Ultra-efficient RNA switches and related expression systems

Splicing-control RNA switches with self-cleaving ribozymes and antisense oligonucleotides provide efficient, reversible, and long-lasting transgene expression, addressing the limitations of existing genetic switches by achieving high induction and extended half-life.

WO2026090418A1PCT designated stage Publication Date: 2026-04-30UNIV OF MASSACHUSETTS
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
UNIV OF MASSACHUSETTS
Filing Date
2025-10-23
Publication Date
2026-04-30

AI Technical Summary

Technical Problem

Existing genetic switches for transgene expression in gene therapy have limitations such as undesirable side effects, short induction half-life, and significant leaky expression, limiting their broader applications.

Method used

Development of splicing-control RNA switches comprising an intron and a self-cleaving ribozyme, regulated by a steric-blocking antisense oligonucleotide, which allows for reversible and dose-dependent induction of transgene expression with negligible leakiness and extended half-life.

Benefits of technology

The RNA switches achieve up to 300,000-fold induction of transgene expression in cell culture and 35,000-fold in mice, with expression lasting over five months, making them suitable for long-acting therapeutics with narrow therapeutic windows and major contraindications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025052263_30042026_PF_FP_ABST
    Figure US2025052263_30042026_PF_FP_ABST
Patent Text Reader

Abstract

Described herein is a method of making a splicing-control RNA switch effector that functions through regulated self-cleavage of an intron, and a method of making ultra-efficient RNA ON-switches through combined use of multiple splicing-control RNA switch effectors and / or self-cleaving ribozymes in mammalian pre-mRNAs. An ultra-efficient RNA ON-switch (Zon) generated based on the described method has negligible leakiness and allows for regulator dose-dependent induction of transgene expression over 300,000-fold in cultured mammalian cells and up to 35,000-fold in mice. Also provided are expression vectors and related expression systems for ultra-efficient regulation of transgene expression in various clinical or industrial applications.
Need to check novelty before this filing date? Find Prior Art

Description

ULTRA-EFFICIENT RNA SWITCHES AND RELATED EXPRESSION SYSTEMSRELATED APPLICATIONS

[0001] This application claims the benefit under 35 U.S.C. § 119(e) of the filing date of U.S. Provisional Application Serial No. 63 / 711,350, entitled “ULTRA-EFFICIENT RNA SWITCHES AND RELATED EXPRESSION SYSTEMS” and filed on October 24, 2024, and U.S. Provisional Application Serial No. 63 / 788,392, entitled “ULTRA-EFFICIENT RNA SWITCHES AND RELATED EXPRESSION SYSTEMS” and filed on April 14, 2025 the entire contents of which are incorporated herein by reference.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (U012070215WO00-SEQ-EAS.xml; Size: 63,088 bytes; and Date of Creation: October 23, 2025) are herein incorporated by reference in their entirety.GOVERNMENTAL SUPPORT

[0003] This invention was made with government support under Al 149646 awarded by the National Institutes of Health. The government has certain rights in the invention.BACKGROUND

[0004] One-time gene therapies, based on in vivo long-term expression of therapeutic proteins or noncoding RNAs, may provide long-lasting treatments or cures for many rare and common diseases. Genetic switches that enable precise temporal and dose control of transgene expression can improve safety and efficacy, and broaden the use of these therapies, particularly for therapeutics with narrow therapeutic windows and / or major contraindications. However, to date, only a handful of genetic switches developed for this purpose function in animals. Moreover, these switches are typically activated or repressed by ligands with undesirable side effects, including rapamycin, a potent immune suppressant; tetracycline, an antibiotic not suitable for chronic use; and branaplam (LMI070), a compound that causes peripheral neurotoxicity.

[0005] Generally, a useful genetic switch for temporal and dose control of gene therapeutics should have the following key features: (i) small-sized; (ii) non-immunogenic; (iii) the switch regulator is suitable for chronic use; and (iv) the switch effector efficiently turns ON or OFF transgene expression upon regulator administration and allows negligible or nounwanted leaky expression. RNA switches, with their small size (-100 bp) and lack of dependence on exogenous proteins, naturally meet the first two criteria, making ideal candidate systems for gene therapy applications. The inventors recently developed a reversible RNA ON-switch that controls transgene expression in vivo. The switch regulator is part of a class of small RNA drugs safe for chronic use in humans. In this system, a novel self-cleaving hammerhead ribozyme (T3H38) developed by the inventors is inserted into the 3' untranslated region (UTR) of a transgene, keeping the transgene turned “OFF” through cis cleavage of the transgene mRNA. The switch regulator (v-M8), which is a steric-blocking antisense oligonucleotide (ASO) complementary to the ribozyme and provided in trans, blocks the ribozyme’s selfcleavage, thus switching “ON” transgene expression. Utilizing this switch system to regulate AAV-delivered transgenes in mice, the inventors achieved switch regulator dose-dependent induction of a firefly luciferase (Flue) reporter and erythropoietin (Epo) expression with regulatory ranges up to 200-fold.

[0006] Although useful, the T3H38 / v-M8 system still allows a significant amount of baseline leaky expression and has a relatively short in vivo induction half-life (-5 days), limiting its broader applications. There is a need for a more efficient method that controls transgene expression with negligible leakiness and allows for regulator dose-dependent induction of transgene expression.SUMMARY

[0007] The inventors have engineered a panel of splicing-control RNA switches, each comprising (i) an intron, (ii) a self-cleaving ribozyme within the intron, and (iii) a steric-blocking antisense oligonucleotide (ASO) complementary to the ribozyme (Fig. 1A). When a splicing-control RNA switch effector comprising an intron and a self-cleaving ribozyme is placed in the 5'-UTR or coding region of a target gene, the RNA switch effector can inhibit the target gene expression. Without being held to a theory, likely because the self-cleavage of the ribozyme can occur before the pre-mRNA splicing and result in splitting of the pre-mRNA into two non-functional fragments susceptible to fast degradation. Blocking ribozyme self-cleavage with the complementary steric-blocking antisense oligonucleotide (ASO) provided in trans can rescue pre-mRNA splicing and then a full-length mature mRNA encoding a transgene.

[0008] The inventors have further engineered ultra-efficient RNA ON-switches, each comprising one or multiple copies of a splicing-control RNA switch effectors in the 5'-UTR and / or coding region, and one or more copies of a self-cleaving ribozyme in the 3 '-UTR. An ultra-efficient RNA ON-switch (Zon), which reversibly controls transgene expression byregulated multiple self-cleavages within the 5' UTR, coding sequence, and the 3' UTR of mammalian pre-mRNAs, has negligible leakiness and allows for regulator dose-dependent induction of transgene expression over 300,000-fold in cell culture and up to 35,000-fold in mice. Monthly administration of the regulator can consistently induce transgene expression, with flat expression kinetics, over at least 42 weeks. Further, a single dose of a regulator morpholino oligo can induce Zon-regulated transgene expression for up to five months with an induction half-life of -500 hours in mice, which is orders of magnitude longer than the halflife of many short-lived biologies (e.g., interleukins, interferons, GLP-1, insulin, FGF21, leptins, Epo; half-life: minutes to hours). Thus, utilizing the present RNA switch system to regulate ‘bio-factory’ gene therapy offers a safe and generalizable approach to developing long-acting therapeutics based on these short-lived biologies, which normally also have narrow therapeutic windows and / or major contraindications.

[0009] Some aspects of the disclosure provide a splicing-control RNA switch effector, comprising an intron and a self-cleaving ribozyme placed between a 5'-splice site and a 3'-splice site of the intron. In some embodiments, the intron is any one of: a human IgGl intron having a sequence identified in SEQ ID NO: 13 or a sequence or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence; COL1A2 intron 7 having a sequence identified in SEQ ID NO: 14 or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence; COL1A2 intron 14 having a sequence identified in SEQ ID NO: 15 or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence; or COL5A3 intron 58 having a sequence identified in SEQ ID NO: 16 or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence. In some embodiments, the intron comprises an enhancer of human ubiquitin C (UBC) gene between the 5'-splice site and the 3'-splice site, the intron having a sequence identified in SEQ ID NO:22, or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

[0010] In some embodiments, the self-cleaving ribozyme is any one or variant of a hammerhead ribozyme, a twister ribozyme, a hepatitis delta virus (HDV) ribozyme, a HDV-like ribozyme, a pistol ribozyme, a hatchet ribozyme, a twister sister ribozyme, a hairpin ribozyme, a Varkud satellite (VS) ribozyme, a glucosamine-6-phosphate synthase (glmS) ribozyme, a Vgl ribozyme, a B2 retrotransposon ribozyme, an ALU retrotransposon ribozyme, a hovlinc ribozyme, or a combination thereof.

[0011] In some embodiments, the self-cleaving ribozyme comprises a sequence (5'- 3') GCGCG TCCTG GATTC CACTT CGGGT ACATC CAGCT GACGA GTCCC AAATAGGACG AAACG CGC (SEQ ID NO: 5) or a or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

[0012] In some embodiments, the ribozyme is placed within about 20 to 100 bp downstream of the 5'-splice site.

[0013] In some embodiments, the RNA switch effector comprises a sequence (5'- 3') shown in any one of SEQ ID NOs: 1-4, 7-12, and 17-21, or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

[0014] Further aspects provide an expression vector comprising a target gene sequence operably fused to one or more splicing-control RNA switch effector coding sequences, wherein the RNA switch effector coding sequences are inserted into the target gene sequence within its 5' untranslated region (5'-UTR) and / or coding region, and wherein the RNA switch effector is set forth above. In some embodiments, the expression vector further comprises a self-cleaving ribozyme coding sequence, wherein the self-cleaving ribozyme coding sequence is inserted into the target gene within its 3' untranslated region (3'-UTR).

[0015] In some embodiments, the self-cleaving ribozyme is any one or variant of a hammerhead ribozyme, a twister ribozyme, a hepatitis delta virus (HDV) ribozyme, a HDV-like ribozyme, a pistol ribozyme, a hatchet ribozyme, a twister sister ribozyme, a hairpin ribozyme, a Varkud satellite (VS) ribozyme, a glucosamine-6-phosphate synthase (glmS) ribozyme, a Vgl ribozyme, a B2 retrotransposon ribozyme, an ALU retrotransposon ribozyme, a hovlinc ribozyme, or a combination thereof.

[0016] In some embodiments, the self-cleaving ribozyme is a hammerhead ribozyme, the ribozyme comprising a sequence (5'- 3') GCGCG TCCTG GATTC CACTT CGGGT ACATC CAGCT GACGA GTCCC AAATA GGACG AAACG CGC (SEQ ID NO: 5) or a or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence. In some embodiments, the splicing-control RNA switch effector coding sequence comprises a sequence (5'- 3') shown in any one of SEQ ID NOs: 1-4, 7-12, and 17-21, or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

[0017] In some embodiments, the expression vector further comprises one or more regulatory sequences. In some embodiments, the vector is a DNA vector.

[0018] In some embodiments, the target gene encodes erythropoietin (Epo), vascular endothelial growth factor A (VEGFA), fibroblast growth factor 21 (FGF21), interleukin-2 (IL-2), or a CRISPR-Cas genome editor.

[0019] Further aspects of the invention provide an engineered mammalian cell harboring the expression vector described herein.

[0020] Further aspects of the invention provide a method for inducing expression of a target gene in a cell, comprising (i) introducing the expression vector described herein into the cell, and (ii) contacting the cell with an RNase H-independent antisense oligonucleotide that is complementary to the self-cleaving ribozyme coding sequence in the expression vector; thereby inducing expression of the target gene in the cell. In some embodiments, the RNase H-independent antisense oligonucleotide is a morpholino oligonucleotide, or a 2'-0-methoxyethyl modified oligonucleotide with phosphorothioate linkages (2'-O-MOE / PS). In some embodiments, the cell is a mammalian cell. In some embodiments, the expression vector is an adeno-associated virus (AAV) vector.

[0021] In some embodiments, the RNA switch effector encoded by the vector is as described herein. In some embodiments, the self-cleaving ribozyme encoded by the vector described herein.

[0022] In some embodiments, the target gene encodes erythropoietin (Epo), vascular endothelial growth factor A (VEGFA), fibroblast growth factor 21 (FGF21), interleukin-2 (IL-2), or a CRISPR-Cas genome editor.

[0023] In some embodiments, the RNase H-independent antisense oligonucleotide is an octa- guanidine dendrimer-conjugated morpholino oligo or peptide-conjugated morpholino oligo. In some embodiments, the RNase H-independent antisense oligonucleotide comprises an oligonucleotide sequence as shown in any one of SEQ ID NOs: 6 and 24-36, or a sequence with 95%, 90%, 85%, 80%, or 75% homology thereto.

[0024] In some embodiments, the cell is present in a subject in need of the polypeptide encoded by the target gene. In some embodiments, the cell is obtained from the subject prior to introduction of the expression vector into the cell.

[0025] In some embodiments, the method further comprising, subsequent to introducing the expression vector into the cell, reintroducing the cell into the subject. In some embodiments, the RNase H-independent antisense oligonucleotide is administered to the subject subsequent to reintroducing the cell into the subject.

[0026] In another aspect, a splicing-control RNA switch effector, comprising an intron and a self-cleaving ribozyme or variant thereof placed at a location between the 5'-splice site and the 3 '-splice site. In another aspect, the ribozyme may be placed within about 20 to 100 bp, about 30 to 80 bp, about 40 to 70 bp, up to about 200 bp downstream of the 5'-splice site. Experiments for determining the optimal placement are known in the art and shown below in the Examples. In yet another aspect, an RNA switch effector comprising the nucleic acid sequence identified in any of SEQ ID Nos: 1-4, 7-12, 17-21, or a sequence with 95%, 90%,85%, 80%, or 75% homology to said sequence. In yet another aspect, the ribozyme is a T3H38 ribozyme comprising the nucleic acid sequence identified in SEQ ID N0:5, or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

[0027] In another aspect, the intron of the splicing-control RNA switch effector can be any intron known to a person of skill in the art. In yet another aspect, the intron can be selected from human IgGl intron, optionally having the nucleic sequence identified in SEQ ID NO: 13; COL1A2 intron 7, optionally having the nucleic acid sequence identified SEQ ID NO: 14; COL1A2 intron 14, optionally having the nucleic acid sequence identified in SEQ IDNO:15; COL5A3 intron 58, optionally having the nucleic acid sequence identified in SEQ ID NO: 16. In one aspect, the intron can carry a potent enhancer between the 5'-splice site and the 3'-splice site. In one aspect, the intron carries a potent enhancer from the human ubiquitin C (UBC) gene, optionally having the nucleic acid sequence identified in SEQ ID NO:22, or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

[0028] In one aspect, the steric blocking antisense oligonucleotide is an RNase Id-independent antisense oligonucleotide. In still another aspect, the RNase H-independent antisense oligonucleotide is a morpholino oligonucleotide or a modified morpholino oligonucleotide. In an aspect, the RNase H-independent antisence oligonucleotide is a 2’-O-methoxyethyl modified oligonucleotide with phosphorothiate linkages (2'-O-MOE / PS). In an aspect, the oligonucleotide is a peptide-conjugated morpholino oligonucleotide. In one aspect, the RNase H-independent antisense oligonucleotide, or morpholino, comprises an oligonucleotide sequence identified in any one of SEQ ID Nos: 6 and 24-36, or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

[0029] In another aspect, an expression vector, comprising a target gene sequence operably fused to one or more splicing-control RNA switch effector of the invention, wherein at least one splicing-control RNA switch effector is inserted into the target gene within its 5' untranslated region (5'-UTR) and / or coding region. In yet another aspect, an expression vector, comprising a target gene sequence that is operably fused to one or more splicing-control RNA switch effector of the invention, wherein at least one self-cleaving ribozyme is inserted into the target gene within its 3' untranslated region (3'-UTR). In yet another aspect, an expression vector comprising a target gene sequence operably fused to one or more splicing-control RNA switch effector of the invention, wherein at least one splicing-control RNA switch effector is inserted into the coding region. In one aspect, at least one splicing-control RNA switch effector is inserted into the 5' -UTR and the coding region, and at least one self-cleaving ribozyme is inserted into the 3'-UTR of the target gene.

[0030] In yet another aspect, the expression vector comprises one or more transcription regulatory sequences that regulate transcription of the target gene in a mammalian cell. The expression vector can be a DNA vector. In one aspect, the expression vector is an adeno-associated virus (AAV) vector.

[0031] In still another aspect, an engineered mammalian cell harboring the expression vector. In another aspect, the cell is present in a subject in need of the polypeptide encoded by the target gene. In one aspect the target gene encodes a hormone, e.g. erythropoietin (Epo); a growth factor, e.g. vascular endothelial growth factor A (VEGFA) or fibroblast growth factor 21 (FGF21); a cytokine, e.g. interleukine-2 (IE-2); or an enzyme, e.g. a CRISPR-Cas genome editor. In yet another aspect, the cell is obtained from the subject prior to introduction of the expression vector into the cell, and subsequent to introducing the expression vector into the cell, reintroducing the cell into the subject. In another aspect, the RNase H-independent antisense oligonucleotide is administered to the subject subsequent to reintroducing the cell into the subject.

[0032] In yet another aspect, a method for inducing expression of a target gene in a cell, comprising (a) constructing an expression vector according to the present invention, (b) introducing the expression vector into the cell, and (c) contacting the cell with an RNase H-independent antisense oligonucleotide that is complementary to the self-cleaving ribozymecoding sequence in the expression vector; thereby inducing expression of the target gene in the cell.BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0034] FIGs. 1A-1G show the development of a novel switch mechanism. FIG. 1A shows a diagram illustrating a novel switch mechanism: self-cleavage-mediated regulation of intron splicing. FIG. IB shows sequences and secondary structures of optimized self-cleaving hammerhead ribozyme T3H38 (SEQ ID NO: 5). The short arrowhead indicates the selfcleavage site. The long arrow indicates an adenine to guanine mutation that inactivates the ribozyme self-cleavage activity. Darker gray bases indicate the target sequence for morpholino oligo v-M8 that blocks the T3H38 self-cleavage activity. FIG. 1C shows a diagram depicting a panel of splicing-control RNA effectors, each consisting of an intron within the coding region of a Gaussia luciferase (Glue) gene and the optimized self-cleaving hammerhead ribozymeT3H38 at one of the indicated intron locations. Each effector-regulated Glue gene was cloned into a dual-reporter plasmid, which also contains a Cypridina luciferase (Clue; internal control) driven by an independent promoter. FIG. ID shows reporter inhibition assay results showing the corrected effector index (CEI) of the indicated RNA effector-controlled reporter plasmids in 293T cells, 48 hours post-transfection. FIG. IE shows reporter switch-on assay results showing the corrected dynamic range (CDR) of the RNA effector-controlled reporter plasmids upon addition of the T3H38- complementary morpholino oligo v-M8. FIG. IF shows RT-PCR analysis amplifying Glue cDNA (upper panel) and Clue cDNA (lower panel; internal control run on a separate gel) from 293T cells transfected with the CI- 1.1 -controlled reporter plasmid, followed by induction with either v-M8 or a control oligo (M3R). Mock: cDNA sample from 293T cells transfected with the pcDNA3.1 vector plasmid. Plasmid: the reporter plasmid was used as the PCR template. FIG. 1G shows representative Sanger sequencing result for the 183-bp RT-PCR products in (FIG. IF). Data shown are representative of three independent experiments with similar results, and data points in (FIG. ID) and (FIG. IE) represent the mean ± s.d. of three cell cultures.

[0035] FIGs.2A-2K show the development of ultra-efficient RNA ON-switches. FIG.2A shows diagrams showing a panel of RNA effector constructs with single-, double- (2R-), or triple-regulation (3R-) designs. The triple-regulation construct (3R-vl) is subsequently referred to as Zon. FIGs. 2B-2C show reporter inhibition assay (FIG. 2B) and reporter switchon assay (FIG. 2C) results for the switch effector constructs shown in (FIG. 2A). FIG. 2D shows RT-PCR analysis for the ““-controlled reporter in 293T cells. FIG. 2E shows representative Sanger sequencing results for the 5'-UTR and coding region of the 529-bp (spliced mRNA) RT-PCR product in (FIG. 2D). FIG. 2F shows a diagram depicting a panel of T3H38 ribozyme-regulated Gaussia luciferase (Glue) reporter constructs. FIGs. 2G-2H show reporter inhibition assay (FIG. 2G) and reporter switch-on assay (FIG. 2H) results for the switch effector constructs shown in (FIG. 2F). FIG. 21 shows sequence and secondary structure of a natural hepatitis delta virus ribozyme (HDVR). The short arrowhead indicates the self-cleavage site. The long arrow indicates a cytosine to uracil mutation that inactivates the ribozyme self-cleavage activity. Darker gray bases indicate the target sequence for morpholino oligo V-HDM2, which was used as a trigger molecule to induce HDVR-controlled transgene expression in (FIG.2K). FIG.21 shows reporter inhibition assay results for 3'-UTR single-regulation constructs (3' UTR) and triple-regulation constructs (3R-vl) based on a natural hammerhead ribozyme from a termite (Termite-HHR), a natural twister ribozyme fromSchistosoma mansoni (Sm-TwR), and a natural hepatitis delta virus ribozyme (HDVR). FIG.2K shows reporter switch-on assay results for the indicated RNA effectors. Data shown are representative of two or three independent experiments with similar results, and data points in (FIGs. 2B, 2C, 2G, 2H, 2J, 2K) represent the mean ± s.d. of three cell cultures.

