Solanum lycopersicum with altered abscission zone morphology

The novel Jointless-2 allele in tomatoes, achieved via CRISPR/Cas editing of the SIMBP21 gene, addresses the challenges of jointless breeding by eliminating abscission zones without branching or yield reduction, maintaining desirable traits like disease resistance.

WO2026093395A1PCT designated stage Publication Date: 2026-05-07PHYTOFORM LABS LTD
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
PHYTOFORM LABS LTD
Filing Date
2025-10-29
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Conventional breeding methods for producing jointless tomatoes in fresh market production are hindered by linkage drag, resulting in unwanted traits such as extreme flower truss branching, reduced yields, and loss of disease resistance, while CRISPR/Cas-mediated gene knock-outs also fail to address these issues effectively.

Method used

A novel Jointless-2 (J2) allele is introduced through CRISPR/Cas gene editing, specifically disrupting the SIMBP21 gene's splice site to eliminate the abscission zone, maintaining desirable genetics like broad-spectrum disease resistance without excessive branching.

Benefits of technology

The solution achieves a jointless phenotype in tomatoes without extreme branching or morphological disruptions, ensuring high yield and disease resistance, overcoming the limitations of conventional breeding and CRISPR/Cas-mediated approaches.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2025081267_07052026_PF_FP_ABST
    Figure EP2025081267_07052026_PF_FP_ABST
Patent Text Reader

Abstract

A member of the Solanum species, such as a tomato (Solanum lycopersicum) plant, is provided that exhibits a jointless phenotype, wherein the plant comprises a Jointless-2 (j2) allele that is defined by the removal or disruption of a splice site within the SlMBP21 (Solyc12g038510) gene The removal or disruption of a splice site results in the complete or partial loss of at least one exon in an mRNA transcribed from a SlMBP21 gene (Solyc12g038510). More particularly, the removal or disruption of a splice site results in the complete or partial loss of exon 5 in an mRNA transcribed from a SlMBP21 gene (Solyc12g038510). The removal or disruption of a splice site may be carried out using precision breeding techniques.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] SOLANUM LYCOPERSICUMWVTH ALTERED ABSCISSION ZONE MORPHOLOGY

[0002] TECHNICAL FIELD

[0003] [1] The disclosure relates to improvements of tomato (Solatium lycopersicum) varieties utilising gene manipulation technologies, to generate plants having altered morphology in the form of a loss of a pedicel abscission zone.

[0004] BACKGROUND

[0005] [2] The wild ancestor of the modern tomato plant (Solanum lycopersicum) originated in the Andes Mountains of South America. This plant is believed to have been domesticated in pre-Columbian Mexico with the name “tomato” derived from the Nahuatl (Aztec) word “tomatl”. Today, tomatoes are cultivated extensively around the world for their edible fruits, which are commonly eaten raw, used in cooking, pickled, or processed into diverse products like canned tomatoes, tomato juice, concentrates, sauces, passata and ketchup. It is an essential crop in many countries and has high nutritional value, being rich in antioxidants such as vitamin C and lycopene. Improved agronomy and biotechnology efforts have resulted in thousands of diverse cultivars and varieties that are able to generate improved yields, flavours as well as better adapt to environmental stresses.

[0006] [3] The abscission zone in plants is a specialized layer of cells found at the base of various plant organs, such as leaves, fruits, and flowers. In the case of flowers and fruits, the abscission zone is characterised by a ‘joint’ in the architecture of the plant pedicel. This cellular structure plays a critical role in the regulated detachment of these organs from the main plant body. In tomatoes, pedicel abscission plays an important role in fruit yields and post-harvest quality. T omatoes having an abscission zone retain a distal pedicel section of stem after abscission and / or harvest. The stem can then damage other fruits during transportation and processing, dramatically lowering the quality of the product. Tomatoes lacking such an abscission zone are therefore desirable, and are also easier to harvest mechanically.

[0007] [4] ‘Jointless’ tomatoes, lacking an abscission zone, were reported in the mid-20thcentury (Rick, C. M. (1956), “Genetic and Systematic Studies on Accessions of Lycopersicon from the Galapagos Islands”, American Journal of Botany, 43(9), 687-696). Although the jointless trait is present in the global tomato germplasm, there have been multiple factors preventing widespread adoption in fresh market production. This is mostly associated with linkage drag from crosses between processing tomato germplasm that contain jointlessness and fresh market tomato germplasm using conventional breeding. It is not clear whether the strong linkage drag associated with jointless genes could be overcome through conventional breeding. Conventional breeding methods of producing jointless tomatoes have not been successful and result in unwanted morphology phenotypes such as small fruit, rough ‘shoulder’, skin cracking and fruit having variable or misshapen shape. [5] Although others have identified genes associated with jointlessness in tomatoes (e.g. US6514760B1 described the isolation and identification of a ‘JOINTLESS’ gene from a tomato plant), jointlessness is not a single gene trait. Further, the Jointless-2 (J2) gene is physically located near several other important genes associated with fruit characteristics. Therefore, introgression of jointless phenotype has been stymied by a large amount of linkage drag, whereby the trait is intrinsically linked to negative traits derived from the wild ancestor (Roldan M.V.G. et al. (2017), “Natural and induced loss of function mutations in SIMBP21 MADS-box gene led to jointless-2 phenotype in tomato”, Sci Rep 7, 4402). A number of defects that breeders observe when attempting introgression of jointlessness are dilution or complete lack of disease resistances, small fruits, rough ‘shoulder’, tomato cracking. Jointlessness can be achieved by CRISPR / Cas-mediated gene knock-out of J2, however this also results in excessive flower truss branching and reduced yields in the edited plant (Roldan et al. 2017). Hypothetically, suppressors of such excessive extreme branching caused by loss of J2 and EJ2 (enhancer of J2) do exist (Soyk et al. (2017), “Bypassing Negative Epistasis on Yield in Tomato Imposed by a Domestication Gene”, Cell (169), 1142-1155), but these are poorly characterised and thus cannot be implemented as needed.

[0008] [6] There therefore exists a need seeking to establish ‘jointless’ phenotype in a tomato variety targeted for fresh market tomato production, that does not exhibit any unwanted traits such as extreme flower truss branching or disrupted morphology but also maintains desirable background genetics such as broad-spectrum disease resistance of the background tomato hybrid variety.

[0009] SUMMARY OF THE DISCLOSURE

[0010] [7] Accordingly, the present disclosure provides a member of the Solanum species, such as a tomato (Solanum lycopersicum) plant, that exhibits a jointless phenotype, wherein the plant comprises a Jointless-2 (J2) allele that is defined by the removal or disruption of a splice site within the SIMBP21 (Solyc12g038510) gene.

[0011] [8] In some embodiments, the removal or disruption of a splice site results in the complete or partial loss of at least one exon in an mRNA transcribed from a SIMBP21 gene (Solyc12g038510). More particularly, in some embodiments, the removal or disruption of a splice site results in the complete or partial loss of exon 5 in an mRNA transcribed from a SIMBP21 gene (Solyc12g038510).

[0012] [9] In some embodiments, the splice site is disrupted by a mutation selected from an insertion, substitution, or a deletion mutation. In some embodiments, the complete or partial loss of the at least one exon from the mRNA is due to a deletion mutation of at least 12 nucleotides, at least 10 nucleotides, at least 9 nucleotides, at least 8 nucleotides, at least 7 nucleotides, at least 6 nucleotides, or optionally at least 5 nucleotides. In embodiments the mutation may be due to insertion or deletion of a single nucleotide. In some embodiments, the mutation is the result of a deletion during non-homologous end joining (NHEJ) repair or homology directed repair (HDR) following a staggered double strand break in the DNA, optionally wherein the staggered double strand break in the DNA is due to gene editing. In yet further embodiments, gene editing is effected by a Cas12a / Cpf1 ribonucleoprotein (RNP) complex comprising a Cas12a / Cpf1 endonuclease, or homologue or derivative thereof, and a guide RNA (gRNA), wherein the gRNA hybridises with a target sequence comprised within a SIMBP21 (Solyc12g038510) gene of the plant.

[0013]

[0010] In some embodiments, the plant of the disclosure is a cultivar selected from one of: Ailsa Craig, Amelia, Bella Rosa, BHN 602, BHN 730, BHN 975, Camaro, Charger, Crista, Everglade, Fletcher, FL 47, FL 91 , Grand Marshall, HM 1823, Maverick, Phoenix, Raceway, Red Morning, Red Rave, Resolute, Rocky Top, Sanibel, Sebring, Skyway, Solar Fire, Soraya, Southern Ripe, SV 7631 , Tasti-Lee, Volante, BHN 685, Daytona, Mariana, Monticello, Sunoma, Supremo, or Tachi.

[0014]

[0011] In some embodiments of the disclosure, the j2 allele is defined by a mutated SIMBP21 gene (Solyc12g038510) gene having a sequence according to SEQ ID NO: 4. In other embodiments, the j2 allele is defined by a mutated SIMBP21 gene (Solyc12g038510) gene having a sequence according to SEQ ID NOs: 12, 18 or 19.

[0015]

[0012] In some aspects of the disclosure, the jointless phenotype comprises elimination of an abscission zone within a pedicel of the plant, optionally a majority or even substantially all abscission zones are eliminated.

[0016]

[0013] The disclosure also provides a tomato (Solatium lycopersicum) plant cell comprising a mutation in at least one allele of a SIMBP21 gene (Solyc12g038510), wherein the mutation results in a jointless phenotype that comprises elimination of an abscission zone within a pedicel of a plant grown from the plant cell when compared to a plant grown from a tomato plant cell without the mutation. In some aspects, the jointless phenotype is defined as a Jointless-2 (J2) allele. In some aspects, the plant cell comprises a Jointless-2 (J2) allele.

