obtained in step d) is characterized by the expression of at least one marker selected from the group consisting of DCX, MAP2, TUBB3, SNAP25 and SIX3 or the group consisting of RBF0X3, MAP2, TUBB3, DCX, SYN1, SNAP25, SYP and DLG4; such as the group consisting of MAP2, TUBB3, DCX, SNAP25 and SYP; such as group consisting of MAP2, TUBB3, DCX and SNAP25; such as the group consisting of MAP2, TUBB3 and DCX. In some embodiments, said at least one cerebral organoid obtained in step d) is characterized by the expression of at least one marker selected from the group consisting of SLC6A1, GAD1, GAD2, SLC32A1, SST and VIP; such as the group consisting of SLC6A1, GAD1, GAD2, SLC32A1; such as the group consisting of GAD1, GAD2, SLC32A1 or such as the group consisting of SLC6A1, GAD1 and GAD2; such as the group consisting of GAD1 and GAD2. In some embodiments, said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of SLC1A2, SLC1A1, GLS, GRIA1, CAM2A and GRIN1; such as the group consisting of SLC1A2, GLS and GRIA1; such as the group consisting of SLC1A2 and GRIA1 or the group consisting of GLS and GRIA1 or the group consisting of SLC1A2 and GLS. In one embodiment, said at least one cerebral organoid obtained in step d) is characterized by the expression of at least one marker selected from the group consisting of T0P2A, MKI67 and AURKB; such as the group consisting of TOP2A and MKI67.
[0147] In some embodiments, the functional cerebral organoids are characterized by the presence of cells expressing one or more markers selected from the group consisting of TUBB3A, MAP2, GAD1 and GRIA1 by approximately 40 days in culture in said fourth culture medium.
[0148] As demonstrated in Example 4 and Fig. 8 as well as in Example 12 and Fig. 19D, the functional cerebral organoids may be further characterized by presence of GFAP expressing astrocytes. The expression of GFAP, in some embodiments, is observed at and after approximately 20 days, such as approximately 30 days, such as approximately 35 days, such as approximately 40 days, such as approximately 45 days, such as approximately 50 days, such as approximately 55 days, such as approximately 60 days, such as approximately 65 days, such as approximately 70 days, in culture in said fourth culture medium. In some embodiments, the presence of GFAP expressing astrocytes is observed in the functional cerebral organoids by approximately 80 days in culture in said fourth culture medium. The astrocytes may also express AQP4. Thus, in some embodiments, the functional cerebral organoids may be further characterized by presence of GFAP and / or AQP4 expressing astrocytes.
[0149] The combinations of the above markers are characteristic for different developmental stages along cell lineages of the various CNS cell types discussed herein. The skilled person will appreciate that it is possible to select markers such that the expression or lack of expression of combinations of markers allows to distinguish between cells of different developmental stages along the cell lineages. The present inventors have used expression of different markers to distinguish between cells of different developmental stages as exemplified in the appended examples. As used herein, the term "characterized by expression of" when referring to cells of a cell population is to be interpreted as related to the expression of a given marker or a set of markers. Conversely, the term "characterized by the lack of expression of" or "lack expression of" or "do not express" when referring to a cell of a cell population is to be interpreted as related to the absence of expression of a given marker or set of markers. The skilled person is well familiar with the use of marker expression as a way to distinguish between cells with different characteristics, such as cells of different developmental stages of the cell lineages. It will be appreciated by the skilled person that when a cell population is analyzed by a method which is limited in terms of the number of markers that can be scored simultaneously, for example due to limitation of the method as such or limitations due to the reagents used, it is possible to select a subset of markers which allow for distinguishing between a first and a second population of cells. The fact that only a subset of markers is used in the experimental set up is in no way to be interpreted as representing the lack of expression of the remaining characteristic markers. The skilled person will appreciate that marker expression may be evaluated at nucleotide level, for example mRNA level, or a protein level. Well known methods of evaluating marker expression include, but are not limited to immunohistochemistry, in situ hybridization, FACS, RNA-sequencing, use of arrays, such as microarrays, as well as quantitative PCR. The skilled person is aware of these and other suitable methods. In this context, differential expression means an increased level for a positive marker and a decreased level for a negative marker as compared to an undifferentiated cell or a cell in a different developmental stage. The detectable level of the marker nucleic acid or polypeptide is sufficiently higher or lower in the cells of interest compared to other cells, such that the cell of interest can be identified and distinguished from other cells using any of a variety of methods known in the art. As used herein, a cell is "positive for" a specific marker, or "positive", when the specific marker is sufficiently detected in the cell, in other words, is expressed by the cell. Thus, a cell which is characterized by the expression of a given marker, is positive for said marker. Conversely, the cell is "negative for" a specific marker, or "negative", when the specific marker is not sufficiently detected in the cell. Thus, a cell which is characterized by the lack of expression of a given marker, is negative for said marker.
[0150] In some embodiments, the culture according to embodiments of the first aspect is performed in at least one culture well having a well volume of approximately 10-200 pl, such as approximately 10-100 pl, such as approximately 20-90 pl, such as approximately 30-80 pl, such as approximately 40-70 pl, such as approximately 50-70 pl, such as approximately 60 pl. In one embodiment, said well has a rounded bottom and / or said wells has an ultralow attachment surface, such as wherein said well has a rounded bottom with ultralow attachment surface. In one embodiment, said well has an inverted cone or pyramid shape and / or said well has an ultralow attachment surface, such as wherein said well has an inverted cone or pyramid shape with ultralow attachment surface. As used herein, the term "ultralow attachment surface" refers to the anti-adhesive properties of the material which faces the cell culture (in other words the inner surface of the culture wells), for example making up the wells as such or coating said wells. Without being bound by theory, said "ultralow attachment surface" provides for a reduction of binding of attachment and serum proteins leading to minimizing cell attachment and spreading on the surface of the culture well and thereby facilitating the formation of spheroid cultures and / or cell aggregates. An "ultralow attachment surface" may be hydrophilic, biologically inert and non-degradable. Non-limiting examples of "ultralow attachment surface" include covalently bound hydrogel layer that effectively inhibits cellular attachment. A well having an ultralow attachment surface may be for example made of a hydrogel, such as but not limited to a PEG-based hydrogel. Furthermore, the shape of the well may aid in spheroid formation, for example round bottom wells, cone shaped wells or wells shaped as an inverted pyramid, such as AggreWell™. It is envisioned that round bottom wells, cone shaped wells or wells shaped as an inverted pyramid may provide a more favorable environment for the formation of cerebral organoids, as they can promote the aggregation of cells and the formation of a more uniform organoid structure. The present inventors envision that this can result in improved organoid formation and more consistent results across different wells and experiments. The skilled person is familiar with cell culture on ultralow attachment surfaces and suitable culture well plates.
[0151] As apparent from the present disclosure, in particular embodiments, the herein disclosed method does not comprise culture in a hydrogel. It is to be understood that the above discussed hydrogel for well-coating is not considered to be a culture in hydrogel. The term "culture in hydrogel", as used herein, refers to embedding spheroids and / or organoids into hydrogel.
[0152] In some embodiments, the culture is stationary culture. Without being bound by theory, it is envisioned that stationary culture methods can provide a more stable environment for the growth and development of the cerebral organoids, which can result in more uniform and reproducible organoids. A stationary culture method can offer several benefits for the industrial scalability of the culturing process. For example, stationary cultures can be more easily scaled up to larger well plates, as they do not require complex shaking or stirring mechanisms and thus, use up smaller space in the culturing incubator. Additionally, stationary cultures can be more easily automated, which can further improve the efficiency and scalability of the culturing process. In other embodiments, the culture is culture under non-stationary conditions, such as shaking or stirring.
[0153] As used therein, the term "population of cerebral organoids" refers to plurality of two or more cerebral organoids. The skilled person appreciates that the method as defined in the first aspect of the present disclosure may be used to generate a population of cerebral organoids. Similarly, populations of cerebral organoids may be obtained by the method according to the second or third aspect as disclosed herein and as discussed below. It will be understood that cerebral organoids of the population may be cultured individually, such as in separate wells of cell culture plates. Alternatively, the population of cerebral organoids may be cultured in bulk, in other words several organoids may be cultured in the same well of a cell culture plate, such as but not limited to a 6-well plate. It is envisioned that one organoid as disclosed herein is preferably cultured in a volume of from approximately 50 to approximately 70 pL, such as approximately 60 pL, media. As a practical and nonlimiting example, in one well of a 6-well cell culture plate, which well has a total volume of 10 ml, it is common to use 2-3 ml media, which corresponds to harboring approximately 30-50 organoids in each well. Characteristics of said population may be determined based on measurements of individual cerebral organoids of the population, which have been cultured individually. Alternatively, characteristics of said population may be determined after pooling individually cultured cerebral organoids of the population. In the present context, the population obtainable or obtained by the method according the first, second or third aspect as disclosed herein exhibits characteristics as discussed in the present disclosure, for example functional and / or structural characteristics. Examples of such characteristics included, but are not limited to, expression of markers, for example as assessed by mRNA expression, and / or neuronal activity. It will be appreciated that said population of cerebral organoids may be described by the average characteristics of the cerebral organoids comprised in the population. Cerebral organoids obtained or obtainable by the present methods are, at basically any developmental stage, valuable resources for in vitro disease modeling. The skilled person will appreciate that any developmental stage may be selected based on the needs for a most reliable disease model (e.g. more immature or more mature organoids can be used). Moreover, culturing conditions may also be chosen for best suitability.
[0154] Thus, in a second aspect of the present disclosure, an in vitro method of cultivation of at least one cerebral organoid is provided, wherein the method comprises obtaining at least one cerebral organoid according to the method as defined in any one the embodiments of the first aspect, and further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of from approximately 2.0 mM to approximately 6.0 mM or further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of from approximately 1 mM to approximately 3 mM. These conditions are considered suitable to assess organoid structure and function in physiological conditions.
[0155] In a third aspect, another in vitro method of cultivation of at least one cerebral organoid is provided, wherein the method comprises obtaining at least one cerebral organoid according to the method as defined in any one the embodiments of the first aspect, and further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of from approximately 7.0 mM to approximately 25.0 mM, such as from approximately 7.0 mM to approximately 20.0 mM, such as from approximately 10.0 mM to approximately 20.0 mM, such as from approximately 15.0 mM to approximately 20.0 mM, such as approximately 17.5 mM or further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of at least approximately 17.5 mM. These culturing conditions are considered suitable to mimic diabetic glucose concentrations, thus such in vitro methods may provide a valuable model for brain structure and function in diabetes. In a fourth aspect, there is provided a cerebral organoid obtainable or obtained by the method according to the first aspect of the present disclosure.
[0156] In a related aspect to said fourth aspect, there is provided a population of cerebral organoids obtainable or obtained by the method according to the first aspect of the present disclosure. In other words, in this related aspect, there is provided a population of cerebral organoids, wherein the cerebral organoids are as defined in any one of the embodiments relating to the fourth aspect. To clarify, said population of cerebral organoids comprises multiple cerebral organoids according to the fourth aspect as disclosed herein. It will be understood that the embodiments discussed in relation to said fourth aspect are applicable to the population of cerebral organoids as disclosed herein. In one embodiment said population of cerebral organoids is a population of functional cerebral organoids.
[0157] The characterization of cell types by the use of markers is extensively discussed in the context of the first aspect of the present disclosure and the skilled person will appreciate that said discussion and well as the specific marker profiles discussed are equally relevant for this fourth aspect of the present disclosure. In particular, reference is made to the different markers expressed by various types of cells comprised in the cerebral organoids as disclosed herein and is not repeated here merely for the sake of brevity alone.
[0158] In some embodiments, the cerebral organoid comprises the following cell types: stem cells (also referred to herein as radial glia), proliferating stem cells (referred to in Fig. 7 as "proliferation"), gliogenic stem cells and neurons, such as GABAergic neurons and / or glutamatergic neurons. In some embodiments, the cerebral organoid comprises the following cell types: neurons and stem cells. Among these, in some embodiments, the neurons comprise both GABAergic and glutamatergic neurons. In some embodiments, the stem cells comprise proliferating stem cells. The stem cell may also be gliogenic stem cells. In particular embodiments of the above, the neurons are subcortical neurons. In some embodiments, the neurons can be characterized by the expression of at least one marker selected from the group consisting of MAP3, TUBB3, GAD1, GAD2 and GRIA1. In some embodiments, stem cells can be characterized by the expression of at least one marker selected from the group consisting of VIM, NES, GLI3 and HES5. In some embodiments, proliferating stem cells (corresponding to "proliferation" in appended Fig. 7) can be characterized by the expression of at least one marker selected from the group consisting of TOP2A, MKI67 and AURKB. In some embodiments, gliogenic stem cells can be characterized by the expression of at least one marker selected from the group consisting of S0X9, VIM, NES and GLI3. In some embodiments, neurons, such as GABAergic neurons and glutamatergic neurons, can be characterized by the expression of at least one marker selected from the group consisting of MAP2 and TUBB3. In some embodiments, GABAergic neurons can be characterized by the expression of at least one marker selected from the group consisting of GAD1, GAD2, SLC6A1, SLC32A1, SST and VIP. In some embodiments, glutamatergic neurons can be characterized by the expression of at least one marker selected from the group consisting of SLC1A2, SLC1A1, GLS, GRIA1 and GRIN1. The skilled person will appreciate that the above recited cell types may be characterized by expression of the specific combinations or subsets of markers recited in the context of the discussion of the cell types in connection with the first aspect of the present disclosure. Said combinations and subsets are not repeated here for the sake of brevity. In some embodiments, the cerebral organoid that comprises the above discussed cell types (according to any of the discussed embodiments) may be selected from the group consisting of the cerebral organoid comprising the neuroepithelium, the matured cerebral organoid and the functional cerebral organoid. In some embodiments, the cerebral organoid that comprises the above discussed cell types (according to any of the discussed embodiments) may be selected from the group consisting of the matured cerebral organoid and the functional cerebral organoid. In a particular embodiment, the cerebral organoid that comprises the above discussed cell types (according to any of the discussed embodiments) is the functional cerebral organoid, such as the functional organoid which has been in culture according to embodiments of the method of the first aspect of the present disclosure at least for about 10 days, such as at least for about 15 days, such as at least for about 25 days, such as at least for about 30 days, such as at least for about 35 days, such as at least for about 40 days, such as at least for about 45 days, such as at least for about 50 days, such as at least for about 55 days, such as at least for about 60 days, such as at least for about 65 days, such as at least for about 70 days in the fourth cell culture medium. In a particular embodiment, the population of cerebral organoids comprising the above discussed cell types (according to any of the discussed embodiments) is the population of functional cerebral organoids, such as a population of functional organoids which has been in culture according to embodiments of the method of the first aspect of the present disclosure for at least for about 10 days, such as at least for about 15 days, such as at least for about 25 days, such as at least for about 30 days, such as at least for about 35 days, such as at least for about 40 days, such as at least for about 45 days, such as at least for about 50 days, such as at least for about 55 days, such as at least for about 60 days, such as at least for about 65 days, such as at least for about 70 days in the fourth cell culture medium.
[0159] In some embodiments, the cerebral organoid, such as the functional cerebral organoid, is characterized by the ability to produce Ca2+oscillatory waves.
[0160] In some embodiments, the population of cerebral organoids, such as the population of functional cerebral organoids, is characterized by the ability to produce Ca2+oscillatory waves.
[0161] In some embodiments, the cerebral organoid or the population of cerebral organoids is characterized by a loss of viability with an EC50 value of from about 7.5 pM to about 12.5 pM, such as from about 8 pM to about 12 pM, such as from about 8.5 pM to about 11.5 pM, such as from about 9 pM to about 11 pM, such as from about 9.5 pM to about 10.5 pM, such as about 10 pM, when treated with Benzethonium Chloride (BzCI). As demonstrated in Example 3 and Fig. 4, said EC50 value may be measured for an organoid of the present disclosure at approximately day 50 in culture.