[0036] FIGs. 3A-3K show further improvement and in vitro characterization of Zon.FIG. 3A shows a diagram showing the chemical backbone of a morpholino oligo. FIGs. 3B-3C show chemical structures of the octa- guanidine dendrimer77 (FIG. 3B) and the cell penetrating peptide P7 (FIG. 3C) conjugated to the v-M8 and P7-M8 morpholino oligos, respectively. Aside from the specific conjugations, v-M8 and P7-M8 share the same nucleobase sequence. FIG.3D shows a reporter switch-on assay results showing corrected Glue expression (Corr-Gluc) from the ““-controlled reporter plasmid upon the addition of P7-M8, v-M8, or M3R in 293T cells. No switch: a positive control plasmid encoding an unregulated reporter. The lower gray dotted line indicates the background noise level in the Glue assay. Glue expression induced by P7-M8 at 5, 10, and 20 pM was significantly higher than that induced by v-M8 at the corresponding concentrations (two-sample Student’s t-test, two-tailed, p < 0.001). FIG.3E shows cell viability of the 293T cells treated with the indicated concentrations of v-M8 or P7-M8. Differences were significant at all tested concentrations (two-sample Student’s t-test, two-tailed, p < 0.001). FIGs.3F-3G show fluorescence microscopy (FIG.3F) and flow cytometry (FIG. 3G) analysis showing P7-M8 induction of enhanced green fluorescent protein (EGFP) expression from a dual-reporter plasmid encoding Z°“-regulated EGFP and an unregulated near- infrared fluorescent protein (iRFP670) in 293T cells. Mock: 293T cells transfected with a single-reporter iRFP670 expression plasmid (FIG. 3F) or the pcDNA3.1 vector plasmid (FIG. 3G). The white scale bar in (FIG. 3F) represents 100 pm.FIG. 3H shows Z°“-regulated Glue expression driven by the short cytomegalovirus (sCMV) promoter, the simian virus 40 (SV40) promoter, the chicken beta-actin (CBA) promoter, and the elongation factor la short (EFS) promoter in 293T cells. FIG.31 shows Z°“-regulated Glue expression in the indicated cell lines. FIG. 3J shows comparison of Z°“ with four published ON-switch systems for regulating Glue expression using the reporter switch-on assay in 293T cells. Parentheses indicate the promoter used for each switch system. 293T cells in 96-well plates were transfected with switch-regulated reporter plasmids at high (100 ng / well) and low (10 ng / well) doses, followed by induction with varying concentrations of each switch’s trigger molecule. FIG.3K shows representative data for Zon-regulated Glue expression in 293T cells, shown as the absolute number of Glue proteins per transfected cell (left Y axis) and as the estimated number of mature Glue mRNA molecules per transfected cell (right Y axis). Colorednumbers in each figure indicate the regulatory range of the switch at high (purple) and low (blue) transfection doses. Data shown are representative of three independent experiments with similar results, and data points in (FIGs. 3D-3E and FIGs. 3H-3J) represent the mean ± s.d. of three cell cultures.

[0037] FIGs. 4A-4J show ultra-efficient regulation of an AAV-delivered reporter transgene in mice. FIG. 4A shows a diagram illustrating a Zon-regulated AAV vector and the experimental design used in subsequent animal studies. UR: inverted terminal repeat; Flue: firefly luciferase gene; i.m.: intramuscular. FIGs. 4B-4C show female BALB / c mice were intramuscularly injected with 1x109 vector genomes (vg) of AAV 1 particles carrying either an unregulated Flue gene (No switch), a Flue gene under the control of a copy of the T3H38 ribozyme at the 3'-UTR (3'-T3H38), or a Flue gene under the control of Zon. Twenty-six days after AAV injection, mice were intramuscularly injected at the same site with saline or 0.5 mg / kg of switch regulator (v-M8 for 3'-T3H38; P7-M8 for Zon). In vivo bioluminescence imaging was performed to measure AAV-mediated luciferase expression. (FIG. 4B) Bioluminescence images showing baseline and induced peak expression of Flue. (FIG. 4C) Flue expression kinetics. The black dotted line in (FIG. 4C) indicates the background noise level of the bioluminescence imaging assay, determined by imaging animals that did not receive AAV transduction. These experiments were independently repeated three times with similar results. FIG. 4D shows experiment similar to (FIG. 4C), except that animals (n=3 / group) were first injected with AAV-Fluc under the regulation of Zon, a ribozyme-inactive Zon, or no switch, and then induced with P7-M8 at 1.25 mg / kg. Baseline and induced peak Flue expression are shown. FIG. 4E shows experiment similar to (FIG. 4C), except that animals (n=3 / group) were first injected with AAV-Fluc -Zonand then treated with 0, 0.2, 0.5, or 1.25 mg / kg of the P7-M8 oligo. FIG.4F shows experiment similar to (FIG.4C), except that animals (n=3 / group) were injected with varying doses (3.3x107, 3.3x108, or 1x109 vg) of AAV-Fluc -Zonand then treated with 0.5 mg / kg of P7-M8. FIGs. 4G-4I show animals in (FIG. 4E) were repeatedly treated every four weeks using different P7-M8 dosing regimens, as indicated by the arrows. The solid line represents the average bioluminescence signal from three animals, while circles indicate signals from individual animals. FIG. 4J shows P7-M8-induced peak Flue expression data from (FIG. 4D), (FIG. 4E) and (FIG. 4G) plotted by P7-M8 dose. Background noise was subtracted from bioluminescence signals for each animal. In the crossgroup dose-escalation experiment, animals that received 1.25 mg / kg of P7-M8 exhibited a regulatory range averaging 66,995-fold, with a maximum of 99,475-fold in one animal. Datapoints in (FIGs. 4C-4F) and (FIG. 4J) represent mean ± s.d. of bioluminescence signals from three animals.

[0038] FIGs. 5A-5L show regulated expression of low-dose interleukin-2 mutein in mice. FIG. 5A shows a diagram illustrating AAV-IL2m-Zon, a Zon-regulated AAV vector encoding an interleukin-2 mutein (IL-2m), and the experimental design used in subsequent animal studies. FIG. 5B shows ELISA measurement of mouse serum IL-2 levels one week post-induction with varying doses of P7-M8. AAV-Ctrl: AAV particles carrying a reporter gene. FIGs. 5C-5F shows representative flow cytometry analyses (FIG. 5C, FIG. 5F) and graphical summaries (FIG. 5D, FIG. 5F) of regulatory T cell (Treg: CD25+Foxp3+) frequencies in gated CD3+CD4+ T cells and CD8+ T cell frequencies in gated CD3+ T cells from blood samples collected one week post-induction with the indicated doses of P7-M8.FIGs. 5G-5H show representative flow cytometry analysis (FIG. 5G) and graphical summary (FIG. 5H) of natural killer (NK: CD3-CD49b+) cell frequencies in gated CD45+ cells from blood samples collected in a separate experiment one week post-induction with the indicated doses of P7-M8. FIG. 51- 5L Treg cell frequencies (FIG. 51), Foxp3 expression levels in Tregs (FIG. 5J), CD25 expression levels in Tregs (FIG. 5K), and NK cell frequencies (FIG. 5L) at the indicated time points in three animal groups. Ctrl: animals injected with AAV-Ctrl. IL2-Zon+MI: animals injected with AAV-IL2m-Zonand subjected to multiple inductions (lighter gray arrows shown at top of graph) with varying doses of P7-M8. IL2-Zon+SI: animals injected with AAV-IL2m-Zonand subjected to a single induction (darker gray arrow) with 0.5 mg / kg of P7-M8. The numbers above the arrows indicate P7-M8 doses in mg / kg. Data points in (FIGs.5B,5D,5F,5H) represent the mean ± s.d. of three animals. Data points in (FIGs. 5I-5K) represent the mean ± s.d. of eight animals from two independent experiments. Data points in (FIG. 5L) represent the mean ± s.d. of five animals. One-tailed two-sample Student’s t-tests were used to assess the significance of differences between each experimental group and the untreated AAV-Ctrl group in (FIGs. 5B,5D,5F,5H-5L). The stars above the arrows in (FIG.5I-5L) indicate the statistical significance of differences between each P7-M8-treated group and the Ctrl group one-week post-treatment, ns: not significant; *: p < 0.05; **: p < 0.01; ***: p < 0.001.

[0039] Figs. 6A-6M show regulated expression of therapeutic-level FGF21 in mice.FIG. 6A shows a diagram illustrating AAV-FGF21-Z011, a Zon-regulated AAV vector encoding mouse fibroblast growth factor 21 (FGF21), and the experimental design used in subsequent animal studies. AAV-Ctrl: AAV particles carrying a reporter gene. FIG. 6B shows ELISA measurement of mouse serum FGF21 levels at weeks 3, 8, and 10 post-AAV injection. FIG.6C shows body weight data presented as the percentages of body weight gain relative to baseline at the start of the experiment. FIG. 6D shows representative images of the Groups 1 and Group 2 animals at weeks 3 and 11 post- AAV injection. FIG.6E shows non-fasting blood glucose levels at the indicated time points. FIG. 6F shows glucose tolerance test conducted at week 11 post- AAV injection. FIGs. 6G-6I shows serum insulin levels (FIG. 6G), alanine aminotransferase (ALT) levels (FIG. 6H), and aspartate aminotransferase (AST) levels (FIG.61) at the indicated time points. FIGs.6J-6L show representative images of mouse livers (FIG.6 J), graphical summary of liver weight (FIG.6K), graphical summary of liver-to-body weight ratio (FIG. 6L), and representative images of hematoxylin-eosin-stained liver sections (FIG.6M) from animals sacrificed at week 11 post- AAV injection. The black scale bar in (FIG.6M) represents 100 pm. Data points in (FIGs.6B,6E,6H,6I,6K,6L) represent the mean ± s.d. of the indicated number of animals from two independent experiments. One-tailed two-sample Student’s t-tests were used to assess the significance of differences between group 2 and group 3 animals in (FIGs. 6B,6E,6H,6I,6K,6L). ns: not significant; *: p < 0.05; **: p < 0.01; ***: p < 0.001. One-tailed paired-sample Student’s t-tests were used in (FIG.6C) and (FIG.6F), and the differences between group 2 and group 3 animals were significant (p < 0.001 for both figures).

[0040] FIGs.7A-7H show evaluation of splicing-control RNA effectors inserted in the coding region of the Glue reporter gene. FIG. 7A shows background noise distribution of thirty-nine Glue assays from ten independent experiments using supernatant of mock-transfected 293T cells. FIGs. 7B,7C shows reporter inhibition assay (FIG. 7B) and reporter switch-on assay (FIG. 7C) results showing corrected Glue expression (Corr-Gluc) for calculating corrected effector index (CEI) and corrected dynamic range (CDR) in FIGs. ID and FIG. IE, respectively. FIG. 7D shows diagram depicting a panel of splicing-control RNA effectors tested in the reporter assays in (FIGs. 7E-7H). FIG. 7E-7F show reporter inhibition assay results showing Corr-Gluc (FIG.7E) and CEI (FIG.7F) of the indicated RNA effectors-controlled reporter plasmids in 293T cells, 48 hours post-transfection. FIGs. 7G-7H show reporter switch-on assay results showing Corr-Gluc (FIG.7G) and CEI (FIG.7H) of the RNA effector-controlled reporter plasmids upon addition of the T3H38-complementary morpholino oligo (v-M8). Data shown are representative of two or three independent experiments with similar results, and data points represent the mean ± s.d. of three cell cultures.

[0041] FIGs.8A-8F show evaluation of splicing-control RNA effectors inserted in the 5'-UTR of the Glue reporter gene. FIG.8A shows diagram depicting a panel of splicing-controlRNA effectors, each consisting of an intron within the 5'-UTR of the Glue reporter gene and T3H38 ribozyme at one of the indicated intron locations. FIG.8B-8E show reporter inhibition assay (FIGs.8B-8C) and reporter switch-on assay (FIGs.8D-8E) results for the switch effector constructs shown in (FIG. 8A). FIG. 8F shows data shown are representative of three independent experiments with similar results, and data points in (FIGs. 8B-8C) represent the mean ± s.d. of three cell cultures.

[0042] FIGs. 9A-9E show evaluation of triple-regulation switch constructs in 293T cells. FIGs. 9A-9B show reporter inhibition assay (FIG. 9A) and reporter switch-on assay (FIG. 9B) results showing corrected Glue expression (Corr-Gluc) for calculating CEI and CDR in FIGs. 2B and 2C, respectively. FIG. 9C shows the 3R-vl effector (Zon)-regulated Glue reporter construct and a corresponding ribozyme-inactive control construct were tested in the reporter inhibition assay, where 293T cells in 96- well plates were transfected with each reporter plasmid at high (100 ng / well) and low (10 ng / well) doses. FIGs. 9D-9E show reporter inhibition assay (FIG. 9D) and reporter switch-on assay (FIG. 9E) results showing corrected Glue expression (Corr-Gluc) for calculating CEI and CDR in FIGs. 2G and 2H, respectively. Data shown are representative of two or three independent experiments with similar results, and data points in represent the mean ± s.d. of three cell cultures.

[0043] FIGs. 10A-10D show evaluation of triple -regulation switch constructs based on distinct self-cleaving ribozymes. FIG. 10A shows sequences and secondary structures of a natural hammerhead ribozyme from a termite (Termite-HHR) and a natural twister ribozyme from Schistosoma mansoni (Sm-TwR). Short arrowheads indicate the self-cleavage sites. Long arrows indicate mutations that inactivate the ribozymes. The darker gray nucleobases in Sm-TwR indicate mutations that were introduced to inactivate a potential 3' splicing site. FIGs.10B-10C show reporter inhibition assay (FIG. 10B) and reporter switch-on assay (FIG. 10C) results showing corrected Glue expression (Corr-Gluc) for calculating CEI and CDR in FIG.2J and FIG. 2K, respectively. FIG. 10D shows RT-PCR analysis for the HDVR:3R-vl-controlled reporter in 293T cells. Data shown are representative of two independent experiments with similar results, and data points in (FIG. 10B) and (FIG. 10C) represent the mean ± s.d. of three cell cultures.

[0044] FIGs. 11A-11H show regulation of T3H38 -controlled AAV-Fluc using cellpenetrating peptide-conjugated morpholino oligos. FIG. 11A shows chemical structure of the cell penetrating peptide DG9. FIG. 11B shows diagram of an AAV vector (AAV-Fluc-T3H38) carrying a T3H38 ribozyme-regulated firefly luciferase (Flue) gene, along with theexperimental design used in subsequent animal studies. FIG. 11C shows six-week-old female BALB / c mice were intramuscularly (i.m.) injected in the right gastrocnemius muscle with 4xl08vector genomes (vg) of AAV-Fluc-T3H38. Five weeks later, mice received an i.m. injection at the same site with either saline or 0.5 mg / kg of the indicated morpholino oligos. In vivo bioluminescence imaging was performed to measure AAV-mediated luciferase expression. Images show baseline expression prior to induction and peak expression after induction. P7-M8-5 ' : a morpholino oligo with the same nucleobase sequence as v-M8, conjugated with a P7ref.47 cell-penetrating peptide at the 5' end. P7-M8-3': same nucleobase sequence as v-M8, with a P7 peptide at the 3' end. DG8-M8-3': same nucleobase sequence as v-M8, conjugated with the DG9 peptide at the 3' end. FIGs. 11D-11H shows mice from (FIG.11C) were monitored by in vivo bioluminescence imaging at the indicated time points over a 30-week period. Quantification of the bioluminescence signals is shown. Data points in (FIG.11E-11H) represent mean ± s.d. of five animals.

[0045] FIGs 12A-12D show Zon / P7-M8-regulated expression of different genes in 293T cells. FIG. 12A shows original flow cytometry dot plot data used to generate the histogram shown in FIG. 3G. FIG. 12B shows summary of the percentage of EGFP-positive (EGFP+) cells (light gray bars, left y-axis) and the median fluorescence intensity (dark gray bars, right y-axis) from the flow cytometry experiment in FIG. 3G. FIGs. 12C-12D show Zon / P7-M 8 -regulated expression of mouse vascular endothelial growth factor (mVEGF; FIG.12C) and erythropoietin (Epo; FIG. 12D) in 293T cells. No switch: protein expression levels from an unregulated control plasmid. Dotted lines indicate the background noise level of the ELISA assays used to quantify protein expression. Data points in (FIGs. 12B-12D) represent the mean ± s.d. of three cell cultures.

[0046] FIGs. 13A-13E show P7-M8 induction of Zon-regulated AAV-Fluc in mice.FIGs. 13A-13B show single-dose P7-M8 induction of Zon-regulated AAV-Fluc in mice. In vivo bioluminescence images showing baseline and peak induced expression of Flue in the animals from FIG. 4E (FIG. 13A) and FIG. 4F (FIG. 13B). FIGs. 13C-13E show multi-dose P7-M8 induction of Zon-regulated AAV-Fluc in mice. In vivo bioluminescence images at the indicated time points for animals from FIG. 4G (FIG. 13C), FIG. 4H (FIG. 13D), and FIG 41 (FIG.13E). Note that signal gray-colored scales are log-transformed. To highlight the minimal leaky expression in the Zongroup prior to induction, signal scaling was adjusted to visualize extremely low expression: blue pixels observed across some imaging fields represent low-level (105p / sec / cm7sr) photon spillover from high Flue signals in the leg region.

[0047] FIGs. 14A-14E show induction of selective Treg expansion using Zon-regulated AAV-IL2m in mice. FIG. 14A shows gating strategy for the blood cell flow cytometry experiments shown in FIGs. 5A-5L. FIG. 14B shows representative flow cytometry dot plots of regulatory T cells (Tregs: CD25+Foxp3+) from the experiments shown in FIG. 5D. FIG.14C shows representative flow cytometry dot plots of CD8+T cells from the experiments shown in FIG. 5F. FIGs. 14D-14E show CD4+ T cell frequencies (FIG. 14D) and CD8+ T cell frequencies (FIG. 14E) at the indicated time points in the three animal groups (n=8 / group) shown in FIGs. 5I-5L. Ctrl: animals injected with AAV-Ctrl. IL2-Zon+ MI: animals injected with AAV-IL2m-Zonand subjected to multiple inductions (light grey arrows) with varying doses of P7-M8. IL2-Zon+ SI: animals injected with AAV-IL2m-Zonand subjected to a single induction (dark gray arrow) with 0.5 mg / kg of P7-M8. The numbers above the arrows indicate P7-M8 doses in mg / kg. Data points in (FIGs. 14D-14E) represent the mean ± s.d. of eight animals from two independent experiments.

[0048] FIGs. 15A-15G show AAV-IL2m-Zon-mediated induction of selective Treg expansion in mouse spleen. FIG.15A shows gating strategy for the subsequent splenocyte flow cytometry experiments. FIGs. 15B-15C show representative flow cytometry analyses of regulatory T cell (Treg: CD25+Foxp3+) frequencies in gated CD3+CD4+ T cells (FIG. 15B) and CD8+ T cell frequencies in gated CD3+ T cells (FIG. 15B) from spleen samples collected one-week post-induction with 0.3 mg / kg of P7-M8. AAV-Ctrl: AAV particles carrying a reporter gene. FIGs. 15D-15G show graphical summaries of Treg cell frequencies (FIG. 15D), Foxp3 expression levels in Tregs (FIG. 15E), CD25 expression levels in Tregs (FIG. 15F), and CD8+ T cell frequencies (FIG. 15G) of the spleen samples. Data points in (FIGs. 15D-15G) represent the mean ± s.d. of three animals. One-tailed two-sample Student’s t-tests were used to assess the significance of differences between each experimental group and the untreated AAV-Ctrl group, ns: not significant; *: p < 0.05; **: p < 0.01; ***: p < 0.001.

[0049] FIGs. 16A-16E show Zon / P7-M 8 -regulated expression of FGF21 in mice. FIG.16A shows diagram illustrating the experimental design used in subsequent animal studies.FIG. 16B shows ELISA measurement of mouse serum FGF21 levels at weeks 0, 3, 4, and 6 post- AAV injection. FIG. 16C shows body weight data presented as the percentages of body weight gain relative to baseline at the start of the experiment. FIG. 16D shows non-fasting blood glucose levels measured at week 7. FIG. 16E shows serum insulin levels measured at week 6. Data points in (FIGs. 16B-16D) represent the mean ± s.d. of four or five animals from two independent experiments.

[0001] FIGs. 17A-17C show control of Zon-regulated gene expression using another class of ASOs. 17A-17C, A panel of thirteen 2'-0-methoxyethyl and phosphorothioate linkages (2'-0-MOE / PS)-modified ASOs (Zon-MOE-1, SEQ ID NO: 24; Zon-MOE-2, SEQ ID NO:25; Zon-MOE-3, SEQ ID NO:26; Zon-MOE-4, SEQ ID NO:27; Zon-MOE-6, SEQ ID NO:28; Zon-MOE-7, SEQ ID NO:29; Zon-MOE-8, SEQ ID NO:30; Zon-MOE-9, SEQ ID NO:31; Zon-MOE-10, SEQ ID NO:32; Zon-MOE-11, SEQ ID NO:33; Zon-MOE-12, SEQ ID NO:34; Zon-MOE-13, SEQ ID NO:35; Zon-MOE-13, SEQ ID NO:36) complementary to the T3H38 ribozyme within Zonwere tested for the induction of Zon-regulated Glue expression in 293T cells. 293T cells transfected with Zon-regulated Glue were then further transfected with 2.5 pM of one of the indicated ASOs (Zon-MOE-1 - Zon-MOE-13). MOE / PS ASO induced Glue expression was measured at 48 hours post transfection. The regulatory range of each ASO-regulated system was calculated as fold induction of Glue reporter expression from cells treated with the ASO relative to the Glue expression from cells received no ASO treatment.

[0002] FIGs. 18A-18F show that Zon / P7-M8-mediated regulation is compatible with different transgenes. 18A-18F, P7-M 8 -mediated efficient induction of Zon-regulated erythropoietin (Epo; 18A), vascular endothelial growth factor A (VEGFA; 18B), fibroblast growth factor 21 (FGF21; 18C), or interleukin-2 (IL-2; 18D) expression in 293T cells. 18E-18F, P7-M8-mediated efficient induction of Zon-regulated adenine base editor (ABE8e) in a base editing-mediated gain-of-expression reporter assay in 293T cells. 293T cells were cotransfected with 25 ng of the base editing reporter plasmid and either 10 ng (18E) or 50 ng (18F) of Zon-regulated ABE8e plasmid. Cells were then either untreated (Mock) or treated with 10 pM of P7-M8. ABE8e editing-induced reporter expression was measured 72 hours post transfection. Reporter expression was normalized to that of the un-regulated ABE8e group (no switch). Data shown are representative of three independent experiments with similar results, and data points represent mean ± s.d..

[0003] FIGs. 19A-19E show reversal of P7-M8’s induction effect with an “antidote” morpholino oligo. FIG. 19A shows representative sequences of the P7-M8 morpholino oligo (SEQ ID NO: 6) and P7-aM8 (SEQ ID NO: 23) — an “antidote” morpholino oligo complementary to P7-M8. X: 6-aminohexanoic acid; B: beta-alanine. FIG. 19B shows a diagram showing an AAV vector encoding Zon-regulated Flue and the experimental design used in the subsequent animal studies. FIG. 19C shows representative Flue expression measured by in vivo bioluminescence imaging at the indicated time points. Vertical dotted lines mark the time points when P7-M8-induced expression in each group declined to 1 / 100 of its peak level (ti / ioo). One-tailed paired-sample Student’s t-tests were used to assess thesignificance of differences between each P7-aM8-treated group and the d2:Saline group and the differences were all significant (p < 0.01 for d2:P7-aM8; p < 0.05 for d5:P7-M8; p < 0.01 for dl9:P7-M8). FIG. 19D shows representative bioluminescence images for animals from (FIG. 19C) at the indicated time points. FIG. 19E shows a calculated area under the curve (AUC) for the Flue expression kinetics data in (FIG. 19C).