[0017]

[0014] In some embodiments, the Jointless-2 (j2) allele of the plant cell comprises the loss of at least one exon in an mRNA obtained from the SIMBP21 gene (Solyc12g038510).ln some embodiments, the Jointless-2 (J2) allele comprises loss of exon 5 in an mRNA obtained from the SIMBP21 gene (Solyc12g038510). In some embodiments, the mutation comprises a deletion mutation of at least 12 nucleotides, at least 10 nucleotides, at least 9 nucleotides, at least 8 nucleotides, at least 7 nucleotides, at least 6 nucleotides, or optionally at least 5 nucleotides within a splice site that leads to loss of at least one exon in an mRNA obtained from the SIMBP21 (Solyc12g038510) gene. In yet further embodiments, the j2 allele is defined by a mutated SIMBP21 (Solyc12g038510) gene having a sequence according to SEQ ID NO: 4. In still further embodiments, the j2 allele is defined by a mutated SIMBP21 (Solyc12g038510) gene having a sequence according to SEQ ID NO: 18 or 19.

[0018]

[0015] In some embodiments, the plant cell is comprised within a leaf, pollen, an ovule, a fruit, a seed, a rootstock, a scion, an explant or a flower.

[0019]

[0016] The disclosure further provides a tissue culture comprising regenerable plant cells as described herein. Also encompassed within the scope of the disclosure is a tomato fruit comprising a plant cell as described herein.

[0017] The disclosures also provides a method for modifying a plant cell from the Solanaceae family in order to introduce a jointless phenotype, the method comprising mutating one or more copies of a SIMBP21 (Solyc12g038510) gene within the genome of the plant cell, wherein the mutation comprises a substitution of at least one nucleotide, a deletion of at least one nucleotide, an insertion of at least one nucleotide or any combination thereof so as to induce removal or disruption of a splice site within the SIMBP21 gene, wherein the removal or disruption of a splice site within the SIMBP21 gene results in the loss of at least one exon in an mRNA transcribed from the mutated SIMBP21 (Solyc12g038510) gene.

[0020]

[0018] In some embodiments, the removal or disruption of a splice site within the SIMBP21 gene results in the loss of exon 5 in an mRNA transcribed from the mutated SIMBP21 (Solyc12g038510) gene. In some embodiments, mutating of the one or more copies of the SIMBP21 (Solyc12g038510) gene within the genome of the plant cell is via a gene editing technique.

[0021]

[0019] In some embodiments, the gene editing technique of the disclosure comprises use of a CRISPR / Cas gene editing complex. In some embodiments, the CRISPR / Cas gene editing complex comprises a Cas endonuclease selected from: Cas9 (including derivatives and homologues thereof) and Cas12a / Cpf1 (including derivatives and homologues thereof). In some aspects, the plant cell which is modified is from the species Solanum lycopersicum (tomato).

[0022]

[0020] Unless otherwise stated, any and all embodiments, features, and variations described herein may be combined with one another in any suitable manner within the scope of the present disclosure and disclosure.

[0023] BRIEF DESCRIPTION OF THE DRAWINGS

[0024]

[0021] Figure 1. Splice map of Jointless-2. A. Splice map of wildtype Jointless-2 (Solyc12g038510) showing how the exons are spliced together during processing. B. Splice map of an edited jointless-2 according to the disclosure, showing the loss of the splice site causes the whole of exon 5 to be missed.

[0025]

[0022] Figure 2. Portion of the Jointless-2 sequence with a specific -6 nucleotide edit (SEQ ID NO: 1), shown in relation to an unedited reference, wild type Jointless-2 sequence (SEQ ID NO: 2). Depiction of read percentages from next generation sequencing results for the target region in Jointless-2 compared to the jointless edit.

[0026]

[0023] Figure 3. Alignment of wildtype Jointless-2 (Solyc12g038510) (SEQ ID NO: 3) against edited Jointless-2 (SEQ ID NO: 4).

[0027]

[0024] Figure 4. Photographs of tomato truss. A. Unedited wild-type truss. B. and C. Edited jointless truss. Arrows indicate presence of joints on the wildtype truss.

[0028]

[0025] Figure 5. Linear gene map of Jointless-2 (Solyc12g038510). Shaded pointed boxes indicate genetic elements, either exons or introns. Guide RNA (g11064F) that was used in generation of nonfunctional alleles (as described in Example 1) location is labelled with by the arrow above the gene map.

[0026] Figure 6. Linear gene map of Enhancer of Jointless-2 (EJ2, Solyc03g114840). Shaded pointed boxes indicate genetic elements, either exons or introns. Natural transposon insertion into intron 5 is annotated.

[0029]

[0027] Figure 7. Alignment of wildtype Jointless-2 (Solyc12g038510) coding sequence (CDS) (SEQ ID NO: 5) against the edited Jointless-2 CDS (SEQ ID NO: 6) isolated from cDNA.

[0030]

[0028] Figure 8. Alignment of wildtype Jointless-2 (Solyc12g038510) amino acid sequence (SEQ ID NO: 7) against edited jointless-2 amino acid sequence (SEQ ID NO: 8) from cDNA.

[0031]

[0029] Figure 9. The Jointless-2 sequence with a specific -10 nucleotide edit (-10bp_J2) (SEQ ID NO: 12), shown in relation to an unedited reference, wild type Jointless-2 sequence (WT_J2) (SEQ ID NO: 2).

[0032]

[0030] Figure 10. Alignment of wildtype EJ2 sequence (SEQ ID NO: 13) with an EJ2w sequence (SEQ ID NO: 14). EJ2w is a weak allele of EJ2 used in the background germplasm of Example 1 .

[0033]

[0031] Figure 11. Comparison of a wild type tomato plant exhibiting unbranched flowering truss and jointed pedicels, to an edited J2 tomato plant according to the disclosure. Arrows indicate that both the wild type and edited plants exhibit a single truss with no branching. The edited plant of the disclosure does not exhibit increased truss branching.

[0034]

[0032] Figure 12. Sequence of a MAD7 nuclease (SEQ ID NO: 15) which may be employed in the gene editing methods of the disclosure.

[0035]

[0033] Figure 13. Comparison of a wild type tomato plant of the Ailsa Craig variety exhibiting unbranched flowering truss and jointed pedicels, to an edited Ailsa Craig variety according to the present disclosure, close up images of the pedicel are shown in the bottom panels.

[0036]

[0034] Figure 14. Sequence (SEQ ID NO: 18) of the edited J2 Ailsa Craig variety (Allelel) shown in Fig. 13.

[0037]

[0035] Figure 15. Sequence (SEQ ID NO: 19) of the edited J2 Ailsa Craig variety (Allele2) shown in Fig. 13.

[0038] DETAILED DESCRIPTION

[0039]

[0036] The present disclosure seeks to provide a ‘jointless’ phenotype in a tomato variety targeted for fresh market tomato production, without any unwanted traits found in existing jointless plants such as extreme flower truss branching or disrupted morphology and while maintaining desirable background genetics such as the broad-spectrum disease resistance of the background tomato.

[0040]

[0037] Jointlessness in tomato is an absence of the abscission zone in the pedicel, located between the calyx of the fruit and the branch / peduncle. The abscission zone is also known as the joint. If a joint is present, it causes the distal pedicel (i.e. the pedicel closest to the calyx / fruit) to be retained if not removed by hand. The woody pedicel can then damage fruits during transportation and processing, dramatically lowering the quality of the product. Naturally occurring jointless mutants lack the joint. When harvested, jointless tomatoes do not retain the pedicel.

[0038] When attempting to generate fresh-market jointless tomatoes by conventional breeding, breeders and seed developers run into several problems, including: dilution of existing needed genetics such as broad-spectrum disease resistance, small fruit, rough ‘shoulder’, skin cracking and fruit having variable or misshapen shape.

[0041]

[0039] Using CRISPR / Cas technology to introduce jointlessness is also not straightforward because even though a j2 recessive allele causes jointlessness, in specific varieties such as heirlooms it can also result in unwanted extreme branching of the flowering truss and low yields (Soyk et al. 2017). Branching is caused by secondary recessive allele EJ2 (enhancer of jointless 2) and influenced to a variable extent by other unmapped factors. Therefore, although jointless is a valuable and desirable trait in production of tomatoes, it remains underutilised.

[0042]

[0040] Although the jointless trait has been known for a long time, and despite there being sources of the jointless trait in the global tomato germplasm, there have been multiple factors preventing widespread adoption in fresh market production. The Jointless-2 gene is physically located near several other important genes associated with fruit characteristics. Therefore, introgressing jointless has been stymied by a large amount of linkage drag, whereby the trait is intrinsically linked to negative traits derived from the wild ancestor (Roldan et al., 2017). A number of defects that breeders observe when introgressing jointlessness are dilution or complete lack of disease resistance, small fruits, rough ‘shoulder’, tomato cracking.