[0162] In some embodiments, the cerebral organoid or the population of cerebral organoids is characterized by physiologically relevant mitochondrial activity, such as mitochondrial membrane potential. In one embodiment, the cerebral organoid or the population of cerebral organoids is characterized by lower mitochondrial activity compared to a corresponding cerebral organoid or population, respectively, obtained using high glucose culture conditions in step b) or step b)-d), such as at least two times lower or at least three times lower mitochondrial activity compared to a cerebral organoid or population, respectively, obtained in high glucose culture conditions in step b) or step b)-d). It will be understood that the comparative corresponding cerebral organoid or population obtained using high glucose culture conditions in step b) or step b)-d), is a cerebral organoid or population obtained by a method wherein all conditions except glucose concentration are the same as employed in the method as disclosed herein. In one embodiment, the mitochondrial activity is assessed by using a mitochondrial potential dye, such as TMRM. Said high glucose conditions may correspond to a glucose concentration of from approximately 7.0 mM to approximately 25.0 mM, such as from approximately 7.0 mM to approximately 20.0 mM, such as from approximately 10.0 mM to approximately 20.0 mM, such as from approximately 15.0 mM to approximately 20.0 mM, such as approximately 17.5 mM, in the second, third and / or fourth cell culture media. In one embodiment, the cerebral organoid or the population of cerebral organoids is characterized by lower mitochondrial activity compared to a corresponding cerebral organoid or population obtained using high glucose culture conditions in step d), such as at least two times lower or at least three times lower mitochondrial activity compared to a cerebral organoid or population obtained in high glucose culture conditions in step d). Accordingly, in relating embodiments, the high glucose conditions may correspond to a glucose concentration of from approximately 7.0 mM to approximately 25.0 mM, such as from approximately 7.0 mM to approximately 20.0 mM, such as from approximately 10.0 mM to approximately 20.0 mM, such as from approximately 15.0 mM to approximately 20.0 mM, such as approximately 17.5 mM, in the fourth cell culture media. In some instances, said cerebral organoid and said corresponding cerebral organoid are both obtained by the method according to the first aspect, but cultured according to the second and the third aspects of the present disclosure, respectively, as discussed above: thus, in some embodiments, the cerebral organoid that is cultured in low glucose according to the method of the second aspect of the present disclosure is characterized by lower mitochondrial activity compared to a corresponding cerebral organoid that is cultured in high glucose according to the third aspect of the present disclosure, such as at least two times lower or at least three times lower mitochondrial activity compared to a cerebral organoid cultured in the high glucose culture conditions. In some instances, said population of cerebral organoids and said corresponding population are both obtained by the method according to the first aspect, but cultured according to the second and the third aspects of the present disclosure, respectively, as discussed above: thus, in some embodiments, the population of cerebral organoids that is cultured in low glucose according to the method of the second aspect of the present disclosure is characterized by lower mitochondrial activity compared to a corresponding population that is cultured in high glucose according to the third aspect of the present disclosure, such as at least two times lower or at least three times lower mitochondrial activity compared to a population cultured in the high glucose culture conditions. In some embodiments, the cerebral organoid or the population of cerebral organoids that is cultured in low glucose according to the method of the second aspect of the present disclosure is characterized by lower mitochondrial activity compared to a corresponding cerebral organoid or population that is cultured in high glucose according to the method of third aspect of the present disclosure, such as at least two times lower or at least three times lower mitochondrial activity compared to a cerebral organoid or population cultured in the high glucose culture conditions; wherein said mitochondrial activity is a basal mitochondrial activity. "Basal mitochondrial activity" corresponds to mitochondrial activity measured in unstimulated condition of said cerebral organoids or populations. "Unstimulated condition" in this context is used with reference to a condition wherein the culture media used according to the method of the second and third aspects does not comprise any additional component that may affect mitochondrial activity of the cerebral organoids. "Basal mitochondrial activity" may be measured in the presence of DMSO and a mitochondrial potential dye, such as TMRM. It is to be understood that DMSO and the mitochondrial potential dye, such as TMRM, are not expected to affect mitochondrial activity, and the culture media used according to the method of the second and third aspects does not comprise any additional component that may affect mitochondrial activity of the cerebral organoids. Thus "basal mitochondrial activity" may be measured in the two glucose conditions for comparison. This is exemplified in Example 5 below.
[0163] In some embodiments, the cerebral organoid or the population of cerebral organoids is characterized by physiologically relevant mitochondrial activity, such as mitochondrial membrane potential, in response to a ROS- (reactive oxygen species-) inducing compound, such as menadione, such as menadione at a concentration of approximately 10 pM. In one embodiment, the cerebral organoid or the population of cerebral organoids is characterized by higher mitochondrial activity in response to a ROS-inducing compound, such as menadione, such as menadione at a concentration of approximately 10 pM, compared to a corresponding cerebral organoid or population obtained using high glucose culture conditions in step b) or step b)-d), such as at least two times higher or at least three times higher, mitochondrial activity compared to a cerebral organoid or population obtained in high glucose culture conditions in step b) or step b)-d). In one embodiment, the mitochondrial activity is assessed by using a mitochondrial potential dye, such as TMRM. High glucose culture conditions may be as described above with respect to basal mitochondrial membrane activity. In some embodiments, the cerebral organoid or the population of cerebral organoids that is cultured in low glucose according to the method of the second aspect of the present disclosure is characterized by higher mitochondrial activity compared to a corresponding cerebral organoid or population that is cultured in high glucose according to the method of the third aspect of the present disclosure, such as at least two times higher or at least three times higher mitochondrial activity compared to a cerebral organoid or population cultured in the high glucose culture conditions; wherein said mitochondrial activity is measured in response to a ROS-inducing compound, such as menadione, such as menadione at a concentration of approximately 10 pM. This is exemplified in Example 10 and Fig. 17B.
[0164] In some embodiments, the cerebral organoid or the population of cerebral organoids is characterized by physiologically relevant oxidative stress response, such as ROS production, in response to a ROS-inducing compound, such as menadione, such as menadione at a concentration of approximately 10 pM. In one embodiment, the cerebral organoid or the population of cerebral organoids is characterized by enhanced oxidative stress response, such as ROS production, in response to a ROS-inducing compound, such as menadione, such as menadione at a concentration of approximately 10 pM, compared to a corresponding cerebral organoid or population obtained using high glucose culture conditions in step b) or step b)-d), such as at least two times more enhanced or at least three times more enhanced, oxidative stress response, such as ROS production, compared to a cerebral organoid or population obtained in high glucose culture conditions in step b) or step b)-d). In one embodiment, the oxidative stress response is assessed by using a ROS-sensitive fluorescent dye, such as it is described in Example 10. High glucose culture conditions may be as described above with respect to basal mitochondrial membrane activity. In some embodiments, the cerebral organoid or the population of cerebral organoids that is cultured in low glucose according to the method of the second aspect of the present disclosure is characterized by enhanced oxidative stress response, such as ROS production, compared to a corresponding cerebral organoid or population that is cultured in high glucose according to the method of the third aspect of the present disclosure, such as at least two times more enhanced or at least three times more enhanced mitochondrial activity compared to a cerebral organoid or population cultured in the high glucose culture conditions; wherein said oxidative stress response is measured in response to a ROS-inducing compound, such as menadione, such as menadione at a concentration of approximately 10 pM. This is exemplified in Example 10 and Fig. 17A.
[0165] In certain embodiments, the cerebral organoid or the population of cerebral organoids is characterized by having a neuronal activity as assessed by Ca2+imaging which is elevated by from approximately 15% to approximately 45%, such as from approximately 17% to approximately 40%, such as from approximately 20% to approximately 30%, such as approximately 25% to approximately 30%, such as about 27%, when compared to the neuronal activity in a corresponding cerebral organoid or population obtained using high glucose culture condition in step b) or step b)-d). Said high glucose conditions may correspond to a glucose concentration of from approximately 7.0 mM to approximately 25.0 mM, such as from approximately 7.0 mM to approximately 20.0 mM, such as from approximately 10.0 mM to approximately 20.0 mM, such as from approximately 15.0 mM to approximately 20.0 mM, such as approximately 17.5 mM, in the second, third and / or fourth cell culture media. In certain embodiments, the cerebral organoid or the population of cerebral organoids is characterized by having a neuronal activity as assessed by Ca2+imaging which is elevated by from approximately 15% to approximately 45%, such as from approximately 17% to approximately 40%, such as from approximately 20% to approximately 30%, such as approximately 25% to approximately 30%, such as about 27%, when compared to the neuronal activity in a corresponding cerebral organoid or population obtained using high glucose culture condition in step d). Accordingly, in relating embodiments, the high glucose conditions may correspond to a glucose concentration of from approximately 7.0 mM to approximately 25.0 mM, such as from approximately 7.0 mM to approximately 20.0 mM, such as from approximately 10.0 mM to approximately 20.0 mM, such as from approximately 15.0 mM to approximately 20.0 mM, such as approximately 17.5 mM, in the fourth cell culture media. In some instances, said cerebral organoid or the population of cerebral organoids and said corresponding cerebral organoid or population, respectively, are both obtained by the method according to the first aspect, but cultured according to the second and the third aspects of the present disclosure, respectively, as discussed above: thus, in some embodiments, the cerebral organoid or the population of cerebral organoids that is cultured in low glucose according to the second aspect of the present disclosure is characterized by having a neuronal activity as assessed by Ca2+imaging which is elevated by from approximately 15% to approximately 45%, such as from approximately 17% to approximately 40%, such as from approximately 20% to approximately 30%, such as approximately 25% to approximately 30%, such as about 27%, when compared to the neuronal activity in a corresponding cerebral organoid or population that is cultured in high glucose according to the third aspect of the present disclosure. As shown in Example 6, said neuronal activity assessed by Ca2+imaging may be the amplitude of KCI-evoked Ca2+spikes.
[0166] As demonstrated in Fig. 16 and Example 9, cerebral organoids of the present disclosure may be co-cultured with microglia. Thus, in a related aspect, there is provided a co-culture of microglia and at least one cerebral organoid obtainable or obtained by the method according to the first aspect of the present disclosure. Also is provided a co-culture of microglia and a population of cerebral organoids obtainable or obtained by the method according to the first aspect of the present disclosure.
[0167] In one embodiment, the cerebral organoid or the population of cerebral organoids is characterized by having enhanced neuronal activity characterized by one or more selected from the group consisting of increased firing rate, increased spike amplitude, decreased inter-spike interval (isi) and increased total spike count per active electrode, in comparison with said neuronal activity in a corresponding cerebral organoid or population obtained using high glucose culture condition. In one embodiment, the population of cerebral organoids is characterized by having enhanced average neuronal activity characterized by one or more selected from the group consisting of increased average firing rate, increased average (also referred to herein as "mean") spike amplitude, decreased average inter-spike interval and increased average total spike count per active electrode, in comparison with said average neuronal activity in a corresponding population obtained using high glucose culture condition. In certain embodiments, the cerebral organoid or the population of cerebral organoids is characterized by having enhanced neuronal activity characterized by one or more selected from the group consisting of increased firing rate, increased spike amplitude, decreased inter-spike interval and increased total spike count per active electrode; when compared to said neuronal activity in a corresponding cerebral organoid or population obtained using high glucose culture condition in step b) or step b)-d). In certain embodiments, the population of cerebral organoids is characterized by having enhanced average neuronal activity characterized by one or more selected from the group consisting of increased average firing rate, increased average spike amplitude, decreased average interspike interval and increased average total spike count per active electrode (as illustrated in Example 11 and Fig. 18); when compared to said average neuronal activity in a corresponding population obtained using high glucose culture condition in step b) or step b)-d). In one embodiment, said firing rate, said spike amplitude, said inter-spike interval and / or said total spike count per active electrode is measured by Cytotronics high-density complementary metal-oxide-semiconductor microelectrode arrays (CMOS-MEA). Said high glucose conditions may correspond to a glucose concentration of from approximately 7.0 mM to approximately 25.0 mM, such as from approximately 7.0 mM to approximately 20.0 mM, such as from approximately 10.0 mM to approximately 20.0 mM, such as from approximately 15.0 mM to approximately 20.0 mM, such as approximately 17.5 mM, in the second, third and / or fourth cell culture media.
[0168] In one embodiment, said increased average firing rate corresponds to an increase of at least about 80%, such as at least about 90%, such as at least about 100%, such as at least about 110%, such as at least about 120%, such as at least about 130%, such about 139%. In one embodiment, the population of cerebral organoids exhibits an average firing rate per second of at least about 0.75, such as at least about 0.80, such as at least about 0.85, such as at least about 0.90, such as at least about 0.95, such as at least about 1.00, such as at least about 1.05, such as at least about 1.10, such as at least about 1.15, such as at least about 1.20, such as at least about 1.25, such as at least about 1.30, such as at least about 1.35, such as about 1.36.
[0169] In one embodiment, said increased average spike amplitude corresponds to an increase of at least about 7%, such as at least about 8%, such as at least about 9%, such as at least about 10%, such as at least about 11%, such as at least about 12%, such as at least about 13%, such about 13%. In one embodiment, the population of cerebral organoids exhibits an average spike amplitude of at least about 58 pV, such as at least about 59 nV, such as at least about 60 nV, such as at least about 61 nV, such as at least about 62 nV, such as at least about 63 nV, such as at least about 63.5 nV, such as about 63.6 nV.
[0170] In one embodiment, said decreased average inter-spike interval corresponds to a decrease of at least about 20%, such as at least about 25%, such as at least about 30%, such as at least about 35%, such about 35%. In one embodiment, the population of cerebral organoids exhibits an average inter-spike interval of at most about 1.4 s, such as at most about 1.35 s, such as at most about 1.30 s, such as at most about 1.25 s, such as at most about 1.20 s, such as at most about 1.15 s, such as at most about 1.10 s, such as about 1.10 s.
[0171] In one embodiment, said increased average total spike count per active electrode corresponds to an increase of at least about 80%, such as at least about 90%, such as at least about 100%, such as at least about 110%, such as at least about 120%, such as at least about 130%, such about 134%. In one embodiment, the population of cerebral organoids exhibits an average total spike count per active electrode over a period of eight seconds of at least about 8.0, such as at least about 8.5, such as at least about 9.0, such as at least about 9.5, such as at least about 10.0, such as at least about 10.5, such as about 10.7.
[0172] In one embodiment, said neuronal activity or said average neuronal activity is calculated based on recordings for eight seconds four times a day over a period of seven consecutive days, as described in Example 11. In one embodiment, said period of seven consecutive days falls within about day 50 to about 70, such as about day 55 to about day 65, such as about day 58 to about day 64 or about day 57 to about day 63, of culture.
[0173] In one embodiment, the population of cerebral organoids at about 51 or 58 days in culture exhibits at least a two-fold average increase in FOS mRNA expression compared to the population of cerebral organoids at about 23 days in culture. In one embodiment, the population of cerebral organoids at about 58 days in culture exhibits at least a 1.5-fold average increase in FOS mRNA expression compared to a corresponding population of cerebral organoids at about 58 days in culture, wherein the corresponding population is obtained using high glucose culture condition in step b)-d). It will be understood that the comparative corresponding population obtained using high glucose culture conditions in step b) or step b)-d), is a population obtained by a method wherein all conditions except glucose concentration are the same as employed in the method as disclosed herein.
[0174] In one embodiment, the population of cerebral organoids at about 44 days in culture exhibits at least a 1.2-fold average increase in F0XG1 mRNA expression compared to the population of cerebral organoids at about 23 days in culture. In one embodiment, the population of cerebral organoids at about 58 days in culture exhibits at least a 1.2-fold, such as at least a 1.3-fold, such as at least a 1.4-fold, average increase in F0XG1 mRNA expression compared to the population of cerebral organoids at about 23 days in culture. In one embodiment, the population of cerebral organoids comprising functional organoids exhibits at least a 1.2-fold, such as at least a 1.3-fold, such as at least a 1.4-fold, average increase in F0XG1 mRNA expression compared to the population of cerebral organoids comprising matured cerebral organoids.
[0175] In one embodiment, expression of GFAP in the population of cerebral organoids is induced at about 47 days, such as about 48 days, such as about 49 days, such as about 50 days, such as at about 51 days, in culture. In one embodiment, the population of cerebral organoids at about 51 days in culture exhibits at least a fiftyfold average increase in GFAP mRNA expression compared to the population of cerebral organoids at about 44 days in culture. In one embodiment, the expression of GFAP in the population of cerebral organoids at about 51 days in culture is on average higher, such as at least two-fold higher, such as at least three-fold higher, such as at least four-fold higher, such as at least five-fold higher, such as at least sixfold higher, compared to a corresponding population of cerebral organoids at about 51 days in culture, wherein the corresponding population is obtained using high glucose culture condition in step b)-d). In one embodiment, the average number of GFAP-positive astrocytes in the population of cerebral organoids at about 51 days in culture is higher, such as at least two-fold higher, such as at least three-fold higher, such as at least four-fold higher, such as at least five-fold higher, such as at least sixfold higher, compared to the average number of GFAP-positive astrocytes in a corresponding population of cerebral organoids at about 51 days in culture, wherein the corresponding population is obtained using high glucose culture condition in step b)-d). In one embodiment, the population of cerebral organoids at about 58 days in culture exhibits at least a 1.2-fold average increase in NES (also referred to herein as "NESTIN") mRNA expression compared to the population of cerebral organoids at about 23 days in culture. In one embodiment, the population of cerebral organoids at about 51 days in culture exhibits at least a 1.3-fold, such as at least a 1.4-fold, average increase in NES mRNA expression compared to the population of cerebral organoids at about 23 days in culture. In one embodiment, the population of cerebral organoids at about 44 days in culture exhibits at least a 1.5-fold, such as at least a 1.6-fold, average increase in NES mRNA expression compared to the population of cerebral organoids at about 23 days in culture. In one embodiment, the population of cerebral organoids comprising functional organoids exhibits at least a 1.2-fold, such as at least a 1.3-fold, such as at least a 1.4-fold, such as at least a 1.5-fold, average increase in NES mRNA expression compared to the population of cerebral organoids comprising matured cerebral organoids. In one embodiment, the population of cerebral organoids at about 51 days in culture exhibits at least a twofold average increase in NES mRNA expression compared to a corresponding population of cerebral organoids at about 51 days in culture, wherein the corresponding population is obtained using high glucose culture condition in step b)-d).
[0176] In one embodiment, the population of cerebral organoids at about 58 days in culture exhibits at least a 1.3-fold, such as at least a 1.4-fold, average increase in TBR1 mRNA expression compared to the population of cerebral organoids at about 23 days in culture. In one embodiment, the population of cerebral organoids at about 51 days in culture exhibits at least a 1.3-fold, such as at least a 1.4-fold, such as at least a 1.5-fold, such as at least a 1.8-fold, such as at least a 2-fold, average increase in TBR1 mRNA expression compared to the population of cerebral organoids at about 23 days in culture. In one embodiment, the population of cerebral organoids at about 44 days in culture exhibits at least a 1.3-fold, such as at least a 1.4-fold, such as at least a 1.5-fold, such as at least a 1.8-fold, such as at least a 2-fold, such as at least a 2.2-fold, average increase in TBR1 mRNA expression compared to the population of cerebral organoids at about 23 days in culture. In one embodiment, the population of cerebral organoids comprising functional organoids exhibits at least a 1.3-fold, such as at least a 1.4-fold, such as at least a 1.5-fold, such as at least a 1.8-fold, such as at least a 2-fold, such as at least a 2.2-fold, average increase in TBR1 mRNA expression compared to the population of cerebral organoids comprising matured cerebral organoids.