[0004] FIGs. 20A-20C show evaluation of a panel of T3H38 ribozyme-based RNA switch effectors in 293T cells. FIG. 20A shows a diagram depicting a panel of T3H38 ribozyme-regulated Gaussia luciferase (Glue) reporter constructs. Each construct was cloned into a dual-reporter plasmid, which also contains a Cypridina luciferase (Clue; internal control) driven by an independent promoter. FIGs.20B-20C show representative data for the constructs shown in (FIG.20A) and their inactive -ribozyme counterparts were tested in 293T cells using two assays: a reporter inhibition assay measuring ribozyme-mediated inhibition of Glue expression (FIG. 20B) and a reporter switch-on assay assessing induction of Glue reporter expression via v-M8, the T3H38-complementary morpholino oligo that blocks the ribozyme self-cleavage (FIG.20C). Data shown are representative of two independent experiments with similar results, and data points represent the mean ± s.d. of three cell cultures.

[0005] FIG. 21 shows sequences and secondary structures of the T3H38 hammerhead ribozyme (SEQ ID NO: 5) and a natural hepatitis delta virus ribozyme (HDVR) (SEQ ID NO: 39). Darker gray indicates the target sequences for morpholino oligos v-M8 and V-HDM2, which block the T3H38 and HDVR ribozymes, respectively.

[0006] Figs. 22A-22F show development of tight, leak-free control of the highly efficient adenine base editor ABE8e. Fig. 22A shows a schematic of an adenine base editing (ABE)-activatable reporter assay. The reporter gene encodes EGFP and Gluc / Fluc, separated by two stop codons (TAATAG) and a self-cleaving 2A peptide. EGFP and Gluc / Fluc are in the same open reading frame. In the absence of ABE8e, Gluc / Fluc expression is silenced by the upstream stop codons. In the presence of ABE8e and a guide RNA (gRNA) targeting the stop codons, base editing converts them to tryptophan codons (TGGTGG) thereby activating Gluc / Fluc expression. FIG. 22B shows representative data for varying doses (0, 4, 20, 100 ng / well) of a plasmid encoding one of the indicated ABE8e constructs that was co-transfected with the reporter plasmid into 293T cells. Editing-activated Glue reporter expression was measured at 24, 48, and 72 hours post-transfection. ABE8e-3'-T3H38: ABE8e regulated by the T3H38 ribozyme at the 3’ UTR. ABE8e-Zon: Zon-regulated ABE8e. ABE8e-eZon: ABE8e regulated by an enhanced Zon(eZon) effector. FIG.22C shows representative data for the sameexperimental setup as in (FIG. 22B), except that 293T cells were treated with 10 pM P7-M8 post-transfection. Ctrl gRNA: 293T cells transfected with unregulated ABE8e and a nontargeting control gRNA. Mock: no P7-M8 induction. FIG. 22D shows a diagram of two AAV vectors encoding eZon-regulated ABE8e and the experimental design used in subsequent animal studies. FIG. 22E shows representative data for base editing-activated Flue expression in mouse muscle, measured by in vivo bioluminescence imaging at the indicated time points.FIG. 22F shows representative bioluminescence images of animals from (FIG. 22E) at the indicated time points.

[0007] The above-described and other features will be appreciated and understood by those skilled in the art from the following detailed description, drawings, and appended claims.DETAILED DESCRIPTION

[0008] One-time gene therapies, based on in vivo long-term expression of therapeutic proteins or noncoding RNAs, may provide long-lasting treatments or cures for many rare and common diseases. Genetic switches that enable precise temporal and dose control of transgene expression can improve safety and efficacy, and broaden the use of these therapies, particularly for therapeutics with narrow therapeutic windows and / or major contraindications. However, to date, only a handful of genetic switches developed for this purpose function in animals. Moreover, these switches are typically activated or repressed by ligands with undesirable side effects, including rapamycin, a potent immune suppressant; tetracycline, an antibiotic not suitable for chronic use; and branaplam (LMI070), a compound that causes peripheral neurotoxicity.

[0009] A recent system was developed using a reversible RNA ON-switch that controls transgene expression in vivo (Zhong, G. et al., 2020, Nat. Biotechnol. 38, 169-175; US20230265422A1). The switch regulator (also referred to interchangeably herein as “switch trigger”) is part of a class of small RNA drugs safe for chronic use in humans. In this system, a novel self-cleaving hammerhead ribozyme (HH), T3H38, is inserted into the 3' untranslated region (UTR) of a transgene, keeping the transgene turned “OFF” through cis cleavage of the transgene mRNA. The switch regulator (v-M8), which is a steric-blocking antisense oligonucleotide (ASO) complementary to the ribozyme and provided in trans, blocks the ribozyme’s self-cleavage, thus switching “ON” transgene expression. Switch regulator dosedependent induction of a firefly luciferase (Flue) reporter and erythropoietin (Epo) expression with regulatory ranges up to 200-fold were achieved utilizing this switch system to regulate AAV-delivered transgenes in mice (Zhong, G. et al., 2020, Nat. Biotechnol. 38, 169-175;US20230265422A1). However, the T3H38 / v-M8 system had a relatively short induction halflife (around 5 days), and allowed a significant amount of baseline leaky expression, limiting its broader applications.

[0010] The present invention solves the drawbacks of the T3H38 / v-M8 system. The present invention is derived in part from the studies undertaken by the inventors to engineer a class of HH ribozymes combined with an optimized morpholino, P7-M8, a peptide-conjugated morpholino oligo (PPMO), to develop an ultra-efficient RNA ON-switch that controls transgene expression by regulated self-cleavage within the 5'-UTR, coding region, and the 3'-UTR of mammalian pre-mRNAs. This system has negligible leakiness and allows for regulator dose-dependent induction of transgene expression up to 35,000-fold in mice. Monthly administration of the regulator can consistently induce transgene expression, with flat expression kinetics, over at least 42 weeks.

[0011] It is noted that this invention is not limited to using a PPMO for in vivo regulation. Rather, one can improve tissue-targeting specificity and safety by changing the delivery chemistry for morpholino, such as replacing peptide conjugation with N-acetylgalactosamine (GalNAc) conjugation or anti-transferrin receptor (anti-TfR) antibody conjugation. GalNAc conjugations are now widely used in clinical trials for liver- specific delivery of oligonucleotides. See, e.g., Huang Y., Mol. Ther. Nucleic Acids. 6:116-132, 2017. Anti-TfR antibody conjugations are now widely used in clinical trials for the delivery of oligonucleotides to muscles or the brain. See, e.g., Mullard A., Nat Rev Drug Discov. 21: 6-8, 2022. In addition, morpholino is a class of steric-blocking antisense oligonucleotides that do not trigger RNase H cleavage of the complementary RNAs. Thus, one can replace morpholino with a completely different steric-blocking antisense chemistry, such as locked nucleic acid (LNA) / DNA mixmer or 2'-0-methoxyethyl phosphorothioate-modified antisense oligonucleotide (see, e.g., Smith ICE, Zain R., Annual Rev Pharmacol Toxicol. 59: 605-630, 2019). Unless otherwise specified, this invention is not limited to the particular methodology, protocols, and reagents described as these may vary. Unless otherwise indicated, the practice of the present invention employs conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. For example, exemplary methods are described in the following references, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (3rded., 2001); Brent etal., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (ringbou ed., 2003); Freshney, Culture of Animal Cells: A Manual of Basic Technique, Wiley-Uiss, Inc. (4thed., 2000); andWeissbach & Weissbach, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp. 42 1-463, 1988. In addition, the following sections provide more detailed guidance for practicing the invention.DEFINITIONS

[0012] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention pertains. The following references provide one of skill with a general definition of many of the terms used in this invention: Academic Press Dictionary of Science and Technology, Morris (Ed.), Academic Press (1sted., 1992); Oxford Dictionary of Biochemistry and Molecular Biology, Smith et al. (Eds.), Oxford University Press (revised ed., 2000); Encyclopaedic Dictionary of Chemistry, Kumar (Ed.), Anmol Publications Pvt. Ltd. (2002); Dictionary of Microbiology and Molecular Biology, Singleton et al. (Eds.), John Wiley & Sons (3rded., 2002); Dictionary of Chemistry, Hunt (Ed.), Routledge (1sted., 1999); Dictionary of Pharmaceutical Medicine, Nahler (Ed.), Springer- Verlag Telos (1994); Dictionary of Organic Chemistry, Kumar and Anandand (Eds.), Anmol Publications Pvt. Ltd. (2002); and A Dictionary of Biology (Oxford Paperback Reference), Martin and Hine (Eds.), Oxford University Press (4thed., 2000). Further clarifications of some of these terms as they apply specifically to this invention are provided herein.

[0013] As used herein, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to “a cell” includes a plurality of such cells, reference to “a protein” includes one or more proteins and equivalents thereof known to those skilled in the art, and so forth.

[0014] A “host cell” refers to a living cell into which a heterologous polynucleotide sequence is to be or has been introduced. The living cell includes both a cultured cell and a cell within a living organism. Means for introducing the heterologous polynucleotide sequence into the cell are well known, e.g., transfection, electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, and / or the like. Often, the heterologous polynucleotide sequence to be introduced into the cell is a replicable expression vector or cloning vector. In some embodiments, host cells can be engineered to incorporate a desired gene on its chromosome or in its genome. Many host cells that can be employed in the practice of the present invention (e.g., CHO cells) serve as hosts are well known in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (3rded.,2001); and Brent et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (Ringbou ed., 2003). In some preferred embodiments, the host cell is a mammalian cell.

[0015] The term “operably linked” or “operably associated” refers to functional linkage between genetic elements that are joined in a manner that enables them to carry out their normal functions. For example, a gene is operably linked to a promoter when its transcription is under the control of the promoter and the transcript produced is correctly translated into the protein normally encoded by the gene. Similarly, a self-cleaving ribozyme coding sequence is operably linked to a target gene if its insertion into the 5'-UTR, coding region, or the 3'-UTR of the gene, as described herein, allows control of the target gene expression by the ribozyme in the presence or absence of an inhibitor of the ribozyme.

[0016] A “substantially identical” nucleic acid or amino acid sequence refers to a polynucleotide or amino acid sequence which comprises a sequence that has at least 75%, 80% or 90% sequence identity to a reference sequence as measured by one of the well-known programs described herein (e.g., BLAST) using standard parameters. The sequence identity is preferably at least 95%, more preferably at least 98%, and most preferably at least 99%. In some embodiments, the subject sequence is of about the same length as compared to the reference sequence, i.e., consisting of about the same number of contiguous amino acid residues (for polypeptide sequences) or nucleotide residues (for polynucleotide sequences).

[0017] Sequence identity can be readily determined with various methods known in the art. For example, the BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)). Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

[0018] A cell has been “transformed” or “transfected” by exogenous or heterologous polynucleotide when such polynucleotide has been introduced inside the cell. The transformingpolynucleotide may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming polynucleotide may be maintained on an episomal element such as a plasmid or an AAV genome. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming polynucleotide has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming polynucleotide. A “clone” is a population of cells derived from a single cell or common ancestor by mitosis. A “cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.

[0019] The term “vector” or “construct” refers to polynucleotide sequence elements arranged in a defined pattern of organization, such that the expression of genes / gene products that are operably linked to these elements can be predictably controlled. Typically, they are transmissible polynucleotide sequences (e.g., plasmid or virus) into which a segment of foreign polynucleotide sequence can be spliced in order to introduce the foreign DNA into host cells to promote its replication and / or transcription.

[0020] A “vector” or “construct” is a nucleic acid with or without a carrier that can be introduced into a cell. Vectors capable of directing the expression of heterologous polynucleotide or target gene sequences encoding for one or more polypeptides are referred to as “expression vectors” or “expression constructs”. The cloned target gene sequence is usually placed under the control of (i.e., operably linked to) certain regulatory sequences such as promoters, enhancers, splicing-control RNA switch effector coding sequences, and ribozymecoding sequences.

[0021] As used herein, the term “target gene” refers to a nucleic acid comprising a sequence that encodes a gene product (e.g., a polypeptide). For example, a target gene includes polynucleotides comprising a region that encodes a polypeptide or polynucleotide region that regulates replication, transcription, translation, or other process important in expression of the target protein; or a polynucleotide comprising a region that encodes the target polypeptide and a region that regulates expression of the target polypeptide; or non-coding regions such as the 5' or 3' UTR or introns. Accordingly, the term “target gene” as used herein may refer to, for example, an mRNA molecule produced by transcription from a gene of interest.

[0022] As used herein, “AAV” is adeno-associated virus, and may be used to refer to the naturally occurring wild-type virus itself or derivatives thereof. The term covers allsubtypes, serotypes and pseudotypes, and both naturally occurring and recombinant forms, except where required otherwise. Pseudotyped AAV refers to an AAV that contains capsid proteins from one serotype and a viral genome including 5 '-3' ITRs of a second serotype. The abbreviation “rAAV” refers to recombinant adeno-associated viral particle or a recombinant AAV vector (or “rAAV vector”). An “AAV virus” or “AAV viral particle” refers to a viral particle composed of at least one AAV capsid protein (preferably by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than a wild- type AAV genome such as a transgene to be delivered to a mammalian cell), it is typically referred to as “rAAV”.

[0023] A retrovirus (e.g., a lentivirus) based vector or retroviral vector means that genome of the vector comprises components from a retrovirus or lentivirus as a backbone. The viral particle generated from the vector as a whole contains essential vector components compatible with the RNA genome, including reverse transcription and integration systems. Usually these will include the gag and pol proteins derived from the virus. If the vector is derived from a lentivirus, the viral particles are capable of infecting and transducing nondividing cells. Recombinant retroviral particles are able to deliver a selected exogenous gene or polynucleotide sequence such as therapeutically active genes, to the genome of a target cell.

[0024] As used herein, complementary refers to a nucleotide or nucleotide sequence that hybridizes to a given nucleotide or nucleotide sequence. For instance, for DNA, the nucleotide A is complementary to T and vice versa, and the nucleotide C is complementary to G and vice versa. For instance, in RNA, the nucleotide A is complementary to the nucleotide U and vice versa, and the nucleotide C is complementary to the nucleotide G and vice versa. Complementary nucleotides include those that undergo Watson and Crick base pairing and those that base pair in alternative modes (non-Watson and Crick base pairing). For instance, as used herein for RNA, the nucleotide G is complementary to the nucleotide U and vice versa, and the nucleotide A is complementary to the nucleotide G and vice versa. Therefore, in an RNA molecule, the complementary base pairs are A and U, G and C, G and U, and A and G. Other combinations, e.g., A and C or C and U, are considered to be non-complementary base pairs.

[0025] A complementary sequence is comprised of individual nucleotides that are complementary to the individual nucleotides of a given sequence, where the complementary nucleotides are ordered such that they will pair sequentially with the nucleotides of the given sequence. Such a complementary sequence is said to be the “complement” of the given sequence. For example, complements of the given sequence, 5'-acuaguc-3', include 3'-ugaucag-5' and 3'-uggucgg-5', among others. In the latter sequence, the third and sixth base pairs are both non-Watson and Crick G / U complementary base pairs.

[0026] The term “ribozyme” refers to an RNA molecule that is capable of catalyzing a biochemical reaction. In some instances, ribozymes function in protein synthesis, catalyzing the linking of amino acids in the ribosome. In other instances, ribozymes participate in various other RNA processing functions, such as splicing, viral replication, and tRNA biosynthesis. In some instances, ribozymes can self-cleave.

[0027] A self-cleaving ribozyme is a functional ribonucleic acid (RNA) that selfcleaves, acting on the same strand. Non-limiting examples of self-cleaving ribozymes include a hammerhead ribozyme, a twister ribozyme, a hepatitis delta virus (HDV) ribozyme, a HDV-like ribozyme, a pistol ribozyme, a hatchet ribozyme, a twister sister ribozyme, a hairpin ribozyme, a Varkud satellite (VS) ribozyme, a glucosamine-6-phosphate synthase (glmS) ribozyme, a Vgl ribozyme, a B2 retrotransposon ribozyme, an ALU retrotransposon ribozyme, a hovlinc ribozyme. It should be appreciated to those skilled in the art that a sequence of a selfcleaving ribozyme or variant thereof may be obtained from the “Rfam” database (rfam.org / ).

[0028] Crystal structures of ribozymes have been determined and provide insights into their catalytic mechanisms such that a person of skill in the art, in view of the present description, is able to design an RNA switch effector according to the present invention. The cleavage reaction proceeds by an attack of a 2' hydroxyl oxygen of a catalytic site cytosine on the phosphorus atom attached to the 3' carbon of the same residue. This breaks the sugar phosphate backbone and produces a 2', 3' cyclic phosphate.

[0029] Ribozyme activity can be regulated by complementary steric-blocking antisense oligonucleotides. Steric-blocking antisense oligonucleotides are molecules that bind to complementary target RNA but do not trigger RNase H-mediated degradation. Morpholino, locked nucleic acid (LNA) / DNA mixmer and 2'-0-methoxyethyl phosphorothioate-modified antisense oligonucleotide are all steric-blocking antisense (see, e.g., Smith ICE, Zain R., Annual Rev Pharmacol Toxicol. 59: 605-630, 2019). Morpholines, also known as Morpholino oligomers and as phosphorodiamidate Morpholino oligomers (PMO), are a type of oligomer molecule (colloquially, an oligo) used in molecular biology to modify gene expression. Its molecular structure has DNA bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups. Morpholines are synthetic molecules that are the product of a redesign of natural nucleic acid structure. Usually 25 bases in length, they bind to complementary sequences of RNA or single- stranded DNA by standard nucleic acid basepairing. Morpholines do not trigger the degradation of their target RNA molecules, unlikemany antisense structural types (e.g., phosphorothioates, siRNA). Instead, Morpholines act by “steric blocking”, binding to a target sequence within an RNA, inhibiting molecules that might otherwise interact with the RNA. Morpholines are used as research tools for reverse genetics by knocking down gene function.

[0030] Morpholino oligos are advanced tools for blocking sites on RNA to obstruct cellular processes. A Morpholino oligo specifically binds to its selected target site to block access of cell components to that target site. This property can be exploited to block translation, block splicing, block miRNAs or their targets, and block ribozyme activity. Like all gene knockdown reagents, Morpholines must be actively delivered into most cells. Morpholines can be delivered into cultured cells by a variety of methods, including scrape-loading of adherent cells, electroporation, and even microinjection. As exemplified herein, Endo-Porter delivery reagents (Gene Tools, LLC; Philomath, Oreg.) can be used to achieve excellent delivery in cultured cells in terms of the amount of Morpholino delivered per cell, even distribution throughout a population of cells, reproducibility of delivery and non-toxicity for most cell types at the recommended concentration.

[0031] The dynamic range of an RNA based switch effector refers to the extent of expression regulation afforded by the switch effector on a target sequence that is placed under the control of (i.e., operably linked to) the switch effector. This can be calculated as, e.g., fold inhibition in the target gene expression when placed under control of the RNA switch effector relative to its expression without it or when placed under control of an inactive ribozyme or inactive switch effector.

[0032] Preferably, engineered cis-acting HH ribozymes are used in constructing the RNA on switches and related expression vectors of the invention. Typically, the engineered ribozymes of the invention are type III HH ribozyme variants that are modified from a known cis-acting type I HH ribozyme. Type III HH ribozymes are modified cis-acting ribozymes that have the 5' and 3' ends in stem III. This is in contrast to the type I HH ribozymes, which have its 5' and 3' ends in stem I. Specific examples of type I HH ribozyme for engineering type III variants are exemplified herein, e.g., ribozymes N107 and N117 which are well-known in the art (see, e.g., Yen et al., Nature 431, 471-476, 2004). In addition to the well-known modified Schistosoma mansoni HH ribozymes N107 and N117, many other modified or natural HH ribozymes (including natural Schistosoma mansoni HH ribozymes) are also known in the art. See, e.g., Ferbeyre etal., Mol. Cell. Biol. 18:3880-3888, 1998; Chartrand et al., Nucleic Acids Res. 23:4092-4096, 1995; and Canny et al., Biochemistry 46:3826-3834, 2007.

[0033] In some embodiments, the HH ribozyme variants of the invention may further contain one or more modifications in the sequences that result in further improvement of dynamic range of their enzymatic activities. These additional modifications may include, e.g., optimization of stem III of the resulting type III ribozymes, modification of stem I to stabilize the tertiary interactions essential for ribozyme function, and alteration of loop I to facilitate hairpin formation. Variants of these specific enzymes with substantially identical sequences or conservatively modified residues are also encompassed by the invention.

[0034] Production of ribozyme variants of the invention can be carried out in accordance with the methods exemplified herein or molecule biology methods routinely practiced in the art. For example, they can be produced by recombinant nucleic acid techniques. Endogenous RNA polymerase of the treated cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vitro. Ribozyme variants of the invention may include modifications to either the phosphate-sugar backbone or the nucleoside, e.g., to reduce susceptibility to cellular nucleases, improve bioavailability, improve formulation characteristics, and / or change other pharmacokinetic properties. For example, the phosphodiester linkages of natural RNA may be modified to include at least one nitrogen or sulfur heteroatom. Modifications in RNA structure may be tailored to allow specific genetic inhibition while avoiding a general response to dsRNA. Likewise, bases may be modified to block the activity of adenosine deaminase. Various methods known in the art for chemically modifying RNA molecules can also be adapted for modifying the HH ribozyme variants of the invention. See, e.g., Heidenreich et al., Nucleic Acids Res, 25:776-780, 1997; Wilson et al., J Mol. Recog. 7:89-98, 1994; Chen et al., Nucleic Acids Res 23:2661-2668, 1995; and Hirschbein et al., Antisense Nucleic Acid Drug Dev 7:55-61, 1997.

[0035] RNA splicing is a process where a newly-made precursor messenger RNA (pre-mRNA) transcript is transformed into a mature messenger RNA (mRNA). For genes containing introns (non-coding regions of RNA located between two exons, or coding regions, of a gene), the introns are excised and the exons are spliced back together. Within introns, a donor site (5' end of the intron, also known as 5' splice site) including a GU sequence, and an acceptor site (3' end of the intron, also known as 3' splice site) including an AG sequence are required for splicing. Any intron typically removed from the pre-mRNA during the splicing process to generate mature mRNA can be used in the present invention. In one embodiment, constitutive introns are used, as their splicing patterns are more predictable than those of alternative introns. Any size intron can be used, e.g. from about 10 bp to aboutlOOO bp, from about 50 bp to about 900 bp, from about 100 bp to about 800, from about 200bp to about 700bp, from about 100 to about 400 bp, from about 200 to about 300 bp. Advantageously, an intron with any size or sequence that is compatible with the packaging size limitation of the vector desired, e.g. about 4.7 kb for AAV, can be used. Nonlimiting examples include COL1 A2 intron 7 (SEQ ID NO: 14), COL1A2 intron 14 (SEQ ID NO: 15), COL5A3 intron 58 (SEQ ID NO: 16), human IgGl intron (SEQ ID NO: 13).