[0043]

[0041] The jointless trait is not a single gene trait, even though it can be achieved by targeting the J2 gene with a CRISPR / Cas gene knock-out, causing a recessive allele (Roldan et al. 2017). Its effect on the flowering truss is additionally controlled by its interaction with two layers of extra control: the presence or absence of dominant EJ2 allele and unknown secondary factors. >90% of large fruit varieties have a weak allele of Enhancer of Jointless2 (ej2w) (Soyk et al., 2017). ej2w has a transposon which reduces its function. While disrupting EJ2 does not affect the jointless trait itself, when a disrupted EJ2 is combined with a disrupted J2, an epistatic effect occurs, resulting in excessive flower truss branching and reduced yields. Therefore, because the secondary factors that influence the J2-EJ2 interaction are not known and cannot be screened for, in many cases, (especially heirloom varieties) knocking out J2 causes the extreme branching phenotype. Practically, this means that significant resources and time could be invested in generating CRISPR jointless varieties, only to discover that the variety was inherently incompatible due to the unknown secondary factors. Thus, adoption of jointless in the fresh market varieties has been very limited. Suppressors of such excessive extreme branching caused by loss of J2 and EJ2 do exist hypothetically (Soyk et al. 2017), but these are unknown and therefore cannot be screened or accounted for. The teaching of Soyk et al. shows that introducing a CRISPR / Cas-mediated j2 mutation into tomatoes having the ej2w allele results in extreme branching.

[0044]

[0042] The present disclosure seeks to overcome the above problems to produce an improved jointless tomato having desirable morphology and retaining broad-spectrum disease resistance by providing a novel j2 allele using gene editing. The present disclosure provides a tomato plant comprising a novel allele designed to be sufficiently compromised so as to cause the jointless trait but to retain enough functionality to avoid the extreme branching in an ej2w background. The mutation of the present disclosure therefore acts by lowering the “dose” associated with the J2 gene, while retaining some function necessary to prevent deleterious phenotypes such as excessive branching. The present disclosure therefore overcomes the issues of linkage drag and negative epistasis associated with all previously known jointless phenotypes.

[0045]

[0043] Unless otherwise indicated, the practice of the present disclosure employs conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA technology, and chemical methods, which are within the capabilities of a person of ordinary skill in the art. Such techniques are also explained in the literature, for example, M.R. Green, J. Sambrook, 2012, Molecular Cloning: A Laboratory Manual, Fourth Edition, Books 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel, F. M. et al. (Current Protocols in Molecular Biology, John Wiley & Sons, Online ISSN:1934- 3647); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O'D. McGee, 1990, In Situ Hybridisation: Principles and Practice, Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, IRL Press; and D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press; Synthetic Biology, Part A, Methods in Enzymology, Edited by Chris Voigt, Volume 497, pages 2-662 (2011); Synthetic Biology, Part B, Computer Aided Design and DNA Assembly, Methods in Enzymology, Edited by Christopher Voigt, Volume 498, Pages 2-500 (2011); RNA Interference, Methods in Enzymology, David R. Engelke, and John J. Rossi, Volume 392, Pages 1-454 (2005). All references cited herein are incorporated by reference in their entirety. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0046]

[0044] As used herein, the term “comprising” means any of the recited elements are necessarily included and other elements may optionally be included as well. “Consisting essentially of’ means any recited elements are necessarily included, elements that would materially affect the basic and novel characteristics of the listed elements are excluded, and other elements may optionally be included. “Consisting of’ means that all elements other than those listed are excluded. Embodiments defined by each of these terms are within the scope of this disclosure.

[0047]

[0045] A “polynucleotide” is a single or double stranded covalently-linked sequence of nucleotides in which the 3' and 5' ends on each nucleotide are joined by phosphodiester bonds. The polynucleotide may be made up of deoxyribonucleotide bases or ribonucleotide bases. Polynucleotides include DNA and RNA, and may be manufactured synthetically in vitro or isolated from natural sources. Sizes of polynucleotides are typically expressed as the number of base pairs (bp) for double stranded polynucleotides, or in the case of single stranded polynucleotides as the number of nucleotides (nt). One thousand bp or nt equal a kilobase (kb). Polynucleotides of less than around 40 nucleotides in length are typically called “oligonucleotides”.

[0046] As used herein the term “abscission zone” is synonymous with the term “joint”. The term ‘abscission zone’ may relate to any region of plant architecture provided at a junction between plant organs. More specifically, the term ‘abscission zone’ relates to a region which allows the separation, or abscission, of two or more sections or organs of the plant. The term ‘abscission zone’ (or joint) may particularly refer to the pedicel of a fruiting plant, such as a tomato, where the pedicel connects the fruit to the stem - see, for example, regions indicated by arrows in Figure 4A. As such the abscission zone, or joint, of the pedicel facilitates fruit harvesting or dropping. The pedicel may be divided into two sections, the ‘proximal pedicel’, located between the abscission zone and the main plant stem, and the ‘distal pedicel’ located between the abscission zone and the fruit of the plant.

[0048]

[0047] As used herein the term "jointless” refers to a plant phenotype wherein the plant lacks an abscission zone or joint in the pedicel connecting the main stem to the fruiting body of the plant. A ‘jointless’ plant may exhibit a complete lack of abscission zones. A ‘jointless’ plant may exhibit a reduced number of abscission zones relative to a wild type plant.

[0049]

[0048] The term "phenotype" refers to the observable physical, biochemical, and behavioural characteristics of an organism, which result from the interaction of its genetic makeup (genotype) and environmental factors. These characteristics may include traits such as morphology, development, biochemical properties, and responses to environmental stimuli.

[0050]

[0049] The term "splice site" refers to specific nucleotide sequences at the boundaries of introns and exons in a precursor mRNA molecule that are recognised during the process of RNA splicing into mature mRNA. RNA splicing removes introns from the mRNA to ensure the mature mRNA only consists of exons. Splice sites include the 5' splice site (donor site) and the 3' splice site (acceptor site), which direct the removal of introns and the joining of exons to form mature mRNA. “Splicing” is the process by which introns, non-coding regions of a precursor mRNA, are removed and exons (i.e. coding regions) are joined together to form a mature mRNA molecule. This process occurs in the cell nucleus and is essential for the accurate expression of genes, allowing the mature mRNA to be properly translated into a functional protein. Splicing is catalysed by a complex of proteins and RNA molecules called the spliceosome.

[0051]

[0050] As used herein “removal” of a splice site may refer to any mutation which causes the loss of a splice site in the transcribed precursor RNA. Therefore the “removal” of a splice site may include the deletion of some or all of the DNA bases which encode the nucleotides of the donor and / or the acceptor splice sites. As used herein “disruption” of a splice site may refer to any mutation which causes a splice site to become non-functional in the transcribed precursor RNA. Therefore the “disruption” of a splice site may include a modification to a conserved sequence which results in inhibition of splicing. Such modifications could include one or more of a deletion, insertion, or substitution of one or more nucleotides in the conserved splice site (and may therefore include the deletion of one or more codon sequences in the corresponding DNA coding sequence).

[0052]

[0051] The term "allele(s)" means any of one or more alternative forms of a gene at a particular locus. In a diploid (oramphidiploid) cell of an organism, alleles of a given gene are located at a specific location or locus on a chromosome, with one allele being present on each chromosome of the pair of homologous chromosomes. Similarly, in a tetrapioid cell of an organism, one allele is present on each chromosome of the group of four homologous chromosomes. "Heterozygous" alleles are different alleles residing at a specific locus, positioned individually on corresponding homologous chromosomes. "Homozygous" alleles are identical alleles residing at a specific locus, positioned individually on corresponding homologous chromosomes in the cell.

[0053]

[0052] The term “allelic variant” is used herein to denote any two or more alternative forms of a gene occupying the same chromosomal locus and controlling the same inherited characteristic. Allelic variation may arise naturally though mutation or artificially through gene editing and may result in phenotypic polymorphism within populations. Gene mutations typically result in an altered nucleic acid sequence and in some cases an altered polypeptide sequence also. As used herein, the term “allelic variant” is additionally used to refer to the protein or polypeptide encoded by the allelic variant of a gene.

[0054]

[0053] As used herein, the term “Jointless (j2) allele” refers to any allelic variant of the wild type gene which results in a jointless phenotype. In some embodiments, the wild type gene is the reference gene SIMBP21 (Solyc12g038510) having a sequence according to SEQ ID NO: 3 and a coding sequence represented by SEQ ID NO: 5. An example of a jointless (J2) allele is represented by SEQ ID NO: 4. Other examples of a j2 allele are represented by SEQ ID NOs: 12, and also 18 or 19.

[0055]

[0054] As used herein, the term “exon” refers to a portion of DNA and / or precursor mRNA which is usually processed into mature mRNA. In other words, an exon is a portion of the genome which, under normal circumstances, is expressed in the cell. As used herein, “precursor mRNA” may be taken to mean any mRNA which has been transcribed from DNA, but is yet to undergo splicing. As used herein, “mature mRNA” is mRNA which has been spliced following transcription.

[0056]

[0055] As used herein, the term “exon 5” of a SIMBP21 gene (Solyc12g038510) may refer to a protein having residues 83 to 96 of SEQ ID NO: 7. The protein encoded by exon 5 may therefore have a sequence according to SEQ ID NO: 9. As used herein, the term “exon 5” of a SIMBP21 gene (Solyc12g038510) may refer to bases 427 to 468 of SEQ ID NO: 5. Exon 5 may therefore have a sequence according to SEQ ID NO: 10.

[0057]

[0056] As used herein, the terms “SIMBP21” and “Jointless-2” may be used interchangeably, and may both refer to the Solyc12g038510 gene.

[0058]

[0057] The term “isolated”, when applied to a polynucleotide sequence, denotes that the sequence has been removed from its natural organism of origin and is, thus, free of extraneous or unwanted coding or regulatory sequences. Isolated oligonucleotides may be fully or partially of synthetic origin, that is, synthesised chemically as opposed to derived from natural sources.

[0059]

[0058] The adjective “isolated”, when applied to a polypeptide or a ribonucleoprotein complex refers to a substantially purified composition, or in the case of a ribonucleoprotein complex, at least one component being a substantially purified component. In further respect to an isolated ribonucleoprotein complex, preferably all components are substantially purified.