[0177] The above discussed mRNA expression levels may be measured by qPCR, as demonstrated in Example 12 and Fig. 19.
[0178] In a fifth aspect and related aspect, there is provided a method for test substance screening comprising the steps of:
[0179] providing at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure or obtaining at least one cerebral organoid by the method according to any embodiment of the first aspect of the present disclosure, or obtaining at least one cerebral organoid by the method according to any embodiment of the second or third aspect of the present disclosure,
[0180] bringing said at least one cerebral organoid into contact with a candidate substance; and
[0181] determining the effect of said candidate compound on one or more cell types comprised in said at least one cerebral organoid; or
[0182] providing at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or obtaining at least one population of cerebral organoids by the method according to any embodiment of the first aspect of the present disclosure, or obtaining at least one population of cerebral organoids by the method according to any embodiment of the second or third aspect of the present disclosure,
[0183] bringing said at least one population of cerebral organoids into contact with a candidate substance; and
[0184] determining the effect of said candidate compound on one or more cell types comprised in said at least one population of cerebral organoids.
[0185] The test substance may be a drug substance (also referred to herein as "drug"). In a sixth aspect and related aspect, there is provided a method for test substance, such as drug, screening comprising the steps of:
[0186] providing at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure or obtaining at least one cerebral organoid by the method according to any embodiment of the first aspect of the present disclosure, or obtaining at least one cerebral organoid by the method according to any embodiment of the second or third aspect of the present disclosure,
[0187] bringing said at least one cerebral organoid into contact with a candidate substance; and
[0188] determining the response of said at least one cerebral organoid brought into contact with a candidate substance in comparison to the response of a control cerebral organoid that has not been in contact with said candidate compound; or
[0189] providing at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or obtaining at least one population of cerebral organoids by the method according to any embodiment of the first aspect of the present disclosure, or obtaining at least one population of cerebral organoids by the method according to any embodiment of the second or third aspect of the present disclosure,
[0190] bringing said at least one population of cerebral organoids into contact with a candidate substance; and
[0191] determining the response of said at least one population of cerebral organoids brought into contact with a candidate substance in comparison to the response of a control cerebral organoid that has not been in contact with said candidate compound.
[0192] The test substance may be a drug substance (also referred to herein as "drug"). In a seventh aspect and related aspect, there is provided a method for assessing the efficacy of a test substance, such as drug substance, comprising the steps of:
[0193] providing at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure or obtaining at least one cerebral organoid by the method according to any embodiment of the first aspect of the present disclosure, or obtaining at least one cerebral organoid by the method according to any embodiment of the second or third aspect of the present disclosure; bringing said at least one cerebral organoid into contact with said drug substance; and
[0194] examining the effect of the drug substance on said at least one cerebral organoid compared to the effect of a control compound; or
[0195] providing at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or obtaining at least one population of cerebral organoids by the method according to any embodiment of the first aspect of the present disclosure, or obtaining at least one population of cerebral organoids by the method according to any embodiment of the second or third aspect of the present disclosure;
[0196] bringing said at least one population of cerebral organoids into contact with said drug substance; and
[0197] examining the effect of the drug substance on said at least one population of cerebral organoids compared to the effect of a control compound.
[0198] The test substance in particular embodiments is a drug substance (also referred to herein as "drug").
[0199] In an eighth aspect and related aspect, there is provided a method for assessing the toxicity and / or effect on neuronal function of a test substance, comprising the steps of:
[0200] providing at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure or obtaining at least one cerebral organoid by the method according to any embodiment of the first aspect of the present disclosure, or obtaining at least one cerebral organoid by the method according to any embodiment of the second or third aspect of the present disclosure;
[0201] bringing said at least one cerebral organoid into contact with said test substance; and
[0202] examining the effect of the test substance on said at least one cerebral organoid compared to the effect of a control compound or compared to a control cerebral organoid that has not been in contact with said test compound; or providing at least one population of cerebral organoid as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or obtaining at least one population of cerebral organoids by the method according to any embodiment of the first aspect of the present disclosure, or obtaining at least one population of cerebral organoids by the method according to any embodiment of the second or third aspect of the present disclosure;
[0203] bringing said at least one population of cerebral organoids into contact with said test substance; and
[0204] examining the effect of the test substance on said at least one population of cerebral organoids compared to the effect of a control compound or compared to a control population of cerebral organoids that has not been in contact with said test compound.
[0205] The test substance may be a drug substance (also referred to herein as "drug"). In particular embodiments of the fifth, sixth, seventh or eighth aspect and the aspects related to said fifth, sixth, seventh or eighth aspects, one or more data points are obtained in the methods for individual (i.e. a single) cerebral organoids of the present disclosure. This is particularly advantageous as, according to present disclosure, individual cerebral organoids can be assessed instead of a bulk of organoids, which normally happens in known methods. Accordingly, the current methods can be particularly useful in high throughput screening (HTS), e.g. wherein each well of a plate, such as 384-well plate, contains a single cerebral organoid of the present disclosure.
[0206] In some embodiments of the fifth, sixth, seventh or eighth aspect of the aspects related to said fifth, sixth, seventh or eighth aspects, said step of determining the effect or the step determining the response comprises assessing at least one property or properties selected from the group consisting of morphology of the cerebral organoid; metabolic activity of the cerebral organoid; electrophysiology of the cerebral organoid; omics of the cerebral organoid; viability of the cerebral organoid; immunological responses of the cerebral organoid; connectivity of the cells within the cerebral organoid; plasticity and neuroplasticity of the cellular structures of the cerebral organoid; migratory cell behaviors of the cerebral organoid; cellular and subcellular communication activity of the cerebral organoid; cellular and subcellular structure and morphology of the cerebral organoid; and apoptosis in the cerebral organoid. The omics may be at least one omics selected from the group consisting of genomics, transcriptomics, proteomics, metabolomics, epigenomics, lipidomics and phenomics. In some embodiments of the fifth, sixth, seventh or eighth aspect of the aspects related to said fifth, sixth, seventh or eighth aspects, said step of determining the effect or the step determining the response comprises assessing at least one property selected from the group consisting of structural tissue complexity, functional tissue complexity, axonal connectivity, electrical activity (other than electrophysiology), organoid cell composition, signal transduction, neuroplasticity, synaptogenesis, synaptic complexity and structure / functionality and axonal outgrowth. In some embodiments of the fifth, sixth, seventh or eighth aspect of the aspects related to said fifth, sixth, seventh or eighth aspects, the metabolomic activity is assessed based on mitochondrial activity and / or glucose consumption rate. In some embodiments of the fifth, sixth, seventh or eighth aspect of the aspects related to said fifth, sixth, seventh or eighth aspects, the assessment of electrophysiology is performed by a method selected from the group consisting of Ca2+-imaging, multielectrode array (MEA), impedance and resistance. In particular embodiments, the assessment of electrophysiology is performed by Ca2+-imaging. In some embodiments of the fifth, sixth, seventh or eighth aspect of the aspects related to said fifth, sixth, seventh or eighth aspects, said at least one property or properties are assessed using mass spectrometry and / or immunohistochemistry. Said at least one property or properties may also be assessed using electron microscopy (with or without immunolabeling).
[0207] In a ninth aspect, there is provided a use of at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure, or of at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure, for test substance, such as drug, screening.
[0208] In a tenth aspect, there is provided a cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure, or a population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure, for use as a medicament. In an eleventh aspect, there is provided a cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure, or a population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure, for use in the treatment of a disorder or injury of the central nervous system in a patient in need thereof.
[0209] In some embodiments, the treatment comprises transplantation of said cerebral organoid to said patient or of a subset of cells derived from said organoid to said patient.
[0210] In a twelfth aspect, there is provided a pharmaceutical composition comprising at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure or a subset of cells derived from said organoid and a pharmaceutically active agent; or
[0211] at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure and a pharmaceutically active agent.
[0212] In a thirteenth aspect, there is provided a method for treatment of a disease or a disorder of the central nervous system, wherein said method comprises: transplanting an effective dose of one or more cerebral organoid(s) according to any one of the embodiments of the fourth aspect of the present disclosure or an effective dose of a subset of cells derived from said organoid(s) into a brain of a patient in need thereof. Alternatively, said method comprises: transplanting an effective dose of one or more population(s) of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or an effective dose of a subset of cells derived from said population(s) into a brain of a patient in need thereof.
[0213] In a fourteenth aspect, there is provided a method for treatment of a disorder or injury of the central nervous system, wherein said method comprises the steps of: obtaining at least one cerebral organoid according to the method of any one of the embodiments of the first aspect of the present disclosure; and transplanting an effective dose of said at least one cerebral organoid an effective dose of a subset of cells derived from said organoid(s) into a brain of a patient in need thereof.
[0214] Alternatively, said method comprises obtaining at least one population of cerebral organoids according to the method of any one of the embodiments of the first aspect of the present disclosure; and
[0215] transplanting an effective dose of said at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or an effective dose of a subset of cells derived from said population(s) into a brain of a patient in need thereof.
[0216] In a fifteenth aspect, there is provided a use of at least one cerebral organoid as defined in any one of the embodiments of the fourth aspect of the present disclosure or of a subset of cells derived from said organoid(s), for the manufacture of a medicament for the treatment of a disorder or injury of the central nervous system. Alternatively, there is provided a use of a population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or of a subset of cells derived from said population(s), for the manufacture of a medicament for the treatment of a disorder or injury of the central nervous system.
[0217] In a sixteenth aspect, there is provided a kit of parts comprising at least one cerebral organoid according to any one of the embodiments of the fourth aspect of the present disclosure or at least one cerebral organoid obtainable or obtained by the method as defined in any one of the embodiments of the first aspect of the present disclosure, and instructions for use. Alternatively, there is provided a kit of parts comprising at least one population of cerebral organoids as defined in any one of the embodiments of the aspect related to the fourth aspect of the present disclosure or at least one population of cerebral organoids obtainable or obtained by the method as defined in any one of the embodiments of the first aspect of the present disclosure and instructions for use.
[0218] The kit of parts, in some embodiments, further comprises one or more culture media. Said one or more culture media may be selected from the group consisting of said first, said second, said third and said fourth media according to the first aspect of the disclosure. In some embodiments all of said first, said second, said third and said fourth media are comprised in the kit of parts. In other embodiments only one or more components of said first, said second, said third and / or said fourth media are comprised in the kit of parts. In particular embodiment said kit of parts further comprises microglia. The microglia are suitable for co-culture with cerebral organoids of the present disclosure, as demonstrated in Fig. 16 and Example 9. It will be appreciated that the embodiments discussed in relation to the fifth, sixth, seventh, eight, nineth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth and sixteenth aspects as disclosed herein are also relevant for the population of cerebral organoids according to the aspect related to the fourth aspect disclosed herein. While the invention has been described with reference to various exemplary aspects and embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. In addition, many modifications may be made to adapt a particular situation or molecule to the teachings of the invention without departing from the essential scope thereof. Therefore, it is intended that the invention not be limited to any particular embodiment contemplated, but that the invention will include all embodiments falling within the scope of the appended claims.
[0219] Various publications are cited in the present application, each of which is incorporated by reference herein in its entirety.
[0220] Brief description of drawings
[0221] Figure 1 presents a schematic timeline of an exemplary culturing protocol for the generation of cerebral organoids according to the present disclosure with representative light microscopic images of various developmental stages (scale bar: 400 pm).
[0222] Figure 2 shows area measurement (pixels) for cerebral organoids obtained using methods described in Example 2, wherein seeding cell concentrations at 1500, 2000, 2500 and 3000 cells / well were tested for organoid formation. Error bars indicate standard deviation (n=69 for 1500 cells / well, n=70 for 2000 cells / well, n=62 for 2500 cells / well and n=75 for 3000 cells / well).
[0223] Figure 3 shows pairwise difference in the area (pixels) of organoids obtained by the tested seeding densities of 1500, 2000, 2500 and 3000 cells / well, as described in Example 2.
[0224] Figure 4 shows cerebral organoid viability (shown as a dose response curve) upon exposure to increasing concentrations (pM) of Benzethonium Chloride (BzCI) in three different time intervals: 8h (Fig.4A), 16h (Fig. 4B) and 24 (Fig. 4C). DMSO was used as control. Figure 5 shows cell gene signatures evenly distributed across the UMAP for four separate organoid samples (sample no. 039, 040, 041 and 042), indicating a high level of similarity between the cerebral organoids analyzed using single cell sequencing, as described in Example 4.
[0225] Figure 6 shows the Silhouette width for the four cerebral organoids analyzed using single cell sequencing, as described in Example 4 (sample labels 1, 2, 3 and 4 correspond to organoid sample no. 039, 040, 041 and 042, respectively).
[0226] Figure 7 shows the percentage of cells expressing various marker genes and corresponding conserved cell types present in the four cerebral organoids analyzed using single cell sequencing, as described in Example 4.
[0227] Figure 8 shows an immunofluoreccence staining for the astrocytic marker GFAP in an organoid on day 100 of differentiation.
[0228] Figure 9 shows mean intensity of TMRM dye in cerebral organoids cultured in low glucose (plate no. 103026, 103027 and 103028) or in high glucose (plate no. 103029, 103030 and 103031), as described in Example 5 (each well is shown individually). Figure 10 shows mean intensity of TMRM dye in DMSO-treated cerebral organoids cultured in low glucose (plate no. 103026, 103027 and 103028) or in high glucose (plate no. 103029, 103030 and 103031), as described in Example 5.
[0229] Figure 11A shows mask size plotted for all DMSO-treated cerebral organoids cultured in low glucose (plate no. 103026, 103027 and 103028; light gray; BZmedia) or in high glucose (plate no. 103029, 103030 and 103031; dark gray; HighGlucose). Normalized data (mean intensity of TMRM dye normalized to the mask area, as described in Example 5) are shown in Fig. 11B.
[0230] Figure 12 shows distribution plots of the amplitude of KCI-evoked Ca2+spikes for organoids generated from three different cell lines (314 (Fig. 12A), 441 (Fig. 12B) and 520 (Fig. 12C)) cultured in low glucose (light gray, BZmedia) or high glucose (dark gray, HighGlucose), as described in Example 6.
[0231] Figure 13 shows amplitude of KCI-evoked Ca2+spikes for organoids generated from three different cell lines (314, 441 and 520) cultured in low glucose or high glucose . Figure 14 shows the highest point in KCI-evoked responses for Celecoxib-treated organoids using various Celecoxib concentrations for 24h, under low glucose (light gray, BZmedia) or high glucose (dark gray; HighGlucose) culture conditions, as described in Example 6. Figure 15 shows development dynamics based on the size (area in pixel) of cerebral organoids up to 30 days in culture using high glucose conditions (HighGlucose) and low glucose conditions (BZ), as described in Example 7.
[0232] Figure 16 shows non-treated (Fig. 16A) and BzCI-treated (Fig. 16B) cerebral organoid-microglia co-cultures according to the present disclosure stained using TMRM and Vybrant DiO (scale bar: 700 pm).
[0233] Figure 17 shows results of ROS production assay (Fig. 17A) and TMRM mitochondrial membrane potential assay (Fig. 17B) for organoids cultured under low (BZmedia, dark gray) or high glucose conditions (Highmedia, light gray) following 24-hour treatment with increasing concentrations of ROS-inducing compound menadione (0.1 pM - 100 pM). Change in ROS production and mitochondrial membrane potential is expressed as % change from ROS levels and mitochondrial membrane potential, respectively, measured for samples where no menadione was added (0.0 pM).
[0234] Figure 18 shows firing rate (Fig. 18A), mean spike amplitude (Fig. 18B), inter-spike interval (Fig. 18C), total spike count per active electrode (Fig. 18D), as well as spike traces (Fig. 18E-F) measured using Cytotronics high-density complementary metal-oxide-semiconductor microelectrode arrays (CMOS-MEA) for organoids cultured (generated and maintained) under low glucose conditions (BZ; light gray in Fig. 18A-D; Fig. 18F) or high glucose conditions (High; dark gray in Fig.l8A-D; Fig. 18E).
[0235] Figure 19 shows results of qPCR analysis of gene expression levels for DCX (Fig. 19A), FOS (Fig. 19B), FOXG1 (Fig. 19C), GFAP (Fig. 19D), NESTIN (Fig. 19E) and TBR1 (Fig. 19F) in cerebral organoids cultured (generated and maintained) in BZ media (light gray) or in high-glucose media (dark gray), harvested on Day 23, 44, 51 and 58. The fold change in gene expression was calculated as 2-AACtrelative to the control sample obtained from BZ media culture on Day 23.
[0236] EXAMPLES
[0237] Example 1
[0238] Culturing protocol for the generation and maintenance of cerebral organoids The present inventors have found that certain culturing conditions that utilize physiologically relevant glucose concentrations are surprisingly beneficial for obtaining and maintaining cerebral organoids. Cerebral organoids that are obtained using the herein disclosed methods are highly reproducible and suitable for various applications, such as high-throughput screening (HTS) methods with reliable outcome for in vitro testing prior to applications in clinical settings. The organoids are also useful in direct clinical applications, for example in personalized diagnostics. This example describes an exemplary culturing method for obtaining and maintaining cerebral organoids according to the present disclosure. A schematic timeline of the method and representative bright field microscopic images of the organoids at different developmental stages are shown in Fig 1.