[0036] Splicing-control RNA switches, each comprising (i) an intron, and (ii) a selfcleaving ribozyme (an intron-ribozyme) within the intron between the 5 '-splice site and 3'-splice site, as well as steric-blocking antisense oligonucleotide (ASO) complementary to the ribozyme (Fig. 1A) are described herein. A splicing-control RNA switch is useful for manipulating or modifying expression of a target gene. When a splicing-control RNA switch effector comprising an intron and a self-cleaving ribozyme is placed in the 5'-UTR or coding region of a target gene, these RNA switch effectors can inhibit the target gene expression. Without being held to a theory, likely because the self-cleavage of the ribozyme (cleavage rate: 35-70 min1or faster; see. Khvorova et al., Nat Struct Biol. 10:708-712, 2003) can occur before the pre-mRNA splicing (splicing rate: 0.1 min1or slower; see. Wachutka et al. , Elife. 8:e45056, 2019) and result in splitting of the pre-mRNA into two non-functional fragments susceptible to fast degradation. Blocking ribozyme self-cleavage with the complementary steric-blocking antisense oligonucleotide (ASO) provided in trans can rescue pre-mRNA splicing and then a full-length mature mRNA encoding a transgene.

[0037] As exemplified herein, the splicing-control RNA switch effectors comprising the engineered intron-ribozyme in combination with the use of a morpholino oligonucleotide inducer or the optimized morpholino described herein can be readily employed to control expression of a target gene expression in a target cell. The invention accordingly provides expression constructs that harbor a target gene that is operably linked to an intron-ribozyme of the present invention. Such an inserted intron-ribozyme can inhibit translation by self-cleavage of the mRNA transcript expressed from the vector. Typically, the sequence encoding an intronribozyme variant described herein can be inserted into the target gene at a non-coding region that is important for translation. The insertion site can be at a position that lies in any of the untranslated regions that are known to be involved in controlling mRNA transcription, transport, translation, and / or degradation. These include, e.g., stem-loop structures, upstream initiation codons and open reading frames, internal ribosome entry sites and various cis-acting elements that are bound by RNA-binding proteins. In the absence of the morpholino oligonucleotide inducer, the ribozyme undergoes self-cleavage, resulting degradation of the mRNA and inhibition of translation.

[0038] In some other embodiments, a sequence encoding the intron-ribozyme splicingcontrol RNA switch effector can be inserted at a site that lies in the 5 '-untranslated region (5'-UTR) of the corresponding mRNA transcript. The 5'-UTR, also known as a leader sequence or leader RNA, is the region of an mRNA that is directly upstream from the initiation codon. This region is important for the regulation of translation of a transcript by differing mechanisms in viruses, prokaryotes and eukaryotes. While called untranslated, the 5'-UTR or a portion of it is sometimes translated into a protein product. This product can then regulate the translation of the main coding sequence of the mRNA. In many other organisms, however, the 5'-UTR is completely untranslated, instead forming a complex secondary structure to regulate translation. Regulatory elements within 5'-UTRs have also been linked to mRNA export. By inserting the intron-ribozyme at an appropriate site in the 5'-UTR corresponding region of the target gene, expression of the target gene can be efficiently controlled with a morpholino inducer that specifically inhibits the ribozyme in the expression construct.

[0039] In some other embodiments, a sequence encoding an intron-ribozyme described herein can be inserted at a site that lies in the coding of the corresponding mRNA transcript. The coding region, also known as the open reading frame (ORF) or coding sequence region (CDS), is the region of an mRNA that is produced after introns are spliced or removed. The coding region is flanked by the 5' UTR and the 3' UTR. The 5' UTR is located between the cap site, a 5' cap known as 7-methylguanosine that is added to the 5' end of the RNA transcript, and the initiation codon. The 3' UTR contains the poly adenylation signals that initiate the addition of the poly(A) tail. The coding region is read by ribosomes during translation of the mRNA into protein. By inserting the ribozyme at an appropriate site in the coding region of the target gene, expression of the target gene can be efficiently controlled with a morpholino inducer that specifically inhibits the ribozyme in the expression construct. Any location within the target gene (e.g., target gene sequence) is effective. Empirically preferred is a location between the first and second thirds of the coding region.

[0040] In some embodiments, a self-cleaving ribozyme can be inserted in the 3'-untranslated region (3'-UTR). Regulatory regions within the 3 '-untranslated region can influence polyadenylation, translation efficiency, localization, and stability of the mRNA. The 3'-UTR contains both binding sites for regulatory proteins as well as microRNAs (miRNAs). The 3'-UTR also has silencer regions which bind to repressor proteins and will inhibit the expression of the mRNA. Many 3'-UTRs also contain AU-rich elements (AREs). Proteins bind AREs to affect the stability or decay rate of transcripts in a localized manner or affect translation initiation. Furthermore, the 3'-UTR contains the sequence aauaaa that directsaddition of several hundred adenine residues called the poly(A) tail to the end of the mRNA transcript. Poly(A) binding protein (PABP) binds to this tail, contributing to regulation of mRNA translation, stability, and export. For example, poly (A) tail bound PABP interacts with proteins associated with the 5' end of the transcript, causing a circularization of the mRNA that promotes translation. Cleavage by the inserted ribozyme at any of these regions in the 3'-UTR can lead to disruption or suppression of mRNA translation.

[0041] In some embodiments, an RNA switch effector comprises multiple copies of the intron-ribozyme and / or self-cleaving ribozyme inserted in multiple locations of a target gene. In non-limiting examples, and as shown herein below, an RNA switch effector of the invention can comprise one or more intron-ribozyme and / or self-cleaving ribozyme sequences inserted in the 5'-UTR, the coding region, the 3'-UTR, or any combination thereof, e.g. intron-ribozyme in the 5'-UTR and coding region, and a ribozyme in the 3'-UTR. Other combinations will be evident to a person of skill in the art and can be tested for ability to control target gene expression by methods provided herein and known in the art.

[0042] The expression constructs of the invention are typically circular vectors and, in addition to the RNA switch effector sequence and an operably linked target gene, can optionally also contain selectable markers, an origin of replication, and other elements. For example, the vector can contain a selection marker. The selection marker allows one to select for cells into which the vector has been introduced and / or stably integrated. In some embodiments, the selection marker can be a polynucleotide encoding a protein or enzyme that confers to the cells visually identifiable characteristics. For example, the vector can harbor a selection marker encoding Renilla luciferase reporter enzyme. Other examples include jellyfish green fluorescent protein (GFP) and bacterial P-galactosidase. In some other embodiments, the selection marker for identifying host cells into which the vector was introduced and / or stably integrated can be an antibiotic resistance gene. Examples of such markers include antibiotic resistance genes for neomycin, chloramphenicol, blasticidin, hygromycin, and zeocin. The expression vectors of the invention can also bear other DNA sequences that may be necessary for proper RNA transcription and processing, as well as proper ribosome assembly and function. For example, some vectors of the invention additionally harbor sequences corresponding to the 5'-ETS and ITS elements of the precursor RNA sequence.

[0043] To control a specific target gene expression, the target gene is typically operably fused with a sequence encoding an RNA switch effector described herein in the expression construct. Depending on the specific cells into which the target gene is to be introduced, a suitable expression construct is first to be generated with the target gene and the intron-ribozyme coding sequence. For controlling gene expression in mammalian cells, the expression constructs can be recombinantly produced with many vectors well known in the art. These include viral vectors such as recombinant adenovirus, retrovirus, lend virus, herpesvirus, poxvirus, papilloma virus, or adeno-associated virus. The vectors can be present in liposomes, e.g., neutral or cationic liposomes, such as DOSPA / DOPE, DOGS / DOPE or DMRIE / DOPE liposomes, and / or associated with other molecules such as DNA-anti-DNA antibody-cationic lipid (DOTMA / DOPE) complexes. Exemplary viral vectors suitable for the invention are described herein. For in vivo application, the expression vectors may be administered to a subject via any route including, but not limited to, intramuscular, buccal, rectal, intravenous or intracoronary routes.

[0044] In some preferred embodiments the expression constructs are based on adeno-associated viral (AAV) vectors or adenoviral vectors. Adeno-associated virus (AAV) is a small, nonenveloped virus that was adapted for use as a gene transfer vehicle. Adeno-associated virus vectors refer to recombinant adeno-associated viruses that are derived from nonpathogenic parvoviruses. They evoke essentially no cellular immune response and produce transgene expression lasting months in most systems. Like adenovirus, adeno-associated virus vectors also have the capability to infect replicating and nonreplicating cells and are believed to be nonpathogenic to humans. Delivery of heterologous polynucleotide sequences via recombinant AAV can provide for safe, unobtrusive and sustained expression (>10 year) of high levels of protein therapeutics. As exemplification, the invention provides AAV vectors which are used for controlling expression of a reporter gene (e.g., firefly luciferase) or a therapeutic protein (e.g., FGF21). In these vectors, the target gene (Flue or FGF21) is operably fused to an intronribozyme described herein. As demonstrated herein, these expression constructs allow control of transgene expression in vivo in a manner that is dose-dependent on the presence of the morpholino inducer.

[0045] In some embodiments, the expression constructs are based on retroviral vectors. In order to construct a retroviral vector for gene transfer, the target gene and the intronribozyme coding sequence (which is fused with the target gene at, e.g., the 3'-UTR or 5'-UTR region) are inserted into the viral genome in the place of certain viral sequences to produce a viral construct that is replication-defective. In order to produce virions, a producer host cell or packaging cell line is employed. The host cell usually expresses the gag, pol, and env genes but without the LTR and packaging components. When the recombinant viral vector containing the gene of interest together with the retroviral LTR and packaging sequences is introduced into a host cell (e.g., by calcium phosphate precipitation), the packaging sequences allow theRNA transcript of the recombinant vector to be packaged into viral particles, which are then secreted into the culture media. The media containing the recombinant retroviruses can then be collected, optionally concentrated, and used for transducing host cells (e.g., stem cells) in gene transfer applications. Suitable host or producer cells for producing recombinant retroviruses or retroviral vectors according to the invention are well known in the art (e.g., 293T cells exemplified herein). Many retroviruses have already been split into replication defective genomes and packaging components. For other retroviruses, vectors and corresponding packaging cell lines can be generated with methods routinely practiced in the art. The producer cell typically encodes the viral components not encoded by the vector genome such as the gag, pol and env proteins. The gag, pol and env genes may be introduced into the producer cell and stably integrated into the cell genome to create a packaging cell line. The retroviral vector genome is then introduced- into the packaging cell line by transfection or transduction to create a stable cell line that has all of the DNA sequences required to produce a retroviral vector particle. Another approach is to introduce the different DNA sequences that are required to produce a retroviral vector particle, e.g. the env coding sequence, the gag-pol coding sequence and the defective retroviral genome into the cell simultaneously by transient triple transfection. Alternatively, both the structural components and the vector genome can all be encoded by DNA stably integrated into a host cell genome.

[0046] Expression vectors harboring a target gene sequence and an operably linked RNA switch effector coding sequence can be readily constructed in accordance with methodologies known in the art of molecular biology in view of the exemplifications provided herein specification. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (3rded., 2001); Brent et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (ringbou ed., 2003); and Freshney, Culture of Animal Cells: A Manual of Basic Technique, Wiley-Liss, Inc. (4thed., 2000). Typically, the expression vectors are assembled by inserting into a suitable vector backbone the polynucleotide encoding the target gene and ribozyme sequence fusion, sequences encoding selection markers, and other optional elements. Many virus-based expression vector systems well known in the art can be used in the invention. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol.66:2731-2739, 1992; Johann et al., J. Virol. 66:1635-1640, 1992; Sommerfelt et al., Virol.176:58-59, 1990; Wilson et al., J. Virol. 63:2374-2378, 1989; Miller et al., J. Virol. 65:2220-2224, 1991; and PCT / US94 / 05700). Adeno-associated viral vectors have also been used inmany reported studies for gene therapy in research and clinical environment. See, e.g., Kaplitt et al., Lancet 369: 2097-105, 2007; Daya et al., Clin Microbiol Rev. 21(4): 583-593, 2008; Strobel et al., Am. J. Resp. Cell Mol. Biol. 53: 291-302, 2015; and Kotterman et al., Nat. Rev. Genet. 15:445-451, 2014. Many viral vectors and related reagents (e.g., packaging cell lines) suitable for the invention can be obtained commercially. For example, AAV based expression vectors for practicing the invention can be based on the pAAV-MCS construct that is available from Agilent Technologies (Santa Clara, Calif.). Similarly, a number of retroviral vectors and compatible packing cell lines are available from Clontech (Mountain View, Calif.). Examples of lentiviral based vectors include, e.g., pLVX-Puro, pLVX-IRES-Neo, pLVX-IRES-Hyg, and pLVX-IRES-Puro. Corresponding packaging cell lines are also available, e.g., Lenti-X 293T cell line. In addition to lentiviral based vectors and packaging system, other retroviral based vectors and packaging systems are also commercially available. These include MLV based vectors pQCXIP, pQCXIN, pQCXIQ and pQCXIH, and compatible producer cell lines such as HEK 293 based packaging cell lines GP2-293, EcoPack 2-293 and AmphoPack 293, as well as NIH / 3T3-based packaging cell line RetroPack PT67. Any of these and other retroviral vectors and producer cell lines may be employed in the practice of the present invention.

[0047] Combinations of the various intron-ribozyme and ribozyme variants described herein provide functional RNA switch effectors to regulate gene expression in a target cell. Typically, the target cell is engineered to harbor an expression construct that includes a coding sequence for the target gene that is operably linked to a sequence encoding an RNA switch effector of the invention. Upon transcription, translation of the encoded target polypeptide molecule is inhibited as a result of enzymatic cleavage of the RNA transcript by the ciscleaving ribozyme. To activate target gene expression, an inhibitor molecule or expression inducer that specifically targets the ribozyme is employed.

[0048] Preferably, the inhibitor molecule used for activating target gene expression is an RNase H independent antisense oligonucleotide, such as a morpholino based oligomeric compound, a 2'-0-methoxyethyl phosphorothioate-modified antisense oligonucleotide, or a locked nucleic acid (LNA) / DNA mixmer that contains an oligomer (oligonucleotide) that specifically targets the ribozyme sequence in the expression construct. Morpholino-based oligomeric compounds are non-ionic mimetics of oligonucleotides. They are different from natural nucleic acids, with methylenemorpholine rings replacing the ribose or deoxyribose sugar moieties and non-ionic phosphorodiamidate linkages replacing the anionic phosphates of DNA and RNA. Each morpholine ring suitably positions one of the standard DNA bases (A, C, G, T) for pairing, so that a 25-base Morpholino oligo strongly and specifically binds to itscomplementary 25-base target site in a strand of RNA via Watson-Crick pairing. Because the uncharged backbone of the Morpholino oligo is not recognized by enzymes, it is completely stable to nucleases. Morpholino oligonucleotides with various structures and linking groups are described in the art. See, e.g., Dwaine et al., Biochemistry, 2002, 41, 4503-4510; Heasman et al., J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,521,063, 5,506,337, 5,034,506, 5,166,315, and 5,185,444.

[0049] Provided that they are modified to contain an anti- sense oligonucleotide that is complementary to the self-cleaving ribozyme in the RNA switch effectors described herein, many Morpholino oligos known in the art and readily available from commercial vendors can be employed in the practice of the invention. These include unmodified morpholino oligos as well as modified morpholino compounds such as photo-morpholinos and vivo-morpholinos. In various embodiments, the invention can employ phosphorodiamidate morpholino oligonucleotides for suppressing the ribozyme in the RNA ON-switch described herein and thereby inducing gene expression. In some preferred embodiments, the invention utilizes peptide-conjugated morpholinos to induce gene expression from an expression vector harboring the RNA ON-switch described herein.

[0050] A peptide-conjugated phosphorodiamidate morpholino oligomer (PPMO) is a morpholino oligo that is conjugated to a cell penetrating peptide, which improves delivery of the PMO into cells. The peptide-conjugated morpholino can be assembled by coupling the peptide-delivery group to a Morpholino either in solution or while the oligo is still bound to its solid-phase synthesis resin.

[0051] As described herein, the RNase H independent antisense oligonucleotide (ASO) used in the invention should typically contain sequences that are complementary to the ribozyme element of the RNA switches that are present in the expression vectors. In some embodiments, the ASO compounds contain complementary sequences that target the 5'-region of the ribozyme. Specific examples of ASO compounds that can be used in combination with the RNA switches described herein include the octa-guanidine dendrimer-coupled PMO (v-M8), two PPMOs (P7-M8 and DG9-M8), and thirteen 2'-O-MOE / PS ASOs (Zon-MOE-1 through Zon-MOE-13). The two PPMOs and v-M8 contain a morpholino oligonucleotide that has a sequence shown in SEQ ID NO:6 (gtacccgaagtggaatccaggacgc). The thirteen 2'-O-MOE / PS ASOs have sequences shown in SEQ ID NOs: 24-36. As detailed herein, these ASOs can be used to induce gene expression from vectors that contain any of the variant ribozymes in switch effectors exemplified herein, e.g., T3H38. The ASO compounds that specificallytarget and inactivate a ribozyme can be readily synthesized de novo via standard protocols of organic chemistry and molecule biology. See, e.g., Mardirossian et al., J. Nucl. Med. 38:907-13, 1997; Summerton et al., Biochim. Biophys. Acta 1489, 141-158, 1999; Morcos et al., Biotechniques 45, 613-614, 2008; WO2014052276A1; and U.S. Pat. No. 6,899,864. Alternatively, they can be custom synthesized by commercial suppliers, e.g., Gene Tools, LLC (Philomath, Oreg.), Sarepta Therapeutics (Cambridge, Mass.), and lonis Pharmaceuticals (Carlsbad, CA).

[0052] Controlling target gene expression via the RNA based switches of the invention can be used in various clinical or industrial applications. The recombinant expression vectors expressing a target gene or heterologous polynucleotide sequence can be transduced into host cells in various gene therapy and industrial bioengineering settings. For example, the target gene or heterologous polynucleotide sequence harbored by the recombinant expression vectors can encode a therapeutic agent. These constructs can be transferred, e.g., to express a biologically important agent that is otherwise present in normal healthy subjects (e.g., FGF21 as exemplified herein), to express a protein drug to treat various diseases (e.g., cancer), to express immunomodulatory genes to fight viral infections, or to replace a gene's function as a result of a genetic defect. In various embodiments, the target gene can encode one of the many therapeutic proteins known in the art. These include erythropoietin (Epo), FGF21, leptin, factor VIII, factor IX, P-globin, low-density lipoprotein receptor, adenosine deaminase, purine nucleoside phosphorylase, sphingomyelinase, glucocerebrosidase, cystic fibrosis transmembrane conductance regulator, a-antitrypsin, CD- 18, ornithine transcarbamylase, arginino succinate synthetase, phenylalanine hydroxylase, branched-chain a-ketoacid dehydrogenase, fumarylacetoacetate hydrolase, glucose 6-phosphatase, a-L-fucosidase, [3-glucuronidase, a-L-iduronidase, galactose 1 -phosphate uridyltransferase, interleukins (e.g., IL-2), cytokines (e.g., interferon alpha), small peptides (e.g., insulin, GLP-1, GIP), immunoadhesins (e.g., etanercept), and the like. Other therapeutic proteins that can be expressed from a target polynucleotide in the engineered host cell of the invention include, e.g., Herceptin®, polypeptide antigens from various pathogens such as disease-causing bacteria or viruses (e.g., E. coli, P. aeruginosa, S. aureus, malaria, HIV, rabies virus, HBV, and cytomegalovirus), and other proteins such as lactoferrin, thioredoxin and beta-caseinvaccines.

[0053] Additional examples of therapeutic agents or proteins of interest include, but are not necessarily limited to tissue plasminogen activator (tPA), urokinase, streptokinase, neutropoesis stimulating protein (also known as filgastim or granulocyte colony stimulating factor (G-CSF)), thrombopoietin (TPO), growth hormone, emoglobin, insulinotropin,imiglucerase, sarbramostim, endothelian, soluble CD4, soluble ACE2, and antibodies and / or antigen-binding fragments (e.g., FAbs) thereof (e.g., orthoclone OKT-e (anti-CD3), GPIIb / IIa monoclonal antibody, adalimumab, nivolumab, pembrolizumab), ciliary neurite transforming factor (CNTF), granulocyte macrophage colony stimulating factor (GM-CSF), brain-derived neurite factor (BDNF), parathyroid hormone(PTH)-like hormone, insulinotrophic hormone, insulin-like growth factor-1 (IGF-1), platelet-derived growth factor (PDGF), epidermal growth factor (EGF), acidic fibroblast growth factor, basic fibroblast growth factor, transforming growth factor p, neurite growth factor (NGF), interferons (IFN) (e.g., IFN-a2b, IFN-a2a, IFN-aNl, IFN-pib, IFN-y), interleukins (e.g, IE-1, IE-2, IL-8), tumor necrosis factor (TNF) (e.g., TNF-a, TNF- ), transforming growth factor-a and -p, catalase, calcitonin, arginase, phenylalanine ammonia lyase, L-asparaginase, pepsin, uricase, trypsin, chymotrypsin, elastase, carboxypeptidase, lactase, sucrase, intrinsic factor, vasoactive intestinal peptide (VIP), calcitonin, Ob gene product, cholecystokinin (CCK), serotonin, and glucagon.

[0054] In some embodiments, an RNA switch of the invention is used to control expression of a target gene for regulating cell growth, differentiation or viability in cells transplanted into a subject. The expression constructs used in these methods expresses a target gene operably linked to one or more intron-ribozyme, and optionally a ribozyme variant, of the invention. The target gene encodes a polypeptide that regulates the growth or other cellular processes of the cell. The level of expression of the polypeptide is dependent on the addition of an inducer (e.g., a morpholino oligomer). In these embodiments, binding of the inducer to the ribozyme suppresses activity of the cis-acting ribozyme, resulting in activation of expression of the polypeptide. Thus, expression of the polypeptide alters regulation of cell growth, differentiation or viability in the cells in a manner dependent on the administered inducer. As exemplification, these methods can be used to prevent the growth of hyperplastic or tumor cells, or even the unwanted proliferation of normal cells. The methods can also be used to induce the death of fat cells, to regulate growth and differentiation of stem cells, or to regulate activation of an immune response, or to regulate proliferation, apoptosis, or effector function of genetically engineered T cells (e.g. CAR-T cells) for cancer immune therapies.

[0055] In some embodiments, the target gene can encode an antigen of interest for the production of antibodies. Upon introducing the switch effector-encoding expression construct into a subject, production of antibodies to the antigen encoded by the target gene can be controlled by the absence or presence of the inducer that specifically binds to the ribozyme in the switch effector fused to the antigen-expressing mRNA. In some other embodiments, the target gene can encode a reporter gene, e.g., fluorescent or luminescent reporter proteins suchas GFP or luciferase, enzymatic reporters such as alkaline phosphatase, or colorimetric reporters such as lacZ. Expression of the reporter molecule can be used to correlate with and determine the amount of an antisense inducer that binds to the ribozyme.