[0060]

[0059] As used herein, the terms 3' (‘3 prime’) and 5' (‘5 prime’) take their usual meanings in the art, i.e. to distinguish the ends or directionality within polynucleotide sequences. A polynucleotide has a 5' and a 3' end and polynucleotide sequences are conventionally written in a 5' to 3' direction. The 5’ end is suitably considered to be upstream of the 3’ end of a polynucleotide sequence. Hence, a sequence referred to as upstream of a given reference point in a gene, such as the ATG transcription start codon of an open reading frame (ORF), is a sequence that is 5’ to the reference point. Likewise, a sequence denoted as downstream is 3’ to the reference point, e.g. downstream to the ATG start codon.

[0061]

[0060] As used herein, the terms "plant" and "plant part" refer to cells, tissues, organs, seeds, and severed parts (e.g., roots, leaves, and flowers) that retain the distinguishing characteristics of the parent plant. "Tuber" refers to a thickened underground part of a stem or rhizome, serving as a food reserve and bearing buds from which new plants arise. "Seed" refers to any plant structure that is formed by continued differentiation of the ovule of the plant, following its normal maturation point at flower opening, irrespective of whether it is formed in the presence or absence of fertilization and irrespective of whether or not the seed structure is fertile or infertile. Other propagatable parts of a plant may include tissue cultures of regenerable cells, calli, cuttings, or root segments. Suitably, a “plant cell” may be selected from a gametophyte, a reproductive cell, a vegetative cell and / or a meristematic cell. In embodiments, suitable plant tissue is selected from: leaf, stem, root, seed, branch, pubescence, nodule, leaf axil, flower, pollen, stamen, pistil, petal, peduncle, stalk, stigma, style, scion, bract, fruit, trunk, carpel, sepal, anther, ovule, pedicel, needle, cone, rhizome, stolon, shoot, pericarp, endosperm, placenta, berry, stamen, or leaf sheath. In specific embodiments plant parts and cellular material may include root tissue, leaf mesophyll and / or cultured callus.

[0062]