[0239] Materials and Methods
[0240] Cell seeding and subsequent media changes were performed using a multidrop (Thermo Fisher Scientific) and Apricot liquid handler (SPT Labtech). The entire culturing protocol was performed in stationary culture.
[0241] Seeding and formation of embryonic bodies (Day 0-4)
[0242] iPSCs (induced pluripotent stem cells, as indicated below for each Example) were seeded at a density of 2500 cells / well (except Example 2, wherein the indicated cell densities were tested) in 384-well ultra-low attachment plates (Corning, 3830) in a first cell culture medium (Medium 1) consisting of 78.5 % DMEM / F12 (ThermoFisher, #31331093, 17.5 mM glucose), 20 % KOSR (ThermoFisher, #10828010), 1% Penicillin / Streptomycin (Sigma, #P0781) and 0.5 % vol / vol MEM-NEAA (Sigma #M7145).
[0243] At seeding (day 0), Medium 1 was supplemented with 4 ng / ml bFGF and freshly prepared ROCK inhibitor, Y27632 (Millipore, #SCM075) at 50 pM final concentration. On day 2, cells were fed with medium 1 supplemented with bFGF to reach 2 ng / ml bFGF concentration in the wells.
[0244] In the first 12-24 hours after seeding, the seeded iPSCs formed aggregates and by day 4, clear structures along the rim could be observed in the aggregates by light microscopy. Accordingly, by day 4, embryonic bodies have been formed from the seeded iPSCs. Induction of neuroepithelium (Day 4-13)
[0245] On day 4, the wells were washed 3x with a second cell culture medium (Medium 2) consisting of 96 % DMEM / F12 (ThermoFisher, #11880036, 5.5 mM glucose) supplemented with 1 % vol / vol N2 supplement (ThermoFisher, #175020-01), 1 % vol / vol GlutaMAX supplement (Invitrogen, #35050) - if Glutamax was not included in DMEM / F12, 1 % vol / vol MEM-NEAA (Sigma, #M7145), 1% Pennecillin / Streptomycin (Thermo Fisher, #15140122), 1 pg / ml Heparin (Sigma, #H3149), 3 pM IWP2 (Sigma, #IO536-5MG) and 5 pM SB431542 (Stem Cell Technologies, #72232). Fresh medium 2 was given to the cells every other day starting from day 4 to day 13.
[0246] At day 10-13, preferably at day 10 but also possibly at day 11, 12 or 13, upon the clear appearance of bright neural ectodermal tissue and structure formation of epithelium (as shown at day 10 in Fig. 1), BME (Basement Membrane Extract; R&D systems) was added to the organoids with an effective concentration of 1-10%, such as about 5%, in the well.
[0247] By day 13, cerebral organoids that comprise neuroepithelium have been formed. Typically, the cerebral organoids can be characterized by the presence of one or more ventricular niches at this stage (as indicated by the arrows in Fig. 1). Moreover, the appearance of radial glial cells and / or radial glial progenitor cells is also indicative for completing the induction of neuroepithelium in the cultured embryonic bodies.
[0248] Further culturing and maturation of cerebral organoids (Day 14-120 or longer) From day 13 onwards, a third cell culture medium (Medium 3) was used instead of Medium 2 for culturing of the cerebral organoids. Medium 3 consisted of 95 % DEMEM / F12 (ThermoFisher, #11880036, low 5.5 mM glucose), 0.5 % N2 supplement (ThermoFisher, #175020-01), 0.025 % insulin (Sigma, #I9278-5ML), 1 % GlutaMAX (ThermoFisher, #35050-061) - if Glutamax was not included in DMEM / F12, 0.5 % MEM-NEAA (Sigma, #M7145-100ml), 1 % Penicillin / Streptomycin (Sigma, #P0781), 50 pM 2-Mercaptoethanol (Gibco, #31350010) and 2 % B27 without vitamin A (Thermofisher, #12587010). Fresh Medium 3 was given to the cells every second or third day starting from day 13 until day 30. The lack of vitamin A in Medium 3 played a role in inhibiting hindbrain patterning and differentiation of forebrain structures in the cerebral organoids.
[0249] From day 30 onwards, a fourth cell culture medium (Medium 4) was used instead of Medium 3 for culturing of the cerebral organoids. Medium 4 consisted of 94.975 % DEMEM / F12 (ThermoFisher, #11880036, low 5.5 mM glucose), 0.5 % N2 supplement (ThermoFisher, #175020-01), 0.025 % insulin (Sigma, #I9278-5ML), 1 % GlutaMAX (ThermoFisher, #35050-061) - if Glutamax was not included in DMEM / F12, 0.5 % MEM-NEAA (Sigma, #M7145-100ml), 1 % Penicillin / Streptomycin (Sigma, #P0781), 50 pM 2-Mercaptoethanol (Gibco, #31350010) and 2 % B27 with vitamin A (ThermoFisher, #17504044). Once weekly, Medium 4 was supplemented with laminin2020 (Sigma) at a concentration of 1-2 pg / ml to reach a final concentration of about 0.5-1 pg / ml in the wells.
[0250] From day 13 onwards, further culturing of the cerebral organoids enabled further differentiation and maturation of these, which allowed for the generation of cerebral organoids corresponding to different developmental stages. Culturing of the organoids may be maintained indefinitely.
[0251] Course of actual glucose concentration during culturing
[0252] In the herein described culturing protocol, cell culture medium is exchanged in the culturing wells regularly. As it is known to those skilled in the art, cell culture medium is typically exchanged during cell culturing by the removal of half of the media present in the wells and by the addition of fresh media in the same volume to each well. Accordingly, if certain media components (such as glucose) degrade and / or are used up gradually by the cultured cells, the actual concentration of these components (which the organoids are exposed to) after media exchange is lower in the wells than the concentration that is in the fresh media added to the wells (due to the dilution effect). Thus, e.g. when exchanging Medium 2 in the wells, the actual glucose concentration is at most 5.5 mM (e.g. on day 4 after washing the wells three times). Typically, glucose levels gradually decrease in the wells during culturing by the time of adding fresh media, thus the actual glucose concentration may be about the half of the initial concentration, i.e. Is about 2.75 mM immediately after media exchange (which further decreases over time until the next day of media exchange). The same principle applies to the first step of culturing using 17.5 mM glucose-containing medium (Medium 1).
[0253] Example 2
[0254] Selection of cell number for seeding in high-throughput format
[0255] The present example describes testing of different cell densities for seeding that may be suitable for cerebral organoid formation in a high-throughput format. The inventors have found that certain seeding densities (number of cells / well at seeding) are advantageous for cerebral organoid formation in a high throughput format using the herein disclosed method. They have found that the optimal number of cells for seeding helps to maintain a low variability in the size and shape of the cerebral organoids. Irregular shapes and sizes are considered disadvantageous for the robustness of follow-up assays using organoids and may impede meaningful conclusions.
[0256] Materials and Methods
[0257] An iPSC line (CW60520FF1, also referred to herein as "520"; Fujifilm Cellular Dynamics) was used for the determination of cell seeding optimum for cerebral organoid formation in a high throughput format. Four different cell densities were tested at 1500, 2000, 2500 and 3000 cells / well in a 384 ultra-low attachment plate (Corning, 3830), corresponding to 50 cells / pl, 66.66 cells / pl, 83.33 cells / pl and 100 cells / pl). Cerebral organoids were generated as described in Example 1 and cultured up to day 19. On day 19, the organoids were imaged using Incucyte imager (Sartorius) and organoid size and shape was calculated using machine leaning methods described by Gritti et al. (2021).
[0258] Results and conclusions
[0259] Results from the cell seeding experiments are presented in Fig. 2 and Table 1. The data show that the number of seeded cells on day 0 positively correlated with the size (area measured in pixels) of the obtained organoids on day 19. The area of organoids varied from about 30000 pixels to about 42000 pixels. The smallest area (32722 (+ / - 5306) pixels) was measured for organoids obtained by the seeding density of 1500 cells / well, and the largest area (41963 (+ / - 5056) pixels) was measured for organoids obtained by the seeding density of 3000 cells / well (Table 1).
[0260] #cells / well 1500 2000 2500 3000 Average 32722.31 38326.92 40509.33 41963.04
[0261]
[0262] SD 5306.761 5439.273 3535.634 5056.179 Table 1. Statistics overview of area (in pixels) of organoids after 19 days of culture according to different seeding cell concentrations
[0263] As demonstrated in Table 1 and Fig. 2, the increase in the area of the organoids with increasing seeding cell concentrations appear to reach a plateau just over the density of 3000 cells / well. This is also supported by Fig. 3, wherein pairwise difference in the organoid size is shown between the tested experimental groups. The data indicate that the smallest area difference was obtained between organoids that were obtained at seeding concentrations of 2500 and 3000 cells / well, as also shown by the statistical analysis (2-tailed student t-test, equal variance) in Table 2. The statistical analysis demonstrates that the area difference in pairwise comparison between organoids of the tested conditions became significantly smaller with increasing seeding cell concentrations (n=69 for 1500 cells / well, n=70 for 2000 cells / well, n=62 for 2500 cells / well and n=75 for 3000 cells / well).
[0264] #cells / well 1500 2000 2500 3000
[0265] 1500 1 7.84E-09 2.84E-17 1.42E-21 0.049 <0.05 2000 7.84E-09 1 0.00794 4.64E-06 0.0099 <0.01 2500 2.84E-17 0.00794 1 0.01078 0.00099 <0.001
[0266]
[0267] 3000 1.42E-21 4.64E-06 0.01078 1
[0268] Table 2. p values of the statistical analysis demonstrating the difference in pairwise comparison between the area of organoids obtained by the tested seeding conditions
[0269] Each of the tested seeding densities is considered suitable for generating cerebral organoids with desired properties using the herein disclosed methods. Considering that the lowest standard deviation in the area (i.e. size and shape) of organoids was obtained using a seeding concentration of 2500 cells / well, the inventors have found that a seeding concentration at 2500 cells / well may be particularly advantageous in the herein disclosed method for obtaining cerebral organoids that exhibit low variability in their size and shape. This was further supported by that the smallest area difference was observed between organoids obtained using 2500 and 3000 cells / well seeding concentrations. In particular, the hereby demonstrated low variance in the size and shape of cerebral organoids of the present disclosure is considered beneficial for increasing the robustness of follow-up assays using the organoids, for example in drug screening methods in a high-throughput format.
[0270] Example 3
[0271] Reproducibility of viability response curves of the cerebral organoids
[0272] To use cerebral organoids in HTS, for example in high-throughput drug screening methods, it is required that the organoids show high reproducibility and low variance in their functional properties. A reliable experimental setting requires reproducible functional responses of the organoids upon external challenges. As it is apparent to those skilled in the art, high variability in functional properties of the organoids would affect reliability of functional assays employed on the organoids. This variability may be introduced by known culturing methods for the generation of organoids. Advantageously, the present methods allow for the generation of cerebral organoids that show high reproducibility and low variability in their functional properties.
[0273] As an example, the feasibility of robust viability testing of cerebral organoids according to the present disclosure is demonstrated upon exposure to molecules, such as drugs, at different concentrations and in various time intervals. The assay enables assessing EC50 values from the viability response curves without the need of endpoint determination.
[0274] Materials and Methods
[0275] Organoids were generated from CW60520FF1 cells ("520", Fujifilm Cellular Dynamics) seeded at 2500 cel l / wel I density and cultured as described in Example 1 for 50 days. Fresh Medium 3 was given to the organoids every second or third day from day 13 to day 30, after which Medium 4 was used.
[0276] On day 48 the organoids were incubated with 100 nM TMRM (Thermofisher #T668), a mitochondrial membrane potential dye, that labelled active and live mitochondria. On day 50 the organoids were treated with 0.01; 0.1; 1; 10; 100 or 200 pM of Benzethonium Chloride (BzCI), a synthetic quaternary ammonium, used in HTS screenings as cell death control. Following treatment, the plate comprising the organoids was placed in an Incucyte (Sartorius) imager and imaged at 8 hours, 16, hours and 24 hours to determine viability of the cerebral organoids at the indicated time points.
[0277] Results and conclusions
[0278] Fig. 4 shows a decrease in the viability of the cerebral organoids in response to BzCL-treatment in a concentration dependent manner. EC50 values were calculated after 8 hours (Fig. 4A; 10.32 pM), 16 hours (Fig. 4B; 10.18 pM) and after 24 hours treatment (Fig. 4C; 10.10 pM). The difference between EC50 values measured at 8 hours and 24 hours was negligible; 0.22 pM. This indicates that treatment with BzCL was effective already after 8 hours but can reliably be measured between 8 and 24 hours, without any substantial effect on the obtained EC50 value. The example thus demonstrates functional reliability over time of cerebral organoids of the present disclosure in a viability assay. This property is considered particularly beneficial for HTS methods, as discussed above.
[0279] Example 4
[0280] Reproducibility of the cell composition of the cerebral organoids
[0281] To use brain organoids in pre-clinical and clinical applications, such as in HTS, for example in high-throughput drug screening methods, high reproducibility and low variance of the cell types present in the organoids is also required in addition to functional reliability.
[0282] This example demonstrates using single cell sequencing that the cell composition of the cerebral organoids according to the present disclosure is well-defined and highly reproducible.
[0283] Materials and methods
[0284] Brain organoids were generated from CW60520FF1 cells ("520", Fujifilm Cellular Dynamics) seeded at 2500 cel l / wel I density and cultured according to the method described in Example 1 until day 70. On day 70, single organoids were dissociated using papain dissociation according to the manufacturer's instructions (Miltenyi, Neural tissue - papain dissociation kit) and previously described methods (Kanton et al. 2020). Fluorescence-Activated Cell Sorting (FACS) was performed for the exclusion of dead cells and collection of live cells, which were then loaded into the lOx chromium workflow (lOx Genomics).
[0285] Samples were sequenced on NovaSeq6000 (NovaSeq Control Software 1.8.1 / RTA v3.4.4) with a 28nt(Readl)-10nt(lndexl)-10nt(lndex2)-90nt(Read2) setup using 'NovaSeqXp' workflow in 'S4' mode flowcell. The Bel to FastQ conversion was performed using bcl2fastq_v2.20.0.422 from the CASAVA software suite. The quality scale used was Sanger / phred33 / Illumina 1.8+. Quality control was performed with the cell ranger pipeline (lOx Genomics). Cluster analysis was performed using Seurat (Butler et al. 2018) and the comparison of samples was done using the Silhouette width (Rousseeuw et al. 1987 and Lengyel et al. 2019).
[0286] Results and conclusions
[0287] Fig. 5, 6 and 7 show single cell sequencing data for four separate organoids (sample no. 039, 040, 041 and 042). The cell gene signatures were evenly distributed across the UMAP indicating a high level of similarity between the organoids (Fig. 5). This is evident since each cell type was found evenly distributed across all regions of the UMAP, i.e. each cell type appeared in each of the four analyzed organoids.
[0288] Furthermore, when calculating the Silhouette width, which is an indication for how well the tested samples are separated from each other, individual organoids showed a high level of similarity across all tested samples (Fig. 6). To achieve good separation of clusters (i.e. that samples are different from each other) a value closer to 1 is desirable, whereas a value close to 0 means that the clusters are overlapping. Cerebral organoids according to the present disclosure showed scores of
[0289] -0.07; -0.06; 0.06 and -0.07, which indicates that the samples were almost indistinguishable from each other (Fig. 6). This indicates high reproducibility of the cellular composition of organoids that are produced using the hereby disclosed methods.
[0290] Assessment of conserved cell types present in the organoids was done by calculating the % of cells expressing marker genes commonly found in the human brain, as shown in Fig. 7. The data show consistent gene expression on the level of individual genes involved in brain development and function across the four tested organoids. As apparent from the single cell sequencing data, the expression of marker genes for certain types of glial cells, such as astrocytes, was low in the cerebral organoids at day 70. This indicates that, at this developmental stage, these types of cells are not yet present in the cell composition of the organoids. At day 100 of differentiation, however, the organoids show a clear positive staining for the astrocyte (and ependymal cell) marker GFAP (glial fibrillary acidic protein, Fig. 8), demonstrating the presence of large astrocyte populations in the organoids at this later developmental stage.
[0291] These data together illustrate the continued development and maturation of the organoids comprising cell types typical to human brain. As shown in Fig. 7, the organoids comprised cell identities resembling neurons including GABAergic and glutamatergic neurons, stem cells, proliferating stem cells and, at a later developmental stage, astrocytes. These results together confirm that major cell types of the brain are represented in the organoids, thus the organoids are suitable in vitro models for various pre-clinical and clinical applications, such as HTS for drug molecules to predict in vivo performance. In addition, brain organoids generated by the herein disclosed methods also showed very high similarity between each other in terms of gene expression profiles, cell identities as well as ratios / proportions of the cell identities and expression profiles. As explained above, such high reproducibility and low variance in the cellular composition of the organoids is particularly beneficial for pre-clinical and clinical applications, such as HTS methods, to obtain reliable and reproducible results.
[0292] Example 5
[0293] The effect of glucose on cerebral organoid function - Day 60
[0294] Known protocols for the generation and maintenance of brain organoids employ media comprising glucose at a concentration between 25 mM (neurobasal media) and 17.5 mM (DMEM / F-12, GlutaMAX) (e.g. Lancaster et al. 2013 and Bhaduri et al.