[0056] In some preferred embodiments, the RNA switch effectors described herein can enable safe and effective use of gene therapeutics, expressed from cells engineered by a viral vector (e.g., AAV, ANV, and retroviral vector) or a genome editing technology (e.g., RNA-guided programmable recombinase, integrase, transposase, and retro-transposase), for a range of applications. For example, it can be used for temporal and dose control of gene therapeutics with narrow therapeutic windows and / or major contraindications. Here, an ultra-efficient RNA ON switch can enable precise control of transgene expression to optimal levels and conditional discontinuation of transgene expression when major contraindications emerge. As many in vivo gene therapy relies on somatic cells to produce a therapeutic payload, there is significant interindividual variability in transgene expression among different individuals who have received the same doses of a gene therapy vector, as well as significant intra-individual variation of transgene expression over time. These variabilities could make baseline transgene expression more problematic for therapeutics with narrow therapeutic windows or major contraindications. Here, an ultra-efficient RNA ON switch further allows for individualized adjustment of transgene expression to minimize inter-individual variation, real-time tuning of transgene expression to minimize intra-individual variation or to reflect disease progression, and mitigation of safety issues associated with prolonged and varied baseline transgene expression when the therapy needs to be discontinued long-term or permanently. Moreover, an ultra-efficient RNA ON switch may be directly used or further optimized for temporal control of in vivo genome editing therapies. AAV is one of the most efficient in vivo delivery systems for genome editors and AAV-delivered extrahepatic genome editing has enormous potential for treating a range of diseases. However, AAV-mediated long-lasting expression of a genome editor could lead to multiple major safety issues, including persistent off-target editing of the genome, on-target concatemeric insertion of AAV vector genome into chromosomes, and immune clearance of editor-expressing cells. These issues could significantly increase the risk, undercut the efficacy, and limit the application of this approach. An RNA ON switch-mediated temporal control of a genome editor may help mitigate these safety issues through switch-regulated transient induction of genome editor expression, and delaying the expression until well after AAV vector DNA circularized and after AAV-induced innate immune responses subside. Further, an ultra-efficient RNA ON switch may be directly used or further optimized for temporal control of a suicide gene, which can be transiently induced from an AAV vectorto inactivate the same vector when severe side effects or major contraindications emerge. Finally, an ultra-efficient RNA ON switch may be used for regulating survival, payload expression, or local activation of cell-based gene therapies, just to name a few.

[0057] Muscle-targeted ‘bio-factory’ gene therapy is a promising approach for the treatment of a range of diseases, such as rare genetic diseases (e.g., alpha- 1 antitrypsin deficiency, congenital leptin deficiency), chronic metabolic disorders (e.g., diabetes, obesity), autoimmune diseases, chronic hormone / cytokine deficiency (e.g., renal anemia), and viral infectious diseases (e.g., HIV-1 infection, Ebola). In the current study, a single dose of a regulator morpholino oligo can induce Zon-regulated AAV transgene expression for up to five months with an induction half-life of -500 hours in mice, which is orders of magnitude longer than the half-life of many short-lived biologies (e.g., interleukins, interferons, GLP-1, insulin, FGF21, leptin, Epo; half-life: minutes to hours). Thus, utilizing our RNA switch system to regulate ‘bio-factory’ gene therapy offers a safe and generalizable approach to developing long-acting therapeutics based on these short-lived biologies, which normally also have narrow therapeutic windows and / or major contraindications. This regulated ‘bio-factory’ gene therapy approach has two major strengths over recombinant protein therapy with these biologies. First, in contrast to short-lived protein therapy, which is associated with great fluxes in the concentration of the biologic in circulation, inducible gene therapy can provide a flat pharmacokinetic profile of the biologic, likely leading to improved safety of the treatment. Second, the long induction half-life of the RNA switch system described herein enables injections with much lower frequencies (e.g., monthly vs. daily) and fewer total injection numbers, allowing for improved patient experiences, better medication adherence, and the potential for improved treatment outcomes.

[0058] For a review of gene therapy procedures, see Anderson, Science 256:808-813, 1992; Nabel & Feigner, TIBTECH 11:211-217, 1993; Mitani & Caskey, TIBTECH 11:162-166, 1993; Mulligan, Science 926-932, 1993; Dillon, TIBTECH 11:167-175, 1993; Miller, Nature 357:455-460, 1992; Van Brunt, Biotechnology 6:1149-1154, 1998; Vigne, Restorative Neurology and Neuroscience 8:35-36, 1995; Kremer & Perricaudet, British Medical Bulletin 51:31-44, 1995; Haddada et al., in Current Topics in Microbiology and Immunology (Doerfler & Bohm eds., 1995); Yu et al., Gene Therapy 1:13-26, 1994, and Dunbar et al., Science.359:eaan4672, 2018.

[0059] In some embodiments, the target gene to be expressed under the control of an RNA switch effector of the invention can be a gene that encodes a therapeutic polypeptide or agent noted above. For example, transfection of tumor suppressor gene p53 into human breastcancer cell lines has led to restored growth suppression in the cells (Casey et al., Oncogene 6: 1791-7, 1991). In some other embodiments, the target gene operably linked to an RNA switch effector of the invention can encode an enzyme. For example, the gene can encode a cyclin-dependent kinase (CDK). It was shown that restoration of the function of a wild- type cyclin-dependent kinase, pl6INK4, by transfection with a pl6INK4-expressing vector reduced colony formation by some human cancer cell lines (Okamoto, Proc. Natl. Acad. Sci. U.S.A. 91:11045-9, 1994). Additional embodiments of the invention encompass RNA switch-controlled expression in target cells of cell adhesion molecules, other tumor suppressors such as p21 and BRCA2, inducers of apoptosis such as Bax and Bak, other enzymes such as cytosine deaminases and thymidine kinases, hormones such as growth hormone and insulin, and interleukins and cytokines. As exemplified herein, preferred target cells for the present invention are mammalian cells, e.g., cells of both human and non-human animals including vertebrates and mammals. In some embodiments, the target cells are cancer or tumor cells. Various cancer types are suitable for treatment with methods of the invention by introducing into the cancer cells an expression construct that can be turned on or off via the addition of an antisense oligonucleotide inhibitor of the ribozyme. In some other embodiments, the target cells are stem cells. The expression construct introduced into the cells can express a polypeptide that regulates differentiation and proliferation of stem cells. Stem cells suitable for practicing the invention include and are not limited to hematopoietic stem cells (HSC), embryonic stem cells or mesenchymal stem cells. In some embodiments, the target cells are muscle cells.

[0060] The invention provides engineered mammalian cells which express a target gene that is operably fused to an RNA switch effector described herein. Using the RNA switch effectors or expression vectors of the invention, various mammalian cells can be employed for introducing an expression vector of the invention or by stably integrating the rDNA described herein into the host genome. Polynucleotides encoding the RNA switch effectors or expression vectors can be introduced into an appropriate host cell (e.g., a mammalian cell such as 293T cell, N2a cell or CHO cell, or PBMC, or primary immune cells) by any means known in the art. The cells can transiently or stably express the introduced ribozyme containing target gene. Preferably, mammalian cells are used in these embodiments of the invention. Mammalian expression systems allow for proper post-translational modifications of expressed mammalian proteins to occur, e.g., proper processing of the primary transcript, glycosylation, phosphorylation and advantageously secretion of expressed product. Suitable cells include cells from rodent, cow, goat, rabbit, sheep, non-human primate, human, and the like. Specific examples of cell lines include CHO, BHK, HEK293, N2a, VERO, HeLa, COS, MDCK, andW138. As exemplified herein, any convenient protocol may be employed for in vitro or in vivo introduction of the expression vector into the host cell, depending on the location of the host cell. In some embodiments, where the host cell is an isolated cell, the expression vector may be introduced directly into the cell under cell culture conditions permissive of viability of the host cell, e.g., by using standard transformation techniques.

[0061] Alternatively, where the host cell or cells are part of a multicellular organism, the targeting vector may be administered to the organism or host in a manner such that the expression vector is able to enter the host cell(s), e.g., via an in vivo or ex vivo protocol. By “in vivo,” it is meant in the target construct is administered to a living body of an animal. By “ex vivo” it is meant that cells or organs are modified outside of the body. Such cells or organs are typically returned to a living body. Techniques well known in the art for the transfection of cells can be used for the ex vivo administration of nucleic acid constructs. The exact formulation, route of administration and dosage can be chosen empirically. See e.g. Fingl et al., 1975, in The Pharmacological Basis of Therapeutics, Ch. 1 p 1). For example, nucleic acid constructs can be delivered with cationic lipids (Goddard, et al, Gene Therapy, 4:1231-1236, 1997; Gorman et al., Gene Therapy 4:983-992, 1997; Chadwick et al., Gene Therapy 4:937-942, 1997; Gokhale et al., Gene Therapy 4:1289-1299, 1997; Gao and Huang, Gene Therapy 2:710-722, 1995), using viral vectors (Monahan et al., Gene Therapy 4:40-49, 1997; Onodera et al., Blood 91:30-36, 1998), by uptake of “naked DNA”, and the like. In some other embodiments, the expression constructs of the invention can be introduced into the target cells via a liposome. Preferably, the liposome is composed of steroid, particularly a combined substance with phospholipid combined with cholesterol, particularly a combined substance with phospholipid with high phase transition temperature. The physical properties of liposomes depend on pH, ion strength and the existence of divalent cations.

[0062] Pharmaceutical preparations or compositions are typically employed in the practice of the various therapeutic embodiments of the invention. The pharmaceutical preparations contain an RNA switch effector of the invention or its coding sequence, or an expression construct harboring the RNA switch effector coding sequence. In some embodiments, a target gene sequence is operably linked to the RNA switch effector coding sequence in the expression construct as described herein. In addition, the pharmaceutical compositions of the invention can also contain a pharmaceutically acceptable carrier suitable for administration to a human or non-human subject. The pharmaceutically acceptable carrier can be selected from pharmaceutically acceptable salts, ester, and salts of such esters.

[0063] The following examples are provided to further illustrate the invention but not to limit its scope. Other variants of the invention will be readily apparent to one of ordinary skill in the art and are encompassed by the appended claims.EXAMPLE 1: ENGINEERING SWITCH MECHANISM OF GENE EXPRESSION BY SELF-CLEAVAGE-MEDIATED REGULATION OF PRE-MRNA SPLICING

[0064] Because the self-cleavage of a hammerhead ribozyme can occur within seconds to a minute and may be faster than the multi-step, complex pre-mRNA splicing process — which can take more than 10 minutes to complete for an intron of 200 nt — the inventors hypothesized that a fast self-cleaving ribozyme could be inserted into an intron and used to regulate gene expression by competing with pre-mRNA splicing (Fig. 1A). Self-cleavage of the ribozyme may occur before the pre-mRNA splicing and result in splitting of the pre-mRNA into two nonfunctional fragments susceptible to fast degradation. Blocking ribozyme self-cleavage with a complementary steric-blocking ASO may rescue pre-mRNA splicing and then a full-length mature mRNA encoding a transgene.

[0065] To test this hypothesis, the optimized self-cleaving hammerhead ribozyme T3H38 (SEQ ID NO:5) — which is 63 bp in length and can be specifically blocked by its complementary morpholino oligonucleotide v-M8 (FIG. IB) and human IgGl intron 2 (IGHG1 ) (SEQ ID NO: 13) was selected as the initial framework for a panel of splicing control RNA switch effector constructs (SEQ ID NOs: 1-4). V-M8 is a vivo-morpholino comprised of a Morpholino oligo (SEQ ID NO:6) with a unique covalently linked delivery moiety, which is comprised of an octa-guanidine dendrimer. In this assay, the v-M8 oligo was used to block ribozyme self-cleavage and rescue Glue expression. The human IgGl intron 2 (IGHG1) was chosen because it is a small (118 bp) constitutive intron containing predicted strong 5' and 3' splice sites (SS), as well as a branch point sequence (BPS) that conforms to the human branch point consensus motif yUnAy. As the 5'SS, BPS, and 3'SS are three conserved sequence elements critical for intron splicing, multiple intronic positions were tested to identify optimal locations for ribozyme insertion. A copy of the T3H38 ribozyme, or its catalytically inactive mutant (FIG. IB), was inserted at 50 bp, 64 bp, 89 bp, or 107 bp downstream of the 5'SS (FIG.1C). The resulting splicing-control RNA effectors (CI-1.1 (SEQ ID NO:1), CI-1.2 (SEQ ID NOG), CI- 1.3 (SEQ ID NOG) CI-1.4 (SEQ ID NO:4)) were inserted into the coding region of a Gaussia luciferase (Glue) reporter gene within a dual-reporter plasmid that also encoded an unregulated Cypridina luciferase Clue) gene, driven by an independent promoter and serving as an internal control. The switch effector constructs were evaluated in 293T cells using tworeporter assays. In the reporter inhibition assay, the effector index (El) was measured, defined as the fold inhibition of Glue expression by each splicing-control RNA effector relative to its corresponding ribozyme-inactive control. In the reporter switch-on assay, each switch’s dynamic range (DR) was assessed, defined as the fold induction of Glue expression by the functional morpholino v-M8 relative to a nonfunctional control morpholino (M3R). To ensure more accurate calculation of El and DR, background noise in the Glue assay was quantified (FIG. 7A) and subtracted from raw signals prior to calculation. Clue expression was concurrently monitored to correct for plasmid dose, transfection efficiency, and non-specific effects of v-M8. Corrected Glue expression (corr-Gluc), and consequently corrected effector index (CEI) and corrected dynamic range (CDR), were calculated for each construct. All tested effectors exhibited regulatory activity, with CI- 1.1 showing the strongest response: a CEI of 19-fold and a CDR of 11.5-fold in response to v-M8 (FIGs. ID, IE, 7B, and 7C). Reverse transcription PCR (RT-PCR) and Sanger sequencing confirmed its ability to modulate spliced mRNA levels (FIGs. IF and 1G).

[0066] Without wishing to be bound by theory, CI-l.l / v-M8 may most effectively regulate gene expression because the ribozyme is positioned closest to the 5' splice site (5'SS) and upstream of the branch point sequence (BPS). It therefore may fold and cleave before the BPS and 3'SS are transcribed and subsequently recognized by the SF1 and U2AF proteins — events that initiate spliceosome assembly into the early (E) complex. By contrast, when the ribozyme is positioned immediately adjacent to the BPS or between the BPS and 3'SS (e.g., CI- 1.3 and CI- 1.4), its folding and cleavage may need to compete with already assembled supramolecular spliceosomal RNP complexes. Accordingly, a panel of new effectors were constructed, each consisting of one of three small (92-182 bp) constitutive introns with a copy of T3H38 inserted between the 5'SS and BPS (FIG. 7D). Interestingly, similar to CI-1.1, all effectors with the ribozyme inserted ~50 bp downstream of the 5'SS (CI-2.2 (SEQ ID NO:8), CI-3.2 (SEQ ID NO: 10), CI-4.1 (SEQ ID NO: 11)) outperformed their counterparts in which the ribozyme was inserted either closer to or farther from the 5'SS (CI-2.1 (SEQ ID NO: 7), CI-3.1 (SEQ ID NO:9), CI-4.2 (SEQ ID NO: 12); FIGs. 7E-7H), suggesting that this position represents an optimal site for ribozyme insertion.

[0067] Because the 5'-terminal 7-methylguanosine (m7G) cap plays multiple indispensable roles in the lifecycle of mammalian mRNAs — including promoting pre-mRNA splicing, facilitating nuclear export, initiating translation, and protecting transcripts from 5 '-3' exonuclease degradation — and because inserting a splicing-control RNA effector in the 5' UTR would not leave any “scar” sequence or secondary structure in the mature mRNA upon switchactivation, it was next tested whether gene expression could be regulated by placing a splicingcontrol RNA effector in the 5' UTR. The intron / ribozyme sequence of effector CI- 1.1 (SEQ ID NO: 1) was inserted into the 5' UTR of the Glue gene. The resulting construct (5'1-1.1) exhibited a 9.0-fold CDR in response to v-M8 (FIGs. 8A-8E). To enable higher transgene expression, the insertion of T3H38 into a well- validated 5' UTR intron containing an enhancer element from the human ubiquitin C gene (UBC enhancer) was next tested. Of the five UBC-based constructs (SEQ ID NO: 17-21), 5'1-5.5 (SEQ ID NO: 21) demonstrated the best performance, showing an 11.9-fold CDR and significantly higher induced expression than 5'1-1.1 (FIGs. 8A-8E). In this construct, the ribozyme was inserted adjacent to the junction between the UBC enhancer and BPS, potentially posing minimal steric or transcriptional interference to the UBC enhancer (SEQ ID NO: 22). Notably, upon v-M8 induction, 5'1-5.5-controlled Glue expression was restored to -78% of constitutive levels (FIGs. 8B-8D), markedly higher than the -3% restoration observed with direct ribozyme placement in the 5' UTR (FIG.8F). This is consistent with the observation that secondary structures in the 5' UTR of mature mRNAs can impede binding and movement of the 40S ribosome during translation initiation.

[0068] These results demonstrate the effectiveness of self-cleavage-mediated regulation of intron splicing as a novel switch mechanism. As 5 '1-5.5 and CI- 1.1 were the bestperforming splicing-control effectors in the 5' UTR and coding region, respectively, they were selected for subsequent studies.EXAMPLE 2: DEVELOPMENT OF AN ULTRA-EFFICIENT RNA ON-SWITCH ZONBY COMBINING SWITCH EFFECTOR RNAS THAT REGULATE THE INTEGRITY OF THE5' UTR, CODING SEQUENCE, AND 3' UTR

[0069] To test whether combined regulation of pre-mRNA integrity across the 5' UTR, coding region, and 3' UTR would enable ultra-tight control of transgene expression, constructs with dual- and triple-regulation designs by combining the splicing-control strategy in the 5' UTR and / or coding region with the well-established 3' UTR strategy were generated and evaluated (FIG. 2A). Dual-regulation constructs (2R-vl, 2R-v2, and 2R-v3) exhibited significantly enhanced v-M8-responsive regulation compared to their single-regulation counterparts, while the triple-regulation construct (3R-vl) substantially outperformed all others, achieving an ultra-wide CDR exceeding 60,000-fold (FIGs. 2A-2C and 9A-9B).Notably, the 3R-vl -controlled reporter plasmid exhibited negligible baseline (leaky) Glueexpression. At a high transfection dose (100 ng / well), leakiness was barely detectable and remained within twice the background noise of the highly sensitive luciferase assay (FIGs.9A-9C). At a 10-fold lower dose (10 ng / well), leaky expression was completely undetectable (FIG.9C). Accordingly, the 3R-vl effector-based switch system was designated Zon(short for "switch on from zero leakiness"). RT-PCR and Sanger sequencing further confirmed Zon’s ultra-tight regulation at the mRNA level (FIGs. 2D-2E).

[0070] Because Zoncarries three copies of the self-cleaving ribozyme T3H38, it was compared it with alternative multi-cut strategies in which tandem ribozyme copies were simply introduced into the 5' UTR, 3' UTR, or both (FIG. 2F). In contrast to Zon, these strategies did not yield regulation substantially better than that of the 3' UTR T3H38 switch (3'UTR; FIGs.2G-2H, and FIGs. 9D-9E), indicating that Zon’s ultra-tight regulation arises from the tripleregulation design rather than ribozyme copy number. Notably, although two tandem constructs (5'5'3' and 5'3'3') exhibited markedly improved CEIs relative to the 3' UTR T3H38 switch, their CDRs were either marginally higher (5'3'3') or significantly lower (5'5'3') than that of the 3' UTR T3H38 switch, restoring expression to just ~2-4% of constitutive levels. Again, these findings are consistent with the observation that secondary structures in the 5' UTR can impede translation initiation, and they further underscore the effectiveness of the scarless, self-cleavage-mediated splicing-control mechanism developed here.

[0071] To test whether the triple-regulation design is generalizable, the T3H38 ribozyme in Zonwas replaced with ribozymes from three distinct self-cleaving classes, each representing one of the most efficient natural ribozymes described in its respective class: a natural hammerhead ribozyme from a termite (Termite-HHR), a natural twister ribozyme from Schistosoma mansoni (Sm-TwR), and a natural hepatitis delta virus ribozyme (HDVR; FIGs.21 and 10A). Interestingly, the regulatory enhancement achieved by the triple-regulation design appeared to correlate with ribozyme efficiency: the HDVR-based triple-regulation construct — but not those based on Termite-HHR or Sm-TwR — exhibited substantially improved regulation compared to its corresponding 3' UTR-only version (FIGs. 2J-2K, and 10B-10D). Without wishing to be bound by theory, the self-cleavage rates of the other two ribozymes may not be fast enough to compete effectively with intron splicing. Supporting this hypothesis, the tripleregulation design yielded another ultra-tight switch when the twister ribozyme was substantially optimized (Lu M, et al. unpublished data). As the T3H38 ribozyme-based Zonconstruct exhibited the lowest leakiness and the highest CDR, it was selected for subsequent studies.EXAMPLE 3: A CELL PENETRATING PEPTIDE CONJUGATION MITIGATES THE CYTOTOXICITY OF THE OLIGO REGULATOR

[0072] The switch regulator (also referred to as “switch trigger”), v-M8 morpholino oligo, has an octa-guanidine dendrimer conjugation to facilitate its delivery into cells (Morcos, P. A. et al., 2008, Biotechniques 45, 613-614) (FIGs. 3A and 3B). While the OGD conjugate shows strong promise for enhancing morpholino delivery in mice, cell-penetrating peptide (CPP) conjugates (also referred to as “peptide-conjugated morpholino oligos” or (PPMOs)) have been extensively studied for morpholino delivery in rodents, non-human primates, and humans. It was recently demonstrated that two CPP conjugates, B and B-MSP, can substitute for OGD in v-M8 without compromising its activity in inducing T3H38 ribozyme-controlled reporter expression in mice. Expanding on this, it was further tested replacing the OGD moiety in v-M8 with either a well-validated CPP P7 (FIG. 3C) or a recently developed CPP DG9 (FIG. 11A). The resulting P7-conjugated morpholino, P7-M8, outperformed v-M8 and induced stronger and more sustained reporter expression from a T3H38 ribozyme-controlled AAV in mice (FIGs. 11B-11H).

[0073] Given these results, and the fact that P7 conjugated morpholines have been evaluated in both animal models and human studies, P7-M8 was tested as a replacement for v-M8 as Zon’s switch trigger. In the reporter switch-on assay, P7-M8 exhibited performance comparable to v-M8 in inducing Zon-regulated Glue expression in 293T cells (FIG.3D), while exerting substantially less impact on cell viability (FIG. 3E). A series of cell culture studies were then performed to further evaluate Zon / P7-M8 in gene regulation. Zon / P7-M8 demonstrated robust regulatory performance across diverse genes, promoters, and cell types (see Example 5, FIGs.3F-3I, and 12A-12D). In these studies, P7-M8 was able to induce Glue expression to levels comparable to those of constitutive control constructs lacking any switch elements (FIG. 3D) or carrying an inactive Zon(FIG. 3H).