[0061] As used herein the term “tomato” may be taken to refer to any variety or cultivar of tomato. The term “tomato” therefore encompasses (but is not limited to) the following, to which the genetic modifications described herein may be made: 42 days; 506 Bush; A Grappoli D'lnverno; Abracazebra; Ace; Ailsa Craig; Alicante; Amai; Amana Orange; Amarillo; Amelia; Amish Gold Slicer; Amish Paste; Amsterdam; Ananas Noire; Andiamo; Andrew; Arvento; Rahart's Jumbo Red; Andrina; Anna Aasa; Apero; Applause; Apple Yellow; Apricot Zebra Hybrid; Arbason; Argentina Cherry; Arkansas Traveler; Armenian; Artic Rose; Attention; Aubry's Special Pink; Aunt Gertie's Gold; Aunt Ginny's; Aunt Molly's Ground Cherry; Aunt Ruby's German Cherry; Aunt Ruby's German Green; Austin's Red Pear; Azoychka; Baby Bottle; Baby Bottle Red Pear; Baby Cakes; Baby Grape; Bali; Ball's Beefsteak; Banana Legs; Barnes Mountain Yellow; Bartelly; Basinga; Basket Vee; Basrawya; Baxter's Early Bush Cherry; Beall's Gourmet; Beam's Yellow Pear; Bear Creek; Beauty King; Beauty Queen; Beefmaster; Beefsteak; Believe It Or Not; Bella Rosa Bella Rosa; Bellestar; Bellini; Best Boy; Betalux; Better Boy Better Boy; Better Bush; Betty; BHN 785; BHN 1021 BHN 1021 ; BHN 189 BHN 189; BHN 268 BHN 268; BHN 444; BHN 543 BHN 543; BHN 589 BHN 589; BHN 602; BHN 624; BHN 762 BHN 762; BHN 826 BHN 826; BHN 871 ; BHN 901 ; BHN 961 BHN 961 ; BHN 964; BHN YC1 ; Bi-Color Cherry; Big Beef; Big Boy; Big Brandy; Big Bunch; Big League; Big Pink; Big Rainbow; Big Raspberry; Big Red; Big Tiger; Big White; Big White Pink Stripes; Big Yummy; Big Zebra; Bison; Black; Black Cherry; Black Icicle; Black Krim; Black Mauri; Black Opal; Black Pear; Black Pearl; Black Plum; Black Prince; Black Sea Man; Black Strawberry; Black Velvet; Black Vernissage; Black Zebra; Bliss; Blondkopfchen; Bloody Butcher; Blue Beauty; Blue Beech; Blue Ribbon; Blush; Blushing Star; Bobcat; Bolseno; Boondocks; Booty; Box Car Willie; Bradley; Brandymaster Pink; Brandymaster yellow; Brandysweet Plum; Brandywine; Brandywine Black; Brandywine OTV; Brandywine Pink; Brandywine Red; Brave General; Braveheart; Bronze Torch; Brown Berry; Buckbees New Fifty Day; Buffalo Steak; Buffalosun Hybrid; Bulgarian #7; Bulgarian Triumph; Burbank; Burgess Stuffing Tomato; Burpee's Big Boy; Burpee's Burger; Burpee's Summer Choice; Burrell's Special; Bush Beefsteak; Bush Big Boy; Bush Blue Ribbon; Bush Early Girl II; Bush Goliath; Cabernet; Cabo; Cacady's Folly; Caiman; Calypso; Camara; Camelia; Campbell's 1327; Campbell's 33; Candyland; Canestrino; Cannellino; Capaya; Captain Lucky; Carbon; Carmelita; Carmello; Caro Rich; Carolina Gold; Casa del Sol; Caspian Pink; Cedro; Celano; Celebration; Celebrity; Celebrity Supreme; Centiflor Red; Cerise Orange; Ceylon; Chadwick Cherry; Chalk's Early Jewel; Champion; Chancha; Chapman; Charger; Chefs Choice Black; Chef's Choice Green; Chef's Choice Orange; Chef's Choice Pink; Chefs Choice Purple; Chef's Choice Red; Chefs Choice Striped; Chello; Cherokee Carbon; Cherokee Chocolate; Cherokee Green; Cherokee Purple; Cherries Jubilee; Cherry Baby; Cherry Blossom; Cherry Bomb; Cherry Brandywine; Cherry Buzz; Cherry Ember; Cherry Pink; Cherry Princess Sweetie Surprise; Cherry Roma; Cherry Sweetie; Chianti Rose; Chile Verde; Chiquita; Chocolate; Chocolate Cherry; Chocolate Pear; Chocolate Sprinkles; Chocolate Stripes; Christmas Grapes; Church; Cipolla's Pride; Classica; Clear Pink Early; Clementine; Clermon; Cloudy Day; Cluster Grande; Colonial; Conestoga; Copia; Corbarino; Cordova; Corona; Cosmonaut Volkov Red; Costoluto Fiorentino; Costoluto Genovese; Council Bluffs; Country Taste; Cour Di Bue; Coustralee; Coyote; Cream Sausage; Creme Brulee; Creole Original; Crimson Cushion Beefsteak; Crimson Sprinter; Crista; Crnkovic Yugoslavian; Crokini; Csiko Botermo; Cupid; Dacquiri; Dads Sunset; Dafel; Dagma's Perfection; Damsel; Dark Galaxy; David Davidson's; Daytona; Debaro; Debut; Defiant PhR; Delizia; Dester; Dixie Red; Djena Lee's Golden Girl; Dona; Dorothy's Green; Double Rich; Dr. Carolyn; Dr. Wyche's Yellow; Druzba; Dwarf Golden Tipsy; Dwarf Tennessee Suited; Earliana; Earl's Faux; Early Blue Ribbon; Early Boy Bush; Early Cherry; Early Choice; Early Doll; Early First Prize; Early Girl; Early Goliath; Early Harvest; Early Treat; Early Wonder; Egg Yolk; El Dorado; El Fresco Hybrid; Elberta Girl; Elfin; Ella Bella; Emerald; Emmy; Emmylou; Empire; Enchantment; Esterina; Estiva; Eva Purple Ball; Evil Olive; Fabulous; Fantastic; Fantastico; Fantome du Laos; Favorita; Fenda; Ferline; Finishline; Firecracker; Fireworks; First Light; First Prize; Five Star Grape; FLA 47R; FLA 7514; Flaming Burst; Floradade; Floralina; Florida 47; Florida 91 ; Fourth of July; FoxCherry; Frazier's Gem; Fresh Salsa; Fried Green Tomato; Front Runner; Frosted Green Doctors; Fruity Cherry; Gabrielle; Galina; Garden Gem; Garden Leader Monster; Garden Peach; Garden Treasure; Gardener's Delight; Garnet; Garnet; Genuwine; Georgia Streak; Geranium Kiss; German Giant; German Head; German Johnson Pink; German Lunchbox; German Pink; German Queen; German Red Strawberry; Geronimo; Get Stuffed!; Giallo De Summer; Giant Belgium; Giant Syrian; Giant Tree Giant Tree; Gill's All Purpose; Gin Fiz; Glacier; Glamour; Glitter; Gold Medal; Gold Nuggets; Gold Spark; Golden Delight; Golden Gem; Golden Girl; Golden Jubilee; Golden Mama; Golden Pearl; Golden Ponderosa; Golden Queen USDA Strain; Golden San Marzano; Golden Sunburst; Golden Sunshine; Golden Sweet; Goldene Konigin; Goldie; Golova Negra; Grandaddy; Grandero Plum; Grandeur; Grandma's Little Girl; Grandma's Pick; Grandpap's Rose Wax; Granny Cantrell's; Granny Smith; Great White; Greater Baltimore; Green Bell Pepper; Green Berkeley Tie-Dye; Green Doctors; Green Envy; Green Giant; Green Grape; Green Pear; Green Sausage; Green Tiger; Green Zebra; Green Zebra Cherry; Gremlin; Grinch Dwarf; Grushovka; Gulf State Market; Gum Drop; Gypsy; Halley 3155; Hard Rock; Harlequin; Harless Creek Gold; Hartman's Yellow Gooseberry; Hawaiian Pineapple; Health Kick; Heinz 1350; Heinz 1370; Heinz 1439; Heirloom Green; Heirloom Orange; Helix; Heritage; High Carotene; Hillbilly; Holland; Homestead; Homesweet; Honey Bunch; Honey Bunch Yellow; Honey Delight; Honey Drop; Honey Hybrid; Honeybee; Honeycomb; Hugh's; Huichol; Hungarian Heart; Husky Gold; Husky Pink; Hybrid 46; Hybrid Beef 9904; Hy-Brix; Igleheart Yellow Cherry; lldi; lllini Star; Illinois Beauty; Indian Stripe; Indigo Cream Berries; Indigo Gold Berries; Indigo Kumquat; Indigo Rose; Indigo Ruby; Invincible; Iron Lady; Isis Candy; Italian Giant Beefsteak; Italian Goliath; Italian Heirloom; Italian Ice; Ivory Pear; Janet's Jewel; Japanese Trifele Black; Jasper; Jaune Flamme; Jazzy; Jelly Bean Red; Jersey Boy; Jersey Devil; Jet Star Jet Star; Jetsonic; Joker; Jolly; Jolly Elf; Jolly Girl; Jubilee; Jujube Cherry; Juliet; Jung's Wayahead; Kalman's Hungarian Pink; Kanner Hoell; Katana; KC 146; Kellogg's Breakfast; Kimberly; Kobe Beefsteak; Kolb; Koralik; La Roma III; Lady Finger; Ladybug; Lake; Large Barred Boar; Legend; Lemon Boy; Lemon Cherry; Lemon Drop; Lemon Tree; Lime Green Salad; Limmony; Lisa King; Lizziebelle; Lollipop; Longkeeper; Lost Marbles; Lovertino; Lucky Cross; Lucky Tiger; Lunch Box; Lyn's Mahogany Garnet; Madame Marmande; Maglia Rosa; Magnum; Maiden's Gold; Malakhitovaya Shkatulka; Malinowski; Mama Leone; Mamie Brown's Pink; Mandarin Cross; Manitoba; Manyel; Margherita; Marglobe Improved; Margo; Mariana; Marion; Marizol Magic; Marizol Purple; Marmande; Marmara; Martian Giant; Martin; Martino's Roma; Marvel Stripe; Marzinera; Matchless; Mater Sandwich; Matina; Matthew; Maya; Medford; Medium Rare; Mega Tom Giant; Megabite; Mexico; Micado Violettor; Midnight Pear; Mighty Sweet; Mikado; Mingle Mix; Mini Charm; Minibel; Mint Julep; Mirabelle Blanche; Miroma; Missouri Pink Love Apple; Momotaro; Moneymaker; Montesino; Moonbeam; Moonglow; Moonshadow; Moravsky Div; Moreton; Morning Light; Mortgage Lifter; Mortgage Lifter, bi-color strain; Mosaico; Moskvich; Mountain Delight; Mountain Fresh; Mountain Fresh Plus; Mountain Gem; Mountain Glory; Mountain Gold; Mountain Magic; Mountain Majesty; Mountain Man; Mountain Merit; Mountain Pride; Mountain Spring; Mountain Vineyard; Mr. Stripey; Mr. Ugly; Mrs. Maxwell's Big Italian Hr; Napa Grape; Napa Rose Blush; Napoli; Nature Bites; Nature's Riddle; Nebraska Wedding; Nectar; Nectarine; Neves Azorean Red; New Big Dwarf; New Girl; New Hampshire Red Pickling; New Yorker; Northern Lights; Nova; Nugget; Nyagous; Oaxacan Jewel; Oh Happy Day; Old Brooks; Old Fashioned Goliath; Old German; Old Ivory Egg; Old Yellow Candystripe; Olivade; Orange Banana; Orange Blossom; Orange Brandywine; Orange Fizz; Orange Icicle; Orange Jazz; Orange King; Orange Minsk; Orange Oxheart; Orange Panuche; Orange Peach; Orange Queen; Orange Roma; Orange Russian 117; Orange Santa; Orange Slice; Orange Strawberry; Orange Sunshine; Orange Wellington; Orange Zinger; Oregon Spring; Oroshan; Out Damn Spot; Oxheart Pink; Pamella; Pantano Romanesco; Park's Beefy Boy; Park's Early Challenge; Park's Season Starter; Patsy; Patty's Yellow Striped Beefsteak; Paul Robeson; Peacevine; Peach Blow Sutton; Pearly Pink; Pellicore; Peppermint; Perfect Flame; Perfectly Pink; Peron; Persimmon; Phoenix; Phuket Egg; Piccolo Carina; Picus; Pilcer Vesy; Pineapple; Pineapple Pig; Pink Accordion; Pink Beauty; Pink Berkeley Tie-Dye; Pink Boar; Pink Bumble Bee; Pink Champagne; Pink Cupcake; Pink Girl; Pink Peach; Pink Ping Pong; Pink Pounder; Pink Stuffer; Pink Tiger; Pink Wonder; Pink-a-Licious; Piriform; Pixie Stripe; Placero; Plum Crimson; Plum Lemon; Plum Regal; Polar Beauty; Polar Star; Polbig; Polish Dwarf; Poma Amoris Minora Lutea; Pony Express; Pork Chop; Porter; Porterhouse; Poseidon 43; Power Pops; Prairie Fire; Premio; Prime Beef Goliath; Primo Red; Princess; Principe Borghesi; Pritchard; Prize of the Trials; Pruden's Purple; Purple Boy; Purple Brandy; Purple Bumble Bee; Purple Russian; Purple Smudge; Quali T 23; Quarter Century; Quedlinburger Fruhe Liebe; Queen Aliquippa; Queen of the Night; Queens; Querida; Quick Pick; Quimbaya; Rally; Ramapo; Rambler; Rambling Gold Stripe; Rambling Red Stripe; Ranger; Rapunzel; Raspberry Lyanna; Ravello; Razzle Dazzle; Rebekah Allen; Red Anjou; Red Brandywine; Red Candy; Red Cherry Large Fruited; Red Cup; Red Defender; Red Eclipse; Red Fig; Red Grape; Red House Free Standing; Red Lightning; Red Morning; Red Mountain; Red Pear; Red Pearl; Red Plum; Red Pride; Red Rave; Red Robin; Red Rocket; Red Rose; Red Star; Red Zebra; Redfield Beauty; Reisetomate; Ridge Runner; Riesentraube; Rio Grande; Riviera; Roadster; Rocket; Rojita; Roma; Roman Candle; Rosalita; Rose; Rose De Berne; Rosella; Rosso Sicilian; Rostova; Rowdy Red; Royal Hillbilly; Royal Mountie; Royesta; RuBee Dawn; RuBee Prize; Rugged Boy; Russian Persimon; Russian Rose; Rutgers; Rutgers 250; Rutgers 39; Rutgers Improved PS; Rutgers Select; S 151496; Sakura Honey; Salt Spring Sunrise; Sanibel; Santa Clara Canner; San Marzano; Santiam; Sapho; Sara's Galapagos; Sasha's Pride; Saybrook; Scarlet Red; Scarlet Sunrise; Schimmeig Striped Hollow; Sean's Yellow; Seattle's Best of All; Seminis 0172-1432; Seminis 1236; Seminis Grape 9137; Serrat; Shady Lady; Shasta; Sheboygan; Shelby; Shilling Giant; Sicilian Saucer; Siletz; Silvery Fir Tree; Sioux; Skorospelka; Skyreacher; Skyway; Slava; Sleeping Lady; Small Fry; Smarty; Snacker's Delight; Snow White; Snowberry; Solar Fire; Solar Flare; Solar Power; Solid Gold; Sophie's Choice; Sophya; Southern Night; Sparky XSL; Spear's Tennesse Green; Speckled Roman; Spike; Spitfire; Sprite; St. Nick; St. Pierre; Steak House; Steak Sandwich; Stellar; Stone; Striped Cavern; Striped German; Striped Roman; Striped Stuffer; Subarctic; Sugar Lump; Sugar Plum; Sugar Rush; Sugar Snack; Sugary; Summer Girl; Summer Pick; Summer Pink; Summer Sunrise; Sun Cherry; Sun Gold; Sun King; Sun Orange; Sunbrite; Sunchocola; Sungold Select II; Sungreen 4029; Sungreen Garden; Sunkist; Sunleaper; Sunlemon; Sunny Blue Ribbon; Sunny Boy; Sunny Goliath; Sunpeach; Sunray; Sunrise; Sunrise Bumble Bee; Sunrise Sauce; Sunset Falls; Sunshine Heirloom; Sunstart; SunSugar; Super Boy 785; Super Bush; Super Fantastic; Super Marmande; Super Snow White; Super Sweet 100; Supernova; SuperSauce; Supersonic; Supersteak; Supertasty; Supremo; SVR 1400; Sweet 100; Sweet Aperitif; Sweet Aroma; Sweet Baby Girl; Sweet Canary; Sweet Carnernos Pink; Sweet Chelsea; Sweet Cheri; Sweet Cluster; Sweet Elite; Sweet Gold; Sweet Golden Roma; Sweet Hearts; Sweet Million; Sweet Olive; Sweet Orange; Sweet Quartz; Sweet Seedless; Sweet Snax; Sweet Tangerine; Sweet Treats; Sweet Zen; Sweethearts; Sweetie; Talladega; Tami G; Tamina; Tangella; Tangerine Mama; Tappy's Hertitage; Tasmanian Blushing; Tasmanian Chocolate; Tasti-Lee; Tasty Evergreen; Tasty Treat; Taxi; Ten Fingers of Naples; Tennessee Britches; Thai Pink Egg; Think Pink; Thunderbird; Tiesto; Tidwell German; Tiffen Mennonite; Tiger Like; Tiger Tom; Tigerella; Tinkerbell; Tip- Top; Tocan; Tolstoi; Tomatoberry Garden; Tom Thumb; Tommy Toe; Tonopah; Top Gun; Topaz; Torbay; Toronjina; Tough Boy; Tribeca; Tribute; Trophy; Tropic; Trucker's Favorite; Tsungshigo Chinese; Two Tasty Hybrid; Tye-Dye; Tygress; Ukrainian Purple; Ultimate Opener; Ultra Pink; Ultra Sweet; Uluru Ochre; Umamin; Umberto; Valencia; Valley Girl; Valleycat; Varsity; Velvet Red; Vintage Wine; Violaceum Krypni- Rozo; Virginia Sweets; Viva Italia; Vivacious; Volante; Wapsipinicon Peach; Washington Cherry; Watermelon Beefsteak; Weissbehaarte; Wes; Wherokowhai; White Beauty; White Cherry; White Currant; White Potato Leaf; White Queen; White Tomesol; White Wax; White Wonder; Whittemore; Wild Cherry; Wild Fred; Willamette; Wins All; Wonder Light; Woodie Orange; Yaqui; Yellow Belgium; Yellow Bell; Yellow Brandywine; Yellow Cherry; Yellow Fire; Yellow Magic; Yellow Mini; Yellow Peach; Yellow Pear; Yellow Perfection; Yellow Stuffer; Yellow Vernissage; Yukon Quest; Zapotec Oaxacan Ribbed; Zapotec Pink Ribbed; Zebra Cherry; and / or Zenzei.