[0295] 2020). Although these concentrations are considered beneficial for in vitro culturing of cells and organoids, they lay far outside of the expected blood and CSF (cerebrospinal fluid) concentration of glucose, even for diabetic patients where the concentrations can be between 5.5 and 10.9 mM in plasma and between 3.3 and 6.1 mM in the CSF (Tigchelaar et al. 2022 and Kavanagh et al. 2019). On the other hand, healthy levels of glucose in human serum are between about 800 - 1100 mg / l (4.4 -6.1 mM), while in the CSF are at approximately 60% of the serum glucose concentration, i.e. about 450 - 800 mg / l (2.5 - 4.4 mM; Irani et al. 2009).
[0296] The present inventors have surprisingly found that cerebral organoids with advantageous characteristics can be generated using culture media that comprises physiologically relevant concentrations of glucose. Moreover, the inventors demonstrate that applying high (i.e. physiologically non-relevant) glucose concentrations (such as between about 17.5 mM and 25 mM) for culturing cerebral organoids leads to disadvantageous characteristics of the organoids. Examples 5 and 6 demonstrate superior properties of cerebral organoids of the present disclosure, wherein the organoids were maintained in culture using media comprising physiologically relevant glucose concentrations.
[0297] Material and methods
[0298] In media 2, 3 and 4, the initial glucose concentration is at 5.5 mM and, as explained in Example 1, a theoretical effective glucose concentration of about 2.75 mM is reached at media change. It is considered that the concentration of glucose decreases over time in culture, until the next media change.
[0299] For the exploration of the effect of glucose levels on brain organoid function, cerebral organoids in a HTS format were generated CW60520FF1 cells ("520", Fujifilm Cellular Dynamics) seeded at 2500 cel l / well density and cultured according to the method described in Example 1 until day 50. From day 50 onwards, three plates were cultured in a mix of DMEM / F-12 and Neurobasal comprising glucose at a concentration of 17.5 mM, as described in the prior art (Lancaster et al. 2013, Camp et al. 2015 and Velasco et al. 2019) until day 60 to mimic high glucose conditions (HighGlucose; plate no. 103029, 103030 and 103031), while another three plates were maintained in culture as described in Example 1 using Media 4 (BZmedia; plate no. 103026, 103027 and 103028) with the low glucose concentration (5.5mM). On day 60, the organoids (cultured according to the present method using a low glucose concentration or according to the known approach using a high glucose concentration) were tested in a mitochondrial membrane potential assay. Two days prior to the assay, the organoids were incubated with 100 nM TMRM (mitochondrial potential dye; Thermofisher) in combination with DMSO. Fluorescent intensity of TMRM was measured using ImageExpress - Pico (Molecular Devices). Whole well imaging was performed at the emission wavelength of 594 / 40 nm and with the excitation wavelength of 530 / 45 nm.
[0300] Results and conclusions
[0301] By measuring the fluorescent intensity of the mitochondrial dye, TMRM, mitochondrial membrane potential and thus metabolic activity of the cerebral organoids may be evaluated. As shown in Fig. 9, the intensity of the mitochondrial dye in cerebral organoids cultured in high glucose conditions (plate no. 103029, 103030 and 103031) was significantly higher in comparison to cerebral organoids cultured in low glucose conditions according to the present disclosure (plate no. 103026, 103027 and 103028). Similarly, upon DMSO treatment (Fig. 10), organoids cultured in high glucose conditions (HighGlucose) showed a significantly higher intensity of the mitochondrial dye than cerebral organoids cultured in low glucose conditions according to the present disclosure (BZmedia). Notably, the difference in metabolic activity could not be accounted for any glucose-induced change in the size of the organoids, since the (mask) size of organoids remained the same between the two conditions (Fig. 11A). These data together indicate that metabolic activity of cerebral organoids is greatly affected by the glucose concentration of the media, in which the organoids are cultured. For facilitating comparison, the DMSO data were equalized between the results obtained for high and low glucose conditions (Fig. 11B) by setting the lowest value to 0 and the highest value to 1 for each experimental group.
[0302] In conclusion, metabolic activity of the cerebral organoids that are obtained according to methods of the present disclosure is altered under culturing in non-physiological glucose concentrations. Obtaining and culturing cerebral organoids using the methods disclosed herein, i.e. employing glucose concentrations that resemble physiological conditions, are considered beneficial for obtaining reliable (and physiologically relevant) assay results for testing resistance and responsiveness upon exposure of the organoids to molecules, such as drugs, e.g. in a high-throughput format. Example 6
[0303] The effect of glucose on cerebral organoid function - Week 16
[0304] The effect of glucose levels on brain organoid function was further evaluated in this Example using Ca2+-imaging.
[0305] Materials and Methods
[0306] Cerebral organoids in a HTS format were generated from CW60314EE1, CW60441EE1 and CW60520FF1 cells (also referred to herein as "314", "441" and "520", respectively, Fujifilm Cellular Dynamics) seeded at 2500 cell / well density and cultured according to the method described in Example 1 until day 72, whereby in each plate wells were allocated for each of the 3 cell lines, with the distribution Column 1-8 for cell line CW60314EE1, column 9-16 cell line CW60441EE1 and column 17-24 for cell line CW60520FF1. From day 102 the media for half of the plates was switched to high glucose media and maintained for 10 days before FLIPR analysis at day 112 (10 days treatment, at week 16 of differentiation). High and low glucose conditions were as described in Example 5.
[0307] On day 112, organoids were incubated in combination with DMSO or 0.01-1 pM Celecoxib (including a "backfill" of DMSO to equalize the DMSO concentrations across samples) with calcium 6 dye (Molecular Devices) according to manufacturer's instructions for 2 hours at 37°C. Following incubation, the organoids were imaged using FLIPR-Tetra (Molecular Devices) at 3h for 2 minutes to establish a baseline, after which 10 pl 0.5 M KCI was added to the wells and the imaging was continued for a remaining 7 minutes.
[0308] Data analysis was done using standard methods. In short, time series were exported from screenworks FLIPR (Molecular Devices) and normalized to the baseline with pandas software. Plotting was done using seaborn and matplotlib.
[0309] Results and conclusions
[0310] Performing calcium imaging at 16 weeks of differentiation revealed a suppressing effect of culturing in high glucose conditions on the amplitude of evoked Ca2+spikes across organoids generated from three different cell lines (Fig. 12A, 12B and 12C). The effect of the high glucose concentration is clearly shown in Fig. 13 and in Table 3, wherein for each cell line a suppression is visible in the amplitude of the evoked Ca2+spikes under high glucose conditions with an average decrease of 27.3%.
[0311] Cell line BZmedia HighGlucose % decrease 314 602 498 17 441 884 672 23
[0312]
[0313] 520 314 188 40 Table 3. Amplitude of KCI-evoked Ca2+spikes for organoids generated from three different cell lines (314, 441 and 520) cultured in low glucose (BZmedia) or high glucose (HighGlucose).
[0314] This suppressing effect on the amplitude of Ca2+spikes also occurred when the effect of Celecoxib was evaluated, notably, at each tested Celecoxib concentration (Fig. 14). These data further support that culturing cerebral organoids in media which comprises glucose at high concentrations alters the physiological responsiveness of the organoids. Thereby, assay results in e.g. HTS methods may lead to faulty interpretations when such organoids are used for compound testing. In conclusion, the present inventors demonstrate that high glucose concentration in standard cerebral organoid media has a clear increasing effect on mitochondrial activity, such as mitochondrial membrane potential. Furthermore, culturing cerebral organoids in high glucose media shows a repressive effect on the amplitude of KCI evoked Ca2+spikes. Notably, these effects are maintained in the functional response of the organoids to drug treatment.
[0315] Example 7
[0316] The effect of glucose concentration on the development of cerebral organoids -size and shape of the organoids
[0317] The inventors have evaluated the effect of glucose concentration used during the generation of cerebral organoids on the size and shape of the obtained cerebral organoids. The organoids were generated as described in Example 1 but in one experimental group the glucose concentration in Media 2, 3 and 4 was set to 17.5 mM ("high" glucose) instead of 5.5 mM ("low" glucose). Materials and Methods
[0318] Cerebral organoids in a HTS format were generated from CW60520FF1 cells (also referred to herein as "520" cells, Fujifilm Cellular Dynamics) seeded at 2500 cell / well density and cultured according to the method described in Example 1 until day 30. After 4 days in culture, i.e. at the start of neural induction, the organoids were grown using either BZmedia (comprising glucose at a concentration of 5.5 mM; "low" glucose) or HighGlucose media (comprising glucose at a concentration of 17.5 mM; "high" glucose). The same supplements and timepoints were used for each condition except that the base media was either DMEM / F12 (ThermoFisher;
[0319] #10828010), DMEM / F12 (ThermoFisher; #10828010) mixed 50 / 50 with Neuralbasal media (ThermoFisher #21103049; for medium 4), or BZmedia "low" glucose (DEMEM / F12 (ThermoFisher, #11880036). The size of the organoids was measured in pixels using the Operetta (Revity) at Day 2, 6, 10, 13, 20 and 30 in culture. The size was measured using regular thresholding of brightfield images using Python and plotting using seaborn and Matplotlib. Statistical analysis was done using Mann-Whitney U Test with Bonferroni post hoc.
[0320] Results and conclusions
[0321] The results are shown in Fig. 15 as measured area in pixels. Up to day 4 in culture the same media were used in both experimental groups, and accordingly, no differences were observed in the size of the organoids at day 2. For both conditions, it was observed that the organoids grow steadily over time. Results are shown in the Table 4 below:
[0322] Day Treatm. Treatm. N1 N2 p-value p-value Significant 1 2 corrected after Bonferroni 6 BZ High 383 381 1.625769e- 8.128845e- True Glucose 85 85
[0323] 10 BZ High 381 363 1.630496e- 8.152479e- True Glucose 56 56
[0324] 13 BZ High 345 368 1.484295e- 7.421473e- True Glucose 100 100
[0325]
[0326] 20 BZ High 353 357 6.604591e- 3.302296e- True Glucose 108 107
[0327] 30 BZ High 318 377 5.567184e- 2.783592e- True Glucose 49 48
[0328]
[0329] Table 4 shows the results from analysis of organoids grow in HighGlucose conditions and organoids grown in low glucose conditions (BZ). N1 and N2 represent the number of organoids subjected to Treatment 1 (BZ) and Treatment 2 (HighGlucose). p-value corrected was calculated using Mann-Whitney U Test with Bonferroni adjustment.
[0330] From day 6 to day 13 the organoids grown in high glucose conditions (HighGlucose) were significantly larger compared to the organoids grown in low glucose conditions (BZ). After day 13, i.e. after that the emergence of pseudostratified epithelium became obvious (Fig. 1), a switch could be observed in the growth dynamics between the organoids of the two conditions. In particular, organoids that were grown in low glucose conditions (BZ) were significantly larger compared to the organoids grown in high glucose conditions (HighGlucose) at day 20 and day 30. The data presented in this Example indicate that non-physiological glucose concentrations used from the start of neural induction during the generation of cerebral organoids significantly affect development dynamics of the organoids, such as the size and shape of the organoids during various developmental stages. In view of these results, the inventors consider that employing glucose concentrations (that resemble physiological conditions) according to the hereby disclosed methods, is beneficial for obtaining reliable (as well as physiologically relevant) cerebral organoids. Consequently, reliable and physiologically relevant assay results can be expected using these organoids fortesting resistance and responsiveness upon exposure of the organoids to molecules, such as drugs, e.g. in a high-throughput format.
[0331] Example 8
[0332] The effect of glucose concentration on the development of cerebral organoids -further evaluation The effect of glucose concentration during the generation of cerebral organoids can be further evaluated using comparative experiments. Accordingly, the organoids will be generated as described in Example 1 but in one experimental group the glucose concentration in Media 2, 3 and 4 will be set to 17.5 mM ("high" glucose) instead of 5.5 mM ("low" glucose). The effect of this difference will be assessed using functional assays and / or by studying structural characteristics of the obtained organoids, for example, by the above describe methods.
[0333] The inventors envision, esp. based on the results described in Examples 5, 6 and 7, that these comparative experiments will support the surprising finding of the inventors that the herein disclosed culturing conditions, which utilize physiologically relevant glucose concentrations, are particularly beneficial for obtaining and maintaining cerebral organoids with desired structural and functional properties for pre-clinical and clinical applications. The inventors consider that physiologically relevant glucose concentrations of the present methods advantageously contribute to obtaining cerebral organoids that are particularly reliable in vitro HTS models for predicting drug safety, toxicity and responsiveness in vivo in humans.
[0334] Example 9
[0335] Enhancing the capabilities of the screening system with immunological responses The inventors have found that cerebral organoids of the present disclosure may be advantageously co-cultured with microglial cells. Such co-culture is hereby shown to improve further the representation of various cell types, which are typical to the human brain, in the cerebral organoids of the present disclosure. The inclusion of immunological cells into the culture is beneficial in enhancing screening capabilities.
[0336] Materials and Methods
[0337] Organoids were generated from CW60520FF1 cells ("520", Fujifilm Cellular Dynamics) seeded at 2500 cell / wel I density and cultured according to the method described in Example 1 until day 100. Separately from the organoids, microglial cells (BitBio) were also cultured and matured according to the manufacturer's instructions for 10 days. At day 100 of organoid differentiation and day 10 of microglia culture, the microglia were added to the organoids for co-culturing. Before addition to the organoids, the microglial cells in suspension were incubated with Vybrant™ DiO Cell-Labeling Solution (Thermofisher) according to the manufacturer's instructions for 20 min at 37°C 5 % CO2. After labelling, the cells were diluted in Medium 4 (supplemented with IL-34 and GM-CSF, according to BitBio specifications for general microglia culture), added to the organoids at a density of 2000 cells / well and co-cultured for 15 days. On day 114, the co-cultures were incubated with 100 nM TMRM for 2 days for viability assessment, as described in Example 3. Images were captured on the PICO microscope (Molecular devices).
[0338] Results and conclusions
[0339] Viable organoid-microglia co-cultures according to the present disclosure have been successfully obtained (Fig. 16A), wherein microglia are positive for both TMRM and Vybrant DiO. The co-cultured microglia became integrated part of the organoids, thereby contributing to the complexity of the cell types thereof. Such microgliaorganoid co-cultures may be particularly useful in applications, wherein assessment of immunological responses and parameters are required, e.g. in HTS of drug molecules relevant for immunological disorders. Responsiveness of the co-culture is demonstrated in BzCI-treated co-cultures in Fig. 16B, wherein staining for both TMRM and Vybrant DiO is lost, indicating cell death of microglia and other cell types of the organoid, e.g. as listed in Example 4 above.
[0340] Example 10
[0341] The effect of glucose concentration on oxidative stress response in cerebral organoids
[0342] In this example, fluorescent staining assays were carried out to study generation of reactive oxygen species (ROS) and changes mitochondrial membrane potential upon oxidative stress stimulus in cerebral organoids cultured under low glucose conditions, provided by BrainZell medium, and in cerebral organoids cultured under conventional high glucose conditions. The results demonstrate that physiologically relevant oxidative stress response in organoids is facilitated under low glucose conditions, thus providing an improved model of neural oxidative stress response dynamics, particularly under conditions of elevated stressors. Material and methods
[0343] Cerebral organoids were generated from 520 iPSC cell line (CW60520FF1; Fujifilm Cellular Dynamics) in a HTS format and cultured as previously described in Examples 1 to 4 until day 37. After day 37, cultured organoids were grown using either BZmedia (comprising glucose at a concentration of 5.5 mM; "low" glucose) or HighGlucose media (comprising glucose at a concentration of 17.5 mM; "high" glucose), as previously described, until the day of the experiment.
[0344] To induce the generation of reactive oxygen species (ROS), which are mediators of oxidative stress, organoids were treated with increasing concentrations of the ROS-inducing compound menadione (0.1 pM - 100 pM) for 24 hours.
[0345] Organoids were simultaneously incubated with Invitrogen™ CellROX™ Green Reagent (Thermo Fisher Scientific), a fluorescent dye used to detect ROS in live cell. When in reduced form, the reagent exhibits no or very low fluorescence. Upon oxidation by ROS, the reagent exhibits strong fluorescence, which remains localized within the cell.
[0346] Organoids were also co-incubated with 200 nM tetramethylrhodamine methyl ester (TMRM; Thermo Fisher Scientific), a cell-permeant dye used to assess mitochondrial membrane potential under oxidative stress conditions. TMRM accumulates in active, healthy mitochondria with intact membranes and its fluorescence intensity is proportional to the membrane potential, making it useful for assessing mitochondrial function.
[0347] Following the 24-hour incubation, organoids were imaged using the Operetta high-content imaging system (PerkinElmer) under controlled conditions (37 °C, 5% CO2). ROS-associated fluorescence was measured in the FITC channel, and mitochondrial membrane potential was measured in the TRITC channel. Intensities of ROS-associated fluorescence and TMRM fluorescence per organoid were quantified as measures of oxidative stress and mitochondrial function, respectively.
[0348] All imaging data were processed and analyzed using an in-house analysis pipeline. Images were segmented and CellROX™ and TMRM fluorescence intensities per organoid were quantified. Statistical analysis following the quantification was performed using Mann-Whitney U statistical test. Results and conclusions
[0349] Results of ROS generation (Fig. 17A) and mitochondrial membrane potential assay (Fig. 17B) following 24-hour incubation in oxidative stress conditions revealed significant differences between the cerebral organoids grown in different media at moderately high concentrations of menadione.