[0074] Subsequently, Zon / P7-M8 was compared with multiple existing switch systems in 293T cells, including the previously reported 3' UTR-only T3H38 switch (T3H38-3TJTR), two alternative- splicing-control RNA switches (Xonand xpt-G17), and the third generation tetracycline -responsive transcription regulation system Tet-On 3G. Each switch-regulated reporter plasmid was tested at both a high (100 ng / well) and a low (10 ng / well) transfection dose in 96-well plates. Zon / P7-M8 substantially outperformed all others, exhibiting negligible leakiness at both transfection doses and a >300, 000-fold CDR at the high transfection dose (FIG. 3J). At the low dose, the CDR could not be quantified because baseline signals were indistinguishable from background noise (FIG. 3J).EXAMPLE 4: MOE / PS-MODIFIED ASO CAN REPLACE THE MORPHOLINO OLIGO TO SERVE AS AN INDUCER FOR ZON

[0075] A panel of thirteen 2'-0-methoxyethyl and phosphorothioate linkages (MOE / PS)-modified ASOs (Zon-MOE-1 to Zon-MOE-13; SEQ ID NO: 24-36) complementary to the T3H38 ribozyme within Zonwere tested for the induction of Zon-regulated Glue expression in 293T cells. Two ASOs, Zon-MOE-2 (SEQ ID NO: 25) and Zon-MOE-13 (SEQ ID NO:36), showed the best induction of Zon-regulated Glue expression, with regulatory ranges from -17,000- to -28, 000-fold (FIGs. 17A-17C).EXAMPLE 5: ZON / P7-M8-MEDIATED REGULATION IS COMPATIBLE WITH DIFFERENT TRANSGENES, PROMOTERS, AND CELL TYPES

[0076] To further characterize Zonfor gene regulation in vitro, Glue was replaced with an enhanced green fluorescent protein (EGFP) gene. Zon-regulated EGFP showed no detectable baseline leaky expression and P7-M8 efficiently induced EGFP expression to levels comparable to that of a constitutive EGFP construct (FIGs. 3F and 3G). Further testing was conducted using Zonto regulate multiple genes of broad therapeutic interest, including erythropoietin (Epo; FIG. 18A), vascular endothelial growth factor A (VEGFA; FIG. 18B), fibroblast growth factor 21 (FGF21; FIG. 18C), interleukin-2 (IL-2; FIG. 18D), and CRISPR-SpCas9-based adenine base editor (ABE8e; FIGs. 18E-18F). Negligible baseline leaky expression and P7-M8-mediated efficient induction of expression were observed in all these tested genes (FIGs. 18A-18F).

[0077] Zon-regulated Glue expression driven by a panel of ubiquitous promoters of different strength was then compared, including a short cytomegalovirus (sCMV) promoter, the simian virus 40 (SV40) promoter, the chicken beta-actin (CBA) promoter, and the elongation factor la short (EFS) promoter. Negligible baseline leaky expression and ultraefficient induction was observed with all the tested promoters (FIG. 3H). Subsequently, Zon-regulated Glue in multiple cell lines was further tested, including a human embryonic kidney cell line (293T), a cervical cancer cell line (HeLa), a liver cancer cell line (Huh7), and a lung cancer cell line (A549). The P7-M8 oligo efficiently induced Glue expression in a dosedependent manner in all these cell lines (FIG. 3J). These data demonstrate that Zon-mediated regulation is compatible with different transgenes, promoters, and cell types.EXAMPLE 6: ZON / P7-M8 OUTPERFORMS MULTIPLE PREVIOUSLY DESCRIBED GENETIC SWITCH SYSTEMS IN VITRO

[0078] Zon / P7-M8 was compared with multiple previously described systems, including a 3'-UTR-control RNA switch (T3H38 / v-M8, Zhong, G. et al., 2020, Nat. Biotechnol. 38, 169-175), two alternative splicing-control RNA switches (XOI7 LMI070, Monteys, A. M. etal., 2021, Nature 596, 291-294; and xpt-G17 / guanine, WO2016126747Alet al.), and the third generation tetracycline-responsive transcription regulation system (Tet-On 3G / doxycycline, Loew, R. et al., 2010, BMC Biotechnol 10, 81; Zhou, X. et al., 2006, Gene Ther 13, 1382-1390), for the regulation of Glue expression in 293T cells. Each switch-regulated reporter plasmid was tested at a high transfection dose (100 ng / well) and a low transfection dose (10 ng / well). Zon / P7-M8 significantly outperformed all the other switches, exhibiting a regulatory range at least two orders of magnitude wider than that of the other four systems (FIGs. 20A-20E). The regulatory range of Zon / P7-M8 reached ~310,000-fold under the high transfection dose condition (FIG. 3J); it couldn’t be determined under the low transfection dose condition because the baseline leaky expression was completely undetectable (FIG. 20A). In addition, while Xon, xpt-G17, and Tet-On 3G worked better under the low transfection dose condition (FIGs. 20C-20E), Zonworked well under both the low and high transfection dose conditions — a property desirable for gene therapy applications that require a high therapeutic dose (FIG. 20A).

[0079] Purified recombinant Glue protein was then used as a standard to quantify the absolute number of Glue proteins produced from transfected cells. It was found that, under the high transfection dose condition, the baseline leaky expression of Glue proteins from the Zon-regulated plasmid was only ~22 proteins / cell (FIG. 20F). Based on a report that the average cellular half-life and translation rate constant of mammalian mRNAs are 9 hours (median) and 140 proteins / mRNA / hour (median), respectively, the baseline leaky level of functional Glue mRNA under the high transfection dose condition was estimated to be only 0.018 (0.0007-0.73) copies per transfected 293T cell (FIG. 20F).EXAMPLE 7: ZON / P7-M8 PROVIDES MORE EFFICIENT AND DURABLE REGULATION THAN THE PUBLISHED T3H38 / V-M8 SWITCH IN MICE

[0080] After extensive in vitro characterization, Zon / P7-M8 was then evaluated for in vivo control of transgene expression in mice. AAV-transduced long-lived somatic cells can function as a bio-factory to continuously produce and secrete AAV-encoded protein therapeutics into the bloodstream — a promising approach for the treatment of a range of rareand common diseases. Because of its slow turnover and extensive vascularization, skeletal muscle is one of the most extensively investigated target tissues for ‘bio-factory’ gene therapies. Skeletal muscle is also a well-validated target tissue for P7-conjugated morpholino oligos. Therefore, it was opted to assess Zon / P7-M8 for the control of AAV transgenes in skeletal muscle. Zon / P7-M8 was first compared with the previous T3H38 / v-M8 system for the control of AAV-delivered firefly luciferase Flue) gene in mouse gastrocnemius muscles (FIG. 4A).Consistent with what we observed in cell culture, the Zon / P7-M8-regulated group showed -100-fold lower baseline and slightly higher induced Flue expression than that of the T3H38 / v-M8-regulated group (FIGs. 4B-4D). A regulatory range of 20,409-fold in average among three animals and up to 35,000-fold in one animal was achieved with Zon / P7-M8 (FIGs. 4B-4D).

[0081] When animals were injected with different doses of Zon-regulated N-Fluc, leak-free and inducible expression was observed in two animal groups that received lower doses of AAV (FIG. 4E). In the other two animal groups that received higher doses of AAV, a single dose of the P7-M8 oligo at 0.5 mg kg1induced Flue expression for up to 5 months (FIG. 4E). When AAV-injected animals were treated with different doses of the switch regulator P7-M8, regulator dose-dependent induction of Flue expression was observed (FIG.4F). Notably, unlike the v-M8 oligo which has an induction half-life of only -5 days, a single dose of the P7-M8 oligo can induce robust transgene expression for at least 4 weeks (FIGs.4D-4F), supporting the adoption of a monthly induction frequency for applications where flat transgene expression kinetics are particularly beneficial.EXAMPLE 8: ZON / P7-M8 ALLOWS FOR LONG-TERM, TEMPORAL, AND DOSE CONTROL OF AN AAV TRANSGENE

[0082] As muscle-targeted ‘bio-factory’ gene therapy is a promising approach for the treatment of a number of diseases, we then assessed the robustness of Zon / P7-M8 for long-term temporal and dose control of AAV-Fluc in mouse skeletal muscle. Animals injected with Zon-regulated N-Flucrepeatedly induced with the P7-M8 oligo every 4 weeks. Dosedependent induction of Flue expression by the P7-M8 oligo was independently observed in three mice groups receiving different dosing regimens (FIG. 4G-4I). One group of these animals has been repeatedly induced for ten cycles. P7-M8 consistently induced Flue expression with flat kinetics in all cycles, with the expression level in the tenth cycle still comparable to that in the first (FIG. 41).EXAMPLE 9: PROGRAMMABLE RNA SWITCHES FOR ULTRA-EFFICIENT CONTROL OF GENE THERAPIES

[0001] Current gene therapies cannot be regulated post-dosing to respond to changing medical needs over time, limiting their safety, efficacy, and widespread use. This example describes a generalizable approach for developing ultra-efficient gene regulation systems — RNA switches — that enable on-demand, tight control over transgene expression timing and levels through multi-region regulated self-cleavage of transgene pre-mRNAs. One such switch, Zon, exhibits negligible to zero leakiness and a regulatory range spanning five-log to infinitefold. Its regulator is part of a class of oligonucleotide-based precision medicines safe for human use. Repeated dosing of this regulator has consistently induced ““-controlled AAV transgene expression for over a year in mice. Utilizing Z°“ to tightly regulate the expression of multiindication biologies (e.g., an interleukin-2 mutein and fibroblast growth factor 21) at therapeutic levels in mice, this example describes the potential of ““-controlled gene-addition therapies for autoimmune diseases and metabolic disorders. With additional engineering of Z°“, it was further demonstrated Z°“ may provide leak- free temporal control of an AAV-delivered genome editor in mice. Finally, data indicate that Z°“’s offsetting rate can be customized using a reversal oligonucleotide, adding further versatility to this switch system.

[0002] Like many other existing genetic switches functional in gene therapy regulation in animals, the 3'-UTR T3H38 / v-M8 switch exhibits significant leakiness. As a result, multiple approaches to enhance regulation further were investigated, including aiming for a leak-free switch system that maximizes the safety features of gene therapy. For example, because the 5'-terminal 7-methyl-guanosine (m7G) cap plays multiple indispensable roles in the lifecycle of mammalian mRNAs, gene expression may be regulated by placing a self-cleaving ribozyme in the 5'-UTR. However, it was observed that regulation was markedly less efficient when the ribozyme was placed in the 5'-UTR than in the 3'-UTR28 (FIGs. 20A-20C). This observation is consistent with the fact that secondary structures in the 5'-UTR can impede binding and movement of the 40S ribosome during translation initiation. As another approach, we tested a multi-cut design by introducing multiple tandemly arranged ribozyme copies in the 3 -UTR, 5 -UTR, or both. However, this strategy also failed to substantially improve regulation (FIGs.20A-20C).

[0003] In this example, a novel switch mechanism, which employs a fast self-cleavage reaction to compete with and regulate the highly complex and slower intron splicing reaction cascade, was engineered. Because multiple introns can be introduced at various positionswithin a transgene precursor mRNA (pre-mRNA) without altering its coding sequence, this switch mechanism presents a general approach for creating programmable, ultra-efficient RNA switches that tightly control transgene expression with negligible to zero leakiness.Engineering a novel switch mechanism: self-cleavage-mediated regulation of intron splicing

[0004] The cleavage reactions of some fast-reacting self-cleaving ribozymes can occur within seconds. In contrast, intron splicing in pre-mRNA, which involves intron removal and exon ligation by the highly dynamic supramolecular ribonucleoprotein (RNP) complex, the spliceosome, may take minutes to complete in mammalian cells. Therefore, a fast-reacting, self-cleaving ribozyme was inserted into an intron to regulate transgene expression by competing with pre-mRNA splicing (FIG. 1A).

[0005] A panel of splicing-control RNA effectors were generated, each consisting of two elements: (i) one of four constitutive introns (intron- 1, -2, -3, or -4), and (ii) a copy of the T3H38 ribozyme inserted at various positions between the 5' splice site (5'SS) and the 3' splice site (3'SS) of the intron (Fig. 10B). These effectors and their inactive-ribozyme controls were first introduced into the coding region of a Gaussia luciferase (Glue) reporter gene. An unregulated Cypridina luciferase (Clue) reporter gene driven by an independent promoter in the same plasmid was used as an internal control. The resulting constructs were evaluated in 293T cells using two assays: a reporter inhibition assay measuring RNA effector-mediated inhibition of Glue expression (Fig. 10A, upper branch) and a reporter switch-on assay assessing induction of Glue expression via v-M8, the T3H38-complementary morpholino oligo that blocks the ribozyme self-cleavage (Fig. 10A, lower branch). Among the effectors, 1R-CI-1.1 (intron- 1, ribozyme near the 5' splice site) exhibited the strongest regulation, with 19-fold inhibition in the reporter inhibition assay and an 11.5-fold induction upon v-M8 treatment (Figs. 10C-10D). RT-PCR and Sanger sequencing confirmed its activity, revealing reduced levels of spliced mRNA (Figs. 10E-10F). Interestingly, a faint band at the same size of the 389-bp unspliced pre-mRNA band was observed in the 1R-CI- 1.1 -controlled construct but not in its ribozyme-inactive counterpart (Fig. 10E).

[0006] Because these splicing-control RNA effectors do not leave any “scar” sequence or secondary structure in mature mRNA upon activation, a panel of effector variants were introduced into the 5'-UTR of the Glue reporter gene and tested their regulatory efficiency. To prevent accidental protein expression from unspliced Glue mRNA, four in-frame alternative start codons were inserted followed by stop codons upstream of the canonical Glue start codon.The 1R-5I-5.5 effector outperformed the others, exhibiting a 17.6-fold inhibition of Glue expression in the reporter inhibition assay and a 13.7-fold regulatory range in the reporter switch-on assay (Figs. 16A-16E). Notably, lR-5I-5.5-controlled Glue expression was restored to -78% of control levels upon v-M8 treatment (Figs. 16A-16E), a significant improvement over the -3% restoration observed with direct ribozyme placement in the 5'-UTR (Figs. 15A- 15C). These findings highlight the effectiveness of self-cleavage-mediated regulation of intron splicing as a novel switch mechanism.A triple-regulation design leads to ultra-efficient RNA ON-switches

[0007] Since 5' capping, intron splicing, and 3'-end processing are highly coordinated processes regulating mRNA maturation, nuclear export, translation, and stability, regulating the integrity of the 5 -UTR, coding region, and 3'-UTR in parallel to provide ultra-tight transgene regulation was investigated. Accordingly, constructs with single-, dual-, or tripleregulation designs (Fig. 10G) were generated and evaluated in reporter assays. While dualregulation constructs (2R-vl, 2R-v2, and 2R-v3) exhibited significantly improved v-M8-responsive regulation compared to single-regulation constructs, the triple-regulation construct (3R-vl) vastly outperformed all, achieving an ultra- wide regulatory range of exceeding 60,000-fold (Figs. 10G-10I). Notably, the 3R-vl -controlled reporter plasmid exhibited negligible baseline Glue expression (Fig. 17A). At a low transfection dose (10 ng / well), its baseline expression was completely undetectable (zero), whereas at a 10-fold higher dose (100 ng / well), it remained within twice the background noise level of the highly sensitive luciferase assay. The 3R-vl effector-based switch system was therefore denoted as Zon.

[0008] To further validate Zon’s switch activity at the RNA level, RT-PCR was performed to amplify a Glue cDNA fragment encompassing both intron regions. Surprisingly, in addition to the expected loss of the 529-bp band corresponding to fully spliced mature RNA, a strong 1192-bp band corresponding to unspliced pre-mRNA was also detected in the active ZOI1-controlled construct, but not in its inactive counterpart (FIGs. IF and 2D). This result was reproduced when Zon’s RNA effector at the 5'-UTR (51-5.5) was replaced with two different RNA effectors (51-2.2, 51-3.2; Figs. 17C-17D). These data indicate that, in addition to the anticipated cleave- and-degrade mechanism (FIG. 1A), a novel mechanism — self-cleavage-induced inhibition of intron splicing — may play a substantial role in Zon’s ultra-efficient regulation. Consistent with this, blocking self-cleavage with v-M8 not only restored the fully spliced band but also markedly reduced the unspliced band (FIG. IF).

[0009] Unlike the previous tandem-repeat strategy, which failed to enhance regulation (FIGs. 20A-20C), the findings here demonstrate that triple-regulation, rather than ribozyme copy number, is key to Zon’s ultra-low leakiness and ultra- wide regulatory range. To test generalizability, the optimized T3H38 hammerhead ribozyme in Zonwas replaced with ribozymes from three distinct self-cleaving classes: a natural hammerhead ribozyme from a termite (Termite-HHR), a natural twister ribozyme from Schistosoma mansoni (Sm-TwR), and a natural hepatitis delta virus ribozyme (HDVR) (FIGs. 10A and 21, respectively).Interestingly, the regulatory enhancement achieved by the triple-regulation design appeared to correlate with the efficiency of the ribozyme in the 3'-UTR; the HDVR-based triple-regulation construct also exhibited ultra-efficient regulation (FIG.21-21G and FIG.22B-22C). The selfcleavage rates of the other two ribozymes may not be fast enough to compete with intron splicing. Supporting this, the triple-regulation design led to the development of another ultraefficient construct when the twister ribozyme was significantly optimized. As the T3H38 ribozyme-based Zon construct exhibited the lowest leakiness and the best regulatory range, it was selected for use in the following studies.A peptide conjugate to the oligo regulator further enhances Zon

[0010] The current switch regulator, v-M8 morpholino oligo, utilizes an octa-guanidine dendrimer (OGD) moiety for cellular delivery (FIGs. 3A-3B). Compared to OGD, cellpenetrating peptide (CPP) conjugates have been widely studied for morpholino oligo delivery in rodents, monkeys, and humans. It has been observed that two CPP conjugates (B and B-MSP) could replace OGD in v-M8 without compromising its in vivo activity for inducing T3H38 ribozyme-controlled reporter expression. Expanding on this, two additional CPPs: P7 (FIG. 3C), a well- validated CPP that has been tested in animal models and humans, and DG9 (FIG. 11A), a recently developed CPP effective in mice, were tested. P7-M8, a P7-conjugated morpholino oligo with the same nucleobase sequence as v-M8, induced stronger and more sustained reporter expression from a T3H38 ribozyme-controlled AAV than v-M8 did in mice (FIGs. 11B-11H).

[0011] P7-M8 and v-M8 were then compared for their ability to induce Zon-regulated Glue reporter expression in 293T cells. P7-M8 again slightly outperformed v-M8, achieving twice the expression level of a control lacking switch elements (FIG. 3D). Additionally, while v-M8 caused significant cytotoxicity at high concentrations, P7-M8 exhibited minimal toxicity (FIG. 3E). A series of cell culture studies was then performed to further characterize Zon / P7-M8 for gene regulation. Zon / P7-M8 exhibited robust regulation across different genes,promoters, and cell types (Figs. 11F-1 II, and Figs. 19A-19D). Based on these data, P7-M8 was selected as the switch regulator for Zonin the subsequent studies.

[0012] Subsequently, Zon / P7-M8 was compared to multiple existing switch systems in 293T cells, including a previously reported 3'-UTR T3H38 switch28 (3'-T3H38), two alternative-splicing-control RNA switches (Xonand xpt-G17), and the third- generation tetracycline -responsive transcription regulation system (Tet-On 3G). Each switch-regulated reporter plasmid was tested at both a high transfection dose (100 ng / well) and a low dose (10 ng / well) in 96-well plates. Zon / P7-M8 significantly outperformed all others, achieving a >300, 000-fold regulatory range at the high transfection dose and infinite-fold regulation at the low dose (FIG. 3J). Using purified Glue protein standards, the absolute Glue protein output was quantified. Even at the high transfection dose, ZOI1-controlled baseline leaky expression only produced ~24 Glue proteins per transfected cell (FIG. 3K). Based on a report showing that the median cellular half-life and translation rate constant of mammalian mRNAs are 9 hours and 140 proteins / mRNA / hour, respectively, the baseline functional Glue mRNA level was estimated to be just 0.019 copies per transfected cell under these conditions (FIG. 3K).Z°“ allows for ultra-efficient regulation of AAV trans gene expression in mice

[0013] The above in vitro characterization data suggests that Zoncould provide useful in vivo control of gene therapeutics. Among gene therapy platforms, the clinically validated AAV system was selected to evaluate Zon’s therapeutic utility. AAV-transduced skeletal muscle cells can serve as long-term bio-factories, continuously producing and secreting AAV-encoded biologies into the bloodstream for over 10 years. Given the promise of this bio-factory gene therapy approach for treating a broad spectrum of rare and common diseases, Zonwas assessed for the control of AAV transgene expression in skeletal muscle in mice.

[0014] To benchmark Zon’s performance, it was compared to the previously described 3' UTR T3H38 (3'-T3H38) switch for controlling AAV-delivered firefly luciferase (Flue) reporter gene in the gastrocnemius muscle of mice (FIG. 4A). Consistent with the in vitro results (FIG. 3J), Zon-regulated groups demonstrated ~ 100-fold lower baseline Flue expression, while maintaining induced peak expression levels comparable to those of the T3H38 / v-M8-regulated group (FIGs.4B-4C). At 1.25 mg / kg, P7-M8 induced Flue expression to levels comparable to that of constitutive expression controls (FIG. 4D). Intramuscular administration of varying doses of P7-M8 resulted in dose-dependent Flue induction (FIGs.4E and FIG. 13A). Furthermore, in two animal groups receiving lower doses of Zon-regulatedAAV-Fluc, “leak-free” transgene control was observed — baseline signals were statistically indistinguishable from background noise (FIG. 4F and FIG. 13B).Z°“ enables robust, repeated induction of AAV trans gene expression for over a year in mice

[0015] The long-term robustness of the Zonswitch system in regulating AAV transgene expression in mice was further evaluated as follows. Three groups of animals injected with Zon-regulated AA -Flu WCK repeatedly induced every 4 weeks using different P7-M8 dosing regimens. In all three groups, P7-M8 morpholino exhibited robust control over the timing and levels of Flue expression (FIGs. 4G-4I, and FIGs. 13C-13E). In one group of animals subjected to repeated induction for over a year, P7-M8 consistently induced Flue expression with near-flat kinetics, with expression levels in the final induction cycle remaining comparable to those observed in the first (FIG. 41 and 13E). When Flue expression values in response to varying doses of P7-M8 are summarized, an average regulatory range of ~67, 000-fold (up to 99,475-fold in one animal), with post-induction expression levels reaching -98% of constitutive expression, was observed in one group of animals that received 1.25 mg / kg of P7-M8 (FIG. 4J).