[0063]

[0062] In certain embodiments, the plant cell is in the form of a protoplast. As used herein, the term “plant protoplasts” (also referred to simply as “protoplast”, throughout this disclosure) refers to a plant cell that has had its cell wall completely or partially removed. Removal of the cell wall can be effected by mechanical, chemical or enzymatic means. In embodiments, protoplasts are obtained from suitable plant material using cell wall digestive enzymes. For example, enzymes such as cellulase, macerozyme, pectinase, hemicellulase, pectolyase, driselase, xylanase and combinations thereof may be suitable for use in the context of the disclosure. In embodiments, cellulase may be used at a concentration of 1w% - 1.5w%. In embodiments, macerozyme may be used at a concentration of 0.2w% - 0.4w%. In embodiments, hemicellulase may be used at a concentration of 2w% - 5w%. In embodiments, pectolyase may be used at a concentration 0.01w% - 0.5w%. In embodiments, driselase may be used at a concentration of 0.5w% - 2w%. Protocols for obtaining protoplasts from plant tissues are known in the art, for example in Yoo, Cho, & Sheen (2007) Nature Protocols volume 2, pages 1565-1572.

[0064]

[0063] As used herein, "Regenerable plant cells" refer to plant cells that possess the capacity to develop into a whole plant through the process of regeneration. These cells, when cultured under appropriate conditions, can dedifferentiate, proliferate, and subsequently differentiate into various tissues and organs, ultimately forming a complete, functional plant.

[0065]

[0064] The tomato plant, or plant cell, of the present disclosure retains broad spectrum disease resistance. The plant or plant cell may therefore be resistant to infection or disease caused by any virus, bacteria, fungus, or nematode. The plant or plant cell may therefore be resistant to diseases selected from the group consisting of Anthracnose, bacterial canker, bacterial speck, bacterial wilt, early blight, fusarium crown and root rot, fusarium wilt, grey leaf spot, late blight, leaf mold resistance, Phytophthora infestans, powdery mildew, root-knot nematode, Septoria leaf spot, southern blight, tomato mosaic virus, tomato spotted wilt virus, tomato yellow leaf curl virus, and Verticillium wilt. The plant or plant cell may further be resistant to any infection and / or disease caused by pathogens selected from the group consisting of Tomato mosaic virus, Tomato torrado virus, Tomato spotted wilt virus, Tomato yellow leaf curl virus, Tomato brown rugose fruit virus, Psuedomonas syringae pv. tomato, Ralstonia solanacearum, Xanthamonas campestris pv. vesicatoria, Alternaria alternata f. sp. lycopersici, Passalora fulva, Fulvia fulva, Cladosporium fulvum, Fusarium oxysporum f. sp. lycopersici, Fusarium oxysporum f. sp. radicis- lycopersici, Leveillula Taurica, Oidium neolycopersici, Oidium lycopersicum, Phytophthora infestans, Pyrenochaeta lycopersici, Stemphylium botryosum f. sp. lycopersici, Stemphylium lycopersici, Stemphylium solani, Verticillium albo-atrum, Verticillium dahlia, Meloidogyne arenaria, Meloidogyne incognita, and Meloidogyne javanica.

[0066]

[0065] ' 'Wild type" as used herein refers to a typical form of a plant or a gene as it most commonly occurs in nature or as an unmodified control. The SIMBP21 (Solyc12g038510) gene may be considered an example of a wild type form of the Jointless gene. The terms SIMBP21 and Jointless may be used interchangeably. The wild type Jointless (Solyc12g038510) gene may therefore have a sequence according to SEQ ID NO: 3. The wild type Jointless (Solyc12g038510) gene may therefore have a coding sequence (CDS) according to SEQ ID NO: 5. The wild type Jointless (Solyc12g038510) gene may therefore encode a gene product having a sequence according to SEQ ID NO: 7.

[0067]

[0066] The Jointless-2 (J2) allele that is defined by the removal or disruption of a splice site within the SIMBP21 (Solyc12g038510) gene is not a wild type allele and is instead the product of gene editing. An edited j2 allele defined by the removal or disruption of a splice site within the SIMBP21 (Solyc12g038510) gene may have a sequence according to SEQ ID NO: 4, SEQ ID NO: 12, SEQ ID NO: 18, and / or SEQ ID NO: 19 . An edited j2 allele defined by the removal or disruption of a splice site within the SIMBP21 (Solyc12g038510) gene may have a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4 , SEQ ID NO: 12, SEQ ID NO: 18, and / or SEQ ID NO: 19.

[0068]

[0067] A target splice site of the wild type SIMBP21 (Solyc12g038510) gene may have sequence according to SEQ ID NO: 2. An edited splice site of an edited j2 allele defined by the removal or disruption of a splice site within the SIMBP21 (Solyc12g038510) gene may have a sequence according to SEQ ID NO: 1.

[0069]

[0068] In some embodiments, gene disruption may occur by deletion of a genomic sequence using one or two guide RNAs. Methods of using CRISPR / Cas gene editing technology to create a genomic deletion in a cell, such as to knock out a gene in a plant cell, are described in Nekrasov et al. Sci Rep 7, 482 (2017).

[0070]

[0069] Available endonucleases capable of introducing specific and targeted DSBs include, but not limited to, zinc-finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and RNA- guided CRISPR / Cas nucleases (CRISPR / Cas; Clustered Regular Interspaced Short Palindromic Repeats Associated). Additionally, DICE (dual integrase cassette exchange) system utilizing phiC31 and Bxb1 integrases may also be used for targeted integration.

[0071]

[0070] CRISPR / Cas systems are widespread prokaryotic adaptive immune systems that are best known as components of a next generation of genome-editing tools. Cas9 recognizes 3' G-rich PAMs; it has become the most widely used CRISPR / Cas system and has been adapted for genome editing in various contexts, including in plants. Unlike Cas9, Cas12a recognizes 5' T-rich PAMs and self-processes its CRISPR RNA (crRNA). According to certain embodiments of the present disclosure an RNA-guided CRISPR / Cas12a nuclease (CRISPR / Cas12a) nuclease is utilised, suitably a ErCas12a (MAD7) (US patent number US9982279B1) (https: / / www.inscripta.com / madzymes / faq / ). MAD7 is an engineered nuclease of the Class 2 type V-A CRISPR / Cas (Cas12a / Cpf1) family with a low level of homology to canonical Cas12a nucleases, that is particularly effective at generating indel mutations in plant cells. A MAD7 nuclease employed by the disclosure may have a sequence according to SEQ ID NO: 15. In some embodiments, the disclosure employs a Cas12 nuclease selected from the group consisting of MbCas12a, ErCas12a, Lb5Cas12a, BsCas12a, Mb2Cas12a, Mb3Cas12a, and TsCas12a. Other Nonlimiting examples of RNA-guided endonuclease systems include Cas1 , Cas1 B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas10, Csy1 , Csy2, Csy3, Cse1 , Cse2, Csc1 , Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1 , Cmr3, Cmr4, Cmr5, Cmr6, Csb1 , Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1 , Csx15, Csf1 , Csf2, Csf3, and Csf4, as well as homologs thereof, or modified versions thereof. Alternatively, some RNA-guided endonucleases are modified versions of the wildtype form, for example, comprising an amino acid change such as a deletion, insertion, substitution, variant, mutation, fusion, chimera, or any combination thereof, relative to a wild-type version of the protein. In some embodiments, the endonuclease comprises a region exhibiting at least 70% identity over at least 70% of its residues to a Cas9 domain or a Cpfl domain. In particular embodiments, the Cas9 is selected from the group consisting of SpCas9 SaCas9, StCas9, NmCas9, FnCas9, and CjCas9. In embodiments of the disclosure the endonuclease comprises an endonuclease having a Cas9 activity or a variant or derivative thereof.