[0350] At low concentration (0.1 pM) of menadione, organoids maintained in BZ medium exhibited moderately higher ROS-associated responses than those in HighGlucose medium (p = 0.0262).
[0351] The difference observed at 10 pM concentration of menadione became highly significant (p = 0.0009) indicating that organoids in BZ medium showed heightened responsiveness to ROS induction at both moderate and high stress levels.
[0352] At 100 pM concentration of menadione, organoids grown in BZ media also exhibited higher ROS activity (p=0.024), although the difference between low and high glucose conditions was smaller than the difference observed at 10 pM concentration of menadione.
[0353] The decrease in ROS-associated fluorescence intensity observed upon exposure to the highest menadione concentration (100 pM) is likely attributed to cell toxicity induced by high menadione concentrations and the corresponding decrease in cell viability, as confirmed by reduced TMRM intensities observed in Fig. 17B.
[0354] Results of TMRM mitochondrial membrane potential assay were consistent with the results of ROS-associated fluorescence. TMRM fluorescent signal was increased in organoids with increasing menadione concentrations under both culturing conditions, which indicates enhanced mitochondrial activity under oxidative stress (Fig. 17B). Loss of fluorescent signal was observed in both culture conditions upon exposure to high menadione concentrations (100 pM), indicating a loss of membrane potential associated with mitochondrial dysfunction and cell death. The consistency observed between the results of two different assays suggests that the effect of the organoid culture medium, specifically the effect of glucose concentration, impacts the upstream mechanisms of the oxidative stress response, wherein organoids cultured in BZ medium generate robust and physiologically relevant levels of ROS upon stimuli. Cerebral organoids maintained in BZ medium more closely resembled a native human neural tissue environment, which is highly susceptible to oxidative stress and permissive of stress-induced signaling. In contrast, organoids cultured under high-glucose conditions exhibited artificially suppressed ROS generation across the concentration range, indicating that elevated glucose levels blunt the cellular stress response. Concentrations of menadione used in this experiment are considered relevant in the state of the art to mimic the effect of various stressors of nervous system and study oxidative stress response dynamics. The above results demonstrate that low-glucose BZ medium allows for evaluating physiologically relevant stress-induced signaling and ROS generation in cerebral organoids of the present disclosure, thereby enabling physiologically relevant assay results when using these organoids in measurements assessing stress response. On the contrary, ROS generation has been proven to be suppressed when high glucose concentration is provided in the culture medium, thereby masking stress-induced signaling and consequently, assay results when using organoids cultured under high glucose conditions.
[0355] Example 11
[0356] Assessment of neuronal network activity in cerebral organoids cultured under low or high glucose conditions
[0357] The present inventors herein demonstrate that metabolic composition of the culture media according to the present invention advantageously influences not only cellular physiology and gene expression but also the functional properties of neuronal networks in the cerebral organoids. Electrical activity is a key indicator of neuronal maturation, synaptic connectivity, and functional responsiveness in cerebral organoids. In this example, neuronal network activity was compared between cerebral organoids cultured (generated and maintained) either in BZ media (as described in Example 1) or in media comprising high-glucose. Using Cytotronics high-density complementary metal-oxide-semiconductor microelectrode arrays (CMOS-MEA) measurements, firing rate, inter-spike interval, mean spike amplitude and total spike count per active electrode were evaluated.
[0358] Materials and methods
[0359] One set of cerebral organoids (n=24) were generated and maintained as described in Example 1 using BrainZell media ("BZ"), wherein low glucose concentrations were used from day 4 in the culture media (5.5 mM). For comparison, another set of cerebral organoids (n=24) was also generated and maintained using the same protocol but importantly, under high-glucose concentrations throughout culturing, i.e. using media comprising glucose at 17.5 mM concentration (referred to herein as "High" or "HighGlucose"). For the avoidance of doubt, this means that high glucose concentrations were used in Media 2-4 (as referred to in Example 1) in this set of organoids. After culturing for 57 days, organoids in their respective media were transferred onto laminin-coated Cytotronics high-density complementary metal-oxide-semiconductor microelectrode arrays (CMOS-MEA) for functional measurements. Neuronal activity was continuously recorded for over one week, while organoids continued to be maintained in their respective media. Recordings were performed four times per day in duration of 8 seconds per each recording. Signals were considered positive in the events of more than 0.2 spikes per second, wherein the observed height of the peak corresponded to at least 5.5 times the standard deviation. Neural activity was quantified by measuring a number of parameters, including firing rate, inter-spike interval (isi, s), mean spike amplitude (pV) and total spike count per active electrode. To reduce any variability potentially introduced by culture media changes, data were grouped to include datapoints obtained by consecutive measurements during a seven-day period for each organoid, wherein half of the media was replaced every 2-3 days. Aggregated data obtained for each organoid during the first seven days (58-64 days in culture) is shown in Fig. 18. Out of 24 organoids, 13 showed activity for BZ media and 9 showed activity for HighGlucose media. Active organoids were analyzed.
[0360] Results and conclusions
[0361] CMOS-MEA results (Table 5 and Fig. 18) demonstrate stronger neuronal activity of organoids cultured in BZ media compared to organoids cultured in high-glucose media. The differences were consistent across multiple functional parameters accessed by the measurements. MEAN Difference
[0362] P (sign) % High BZ High - BZ
[0363] normalized spikes 4.58 10.73 -6.15 0.00441 134% isi 1.69 1.10 0.59 0.00012 -35% mean_spike_amplitude 56.08 63.60 -7.52 0.00125 13%
[0364]
[0365] firing_rate 0.57 1.36 -0.79 0.00463 139% Table 5 shows CMOS-MEA results presented in Fig. 18.
[0366] Specifically, the firing rate (Fig. 18A) measured in organoids cultured in BZ media (light gray) was significantly higher (p = 0.00463) than the firing rate measured in organoids cultured in high-glucose media (dark gray), indicating higher frequency of neuronal action potentials and enhanced network excitability of cerebral organoids according to the present invention. The inter-spike interval (Fig. 18C) observed for organoids cultured in BZ media was significantly shorter (p = 0.00012) than the interspike interval observed for organoids cultured in high-glucose media, which is indicative of a more regular and synchronous neuronal firing in cerebral organoids that are generated and maintained under low glucose conditions. Mean spike amplitude (Fig. 18B) measured for organoids cultured in BZ media was significantly higher (p = 0.00125), which corresponds to the generation of stronger action potentials and robust synaptic signaling. Total spike count (normalized to the number of active electrodes) was significantly higher for organoids cultured in BZ media (p = 0.00441), which suggests a more frequent neural activity registered on individual electrodes for organoids cultured in BZ media compared to organoids cultured in high-glucose media. Representative spike traces shown in Fig. 18E-F further illustrate these differences. More frequent, high-amplitude spiking with regular firing patterns, typically characteristic of active and well-connected neuronal networks, was observed in organoids cultured in BZ media (Fig. 18F), whereas less frequent, low-amplitude spiking and irregularity in firing pattern, consistent with reduced excitability and weaker synaptic activity, was observed in organoids cultured in high-glucose medium (Fig. 18E).
[0367] Together, the results demonstrate the advantageous effects of BZ media on neural activity of cerebral organoids, wherein cerebral organoids cultured (generated and maintained) in BZ media exhibited higher firing rates, shorter I Sis, larger spike amplitudes and higher normalized spike output. These altogether suggest that more mature and more active neuronal networks have been developed in cerebral organoids cultured in BZ media compared to the cerebral organoids cultured in high-glucose media. These results highlight the advantageous role of optimal metabolic environment achieved by the herein disclosed methods in neural network dynamics and functional maturation.
[0368] Example 12
[0369] The effect of glucose concentration on transcription-mediated regulation of neural differentiation in cerebral organoids
[0370] The metabolic environment affects neural development, influencing both lineage specification and functional maturation of cerebral organoids. Gene expression patterns provide a sensitive readout of these processes, reflecting the balance between progenitor maintenance and neuronal differentiation. The present inventors herein demonstrate the effect of variations in glucose concentration and overall metabolic composition in developmental trajectories of cerebral organoids (via modulating transcriptional programs that regulate neuronal differentiation and likely, synaptic maturation). In this example, the advantageous effect of the BZ culture media on neural development of cerebral organoids is shown by qPCR analysis of the expression of genes associated with neuronal differentiation (DCX, TBR1, FOXG1), progenitor maintenance (NES, referred to herein as NESTIN), glial cells (GFAP) and neuronal activity (FOS) in cerebral organoids at different developmental stages.
[0371] Materials and methods
[0372] Cerebral organoids were generated from 520 iPSC cell line (CW60520FF1; Fujifilm Cellular Dynamics) in a HTS format and cultured as described in Example 11: one set of organoids was generated and maintained as described in Example 1, using BZ media (BZ), and another set of organoids was generated and maintained in high-glucose media (High) for comparison.
[0373] To carry out gene expression analysis, organoids were harvested from the culture at different developmental stages. RNA was extracted from the harvested organoids and reverse-transcribed into cDNA for the following quantitative polymerase chain reaction (qPCR). qPCR reaction mixture was prepared according to standard protocols. qPCR program was carried out according to standard protocols using standard primers suitable for amplification of the below listed target and "housekeeping" genes. Primer pairs used in the qPCR reaction are listed in Table 6.
[0374] SEQ ID NO Gene Sequence (5'->3') Forward / Reverse
[0375] 1 CATGTACGTTGCTATCCAGGC Forward primer ACTB
[0376] 2 CTCCTTAATGTCACGCACGAT Reverse primer
[0377] 3 G CC ATCGTGG CTAAACAG GTA Forward primer RPL13A
[0378] 4 GTTG GTGTTC ATCCG CTTG C Reverse primer
[0379] 5 TCCCGGATGAATGGGTTGC Forward primer DCX
[0380] 6 GCGTACACAATCCCCTTGAAGTA Reverse primer
[0381] 7 CCGGGGATAGCCTCTCTTACT Forward primer
[0382] FOS
[0383] 8 CCAG GTCCGTG CAG AAGTC Reverse primer
[0384] 9 CTG CG G CTCG ATC A ACTC A Forward primer GFAP
[0385] 10 TCCAGCGACTCAATCTTCCTC Reverse primer
[0386] 11 CTGCTACCCTTGAGACACCTG Forward primer NES
[0387] 12 G G G CTCTG ATCTCTG C ATCT AC Reverse primer
[0388] 13 G CAG CAG CTACCC AC ATTC A Forward primer TBR1
[0389] 14 AGGTTGTCAGTGGTCGAGATA Reverse primer
[0390] 15 CGTTCAGCTACAACGCGCTCAT Forward primer
[0391] FOXG1
[0392]
[0393] 16 CAGATTGTGGCGGATGGAGTTC Reverse primer Table 6 shows primer pairs used in the qPCR reaction.
[0394] Genes targeted in the qPCR expression analysis included DCX, TBR1, FOXG1, NESTIN, GFAP, and FOS, wherein DCX, TBR1 and FOXG1 are genes associated with neuronal differentiation, NESTIN is a marker of neural stem cells, GFAP is a marker of astrocytes, and FOS is a transcription factor mediating neural response to stimuli like neurotransmitters, stress, or drugs, thus being one of the key markers of neuronal activity. ACTB and RPL were used as "housekeeping" genes.
[0395] Expression values were calculated by the "AACtmethod", which consists of calculating the difference in the cycle threshold values (ACt) between a target gene and a "housekeeping" gene for each sample, followed by calculating the difference between the ACt of the experimental sample and the ACtof a control sample (AACt). Cycle threshold (Ct) values were batch-aligned across experimental runs using a cross-batch correction procedure, applying a fixed control sample as the normalization sample. Thus, the fold change in gene expression was calculated as 2~ AAQre|atjveto the control sample obtained from BZ media culture on Day 23. Statistical analysis was performed for each analyzed gene for each sample using Welch's t-test or Mann-Whitney U test, depending on the sample distribution. Benjamini-Hochberg correction was applied for multiple comparisons. Data were visualized as fold-change (2-AACt) plots for genes expressed in cerebral organoids obtained on Day 23, 44, 51 and 58.
[0396] Results and conclusions
[0397] qPCR analysis of target gene expression in cerebral organoids obtained on Day 23, 44, 51 and 58 revealed different transcriptional profiles between cerebral organoids cultured in BZ media (light gray) and cerebral organoids cultured in high-glucose medium (dark gray, Figure 19A-F). Differences in ACtvalues observed for FOS expression (Fig. 19B) at Day 58 (q = 0.0191) and NESTIN expression (Fig. 19E) at Day 51 (q = 0.0108) when expressed in organoids grown in two different media conditions, were deemed significant upon multiple-testing correction (q < 0.05). A gradual decrease in the expression levels of DCX (Fig. 19A) and NESTIN (Fig. 19E) supports the maturation of the organoids over time, whereas FOXG1 (Fig. 19C) expression confirms the forebrain identity of neurons generated. Increased expression levels of FOS (Fig. 19B) suggest improved neuronal activity in organoids according to the present invention in comparison to organoids cultured in high glucose. Significantly higher expression levels of FOS, a neuronal marker of neuronal activity, in organoids of the present invention (in comparison with organoids cultured in high glucose) at Day 58 (Fig. 19B) suggests that the methods according to the present invention facilitate obtaining cerebral organoids that comprise neurons with mature neuronal identity. Moreover, as shown in Fig. 18D, appearance of the astrocyte marker, GFAP, further supports generation of functional cerebral organoids according to herein disclosed methods that are suitable to mimic physiological conditions of the human brain. The results also indicate that GFAP expression in organoids of the present invention is induced earlier in comparison with organoids cultured in high glucose.
[0398] In conclusion, the present inventors in this Example demonstrate how variations in glucose concentration and overall metabolic composition influence not solely physiological and electrophysiological properties (as shown in Example 11) but also transcriptional regulation during cerebral organoid development and neuronal function. The inventors have shown advantageous effects of the methods according to present invention using comparative experiments between low and high glucose conditions, which support the surprising finding of the inventors that physiologically relevant glucose concentrations are particularly beneficial for obtaining and maintaining cerebral organoids with desired structural and functional properties for pre-clinical and clinical applications. The data support that physiologically relevant glucose concentrations of the present methods advantageously contribute to obtaining cerebral organoids that are particularly reliable in vitro HTS models for predicting drug safety, toxicity and responsiveness in vivo in humans.
[0399] References
[0400] Gritti N, Lim JL, Anla§ K, et al. mOrgAna: accessible quantitative analysis of organoids with machine learning. Dev Camb Engl. 2021;148(18):devl99611. doi:10.1242 / dev.199611
[0401] Kanton S, Treutlein B, Camp JG. Chapter 10 - Single-cell genomic analysis of human cerebral organoids. In: Spence JR, ed. Methods in Cell Biology. Vol 159. Human Pluripotent Stem Cell Derived Organoid Models. Academic Press; 2020:229-256. doi:10.1016 / bs.mcb.2020.03.013
[0402] Butler A, Hoffman P, Smibert P, Papalexi E, Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat Biotechnol. 2018;36(5):411-420. doi:10.1038 / nbt.4096
[0403] Rousseeuw PJ. Silhouettes: A graphical aid to the interpretation and validation of cluster analysis. J Comput Appl Math. 1987;20:53-65. doi:10.1016 / 0377-0427(87)90125-7
[0404] Lengyel A, Botta-Dukat Z. Silhouette width using generalized mean— A flexible method for assessing clustering efficiency. Ecol Evol. 2019;9(23):13231-13243. doi:10.1002 / ece3.5774
[0405] Lancaster MA, Renner M, Martin CA, et al. Cerebral organoids model human brain development and microcephaly. Nature. 2013;501(7467):373-379. doi:10.1038 / naturel2517
[0406] Bhaduri A, Andrews MG, Mancia Leon W, etal. Cell stress in cortical organoids impairs molecular subtype specification. Nature. 2020;578(7793):142-148. doi:10.1038 / s41586-020-1962-0 Tigchelaar C, Zuylen ML van, Hulst AH, et al. Elevated cerebrospinal fluid glucose levels and diabetes mellitus are associated with activation of the neurotoxic polyol pathway. Diabetologia. 2022;65(7):1098. doi:10.1007 / s00125-022-05693-7 Irani, David N. Cerebrospinal fluid in clinical practice. Elsevier Health Sciences, 2008. Kavanagh K, Day SM, Pait MC, et al. Type-2-Diabetes Alters CSF but Not Plasma Metabolomic and AD Risk Profiles in Vervet Monkeys. Front Neurosci. 2019;13. do i:10.3389 / fnins.2019.00843
[0407] Velasco S, Kedaigle AJ, Simmons SK, et al. Individual brain organoids reproducibly form cell diversity of the human cerebral cortex. Nature. 2019;570(7762):523-527. doi:10.1038 / s41586-019-1289-x
[0408] Chuang HC, Kardosh A, Gaffney KJ, Petasis NA, Schonthal AH. COX-2 inhibition is neither necessary nor sufficient for celecoxib to suppress tumor cell proliferation and focus formation in vitro. Mol Cancer. 2008;7(l):38. doi:10.1186 / 1476-4598-7-38
[0409] ITEMIZED LIST OF EMBODIMENTS
[0410] 1. An in vitro method for obtaining at least one cerebral organoid, comprising the steps a) and b),
[0411] wherein step a) comprises:
[0412] providing a population of pluripotent stem cells;
[0413] culturing said population of pluripotent stem cells in conditions permissive of formation of at least one embryonic body in a first cell culture medium; thereby obtaining at least one embryonic body;
[0414] and wherein step b) comprises:
[0415] providing said at least one embryonic body, such as the at least one embryonic body obtained in step a);
[0416] culturing said at least one embryonic body in conditions permissive of differentiation into at least one cerebral organoid comprising neuroepithelium, wherein said culturing is performed in a second cell culture medium comprising glucose in a concentration range from approximately 1.5 mM to approximately 10 mM, such as from approximately 2.0 mM to approximately 6.0 mM; thereby obtaining at least one cerebral organoid comprising neuroepithelium.