[0016] These findings underscore the feasibility of utilizing Zonto develop regulatable muscle bio-factory gene therapies. Notably, a single dose of P7-M8 can induce ZOI1-controlled transgene expression with near-flat kinetics for four weeks in mice (FIG. 4E-4I), a duration several orders of magnitude longer than the half-life of many short-lived biologies (e.g., cytokines and hormones; half-life: minutes to hours). Thus, utilizing Zonto regulate muscle bio-factory gene therapy may offer a generalizable strategy for developing long-acting therapeutics from short-lived biologies. To demonstrate medically relevant applications of this approach, additional in vivo studies were conducted as described below.Zon-regulated expression of low-dose interleukin-2 mutein enables selective and sustainable in vivo expansion of tolerogenic regulatory T cells

[0017] Additional studies were conducted to achieve precise control over the expression of an AAV-delivered interleukin-2 (IL-2) biologic. IL-2 serves a paradigmatic example of a cytokine with a short serum half-life (13 min), a narrow therapeutic window, and significant contraindications. Low-dose IL-2 (LD-IL-2) and IL-2 muteins that selectively bind to the high-affinity IL-2 receptor (IL-2Rapyc) have been shown to preferentially induce the expansion of regulatory T cells (Tregs). This represents a promising approach for the treatment of autoimmune and inflammatory disorders, with clinical studies in type 1 diabetes (T1D),systemic lupus erythematosus (SLE), and graft-versus-host disease (GVHD) demonstrating treatment benefits without the toxicity associated with high-dose IL-2.

[0018] Here, BALB / c mice were intramuscularly injected with 4xlO10vg of AAV particles carrying either a ““-controlled transgene encoding a mouse IL-2 mutein (IL-2m; AAV-IL2m-Z°“; FIG. 5A) or a reporter gene (AAV-Ctrl). Animals were subsequently administered at the same injection site with varying doses of the P7-M8 morpholino or P7-Ctrl, a P7-conjugated morpholino oligo that does not target the T3H38 ribozyme. In AAV-IL2m-Z°“-transduced animals, a single dose of P7-M8 induced IL-2m expression in a dose-dependent manner (FIG. 5B), leading to selective and potent expansion of Treg cells (CD4+CD25+Foxp3+) in both the blood and spleen, with no significant evidence of expansion in conventional CD4+or CD8+T cells (FIGs. 5C-5F, 14A-14C, and 15A-15G). In an independent experiment, where natural killer (NK) cells (CD45+CD3 CD49b+) were also analyzed, an undesired expansion of the NK cell population by 2.3-fold was observed when P7-M8 was administered at 1.25 mg / kg, coinciding with IL-2m expression reaching ~49 ng / mL (FIGs. 5G-5H and 14A), highlighting the necessity of precise dose control in this application.

[0019] To further investigate this effect, the experiment was repeated with multiple doses of P7-M8 (up to 0.5 mg / kg) and monitored the animals for approximately three months post-AAV injection. In this experiment, repeated dosing of P7-M8 robustly induced the selective expansion of Treg population by up to 7.4-fold, along with increased Foxp3 and CD25 expression in Tregs, in the blood of AAV-IL2m-Z°“-transduced animals (FIGs. 51- 5L). Treg expansion induced by a single dose of P7-M8 persisted for over nine weeks (FIG. 51). Under most conditions, no substantial perturbation to the NK cell population was observed, except for a slight (~1.9-fold) increase at the highest tested dose (0.5 mg / kg) of P7-M8 (FIG. 5L).Notably, two doses of P7-M8 at 0.3 mg / kg, administered four weeks apart, consistently induced a ~5-fold expansion of Tregs without significantly affecting the conventional CD4+T cells, CD8+ T cells, or NK cells (FIGs. 51, 5L, and FIGs. 14D-14E).Zon-regulated FGF21 gene therapy improves body weight, blood glucose, and hepatic steatosis in obese mice

[0020] Additional studies were conducted to achieve tight control over the expression of AAV-delivered fibroblast growth factor 21 (FGF21). Endogenous FGF21 is a short-lived hormone (serum half-life: 30 min to 2 hours) that plays a key role in maintaining energy homeostasis through a range of metabolic actions. FGF21 -based biologies are currently in advanced clinical trials and show significant promise for treating a cluster of related metabolicdisorders, such as obesity, type 2 diabetes, and metabolic dysfunction-associated steatohepatitis (MASH). Compared with protein-based therapies, AAV-delivered FGF21 biofactory gene therapy offers a potentially superior approach for achieving sustained circulating FGF21 levels and has demonstrated efficacy in murine models. However, the clinical translation of FGF21 gene therapy necessitates regulatory safeguards due to (i) >5% discontinuation rates from adverse events in FGF21 protein trials and (ii) recent evidence linking FGF21 to tumor progression in mice, suggesting potential contraindications.

[0021] Here, in an initial experiment, genetically obese (ob / ob) mice were intramuscularly injected with 3xlOnvg of AAV particles carrying either a ““-controlled mouse FGF21 gene (AAV-FGF21-Z°“), a constitutively expressed FGF21 gene (AAV-FGF21), or a reporter gene (AAV-Ctrl). Wild-type C57 mice, injected with AAV-Ctrl, served as healthy controls. In AAV-FGF21-Z°“ vector- transduced ob / ob mice, serum FGF21 levels remained at the endogenous baseline three weeks after AAV transduction (FIGs. 16A-16B).These mice were subsequently administered two escalating doses of P7-M8: 1.25 mg / kg at week 3 and 7.5 mg / kg at weeks 5 post-AAV injection. The morpholino treatment resulted in a dose-dependent induction of FGF21 expression, with serum FGF21 levels reaching 42.3 ng / ml following the high-dose treatment (FIGs. 16A-16B). This increase in serum FGF21 levels led to a modest reduction in body weight gain (up to 12.4% slower growth) and substantial decrease in blood glucose and serum insulin levels compared to AAV-Ctrl-treated ob / ob mice (FIGs. 16C-16E).

[0022] To enhance body-weight control, a follow-up experiment was conducted using a higher AAV dose (IxlO12vg / mouse) and administered P7-M8 (2.5 mg / kg) or the control morpholino (P7-Ctrl) every three weeks (FIG. 6A). Repeated P7-M8 dosing elevated serum FGF21 levels to up to 79.8 ng / ml in AAV-FGF21-Z°“-transduced ob / ob mice (FIG. 6B). This treatment resulted in robust body-weight control, with up to 27.2% slower growth compared to AAV-Ctrl-treated ob / ob mice (FIGs. 6C-6D). Additionally, it rapidly normalized blood glucose levels (FIG. 6E) and significantly improved glucose tolerance in response to high-dose glucose challenge (FIG. 6F). Serum insulin levels were also markedly reduced (FIG.6G). Moreover, serum concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) — markers of liver inflammation and injury — declined to levels comparable to or only slightly above those observed in wild-type C57 mice (FIGs. 6H-6I).Consistent with this, liver weight was reduced by over 50% at the end of the study (FIG.s 6J-61). Histological analysis revealed marked hepatic steatosis in the control ob / ob mice, whereasP7-M8-induced FGF21 expression substantially reversed the pathological lipid deposition in AAV-FGF21-Zon-transduced ob / ob mice (FIG. 6M).

[0023] Here, in an initial experiment, genetically obese (ob / ob) mice were intramuscularly injected with 3xlOnvg of AAV particles carrying either a ““-controlled mouse FGF21 gene (AAV-FGF21-Z°“) (FIG. 6A), a constitutively expressed FGF21 gene (AAV-FGF21), or a reporter gene (AAV-Ctrl). Wild-type C57 mice, injected with AAV-Ctrl, served as healthy controls. In AAV-FGF21-Zon vector-transduced ob / ob mice, serum FGF21 levels remained at the endogenous baseline three weeks after AAV transduction (FIGs. 22A-22B). These mice were subsequently administered two escalating doses of P7-M8: 1.25 mg / kg at week 3 and 7.5 mg / kg at weeks 5 post- AAV injection. The oligo treatment resulted in a dosedependent induction of FGF21 expression, with serum FGF21 levels reaching 42.3 ng / ml following the high-dose treatment (FIGs. 22A-22B). This increase in serum FGF21 levels led to a modest reduction in body weight gain (up to 12.4% slower growth) and substantial decrease in blood glucose and serum insulin levels compared to AAV-Ctrl-treated ob / ob mice (FIGs. 22C-22F).Utilizing Zonto establish tight, leak- free control of AAV-delivered genome editing

[0024] Z°“’s ability to regulate AAV-delivered genome editing was investigated. Tight regulation of AAV-delivered genome editing is highly desirable, as its application is largely limited by AAV-mediated long-term expression of genome editors — large, non- self proteins with potential off-target effects. Likely due to the enzymatic nature of genome editors and the potential permanence of their DNA-editing outcomes, engineering a truly leak-free switch system for genome editors has been proven challenging.

[0025] Here, Z°“ was first compared with the 3'-UTR T3H38 switch (3'-T3H38) in controlling the adenine base editor SpCas9-NG-ABE8e (hereafter referred to as ABE8e), a highly efficient second-generation CRISPR genome editor with broad applications. Using a base-editing-activatable Glue reporter assay in 293T cells (FIG. 19A), plasmids encoding switch-controlled ABE8e at varying doses were transfected into cells and editing-activated reporter expression was measured at 24, 48, and 72 hours post-transfection. Compared to 3'-T3H38-controlled ABE8e, which exhibited a considerable level of dose- and time-dependent leaky editing at all tested plasmid doses, ““-controlled ABE8e demonstrated negligible to no leakiness under the low-dose condition (4 ng / well; FIG. 19B). However, at the highest tested dose (100 ng / well), / ““-controlled ABE8e’s leaky editing activity still reached 0.9% of thatobserved with constitutive ABE8e expression (FIG. 19B). To address this, an additional splicing-control RNA effector domain was incorporated into the transgene coding region and developed an enhanced Zon(eZon), which effectively eliminated residual leakiness under the high-dose condition, highlighting the programmability of the Zonswitch system (FIG. 19B).When tested with P7-M8 inducer oligo in the reporter assay, eZon-controlled ABE8e exhibited efficient base-editing activity, achieving -99.4% of the editing observed with constitutive ABE8e expression (FIG. 19C). Next, AAV delivery of eZOI1-controlled ABE8e (AAV-iABE8e) was evaluated for in vivo editing of a base-editing-activatable Flue reporter gene in mouse muscle (FIG. 19D). Prior to P7-M8 induction, no editing-activated reporter expression was detected (FIG. 19E), confirming that AAV-iABE8e is leak-free. A single dose of P7-M8 treatment efficiently induced strong and sustained reporter expression (FIG. 19E), demonstrating the system’s potent inducibility.Z°“ ’s offsetting rate can be customized using a reversal oligonucleotide

[0026] P7-M 8 -regulated Zon has a slow offsetting rate: a single 0.5 mg / kg dose of P7-M8 induced Zon-controlled transgene expression with near-flat kinetics for four weeks, with expression lasting up to six months in mice (FIGs. 4E, 4F, and 41). With this extended duration, Zon-regulated gene-addition therapy as well as genome-editing therapy may benefit from an “antidote” technology that enables reversal of P7-M8’s induction effect. Here, using P7-aM8 — an “antidote” morpholino oligo complementary to P7-M8 — P7-M8 induction of Zon-regulated AAV-Fluc in mice was successfully reversed. Notably, this “antidote” approach allows on-demand customization of Zon’s offsetting rate by controlling the timing of the “antidote” oligo’ s administration, adding further versatility to this switch system, particularly for regulating genome editing.ADDITIONAL DISCUSSION OF THE EXAMPLES

[0083] Here, a critical limitation in gene therapy was addressed: the inability to tightly control transgene expression post-dosing. First, a novel RNA switch mechanism was developed that leverages the fast cleavage kinetics of small self-cleaving ribozymes to outcompete the more complex and slower pre-mRNA splicing cascade (FIG. 1A-1G). Unlike previously reported alternative splicing-based switch mechanisms, which require the insertion of additional coding sequences into a transgene and may be associated with immunogenicity and, in some cases, on-target toxicity, this approach avoids these limitations. Building on this mechanism, Zon— a next- generation RNA switch with near-zero leakiness and ultra-highinducibility was engineered (FIGs. 2A-2K, 3A-3J, and 4A-4J). The data provided herein indicate that Zonis programmable: for applications requiring even tighter regulation, performance may be further enhanced by incorporating additional copies of splicing-control RNA effectors.

[0084] Compared to existing RNA switches, Zonoffers three notable advantages. First, previously reported RNA switches exhibit limited dynamic ranges (up to ~ 10-fold) when trigger molecules are administered at clinically well-tolerated doses. By contrast, Zonenables in vivo regulation spanning more than four orders of magnitude at well-tolerated morpholino doses. Systemic injection of unconjugated morpholines at 50 mg / kg weekly or conjugated morpholines at 10 mg / kg monthly is generally well tolerated in humans. In this study, location administration of P7-M8 morpholino at 1.25 mg / kg induced over 60,000-fold transgene activation (FIG. 4J), and monthly intramuscular injections of 0.5 mg / kg over one year consistently drove robust transgene expression with dynamic ranges exceeding four orders of magnitude (FIG. 4J). These results suggest that Zonmay be both safe and efficient enough for clinical use. Second, Zonexhibits negligible to undetectable leakiness (FIG. 4A-4J), minimizing safety risks from prolonged, unintended transgene expression. This feature may support safer use of gene therapies, particularly when treatment must be paused long-term or permanently due to emerging contraindications or adverse effects. Third, most existing RNA switches rely on trigger molecules unsuitable for long-term use — for example, tetracycline, a broad-spectrum antibiotic that can disrupt the gut microbiome with prolonged administration, or branaplam (LMI070), a compound associated with peripheral neurotoxicity. In contrast, Zon’s trigger molecule, a morpholino oligo, belongs to a class of oligonucleotide-based precision medicines proven safe for long-term human use, enabling Zon’s application in diseases that require long-term treatment. Collectively, these properties establish Zonas a promising platform technology for precision gene therapy, particularly for therapeutics with narrow therapeutic windows, major contraindications, or severe side effects.

[0085] ZOI1-controlled bio-factory gene therapy supports monthly dosing to achieve robust AAV transgene expression in mouse skeletal muscle (FIGs. 4A-4J, 5A-5L, and 6A-6M). Considering allometric scaling and the dosing frequency of current oligonucleotide drugs, this may translate to quarterly or even semiannual dosing in humans. This approach offers a generalizable strategy for developing long-acting therapies from otherwise short-lived biologies — such as cytokines and hormones, which typically have half-lives of minutes to hours and require frequent (e.g., daily) dosing to maintain pharmacodynamic effects. The studies provided herein showed that Zoncan regulate therapeutic expression of an IL-2 mutein(FIGs. 5A-5L) and FGF21 (FIGs. 6A-6M) from mouse skeletal muscle. This paves the way for regulatable bio-factory gene therapies for autoimmune / inflammatory diseases (e.g., SLE and GVHD) and chronic metabolic disorders (e.g., obesity, diabetes, and MASH). The narrow therapeutic window of IL-2 (FIGs. 5A-5L), along with FGF21’s high discontinuation rates in protein trials, pleiotropic physiological functions, and possible tumor-promoting effects, underscore the necessity of dose and temporal control in such gene therapies. Beyond IL-2 and FGF21, ““-controlled bio-factory gene therapy may be applicable to other short-lived protein or peptide biologies for which long-acting versions are also desirable and dose adjustment or gradual titration is often required — for example, growth hormone, basal insulin, certain interferons and interleukins, and incretins.

[0086] Z°“-regulated bio-factory gene therapies offer three key advantages over protein or peptide pharmacotherapies. First, unlike short-lived proteins and peptides that cause large plasma concentration fluctuations, they can maintain near-flat expression kinetics (low peak-to-trough ratio; FIGs. 4E-4I), which is likely to improve both efficacy and safety. Second, to achieve long-acting pharmacodynamics, protein and peptide biologies often require mutations or chemical modifications, which could lead to biased signaling and high-frequency anti-drug antibody responses. In contrast, Z°“-regulated gene therapies can produce proteins or peptides in their native sequence with natural post-translational modifications, likely enhancing tolerability and safety. Third, their substantially reduced dosing frequency may improve patient compliance. Collectively, these advantages may translate into better treatment outcomes. Notably, applications requiring rapid turnover (e.g., postprandial insulin) fall outside Z°“’s intended scope.