[0072]

[0071] CRISPR / Cas gene editing technology involves the use of a genome-targeting nucleic acid that can direct the endonuclease to a specific target sequence within a target gene for gene editing at the specific target sequence. The genome-targeting nucleic acid can be an RNA. A genome-targeting RNA is referred to as a “guide RNA” or “gRNA” herein. A gRNA typically comprises a guide sequence having sufficient complementarity with a target nucleic acid to hybridize via Watson-Crick base pairing interactions with the target nucleic acid molecule at a given sequence and to direct sequence-specific binding of the endonuclease complex to the target nucleic acid sequence. Typical gRNA molecules include a targeting sequence, which binds to the complementary DNA sequence, and a Cas protein binding scaffold region, which interacts with the Cas enzyme (or equivalent or derivative thereof). The guide molecule or guide RNA may encompass RNA-based molecules having one or more chemical modifications, including synthetic bases, or by chemical linking two ribonucleotides or by replacement of one or more ribonucleotides with one or more deoxyribonucleotides). For example, chemical modifications such as 2'-O-methyl or phosphorothioate modifications can be introduced to increase gRNA stability. The present disclosure provides a guide nucleic acid suitable for use in a CRISPR / Cas system. A gRNA binds to a Cas protein via the scaffold region and targets the Cas protein to a specific location within a target nucleic acid. In some cases, a guide nucleic acid comprises a single nucleic acid molecule, referred to as a single guide nucleic acid (sgRNA). Alternatively, a guide nucleic acid comprises two separate nucleic acid molecules, referred to as a double guide nucleic acid.

[0072] In Type V gRNAs, of the type that is utilised by Cas12a nucleases (e.g. ErCas12a / MAD7), the crRNA forms a duplex that binds to the endonuclease, such that the guide RNA and endonuclease form a complex. In some embodiments, the genome-targeting nucleic acid provides target specificity to the complex by virtue of its association with the endonuclease. The genome-targeting nucleic acid thus directs the activity of the endonuclease to a specific target site within the genome of a host cell. Hence, it will be understood by the person of ordinary skill in the art, that each gRNA is designed to include a spacer sequence complementary to its genomic target sequence. The term guide RNA (gRNA) is used synonymously with single guide RNA, “sgRNA”.

[0073]

[0073] In embodiments of the present disclosure, the spacer sequence comprised within the gRNA is an oligonucleotide sequence, typically around 20 to 25 nucleotides in length, that defines a target sequence (e.g., a DNA target sequence, such as a genomic target sequence) of a target gene of interest. In some embodiments, the spacer sequence as a sequence according to SEQ ID NO: 11. In embodiments of the present disclosure the targets are within at least one allele of the SIMBP21 (Solyc12g038510) gene. In some embodiments of the present disclosure the target is within at least 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides upstream of exon 5 of the SIMBP21 (Solyc12g038510) gene. In some embodiments of the present disclosure the target is within at least 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides upstream of exon 5 of the SIMBP21 (Solyc12g038510) gene represented by SEQ ID NO: 5. In some embodiments of the present disclosure the target is within at least 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) upstream of position 427 of SEQ ID NO: 5. In some embodiments, the spacer sequence ranges from 15 to 30 nucleotides in length. For example, the spacer sequence may contain at least 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, a spacer sequence contains at least 22 nucleotides.

[0074]

[0074] The gRNAs disclosed herein may target any sequence of interest via the spacer sequence comprised within it. In some embodiments, the amount of complementarity between the spacer sequence of the guide RNA and the target sequence in the target gene can be about 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene is 100% complementary. In other embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene may contain up to 5 mismatches, e.g., up to 4, up to 3, up to 2, or up to 1 mismatch. Typically, the mismatches are not consecutive and may be distributed across the spacer sequence. Hence according to specific embodiments, gRNAs corresponding to SEQ ID NO: 11 may be used in gene editing methods, such as for the production of any of the variants disclosed herein. In some embodiments, gRNAs used in the methods of the disclosure have at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 11 .

[0075]

[0075] Any of the gRNAs disclosed herein may be chemically unmodified - i.e. utilising naturally occurring nucleotides. Alternatively, the gRNAs may contain one or more modified nucleotides and / or modified backbones. For example, a modified gRNA can comprise one or more 2'-O-methyl phosphorothioate nucleotides, which may be located at either the 5' end, the 3' end, or both. Alternatively, the gRNAs may comprise at least one non-naturally occurring nucleotide such as any one of those described in US-2020 / 0224234-A1 .

[0076]

[0076] The gRNA employed in the present disclosure may have a spacer sequence of TAAGTGCACACTTTATCAGAC (SEQ ID NO: 11). The gRNA employed in the present disclosure may have a scaffold sequence of GGAATTTCTACTCTTGTAGAT (SEQ ID NO: 16). In some embodiments, the gRNA may be comprised of a scaffold and spacer and have a sequence of GGAATTTCTACTCTTGTAGATTAAGTGCACACTTTATCAGAC (SEQ ID NO: 17).

[0077]

[0077] Base Editing: In an alternative embodiment of the disclosure a base editing approach may be adopted to introduce mutations to the SIMBP21 (Solyc12g038510) gene that may serve to knock out, reduce activity of the gene product function, or result in a truncated gene product. Cytidine deaminase base editing enables the direct, irreversible conversion of a C:G base pair to a T: A base pair in a programmable manner without requiring HDR or the introduction of a double strand break. In contrast to conventional gene editing which relies on a canonical sequence-guided endonuclease such as a Cas9 protein that creates a double strand break, base editors contain a single-stranded DNA- specific cytidine deaminase enzyme tethered to a catalytically impaired Cas9 protein and a base excision repair inhibitor (see Y. B. Kim et al, Nat Biotechnol 35, 371-376 (2017)). In an embodiment of the present disclosure, the nuclease is targeted to a SIMBP21 (Solyc12g038510) gene locus of interest, programmed by a corresponding guide RNA that may comprise a sequence of nucleotides that correspond to any one of those set out herein or that could be determined by the skilled person. The locus of interest may be a region associated with exon 5 of the SIMBP21 (Solyc12g038510) gene. The locus of interest may be within, comprise, orconsist of exon 5 of the SIMBP21 (Solyc12g038510) gene. This leads to the formation of a protein-RNA-DNA ternary “R- loop” complex that exposes a small (~5-nt) bubble of single-stranded DNA that serves as a substrate for the tethered cytidine deaminase enzyme. Cytidines within this bubble may be hydrolytically deaminated to uracils, resulting in G:ll intermediates. The cell’s primary response to the presence of G:ll mismatches is to initiate a base excision repair mechanism to replace the uracils with cytidines. This process is initiated by excision of the uracil by uracil N-glycosylase. To protect the edited G:ll intermediate from excision by uracil N-glycosylase, an uracil glycosylase inhibitor (UGI) can be incorporated into the base editing complex, such as via fusion with the C-terminus of catalytically impaired nuclease such as Cas9 or Cas12a. Manipulation of the cellular DNA mismatch repair systems into preferentially replacing the G in the G:ll mismatch with an A, requires that the nuclease is modified to have nickase activity rather than catalysing a double strand break. This enables the Cas9 protein to nick the DNA strand opposite the newly formed uracil in the G:ll mismatch, resulting in much more efficient conversion of the G:ll intermediate to sequence altered A:ll and A:T products.

[0078]

[0078] An alternative to cytidine deaminase base editing utilises an adenosine deaminase base editor complex to convert A:T base pairs to G:C base pairs at a given target location. The deamination of adenine yields inosine (I), which is read and replicated as guanine (G) by polymerases. The approach is broadly similar to that described in relation to cytidine deamination base editing (see Gaudelli et al. Nature. (2017) Nov 23; 551 (7681): 464-471).

[0079]

[0079] Prime Editing: Prime editing is a powerful editing tool that is an alternative to the base editing approaches described previously. Prime editing also allows precise modifications to genomic DNA utilising a protein editing complex that is guided to a locus within a gene via a guide RNA sequence. It consists of two key components: nCas9, modified Cas9 endonuclease having nickase activity, which nicks the DNA strand, and an associated Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT), which facilitates the editing process (Anzalone AV et al. Nature 576, 149-157 (2019)). The RT component may be comprised within the prime editing complex or present in solution. Guide RNAs (called pegRNAs) direct the prime editor complex to the target locus in the genome. These pegRNAs have an extended structure at their 3’ end compared to single-guide RNAs (sgRNAs) which includes a primer binding site (PBS): complementary to a portion of the DNA protospacerand an RT template that encodes the intended edit. Once nicking occurs, the PBS sequence pairs with the complementary target DNA sequence to start priming reverse transcription from the RT template, which enables the desired editing. However, unlike cytidine / adenosine deaminase containing base editors, prime editing can induce a relatively high frequency of indels. Hence, prime editing represents an alternative mechanism to introduce mutations to the SIMBP21 (Solyc12g038510) gene that may serve to knock out, reduce activity of the gene product function, or result in a truncated form of the gene product being expressed.

[0080]

[0080] Delivery of genetic modification complex: The genetic modification systems disclosed herein, comprising one or more gRNAs and at least one RNA-guided nuclease, such as Cas9 and Cas12a, can be delivered to a target cell or protoplast (e.g., a tomato cell or protoplast) for genetic editing of the target gene, via any conventional method. In some embodiments, components of an endonuclease system as disclosed herein may be delivered to a target cell separately, either simultaneously or sequentially. In other embodiments, the components of the endonuclease system may be delivered into a target together, for example, as a complex. In some instances, gRNA and the RNA-guided endonuclease can be precomplexed together to form a ribonucleoprotein (RNP), which can be delivered into a target cell or protoplast using conventional techniques. Hence, as used herein the phrase “ribonucleoprotein complex” or “RNP” refers to a ribonucleoprotein complex having CRISPR-associated endonuclease activity.