[0417] 2. In vitro method for obtaining at least one cerebral organoid according to item 1, wherein said at least one cerebral organoid obtained in step b) is characterized by the presence of at least one ventricular niche.
[0418] 3. In vitro method for obtaining at least one cerebral organoid according to item 1 or 2, wherein said pluripotent stem cell population is an induced pluripotent stem cell (IPSC) population, such as a human IPSC population.
[0419] 4. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-3, wherein said IPSC population is an IPSC cell line, such as wherein said IPSC population is selected from the group consisting of cell lines CW60314EE1, CW60441EE1 and CW60520FF1.
[0420] 5. In vitro method for obtaining at least one cerebral organoid according to item 1 or 2, wherein said pluripotent stem cell population is an embryonic stem cell (ESC) population, such as a human ESC population.
[0421] 6. In vitro method for obtaining at least one cerebral organoid according to any one of items 1, 2 and 5, wherein said ESC population is selected from the group consisting of HS980 cells, Hl cells and H9 cells.
[0422] 7. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-6, wherein said step a) comprises seeding from approximately 2000 to approximately 3000 pluripotent cells, such as from approximately 2200 to approximately 2800 pluripotent cells, from approximately 2400 to approximately 2600 pluripotent cells, such as approximately 2500 pluripotent cells, per culture well.
[0423] 8. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-7, wherein said second cell culture medium comprises glucose in a concentration range from approximately 2.0 mM to approximately 10.0 mM, approximately 2.0 mM to approximately 8.0 mM, approximately 2.0 mM to approximately 7.0 mM, approximately 2.0 mM to approximately 6.0 mM, such as approximately 2.0 mM to approximately 5.5 mM, such as approximately 2.0 mM to approximately 5.0 mM, such as approximately 2.0 mM to approximately 4.5 mM, such as approximately 2.0 mM to approximately 4.0 mM, such as approximately 2.0 mM to approximately 3.5 mM, such as approximately 2.25 mM to approximately 3.25 mM, such as approximately 2.5 mM to approximately 3.0 mM, such as approximately 2.75 mM.
[0424] 9. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-8, wherein said second cell culture medium comprises glucose in a concentration of at most approximately 10.0 mM, such as at most approximately 8.0 mM, such as at most approximately 7.0 mM, such as at most approximately 6.0 mM, such as at most approximately 5.5 mM, such as at most approximately 5.0 mM. 10. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-9, wherein said second cell culture medium comprises an inhibitor of the transforming growth factor-beta (TGF-|3) signaling pathway.
[0425] 11. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-10, wherein said second cell culture medium comprises an inhibitor of the Wnt signaling pathway.
[0426] 12. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-11, wherein said second cell culture medium comprises an inhibitor of the transforming growth factor-beta (TGF-|3) signaling pathway and an inhibitor of the Wnt signaling pathway.
[0427] 13. In vitro method for obtaining at least one cerebral organoid according to any one of items 10 and 12, wherein said inhibitor of the TGF- signaling pathway is selected from the group consisting of vactosertib, LY2157299, SD-208, RepSox, A-83-01, TGF- -directed monoclonal antibodies, ligand trap inhibitors, luspatercept, antisense oligonucleotides and SB431542 ; such as selected from the group consisting of vactosertib, LY2157299 (Galunisertib), SD-208, RepSox, A-83-01 and SB431542. 14. In vitro method for obtaining at least one cerebral organoid according to any one of items 10, 12-13, wherein said inhibitor of the TGF- signaling pathway is SB431542.
[0428] 15. In vitro method for obtaining at least one cerebral organoid according to any one of items 13-14, wherein said SB431542 is present in said second cell culture medium in a concentration range from approximately 2.5 pM to approximately 7.5 pM, such as approximately 3 pM to approximately 7 pM, such as approximately 3.5 pM to approximately 6.5 pM, such as approximately 4 pM to approximately 6 pM, such as approximately 4.5 pM to approximately 5.5 pM, such as approximately 5 pM. 16. In vitro method for obtaining at least one cerebral organoid according to any one of items 13-15, wherein said SB431542 is present in said second cell culture medium in the concentration of at most approximately 7.5 pM, such as at most approximately 7.0 pM, such as at most approximately 6.5 pM such as at most approximately 6.0 pM, such as at most approximately 5.5 pM, such as at most approximately 5.0 pM.
[0429] 17. In vitro method for obtaining at least one cerebral organoid according to any one of items 13-16, wherein said SB431542 is present in said second cell culture medium in the concentration of at least approximately 2.5 pM, such as at least approximately 3.0 pM, such as at least approximately 3.5 pM such as at least approximately 4.0 pM, such as at least approximately 4.5 pM, such as at least approximately 5.0 pM.
[0430] 18. In vitro method for obtaining at least one cerebral organoid according to any one of items 11 and 12, wherein said inhibitor of the Wnt signaling pathway is selected from the group consisting of IWP-1, IWP-L6, IWR-1, Wnt-directed monoclonal antibodies , ligand trap inhibitors and IWP-2, such as selected from the group consisting of IWP-1, IWP-L6, IWR-1 and IWP-2.
[0431] 19. In vitro method for obtaining at least one cerebral organoid according to any one of items 11-12 and 18, wherein said inhibitor of the Wnt signaling pathway is IWP-2.
[0432] 20. In vitro method for obtaining at least one cerebral organoid according to any one of items 18-19, wherein said IWP-2 is present in said second cell culture medium in a concentration range from approximately 2.5 pM to approximately 4.0 pM, such as approximately 2.9 pM to approximately 3.7 pM, such as approximately 3.0 pM to approximately 3.6 pM, such as approximately 3.1 pM to approximately 3.5 pM, such as approximately 3.2 pM to approximately 3.4 pM, such as approximately 3.3 pM.
[0433] 21. In vitro method for obtaining at least one cerebral organoid according to any one of items 18-20, wherein said IWP-2 is present in said second cell culture medium in the concentration of at most approximately 4.0 pM, such as at most approximately 3.7 pM, such as at most approximately 3.6 pM such as at most approximately 3.5 pM, such as at most approximately 3.4 pM, such as at most approximately 3.3 pM.
[0434] 22. In vitro method for obtaining at least one cerebral organoid according to any one of items 18-21, wherein said IWP-2 is present in said second cell culture medium in the concentration of at least approximately 2.5 pM, such as at least approximately 2.6 pM, such as at least approximately 2.7 pM, such as at least approximately 2.8 pM, such as at least approximately 2.9 pM, such as at least approximately 3.0 pM such as at least approximately 3.1 pM, such as at least approximately 3.2 pM, such as at least approximately 3.3 pM.
[0435] 23. In vitro method for obtaining at least one cerebral organoid according to any one of items 10-22, wherein said inhibitors are present in the second culture medium from during the whole culture time of step b).
[0436] 24. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-23, wherein said second cell culture medium comprises a basement membrane extract or comprises extra cellular matrix proteins, such as wherein extracellular matrix proteins selected from the group consisting of laminins, collagen, entactin and fragments thereof.
[0437] 25. In vitro method for obtaining at least one cerebral organoid according to item 24, wherein said basement membrane extract is present in the second cell culture medium at a concentration of from approximately 4% to approximately 12%, such as from approximately 4% to approximately 10%, such as from approximately 5% to approximately 10%, such as from approximately 5% to approximately 8%, such as from approximately 5% to approximately 7%, such as approximately 5%.
[0438] 26. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-25, wherein said first culture medium comprises basic fibroblast growth factor (bFGF) or an agonist thereof, such as wherein said first cell culture medium comprises bFGF.
[0439] 27. In vitro method for obtaining at least one cerebral organoid according to item 26, wherein said bFGF is present in the first cell culture medium at a concentration of at most 5 ng / ml, such as approximately at most 4.5 ng / ml, such as approximately at most 4 ng / ml.
[0440] 28. In vitro method for obtaining at least one cerebral organoid according to any one of items 26-27, wherein said bFGF is present in the first cell culture medium during a first phase of step a), such as is present in the first cell culture medium during approximately the first half of step a) culture time, at a concentration of at most 5 ng / ml, such as approximately at most 4.5 ng / ml, such as approximately at most 4 ng / ml.
[0441] 29. In vitro method for obtaining at least one cerebral organoid according to any one of items 26-28, wherein said bFGF is present in the first cell culture medium from approximately 0 hours to approximately 36-78 hours of culture, such as from 0 hours to approximately 36-72 hours of culture, such as from approximately 0 hours to approximately 36-66 hours of culture, such as from approximately 0 hours to approximately 36-60 hours of culture, such as from approximately 0 hours to approximately 40-56 hours of culture, such as from approximately 0 hours to approximately 42-54 hours of culture, such as from approximately 0 hours to approximately 44-52 hours of culture, such as from approximately 0 hours to approximately 46-50 hours of culture, such as from approximately 0 hours to approximately 48 hours of culture, at a concentration of at most 5 ng / ml, such as approximately at most 4.5 ng / ml, such as approximately at most 4 ng / ml.
[0442] 30. In vitro method for obtaining at least one cerebral organoid according to any one of items 26-29, wherein said bFGF is present in the first cell culture medium during a second phase of step a), such as is present in the first cell culture medium during approximately the second half of step a) culture time, at a concentration of at most approximately 3 ng / ml, such as at most approximately 2.5 ng / ml, such as at most approximately 2 ng / ml.
[0443] 31. In vitro method for obtaining at least one cerebral organoid according to any one of items 26-30, wherein said bFGF is present in the first cell culture medium from approximately 36-78 hours of culture, such as from approximately 36-72 hours of culture, such as from approximately 36-66 hours of culture, such as from approximately 36-60 hours of culture, such as from approximately 40-56 hours of culture, such as from approximately 42-54 hours of culture, such as from approximately 44-52 hours of culture, such as from approximately 46-50 hours of culture, such as from approximately 48 hours of culture, at a concentration of from approximately 1.5 ng / ml to approximately 2.5 ng / ml, such as approximately 2 ng / ml.
[0444] 32. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-31, wherein a ROCK inhibitor and / or ROCK antagonist is present in the first culture medium, such as in the first culture medium during the first phase of step a), such as in the first culture medium during approximately the first half of step a) culture time.
[0445] 33. In vitro method for obtaining at least one cerebral organoid according to item 32, wherein said ROCK inhibitor and / or ROCK antagonist is selected from the group consisting of Y27632, fasudil, Y-39983, RKI-1447, GSK429286A, H-1152, SLx-2119 and TC-S 7001, such as the group consisting of fasudil and Y27632, such as wherein said ROCK inhibitor and / or ROCK antagonist is Y27632.
[0446] 34. In vitro method for obtaining at least one cerebral organoid according to any one of items 32-33, wherein said ROCK inhibitor and / or ROCK antagonist, such as said Y27632, is present at a concentration of at most approximately 75 pM, such as at most approximately 50 pM.
[0447] 35. In vitro method for obtaining at least one cerebral organoid according to any one of items 32-34, wherein said ROCK inhibitor or ROCK antagonist is present in the first cell culture medium from approximately 0 hours to approximately 36-78 hours of culture, such as from approximately 0 hours to approximately 36-72 hours of culture, such as from approximately 0 hours to approximately 36-66 hours of culture, such as from approximately 0 hours to approximately 36-60 hours of culture, such as from approximately 0 hours to approximately 40-56 hours of culture, such as from approximately 0 hours to approximately 42-54 hours of culture, such as from approximately 0 hours to approximately 44-52 hours of culture, such as from approximately 0 hours to approximately 46-50 hours of culture, such as from approximately 0 hours to approximately 48 hours of culture.
[0448] 36. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-35, wherein the culture time in step a) in said first cell culture medium is from approximately 84 hours to approximately 168 hours, such as approximately 84 hours to approximately 156 hours, such as approximately 84 hours to approximately 144 hours, such as approximately 84 hours to approximately 132 hours, such as approximately 84 hours to approximately 120 hours, such as approximately 84 hours to approximately 108 hours, such as approximately 90 hours to approximately 102 hours, such as approximately 92 hours to approximately 100 hours, such as approximately 94 hours to approximately 98 hours, such as approximately 96 hours.
[0449] 37. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-36, wherein cerebral organoids in step b) are obtained after a culture time in said second cell culture medium of from approximately 6 to approximately 12 days, such as from approximately 7 to approximately 11 days, such as from approximately 7 to approximately 10 days, such as from approximately 8 to approximately 10 days, such as from approximately 8 to approximately 9 days or such as from approximately 9 to approximately 10 days, such as approximately 9 days.
[0450] 38. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-37, wherein said at least one cerebral organoid obtained in step b) is characterized the presence of radial glial cells or radial glial progenitor cells.
[0451] 39. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-38, wherein said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of RBF0X3, MAP2, TUBB3, DCX, SYN1, SNAP25, SYP, DLG4, VIM, NES, GLI3, S0X2, PROMI, HES1, TOP2A, MKI67, AURKB, SLC6A1, GAD1, GAD2, SLC32A1, SST, VIP, SLC1A2, SLC1A1, GLS, GRIA1, CAM2A and GRIN1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, SYP, DLG4, VIM, NES, S0X2, TOP2A, MKI67, SLC6A1, GAD1, GAD2, SLC32A1, GLS and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, SYP, NES, SOX2, GAD1, GAD2, SLC32A1, GLS and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, SNAP25, SOX2, GAD1, GAD2, SLC32A1 and GRIA1; such as the group consisting of MAP2, TUBB3, DCX, SOX2 and GAD1; or wherein said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of VIM, NES, Gli3, DCX, MAP2, TUBB3, SNAP25, SIX3, SLC6A1, GAD1, GAD2, SLC1A2, GLS and GRIA1
[0452] 40. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-39, wherein said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of VIM, NES, GLI3, SOX2, PROMI and HES1; such as the group consisting of VIM, NES, GLI3, SOX2 and PROMI; such as the group consisting of VIM, NES, GLI3 and SOX2; such as the group consisting of VIM, NES and Gli3 or the group consisting of VIM, NES and SOX2; such as the group consisting of VIM and NES or the group consisting of VIM and SOX2 or the group consisting of NES and SOX2.
[0453] 41. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-40, wherein said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of DCX, MAP2, TUBB3, SNAP25 and SIX3 or the group consisting of RBFOX3, MAP2, TUBB3, DCX, SYN1, SNAP25, SYP and DLG4; such as the group consisting of MAP2, TUBB3, DCX, SNAP25 and SYP; such as group consisting of MAP2, TUBB3, DCX and SNAP25; such as the group consisting of MAP2, TUBB3 and DCX.
[0454] 42. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-41, wherein said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of SLC6A1, GAD1, GAD2, SLC32A1, SST and VIP; such as the group consisting of SLC6A1, GAD1, GAD2, SLC32A1; such as the group consisting of GAD1, GAD2, SLC32A1 or such as the group consisting of SLC6A1, GAD1 and GAD2; such as the group consisting of GAD1 and GAD2.
[0455] 43. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-42, wherein said at least one cerebral organoid obtained in step b) is characterized by the expression of at least one marker selected from the group consisting of SLC1A1, SLC1A1, GLS, GRIA1, CAM2A and GRIN1; such as the group consisting of SLC1A2, GLS and GRIA1; such as the group consisting of SLC1A2 and GRIA1 or the group consisting of GLS and GRIA1 or the group consisting of SLC1A2 and GLS.
[0456] 44. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-43, wherein said first culture medium comprises DM EM / Fl 2, Knock-Out Serum Replacement (KOSR) and Non Essential Amino Acid Solution.
[0457] 45. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-44, wherein said second culture medium comprises DMEM / F12, N2 supplement, GlutaMAX supplement or glutamine, Heparin and Non Essential Amino Acid Solution.
[0458] 46. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-45, further comprising step c) of
[0459] providing at least one cerebral organoid obtained in step b);
[0460] culturing said at least one cerebral organoid in conditions permissive of differentiation into at least one matured cerebral organoid using a third cell culture medium,
[0461] thereby obtaining at least one matured cerebral organoid, characterized by the expression of at least one marker, such as a marker selected from the group consisting of EOMES, TBR1, DCX, MAP2, TUBB3, SNAP25, SIX3, SLC6A1, GAD1, GAD2, SLC1A2, GLS and GRIA1.
[0462] 47. In vitro method for obtaining at least one cerebral organoid according to item 46, wherein said at least one matured cerebral organoid is characterized by expression of at least one neuronal marker, such as a neuronal marker selected from the group consisting of TUBB3A and MAP2.
[0463] 48. In vitro method for obtaining at least one cerebral organoid according to any one of items 46-47, wherein said third culture medium does not comprise any retinoids or wherein said third culture medium comprises a retinoic acid inhibitor, or wherein said third culture medium does not comprise vitamin A or any of its derivatives, such as wherein said third culture medium does not comprise Vitamin A.
[0464] 49. In vitro method for obtaining at least one cerebral organoid according to any one of items 46-48, wherein said third culture medium comprises DM EM / Fl 2, N2 supplement, insulin, GlutaMAX supplement or glutamine, 2-Mercaptoethanol, B27 supplement without vitamin A and Non Essential Amino Acid Solution; such as DMEM / F12, N2 supplement, insulin, GlutaMAX supplement or glutamine, Penicillin / Streptomycin, 2-Mercaptoethanol, B27 supplement without vitamin A and Non Essential Amino Acid Solution.