[0087] In summary, the present disclosure provides a programmable RNA switch platform that enables tunable, ultra-tight regulation of therapeutic transgene expression. While focused on muscle-targeted bio-factory gene therapy, the platform's potential is broader. In light of the recent advances in backbone chemistry and delivery of therapeutic oligonucleotides, optimizing the switch trigger — whether to lower systemic doses, fine-tune offset kinetics, or achieve targeted delivery to critical tissues and organs (e.g., the brain) — may further expand Z°“’s utility. Ultimately, beyond AAV gene therapies, Z°“ — whether in its current form or further optimized — may be applied to other vectored gene therapies, genome editing-assisted gene therapies that integrate transgenes into host chromosomes, genome-engineered cell therapies, functional genomics, and synthetic biology.REPRESENTATIVE SEQUENCESThe skilled artisan will appreciate that, except where otherwise noted, polynucleotide sequences set forth in the instant application will recite “T”s in a representative DNA sequence but where the sequence represents RNA, the “T”s would be substituted for “U”s.SEQ ID NO: 1 (1R-CI-1.1) GTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCCTTTTCT TTCTTTGCGCGTCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAAT AGGACGAAACGCGCTTTTCTTTTTGTTTAGAGTAGCCTGCATCCAGGGACAGGCC CCAGCCGGGTGCTGACACGTCCACCTCCATCTCTTCCTCAGSEQ ID NO: 2 (1R-CI-1.2) GTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCCTAGAG TAGCCTGCATTTTCTTTCTTTGCGCGTCCTGGATTCCACTTCGGGTACATCCAGCT GACGAGTCCCAAATAGGACGAAACGCGCTTTTCTTTTTGTTTCCAGGGACAGGCC CCAGCCGGGTGCTGACACGTCCACCTCCATCTCTTCCTCAGSEQ ID NO: 3 (1R-CI-1.3) GTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCCTAGAG TAGCCTGCATCCAGGGACAGGCCCCAGCCGGGTGCTTTCTTTCTTTGCGCGTCCT GGATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAATAGGACGAAACGCGC TTTTCTTTTTGTTTTGACACGTCCACCTCCATCTCTTCCTCAGSEQ ID NO: 4 (1R-CI-1.4) GTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCCTAGAG TAGCCTGCATCCAGGGACAGGCCCCAGCCGGGTGCTGACACGTCCACCTCCATTT TCTTTCTTTGCGCGTCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAA ATAGGACGAAACGCGCTTTTCTTTTTGTTTCTCTTCCTCAGSEQ ID NO: 5 (T3H38 ribozyme)GCGCG TCCTG GATTC CACTT CGGGT ACATC CAGCT GACGA GTCCC AAATA GGACG AAACG CGCSEQ ID NO: 6 (Morpholino oligo M8)GTACCCGAAGTGGAATCCAGGACGCSEQ ID NO:7 (1R-5I-2.1) GTAAGTACTGAAAGCTTGTAATGCCTCTTTCTTTCTTTGCGCGTCCTGGATTCCAC TTCGGGTACATCCAGCTGACGAGTCCCAAATAGGACGAAACGCGCTTTTCTTTTTGTTTTTATGTAAAAAGACAGAGAATTAAGAAATAAAGGCTTGGAGTCTGACATTCTTTTTTTCTTTTAGSEQ ID NO: 8 (1R-5I-2.2) GTAAGTACTGAAAGCTTGTAATGCCTCTTATGTAAAAAGACAGAGAATTAATTTC TTTCTTTGCGCGTCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAA TAGGACGAAACGCGCTTTTCTTTTTGTTTGAAATAAAGGCTTGGAGTCTGACATTCTTTTTTTCTTTTAGSEQ ID NO: 9 (1R-5I-3.1) GTAAGTACTCCTGGCCCCTTGGGGGATCCCTGATTTCTTTCTTTGCGCGTCCTGGA TTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAATAGGACGAAACGCGCTTTTCTTTTTGTTTGCTCTGGACGGGGCTCCCCAGGAACTCTCGGGACTGGCCAGTGCTCAGTGGACTTAACGGGGCTTCCCCTCTCTCCTGCAGSEQ ID NO: 10 (1R-5I-3.2) GTAAGTACTCCTGGCCCCTTGGGGGATCCCTGAGCTCTGGACGGGGCTCCCCATT TCTTTCTTTGCGCGTCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAA ATAGGACGAAACGCGCTTTTCTTTTTGTTTGGAACTCTCGGGACTGGCCAGTGCT CAGTGGACTTAACGGGGCTTCCCCTCTCTCCTGCAGSEQ ID NO: 11 (1R-5I-4.1) GTAAGTACATCATTCCATTATTCTCTTCCCCATCTCCTCCCCTCTTTCCTTTCTTTC TTTGCGCGTCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAATAGG ACGAAACGCGCTTTTCTTTTTGTTTCTCCCTCCCTGGCTGGGGGGCTGGGAGATTG GTGCATCCTCTGCTCCCAAACTCATCACCCTAAGGCTCTAGGAGAAAAACCTCCC TGACTCCTCCCACGTCCTCCCCTCTCTGTGCCTCTTTTGTCCTTCAGSEQ ID NO: 12 (1R-5I-4.2) GTAAGTACATCATTCCATTATTCTCTTCCCCATCTCCTCCCCTCTTTCCCTCCCTCC CTGGCTGGGGGGCTGGGAGATTGGTGCATCCTCTGTTTCTTTCTTTGCGCGTCCTG GATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAATAGGACGAAACGCGCT TTTCTTTTTGTTTCTCCCAAACTCATCACCCTAAGGCTCTAGGAGAAAAACCTCCC TGACTCCTCCCACGTCCTCCCCTCTCTGTGCCTCTTTTGTCCTTCAGSEQ ID NO: 13 (human IgGl intron 2 (IGHG1)) GTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCCTAGAG TAGCCTGCATCCAGGGACAGGCCCCAGCCGGGTGCTGACACGTCCACCTCCATCT CTTCCTCAGSEQ ID NO: 14 (COL1A2 intron 7) GTAAGTACTGAAAGCTTGTAATGCCTCTTATGTAAAAAGACAGAGAATTAAGAA ATAAAGGCTTGGAGTCTGACATTCTTTTTTTCTTTTAG SEQ ID NO: 15 (COL1A2 intron 14) GTAAGTACTCCTGGCCCCTTGGGGGATCCCTGAGCTCTGGACGGGGCTCCCCAGG AACTCTCGGGACTGGCCAGTGCTCAGTGGACTTAACGGGGCTTCCCCTCTCTCCT GCAGSEQ ID NO: 16 (COL5A3 intron 58)GTAAGTACATCATTCCATTATTCTCTTCCCCATCTCCTCCCCTCTTTCCCTCCCTCC CTGGCTGGGGGGCTGGGAGATTGGTGCATCCTCTGCTCCCAAACTCATCACCCTA AGGCTCTAGGAGAAAAACCTCCCTGACTCCTCCCACGTCCTCCCCTCTCTGTGCC TCTTTTGTCCTTCAGSEQ ID NO: 17 (1R-5I-5.1) GTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTC TTTCTTTCTTTGCGCGTCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGTCCC AAATAGGACGAAACGCGCTTTTCTTTTTGTTTACGGCGAGCGCTGCCACGTCAGA CGAAGGGCGCAGCGAGCGTCCTGATCCTTCCGCCCGGACGCTCAGGACAGCGGC CCGCTGCTCATAAGACTCGGCCTTAGAACCCCAGTATCAGCAGAAGGACATTTTA GGACGGGACTTGGGTGACTCTAGGGCACTGGTTTTCTTTCCAAACACCGGAACAG GCGAGGAAAAGTAGTCCCTTCTCGGCGATTCTGCGGAGGGATCTCCGTGGGGCG GTGAACGCCGATGATGCCTCTACTAACCATGACCATGTTTTCTTTTTTTTTCTAGA GSEQ ID NO: 18 (1R-5I-5.2) GTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTC ACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTCCTGTTTCTTTCT TTGCGCGTCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAATAGGA CGAAACGCGCTTTTCTTTTTGTTTATCCTTCCGCCCGGACGCTCAGGACAGCGGC CCGCTGCTCATAAGACTCGGCCTTAGAACCCCAGTATCAGCAGAAGGACATTTTA GGACGGGACTTGGGTGACTCTAGGGCACTGGTTTTCTTTCCAAACACCGGAACAG GCGAGGAAAAGTAGTCCCTTCTCGGCGATTCTGCGGAGGGATCTCCGTGGGGCG GTGAACGCCGATGATGCCTCTACTAACCATGACCATGTTTTCTTTTTTTTTCTAGA GSEQ ID NO: 19 (1R-5I-5.3) GTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTC ACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTCCTGATCCTTCC GCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTTAGAACCCCAGTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTCTAGGGCACTG GTTTTCTTTCCAAACACCGGAACAGGCGAGGAAAAGTAGTCCCTTCTTTCTTTCTT TGCGCGTCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAATAGGAC GAAACGCGCTTTTCTTTTTGTTTTCGGCGATTCTGCGGAGGGATCTCCGTGGGGC GGTGAACGCCGATGATGCCTCTACTAACCATGACCATGTTTTCTTTTTTTTTCTAG AGSEQ ID NO: 20 (1R-5I-5.4) GTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTC ACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTCCTGATCCTTCC GCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTTAGAACCC CAGTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTCTAGGGCACTG GTTTTCTTTCCAAACACCGGAACAGGCGAGGAAAAGTAGTCCCTTCTCGGCGATT CTGCGGAGGGATCTTTTCTTTCTTTGCGCGTCCTGGATTCCACTTCGGGTACATCC AGCTGACGAGTCCCAAATAGGACGAAACGCGCTTTTCTTTTTGTTTCCGTGGGGC GGTGAACGCCGATGATGCCTCTACTAACCATGACCATGTTTTCTTTTTTTTTCTAG AGSEQ ID NO: 21 (1R-5I-5.5) GTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTC ACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTCCTGATCCTTCC GCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTTAGAACCC CAGTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTCTAGGGCACTG GTTTTCTTTCCAAACACCGGAACAGGCGAGGAAAAGTAGTCCCTTCTCGGCGATT CTGCGGAGGGATCTCCGTGGGGCGGTGAACGCTTTCTTTCTTTGCGCGTCCTGGA TTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAATAGGACGAAACGCGCTTTTCTTTTTGTTTCGATGATGCCTCTACTAACCATGACCATGTTTTCTTTTTTTTTCTAGAGSEQ ID NO: 22 (an intron containing a human ubiquitin C (UBC) enhancer)GTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTC ACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTCCTGATCCTTCC GCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTTAGAACCC CAGTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTCTAGGGCACTG GTTTTCTTTCCAAACACCGGAACAGGCGAGGAAAAGTAGTCCCTTCTCGGCGATT CTGCGGAGGGATCTCCGTGGGGCGGTGAACGCCGATGATGCCTCTACTAACCAT GACCATGTTTTCTTTTTTTTTCTAGAGSEQ ID NO: 23 (Peptide sequence of P7)RXR RXR RXR RXR XB(R, arginine; X, 6-aminohexanoic acid; B, beta-alanine)SEQ ID NO:24 (Zon-MOE-1)ATCCAGGACGCGCAAAGSEQ ID NO: 25 (Zon-MOE-2)AATCCAGGACGCGCAAASEQ ID NO: 26 (Zon-MOE-3)GAATCCAGGACGCGCAA SEQ ID NO: 27 (Zon-MOE-4)GGAATCCAGGACGCGCASEQ ID NO: 28 (Zon-MOE-5)AGTGGAATCCAGGACGCSEQ ID NO: 29 (Zon-MOE-6)CGAAGTGGAATCCAGGASEQ ID NO: 30 (Zon-MOE-7)ACCCGAAGTGGAATCCASEQ ID NO: 31 (Zon-MOE-8)TGTACCCGAAGTGGAATSEQ ID NO: 32 (Zon-MOE-9)AATCCAGGACGCGCAAAGSEQ ID NO: 33 (Zon-MOE-lO)GAATCCAGGACGCGCAAASEQ ID NO: 34 (Zon-MOE-11)GAATCCAGGACGCGCAAAGSEQ ID NO: 35 (Zon-MOE-12)ATCCAGGACGCGCAAASEQ ID NO: 36 (Zon-MOE-13)AATCCAGGACGCGCAASEQ ID NO: 37 (Termite-HHR, a natural hammerhead ribozyme from a termite) GCTCGTAGCGGGAGCCGGACCCTCCGCCTCACGGTGGTCAAAACTCCGCCTGAC GAGACCCTTTGCGGCAGGGGTTGAAACGAGCSEQ ID NO: 38 (Sm-TwR, a natural twister ribozyme from Schistosoma mansoni) CCAATAACTCCGCCTGTAGCACATCTTGTGTTACTGCCGGTCCCAAGCCCGGGTA AAGGAGGAGGGTTGGSEQ ID NO: 39 (HDVR, HDV genomic ribozyme) ATGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAG GGGACCGTCCCCTCGGTAATGGCGAATGGGACCSEQ ID NO: 40 (HDVagR, HDV antigenomic ribozyme) ATGGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCATCCGAAGGA GGACGCACGTCCACTCGGATGGCTAAGGGAGAGCCSEQ ID NO: 41 (3R-HDVR 5'-UTR Splicing-control RNA Effector) ACTAAAACAGGTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCG CCCCCCTCCTCACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTC CTGATCCTTCCGCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGC CTTAGAACCCCAGTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTC TAGGGCACTGGTTTTCTTTCCAAACACCGGAACAGGCGAGGAAAAGTAGTCCCTT CTCGGCGATTCTGCGGAGGGATCTCCGTGGGGCGGTGAACGCTTTCTTTCTTTAT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGG GACCGTCCCCTCGGTAATGGCGAATGGGACCTTTTCTTTTTGTTTCGATGATGCCT CTACTAACCATGACCATGTTTTCTTTTTTTTTCTAGAGGTCCTGAGTGACGAACAGSEQ ID NO: 42 (3R-HDVR Coding Region Splicing-control RNA Effector) GTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCCTTTTCT TTCTTTATGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATT CCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCTTTTCTTTTTGTTTGGGGAAGCCTGCATCCAGGGACAGGCCCCAGCCGGGTGCTGACACGTCCACCTCCAT CTCTTCCTCAGSEQ ID NO: 43 (v-HDM2, morpholino oligo targeting the HDV genomic ribozyme) GGTCCCCTCGGAATGTTGCCCAGCCSEQ ID NO: 44 (3R-HDVagR 5'-UTR Splicing-control RNA Effector) ACTAAAACAGGTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCG CCCCCCTCCTCACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTC CTGATCCTTCCGCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGC CTTAGAACCCCAGTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTC TAGGGCACTGGTTTTCTTTCCAAACACCGGAACAGGCGAGGAAAAGTAGTCCCTT CTCGGCGATTCTGCGGAGGGATCTCCGTGGGGCGGTGAACGCTTTCTTTCTTTAT GGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCATCCGAAGGAG GACGCACGTCCACTCGGATGGCTAAGGGAGAGCCTTTTCTTTTTGTTTCGATGAT GCCTCTACTAACCATGACCATGTTTTCTTTTTTTTTCTAGAGGTCCTGAGTGACGA ACAGSEQ ID NO: 45 (3R-HDVagR Coding Region Splicing-control RNA Effector) GTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCCTTTTCT TTCTTTATGGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCATCC GAAGGAGGACGCACGTCCACTCGGATGGCTAAGGGAGAGCCTTTTCTTTTTGTTT GGGGAAGCCTGCATCCAGGGACAGGCCCCAGCCGGGTGCTGACACGTCCACCTC CATCTCTTCCTCAGSEQ ID NO: 46 (v-HDagMl, morpholino oligo targeting the HDV antigenomic ribozyme) AGGTGGAGATGCCATGCCGACCCATSEQ ID NO: 47 (Zon-IL-2 mutein) AAAACAGGTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCC CCCTCCTCACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTCCTG ATCCTTCCGCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTT AGAACCCCAGTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTCTAG GGCACTGGTTTTCTTTCCAAACACCGGAACAGGCGAGGAAAAGTAGTCCCTTCTC GGCGATTCTGCGGAGGGATCTCCGTGGGGCGGTGAACGCTTTCTTTCTTTGCGCG TCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAATAGGACGAAAC GCGCTTTTCTTTTTGTTTCGATGATGCCTCTACTAACCATGACCATGTTTTCTTTTT TTTTCTAGAGGTCCTGAGTGACGAACAGGAATTCGATCCGCGGCCGCCACCATGC CCATGGGGTCTCTGCAACCGCTGGCCACCTTGTACCTGCTGGGGATGCTGGTCGC TTCCGTGCTAGCGGCCCCCACCTCTAGCAGCACCAGCTCTAGTACAGCAGAGGCC CAGCAGCAGCAGCAACAACAGCAGCAGCAACAGCAACACTTGGAGCAGCTCCTG ATGGACCTGCAGGTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACA GGTGCCCTTTTCTTTCTTTGCGCGTCCTGGATTCCACTTCGGGTACATCCAGCTGA CGAGTCCCAAATAGGACGAAACGCGCTTTTCTTTTTGTTTGGGGAAGCCTGCATC CAGGGACAGGCCCCAGCCGGGTGCTGACACGTCCACCTCCATCTCTTCCTCAGGA GTTGCTCAGCAGAATGGAGAATTACAGGAATCTGAAGCTTACAAGGATGCTTAC CTTCAAGTTTTATCTGCCCAAGCAAGCTACAGAGCTCAAGGACCTCCAGTGCCTG GAAGATGAACTGGGCCCTCTCCGGCATGTCCTAGACTTAACCCAGAGCAAATCCT TCCAGCTGGAGGATGCTGAAAATTTCATCAGCAGAATCCGAGACACTGTGGTGA AGCTGAAAGGCAGCGACAACACATTTGAATGCCAGTTTGATGATGAGTCTGCCA CAGTGGTGGACTTCCTCCGGCGCTGGATTGCCTTCGCTCAATCCATCATCTCAAC CTCACCTCAAGGCGGAGGTGGATCTGGTGGTGGAGGATCCGGTGGAGGTGGTAG CGATCCCAGAGGGCCCACAATCAAGCCCTGTCCTCCATGCAAATGCCCAGCACCT AACCTCTTGGGTGGACCATCCGTCTTCATCTTCCCTCCAAAAATCAAGGATGTAC TCATGATCTCCCTGAGCCCCATAGTCACATGTGTGGTGGTGGATGTGAGCGAGGA TGACCCAGATGTCCAGATCAGCTGGTTTGTGAACAACGTGGAAGTACACACAGC TCAGACACAAACCCATAGAGAGGATTACGGCAGTACTCTCCGGGTCGTCAGTGC CCTCCCCATCCAGCACCAGGACTGGATGAGTGGCAAGGAGTTCAAATGCAAGGT CAACAACAAAGACCTCCCAGCGCCCATCGAGAGAACCATCTCAAAACCCAAAGG CAGCGTGAGAGCTCCACAGGTCTATGTCTTGCCTCCACCAGAAGAAGAGATGAC TAAGAAACAAGTCACTCTGACCTGCATGGTCACAGACTTCATGCCTGAAGACATTTACGTGGAGTGGACCAACAACGGGAAAACAGAGCTAAACTACAAGAACACTGA ACCAGTCCTGGACTCTGATGGTTCTTACTTCATGTACAGCAAGCTGAGAGTGGAA AAGAAGAACTGGGTGGAAAGAAATAGCTACTCCTGTTCAGTGGTCCACGAGGGT CTGCACAATCACCACACGACTAAGAGCTTCTCCCGGACTCCGGGCAAATGACAT ATGTTTCTTTCTTTGCGCGTCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGT CCCAAATAGGACGAAACGCGCTTTTCTTTTTGTTTSEQ ID NO: 48 (Zon-FGF21) AAAACAGGTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCC CCCTCCTCACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTCCTG ATCCTTCCGCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTT AGAACCCCAGTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTCTAG GGCACTGGTTTTCTTTCCAAACACCGGAACAGGCGAGGAAAAGTAGTCCCTTCTC GGCGATTCTGCGGAGGGATCTCCGTGGGGCGGTGAACGCTTTCTTTCTTTGCGCG TCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAATAGGACGAAAC GCGCTTTTCTTTTTGTTTCGATGATGCCTCTACTAACCATGACCATGTTTTCTTTTT TTTTCTAGAGGTCCTGAGTGACGAACAGGAATTCGATCCGCGGCCGCCACCATGG AATGGATGAGATCTAGAGTTGGGACCCTGGGACTCTGGGTTCGGCTGCTGCTGGC TGTCTTCCTGCTGGGGGTCTACCAAGCATACCCCATCCCTGACTCCTCTCCACTGC TGCAATTTGGGGGTCAAGTCCGGCAGCGCTACCTGTACACCGATGACGACCAAG ACACTGAAGCCCACCTGGAGATCAGGGAGGATGGAACAGTCGTCGGCGCAGCAC ACCGCAGCCCAGAAAGTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGG ACAGGTGCCCTTTTCTTTCTTTGCGCGTCCTGGATTCCACTTCGGGTACATCCAGC TGACGAGTCCCAAATAGGACGAAACGCGCTTTTCTTTTTGTTTGGGGAAGCCTGC ATCCAGGGACAGGCCCCAGCCGGGTGCTGACACGTCCACCTCCATCTCTTCCTCA GGCCTCCTGGAGCTCAAAGCCCTGAAGCCAGGGGTCATTCAAATCCTGGGTGTC AAAGCCTCCCGCTTTCTGTGCCAACAACCTGATGGAGCTCTCTATGGATCCCCTC ACTTTGATCCTGAGGCCTGCTCCTTCCGCGAACTGCTGCTGGAGGACGGTTACAA TGTGTACCAGTCTGAAGCCCATGGCCTGCCCCTGAGACTGCCACAAAAAGACTCC CCAAACCAAGATGCAACATCCTGGGGACCTGTTCGCTTCCTGCCAATGCCCGGCC TCCTCCACGAGCCCCAAGACCAAGCAGGATTCCTGCCACCTGAACCCCCCGATGT GGGCTCCTCTGACCCCCTGAGCATGGTGGAGCCACTGCAGGGCCGGTCCCCCAGCTATGCATCCTGAGGATCCTTTCTTTCTTTGCGCGTCCTGGATTCCACTTCGGGTA CATCCAGCTGACGAGTCCCAAATAGGACGAAACGCGCTTTTCTTTTTGTTT

Claims

1. CLAIMS2.What is claimed is:

1. A splicing-control RNA switch effector, comprising an intron and a selfcleaving ribozyme placed between a 5 '-splice site and a 3 '-splice site of the intron.

2. The RNA switch effector of claim 1, wherein the intron is any one of:5.i) a human IgGl intron having a sequence identified in SEQ ID NO: 13 or a sequence or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence; ii) COL1 A2 intron 7 having a sequence identified in SEQ ID NO: 14 or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence;6.iii) COL1 A2 intron 14 having a sequence identified in SEQ ID NO: 15 or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence;7.iv) COL5 A3 intron 58 having a sequence identified in SEQ ID NO: 16 or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

3. The RNA switch effector of claim 1, wherein the intron comprises an enhancer of human ubiquitin C (UBC) gene between the 5'-splice site and the 3'-splice site, the intron having a sequence identified in SEQ ID NO:22, or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

4. The RNA switch effector of any one of claims 1-3, wherein the self-cleaving ribozyme is any one or variant of a hammerhead ribozyme, a twister ribozyme, a hepatitis delta virus (HDV) ribozyme, a HDV-like ribozyme, a pistol ribozyme, a hatchet ribozyme, a twister sister ribozyme, a hairpin ribozyme, a Varkud satellite (VS) ribozyme, a glucosamine-6-phosphate synthase (glmS) ribozyme, a Vgl ribozyme, a B2 retrotransposon ribozyme, an ALU retrotransposon ribozyme, a hovlinc ribozyme, or a combination thereof.

5. The RNA switch effector of claim 4, wherein the self-cleaving ribozyme comprises a sequence (5'- 3') GCGCG TCCTG GATTC CACTT CGGGT ACATC CAGCT GACGA GTCCC AAATA GGACG AAACG CGC (SEQ ID NO: 5) or a or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

6. The RNA switch effector of any one of claims 1-5, wherein the ribozyme is placed within about 20 to 100 bp downstream of the 5'-splice site.

7. The RNA switch effector of claim 1, comprising a sequence (5'- 3') shown in any one of SEQ ID NOs: 1-4, 7-12, and 17-21, or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

8. An expression vector comprising a target gene sequence operably fused to one or more splicing-control RNA switch effector coding sequences, wherein the RNA switch effector coding sequences are inserted into the target gene sequence within its 5' untranslated region (5'-UTR) and / or coding region, and wherein the RNA switch effector is set forth in any one of claims 1-7.

9. The expression vector of claim 8 further comprising a self-cleaving ribozyme coding sequence, wherein the self-cleaving ribozyme coding sequence is inserted into the target gene within its 3' untranslated region (3'-UTR).

10. The expression vector of claims 8 and 9, wherein the self-cleaving ribozyme is any one or variant of a hammerhead ribozyme, a twister ribozyme, a hepatitis delta virus (HDV) ribozyme, a HDV-like ribozyme, a pistol ribozyme, a hatchet ribozyme, a twister sister ribozyme, a hairpin ribozyme, a Varkud satellite (VS) ribozyme, a glucosamine-6-phosphate synthase (glmS) ribozyme, a Vgl ribozyme, a B2 retrotransposon ribozyme, an ALU retrotransposon ribozyme, a hovlinc ribozyme, or a combination thereof.

11. The expression vector of any one of claims 8-10, wherein the self-cleaving ribozyme is a hammerhead ribozyme, the ribozyme comprising a sequence (5'- 3') GCGCG TCCTG GATTC CACTT CGGGT ACATC CAGCT GACGA GTCCC AAATA GGACG AAACG CGC (SEQ ID NO: 5) or a or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

12. The expression vector of any one of claims 8-11, wherein the splicing-control RNA switch effector coding sequence comprises a sequence (5'- 3') shown in any one of SEQ ID NOs: 1-4, 7-12, and 17-21, or a sequence with 95%, 90%, 85%, 80%, or 75% homology to said sequence.

13. The expression vector of any one of claims 8-12, further comprising one or more regulatory sequences.

14. The expression vector of any one of claims 8-13, wherein the vector is a DNA vector.

15. The expression vector of any one of claims 8-14, wherein the target gene encodes erythropoietin (Epo), vascular endothelial growth factor A (VEGFA), fibroblast growth factor 21 (FGF21), interleukin-2 (IE-2), or a CRISPR-Cas genome editor.

16. An engineered mammalian cell harboring the expression vector of any one of claims 8-15.

17. A method for inducing expression of a target gene in a cell, comprising (i) introducing the expression vector any one of claims 8-15 into the cell, and (ii) contacting the cell with an RNase H-independent antisense oligonucleotide that is complementary to the selfcleaving ribozyme coding sequence in the expression vector; thereby inducing expression of the target gene in the cell.

18. The method of claim 17, wherein the RNase H-independent antisense oligonucleotide is a morpholino oligonucleotide, or a 2'-0-methoxyethyl modified oligonucleotide with phosphorothioate linkages (2'-O-MOE / PS).

19. The method of claim 17 or 18, wherein the cell is a mammalian cell.

20. The method of any one of claims 17-19, wherein the expression vector is an adeno-associated virus (AAV) vector.

21. The method of claims 17-20, wherein the RNA switch effector encoded by the vector is any one of claims 1-6.

22. The method of claims 17-21, wherein the self-cleaving ribozyme encoded by the vector is any one of claims 4 and 5.

23. The method of claims 17-22, wherein the target gene encodes erythropoietin (Epo), vascular endothelial growth factor A (VEGFA), fibroblast growth factor 21 (FGF21), interleukin-2 (IE-2), or a CRISPR-Cas genome editor.

24. The method of claims 17-23, wherein the RNase H-independent antisense oligonucleotide is an octa- guanidine dendrimer-conjugated morpholino oligo or peptide-conjugated morpholino oligo.

25. The method of claim 17-24, wherein the RNase H-independent antisense oligonucleotide comprises an oligonucleotide sequence as shown in any one of SEQ ID NOs: 6 and 24-36, or a sequence with 95%, 90%, 85%, 80%, or 75% homology thereto.

26. The method of any one of claims 17-25, wherein the cell is present in a subject in need of the polypeptide encoded by the target gene.

27. The method of any one of claims 17-26, wherein the cell is obtained from the subject prior to introduction of the expression vector into the cell.

28. The method of any one of claims 17-27, further comprising, subsequent to introducing the expression vector into the cell, reintroducing the cell into the subject.

29. The method of any one of claims 17-28, wherein the RNase H-independent antisense oligonucleotide is administered to the subject subsequent to reintroducing the cell into the subject.

Citation Information

Patent Citations

  • Programmable alternative splicing devices and uses thereof

    US10053697B1

  • Production and / or delivery of multispecific binding agents

    WO2023225447A1

  • Methods for intron-driven gene editing and control

    WO2024107836A1