[0465] 50. In vitro method for obtaining at least one cerebral organoid according to any one of items 46-49, wherein cerebral organoids in step c) are obtained after a culture time in said third cell culture medium of approximately from 7 to approximately 22 days, such as approximately from 9 to approximately 22 days, such as approximately from 12 to approximately 22 days, such as approximately from 13 to approximately 21 days, such as approximately from 14 to approximately 20 days, such as approximately from 15 to approximately 19 days, such as approximately from 16 to approximately 18 days, such as approximately 17 days.
[0466] 51. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-50, further comprising step d) of
[0467] providing at least one maturated cerebral organoid obtained in step c); culturing said at least one maturated cerebral organoid in conditions permissive of differentiation into functional cerebral organoid using a fourth cell culture medium, and thereby obtaining said functional cerebral organoid, characterized by ability to produce Ca2+oscillatory waves.
[0468] 52. In vitro method for obtaining at least one cerebral organoid according to item 51, wherein said functional cerebral organoids are further characterized by presence of GFAP expressing astrocytes.
[0469] 53. In vitro method for obtaining at least one cerebral organoid according to any one of items 51-52, wherein said functional cerebral organoids in step d) are obtained after a culture time in said fourth culture medium of at least approximately 30 days, such as at least approximately 35 days, such as at least approximately 40 days or longer.
[0470] 54. In vitro method for obtaining at least one cerebral organoid according to any one of items 51-53, wherein said functional cerebral organoids in step d) are further cultured in said fourth cell culture medium for at least 20 days, such as for at least 30 days, such as for at least 50 days, such as for at least 60 days, such as at least 90 days or longer.
[0471] 55. In vitro method for obtaining at least one cerebral organoid according to any one of items 51-54, wherein said fourth cell culture medium comprises DMEM / F12, N2 supplement, insulin, GlutaMAX supplement or glutamine, 2-Mercaptoethanol, B27 supplement with vitamin A and Non Essential Amino Acid Solution, such as DMEM / F12, N2 supplement, insulin, GlutaMAX supplement or glutamine, Penicillin / Streptomycin, 2-Mercaptoethanol, B27 supplement with vitamin A and Non Essential Amino Acid Solution.
[0472] 56. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-55, wherein culture is performed in at least one culture well having a well volume of approximately 10-200 pl, such as approximately 10-100 pl, such as approximately 20-90 pl, such as approximately 30-80 pl, such as approximately 40-70 pl, such as approximately 50-70 pl, such as approximately 60 pl.
[0473] 57. In vitro method for obtaining at least one cerebral organoid according to item 56, wherein said well has a rounded bottom and / or said wells has an ultralow attachment surface, such as wherein said well has a rounded bottom with ultralow attachment surface.
[0474] 58. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-57, wherein said method does not comprise culture in a hydrogel. 59. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-58, wherein culture is stationary culture.
[0475] 60. In vitro method for obtaining at least one cerebral organoid according to any one of items 1-58, wherein culture is culture under non-stationary conditions, such as shaking or stirring.
[0476] 61. An in vitro method of cultivation of at least one cerebral organoid, comprising obtaining at least one cerebral organoid according to the method as defined in any one of items 1-60, and further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of from approximately 2.0 mM to approximately 6.0 mM or further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of from approximately 1 mM to approximately 3 mM.
[0477] 62. An in vitro method of cultivation of at least one cerebral organoid, comprising obtaining at least one cerebral organoid according to the method as defined in any one of items 1-60, and further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of from approximately 7.0 mM to approximately 25.0 mM, such as from approximately 7.0 mM to approximately 20.0 mM, such as from approximately 10.0 mM to approximately 20.0 mM, such as from approximately 15.0 mM to approximately 20.0 mM, such as approximately 17.5 mM or further culturing said cerebral organoid in a culture medium comprising glucose in a concentration of at least approximately 17.5 mM.
[0478] 63. A cerebral organoid obtainable or obtained by the method as defined in any one of items 1-60.
[0479] 64. The cerebral organoid according to claim 63 or the cerebral organoid obtainable or obtained by the method as defined in any one of items 51-60, the cerebral organoid comprising the following cell types: stem cells, proliferating stem cells, gliogenic stem cells and neurons, such as GABAergic neurons and / or glutamatergic neurons.
[0480] 65. Cerebral organoid according to item 64 or the cerebral organoid obtainable or obtained by the method as defined in any one of items 51-60 according to any one of items 63-64, wherein characterized by the ability to produce Ca2+oscillatory waves. 66. Cerebral organoid according to item 64 or 65 or the cerebral organoid obtainable or obtained by the method as defined in any one of items 51-60 according to any one of items 63-65, wherein the cerebral organoid is characterized by a loss of viability with an EC50 value of from about 7.5 p.M to about 12.5 p.M, such as from about 8 pM to about 12 pM, such as from about 8.5 p.M to about 11.5 pM, such as from about 9 p.M to about 11 p.M, such as from about 9.5 p.M to about 10.5 p.M, such as about 10 p.M, when treated with Benzethonium Chloride (BzCI).
[0481] 67. Cerebral organoid according to any one of items 64-66 or the cerebral organoid obtainable or obtained by the method as defined in any one of items 51-60 according to any one of items 63-66, characterized by physiologically relevant mitochondrial activity, such as mitochondrial membrane potential.
[0482] 68. Cerebral organoid according to any one of items 64-67 or the cerebral organoid obtainable or obtained by the method as defined in any one of items 51-60 according to any one of items 63-67, characterized by lower mitochondrial activity compared to a corresponding cerebral organoid obtained using high glucose culture conditions in step b) or step b)-d), such as at least two times lower or at least three times lower mitochondrial activity compared to a cerebral organoid obtained in high glucose culture conditions in step b) or step b)-d).
[0483] 69. Cerebral organoid according to item 68 or the cerebral organoid obtainable or obtained by the method as defined in any one of items 51-60 according to items 68, wherein said mitochondrial activity is assessed by using a mitochondrial potential dye, such as TMRM.
[0484] 70. Cerebral organoid according to any one of items 64-69 or the cerebral organoid obtainable or obtained by the method as defined in any one of items 51-60 according to any one of items 63-69, characterized by having a neuronal activity as assessed by Ca2+imaging which is elevated by from approximately 15% to approximately 45%, such as from approximately 17% to approximately 40%, such as from approximately 20% to approximately 30%, such as approximately 25% to approximately 30%, such as about 27%, when compared to the neuronal activity in a corresponding cerebral organoid obtained using high glucose culture condition in step b) or step b)-d).
[0485] 71. A method for test substance screening comprising the steps of: providing at least one cerebral organoid as defined in any one of items 63-70 or obtaining at least one cerebral organoid by the method of any one of items 1-60 or obtaining at least one cerebral organoid by the method of any one of items 61-62
[0486] bringing said at least one cerebral organoid into contact with a candidate substance; and
[0487] determining the effect of said candidate compound on one or more cell types comprised in said at least one cerebral organoid.
[0488] 72. A method for test substance screening comprising the steps of:
[0489] providing at least one cerebral organoid as defined in any one of items 63-70 or obtaining at least one cerebral organoid by the method of any one of items 1-60 or obtaining at least one cerebral organoid by the method of any one of items 61-62;
[0490] bringing said at least one cerebral organoid into contact with a candidate substance; and
[0491] determining the response of said at least one cerebral organoid brought into contact with a candidate substance in comparison to the response of a control cerebral organoid that has not been in contact with said candidate compound.
[0492] 73. A method for assessing the efficacy of a test substance, such as drug substance, comprising the steps of:
[0493] providing at least one cerebral organoid as defined in any one of items 63-70 or obtaining at least one cerebral organoid by the method of any one of items 1-60 or obtaining at least one cerebral organoid by the method of any one of items 61-62;
[0494] bringing said at least one cerebral organoid into contact with said drug substance; and
[0495] examining the effect of the drug substance on said at least one cerebral organoid compared to the effect of a control compound.
[0496] 74. A method for assessing the toxicity and / or effect on neuronal function of a test substance, comprising the steps of:
[0497] - providing at least one cerebral organoid as defined in any one of items 63-70 or obtaining at least one cerebral organoid by the method of any one of items 1-60 or obtaining at least one cerebral organoid by the method of any one of items 61-62;
[0498] - bringing said at least one cerebral organoid into contact with said test substance; and
[0499] - examining the effect of the test substance on said at least one cerebral organoid compared to the effect of a control compound or compared to a control cerebral organoid that has not been in contact with said test compound.
[0500] 75. Method for test substance screening according to item 71 or 72 or method for assessing the efficacy of a test substance, such as a drug substance, according to item 73 or method for assessing the toxicity and / or effect on neuronal function of a test substance according to item 74, wherein said step of determining the effect or the step determining the response comprises assessing at least one property or properties selected from the group consisting of morphology of the cerebral organoid; metabolic activity of the cerebral organoid; electrophysiology of the cerebral organoid; omics of the cerebral organoid; viability of the cerebral organoid; immunological responses of the cerebral organoid; connectivity of the cells within the cerebral organoid; plasticity and neuroplasticity of the cellular structures of the cerebral organoid; migratory cell behaviors of the cerebral organoid; cellular and subcellular communication activity of the cerebral organoid; cellular and subcellular structure and morphology of the cerebral organoid; and apoptosis in the cerebral organoid.
[0501] 76. Method for test substance screening, assessing the efficacy of a test substance, such as a drug substance, or assessing the toxicity and / or effect on neuronal function of a test substance according to item 75, wherein said omics is at least one omics selected from the group consisting of genomics, transcriptomics, proteomics, metabolomics, epigenomics, lipidomics and phenomics.
[0502] 77. Method for test substance screening according to item 71 or 72 or method for assessing the efficacy of a test substance, such as a drug substance, according to item 73 or method for assessing the toxicity and / or effect on neuronal function of a test substance according to item 74, wherein said step of determining the effect or the step determining the response comprises assessing at least one property selected from the group consisting of structural tissue complexity, functional tissue complexity, axonal connectivity, electrical activity (other than electrophysiology), organoid cell composition, signal transduction, neuroplasticity, synaptogenesis, synaptic complexity and structure / functionality and axonal outgrowth.
[0503] 78. Method for test substance screening, assessing the efficacy of a test substance, such as a drug substance, or assessing the toxicity and / or effect on neuronal function of a test substance according to item 77, wherein assessment of electrophysiology is performed by a method selected from the group consisting of Ca2+-imaging, multi electrode array (MEA), impedance and resistance.
[0504] 79. Use of at least one cerebral organoid as defined in any one of items 63-70, for drug screening.
[0505] 80. Cerebral organoid as defined in any one of items 63-70, for use as a medicament.
[0506] 81. Cerebral organoid as defined in any one of items 63-70, for use in the treatment of a disorder or injury of the central nervous system in a patient in need thereof. 82. Cerebral organoid for use according to item 81, wherein said treatment comprises transplantation of said cerebral organoid to said patient or of a subset of cells derived from said organoid to said patient.
[0507] 83. Pharmaceutical composition comprising at least one cerebral organoid as defined in any one of items 73-70 or a subset of cells derived from said organoid, and a pharmaceutically active agent.
[0508] 84. A method for treatment of a disease or a disorder of the central nervous system, wherein said method comprises:
[0509] transplanting an effective dose of one or more cerebral organoid(s) according to any one of items 63-70 or an effective dose of a subset of cells derived from said organoid(s) into a brain of a patient in need thereof.
[0510] 85. A method for treatment of a disorder or injury of the central nervous system, wherein said method comprises the steps of:
[0511] obtaining at least one cerebral organoid according to the method of any one of items 1-60; and
[0512] transplanting an effective dose of said at least one cerebral organoid according to any one of items 63-70 or an effective dose of a subset of cells derived from said organoid(s) into a brain of a patient in need thereof. 86. Use of at least one cerebral organoid as defined in any one of items 63-70 or of a subset of cells derived from said organoid(s), for the manufacture of a medicament for the treatment of a disorder or injury of the central nervous system.
[0513] 87. Kit of parts comprising at least one cerebral organoid according to any one of items 64-70 or at least one cerebral organoid obtainable or obtained by the method as defined in any one of items 1-60 according to any one of items 63-70, and instructions for use.
[0514] 88. Kit of parts according to item 87, further comprising one or more culture media.
Claims
CLAIMS1. An in vitro method for obtaining at least one cerebral organoid, comprising the steps a) and b),wherein step a) comprises:providing a population of pluripotent stem cells;culturing said population of pluripotent stem cells in conditions permissive of formation of at least one embryonic body in a first cell culture medium; thereby obtaining at least one embryonic body;and wherein step b) comprises:providing said at least one embryonic body;culturing said at least one embryonic body in conditions permissive of differentiation into at least one cerebral organoid comprising neuroepithelium, wherein said culturing is performed in a second cell culture medium comprising glucose in a concentration range from approximately 1.5 mM to approximately 10 mM, such as from approximately 2.0 mM to approximately 6.0 mM;thereby obtaining at least one cerebral organoid comprising neuroepithelium.
2. In vitro method for obtaining at least one cerebral organoid according to claim 1, wherein said at least one cerebral organoid obtained in step b) is characterized by the presence of at least one ventricular niche.
3. In vitro method for obtaining at least one cerebral organoid according to claim 1 or 2, wherein said pluripotent stem cell population is an induced pluripotent stem cell (IPSC) population, such as a human IPSC population.
4. In vitro method for obtaining at least one cerebral organoid according to any one of claims 1-3, wherein said step a) comprises seeding from approximately 2000 to approximately 3000 pluripotent cells, such as from approximately 2200 to approximately 2800 pluripotent cells, from approximately 2400 to approximately 2600 pluripotent cells, such as approximately 2500 pluripotent cells, per culture well.
5. In vitro method for obtaining at least one cerebral organoid according to any one of claims 1-4, wherein said second cell culture medium comprises glucose in a concentration range from approximately 2.0 mM to approximately 10.0 mM, approximately 2.0 mM to approximately 8.0 mM, approximately 2.0 mM to approximately 7.0 mM, approximately 2.0 mM to approximately 6.0 mM, such as approximately 2.0 mM to approximately 5.5 mM, such as approximately 2.0 mM to approximately 5.0 mM, such as approximately 2.0 mM to approximately 4.5 mM, such as approximately 2.0 mM to approximately 4.0 mM, such as approximately 2.0 mM to approximately 3.5 mM, such as approximately 2.25 mM to approximately 3.25 mM, such as approximately 2.5 mM to approximately 3.0 mM, such as approximately 2.75 mM.
6. In vitro method for obtaining at least one cerebral organoid according to any one of claims 1-5, wherein said second cell culture medium comprises an inhibitor of the transforming growth factor-beta (TGF-|3) signaling pathway.
7. In vitro method for obtaining at least one cerebral organoid according to any one of claims 1-6, wherein said second cell culture medium comprises an inhibitor of the Wnt signaling pathway.
8. In vitro method for obtaining at least one cerebral organoid according to any one of claims 1-7, wherein said second cell culture medium comprises an inhibitor of the transforming growth factor-beta (TGF-|3) signaling pathway and an inhibitor of the Wnt signaling pathway.
9. In vitro method for obtaining at least one cerebral organoid according to any one of claims 1-8, wherein cerebral organoids in step b) are obtained after a culture time in said second cell culture medium of from approximately 6 to approximately 12 days, such as from approximately 7 to approximately 11 days, such as from approximately 7 to approximately 10 days, such as from approximately 8 to approximately 10 days, such as from approximately 8 to approximately 9 days or such as from approximately 9 to approximately 10 days, such as approximately 9 days.
10. In vitro method for obtaining at least one cerebral organoid according to any one of claims 1-9, wherein said at least one cerebral organoid obtained in step b) is characterized the presence of radial glial cells or radial glial progenitor cells.
11. In vitro method for obtaining at least one cerebral organoid according to any one of claims 1-10, further comprising step c) ofproviding at least one cerebral organoid obtained in step b);culturing said at least one cerebral organoid in conditions permissive of differentiation into at least one matured cerebral organoid using a third cell culture medium,thereby obtaining at least one matured cerebral organoid, characterized by the expression of at least one marker, such as a marker selected from the group consisting of EOMES, TBR1, DCX, , MAP2, TUBB3, SNAP25, SIX3, SLC6A1, GAD1, GAD2, SLC1A2, GLS and GRIA1.
12. In vitro method for obtaining at least one cerebral organoid according to any one of claims 1-11, further comprising step d) ofproviding at least one maturated cerebral organoid obtained in step c); culturing said at least one maturated cerebral organoid in conditions permissive of differentiation into functional cerebral organoids using a fourth cell culture medium, andthereby obtaining said functional cerebral organoids, characterized by ability to produce Ca2+oscillatory waves.
13. In vitro method for obtaining at least one cerebral organoid according to claim 12, wherein said functional cerebral organoids are further characterized by presence of GFAP expressing astrocytes.
14. A cerebral organoid obtainable or obtained by the method as defined in any one of claims 1-13.
15. A cerebral organoid or the cerebral organoid obtainable or obtained by the method as defined in any one of claims 12-13, the cerebral organoid comprising thefollowing cell types: stem cells, proliferating stem cells, gliogenic stem cells and neurons, such as GABAergic neurons and / or glutamatergic neurons, and optionally wherein said cerebral organoid is characterized by the ability to produce Ca2+oscillatory waves.
16. A population of cerebral organoids, wherein the cerebral organoids are as defined in any one of claims 14-15.