[0081]

[0081] In alternative embodiments, genetic modification systems may be introduced via transformation protocols that rely on use of Agrobacterium tumefaciens to transfer a binary vector with a gene or genes that encoding genetic modification system and selectable markers and / or reporter genes placed between T-DNA borders, into leaf epidermal cells. The genetic modification systems may include the gene, prime or base editing complex as well as nucleotides encoding gRNAs that enable targeting of the genetic modification system to the SIMPB21 (Solyc12g038510) gene within the cells. Protocols using Agrobacterium tumefaciens are known to the skilled person, exemplary approaches are described, for example in Sparkes, I., Runions, J., Kearns, A. et al. Nat Protoc 1 , 2019-2025 (2006).

[0082]

[0082] Other targeted genomic modification techniques: In contrast to genome editing approaches based around the CRISPR platform described above, zinc finger nucleases (ZFNs) can made by combining two different protein domains: engineered Cys2-His2 DNA-binding ZF and a DNA-cutting tool — or restriction endonuclease — called Fok1. The binding of Cys2-His2 ZF to DNA involves the insertion of an alpha helix of the protein into the major groove of double stranded DNA. Each ZF recognizes and binds to three tandem nucleotides. This allows the liberty to link a ZF to a DNA sequence of interest. In theory, ZFs can be programmed to bind to almost any specific DNA sequence, facilitating a Fok1 -induced doublestranded DNA (dsDNA) break. Another approach to genome editing uses DNA-binding transcription activator-like (TAL) effectors from the plant bacterial pathogen Xanthomonas. TAL effectors have sets of repeating amino acids, and small variations in these amino acid repeats determine DNA-binding specificity. These variations can be programmed to target specific DNA sequences. TAL effector nucleases (TALENs), combining the TAL effector DNA-binding domains and the catalytic domain of Fok1 , are also able to make dsDNA breaks at directed genomic loci. Since both the ZFN an TALEN based approaches, like CRISPR, rely upon introducing targeted double strand breaks in the genome, this can be utilised to introduce indel mutations to generate knock outs of targeted genes, such as within alleles of any of the SIMBP21 (Solyc12g038510) gene loci.

[0083]

[0083] Non-tarqeted genomic modification techniques: In addition to the sequence directed approaches described previously, a range of induced mutagenesis techniques can be utilised to drive genetic variation that results in novel phenotypic traits in Solanaceae family members, such as S. lycopersicum. Exposing the genetic material within plant cells to mutagenic agents brings changes in nuclear DNA which results in genomic or chromosomal mutations enabling plant breeders to select useful mutants. Mutants can be ascertained by evaluation of phenotypes determined from progeny of mutated plants, as well as through techniques such as NGS. Tomato behaves like a basic diploid, hence, mutations of many types can be clearly identified in its phenotype. Exemplary mutagenesis approaches, according to embodiments of the present disclosure, that may result in functional mutation of SIMBP21 (Solyc12g038510) gene and the corresponding jointless phenotype may include the following:

[0084]

[0084] Chemical Mutagenesis: Chemical mutagens, such as ethyl methane sulfonate (EMS) and N- methyl-N-nitrosourea (MNU), are used to induce point mutations in the target genome by alkylating DNA bases. Chemical mutagenesis allows for the introduction of specific nucleotide changes, facilitating the generation of allelic diversity within plant populations. EMS is considered as one of the most effective chemical mutagenic agents to induce genetic variability in a number of crop plants, including tomato, through primarily G / C- to A / T transitions (Greene at al. Genetics, Volume 164, Issue 2, 1 June 2003, Pages 731-740).

[0085]

[0085] Radiation Mutagenesis: Ionizing radiation sources, including gamma rays and X-rays, induce random DNA damage, including base substitutions, deletions, and insertions. Radiation mutagenesis provides a broad spectrum of genetic alterations that can produce useful mutants due to the property of large-scale deletions and occasionally, chromosome reconstitution. Typically plant material can be irradiated with doses of ionising radiation, such as X-rays, in an amount of between 20 and 100 Grays (Gy) in order to induce mutations within the genome.

[0086] Insertional Mutagenesis: Transposable elements, such as maize Ac / Ds and En / Spm transposon systems, T-DNA from Agrobacterium tumefaciens and retrotransposons, can be utilized to disrupt gene function or alter gene expression patterns, in Solanaceae family members. Insertional mutagenesis offers the advantage of easier characterisation of mutants as the inserted element acts as a tag for gene Identification, for example, see Memelink, J. (2003). T-DNA Activation Tagging. In: Grotewold, E. (eds) Plant Functional Genomics. Methods in Molecular Biology, vol 236.

[0086]

[0087] In specific embodiments of the present disclosure, the tomato (S. lycopersicum) plants, cells, plant parts, seeds, other propagatable material and progeny thereof that are provided herein can have a mutation in the endogenous alleles of the SIMPB21 (Solyc12g038510) gene such that expression of a functional protein product is reduced or completely inhibited. Thus, in some embodiments, the plants, cells, plant parts, seeds, other propagatable material and progeny exhibit substantially reduced or even totally eliminated detectable levels of functional protein activity. Hence, in other embodiments of the disclosure the level the SIMPB21 (Solyc12g038510) gene product’s activity in the plants, cells, plant parts, seeds, other propagatable material and progeny thereof is sufficiently reduced by at least 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 40%, 30% and 20% when compared to a plant from the same variety that has not been subjected to a genetic modification by the methods as described herein. In specific embodiments of the present disclosure, the tomato (S. lycopersicum) plants, cells, plant parts, seeds, other propagatable material and progeny thereof that are provided herein can have a mutation in the endogenous alleles of the SIMPB21 (Solyc12g038510) gene such that the associated gene product is expressed in a truncated form. The gene product of the edited SIMPB21 (Solyc12g038510) gene may have a sequence according to SEQ ID NO: 8. The gene product of the edited SIMPB21 (Solyc12g038510) gene may have a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 8.

[0087]

[0088] According to embodiments of the disclosure, methods are provided for efficiently engineering and recovering plants, plant cells, or other propagatable plant material - e.g. seeds, cuttings, calli, protoplasts or any other tissue culture of regenerable cells - comprising a non-wild type the SIMPB21 (Solyc12g038510) gene expression patterns. Typically, the plants, plant cells, or other propagatable plant material are from the Solanaceae family, more suitably varieties and cultivars of Solanum lycopersicum - i.e. tomato varieties, of which several thousands are known to exist; Solanum melongena - i.e. aubergine, or egg plant; Solanum tuberosum - the potato, a key staple food; and Capsicum annuum - i.e. sweet, chilli or bell pepper.

[0088]

[0089] The disclosure relates to a modified tomato (Solanum lycopersicum) plant that exhibits a jointless phenotype. However, there is a high degree of conservation of J2 across several crops - for example, those shown in Table 1. The person skilled in the art would therefore readily understand that the disclosure described herein is equally applicable to a wide number of crops, including, but not limited to, those described in T able 1 . The provision of a jointless phenotype in any of these alternative crops is also envisioned as part of the presently disclosed disclosure and the teachings provided herein should be considered to apply mutatis mutandis to other crops which exhibit abscission zones.

[0089] Table 1. Conservation of J2 across species.

[0090]

[0090] The removal or disruption of the splice site within the SIMBP21 (Solyc12g038510) gene may be achieved through a substitution, insertion, and / or deletion mutation. In some embodiments, the mutation is within a splice site of the SIMBP21 (Solyc12g038510) gene. In some embodiments, the mutation is within a region which acts on a splice site of the SIMBP21 (Solyc12g038510) gene, for example epigenetically or epistatically. For example, the mutation or disruption could be in a region of EJ2, a gene which interacts with the SIMBP21 (Solyc12g038510) gene. In other embodiments, the mutation or disruption could be in a promoter or regulatory region associated with the SIMBP21 (Solyc12g038510) gene. In some embodiments, the removal or disruption of the splice site results in a complete or partial loss of at least one exon in an mRNA transcribed from the SIMBP21 (Solyc12g038510) gene. In some embodiments the exon is not transcribed. In some embodiments the exon is only partially transcribed such that a non-functional, or only partially functional, gene product is created. In some embodiments, the exon is exon 5 of the SIMBP21 (Solyc12g038510) gene.

[0091]

[0091] In some embodiments of the present disclosure the mutation is within at least 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides upstream of the splice site of the exon.

[0092]

[0092] In some embodiments the exon is one or more of the exons selected from the group consisting of exon 1 , exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8 of the SIMBP21 (Solyc12g038510) gene. In some embodiments the exon is exon 5 of the SIMBP21 (Solyc12g038510).

[0093]

[0093] In some embodiments, the deletion mutation is of at least 1 , 3, 6, 9, 10, 12, or 15 nucleotide(s). In some embodiments, the deletion mutation is a deletion of exactly 10 nucleotides corresponding to positions 18 to 27 of SEQ ID NO: 2 or positions 11 ,821 to 11 ,830 of SEQ ID NO: 3. In some embodiments, the deletion mutation is a deletion of exactly 6 nucleotides corresponding to nucleotides 23 to 28 of SEQ ID NO: 2 or positions 11 ,826 to 11 ,831 of SEQ ID NO: 3.

[0094] EXAMPLES

[0095]

[0094] The disclosure is further illustrated by way of the below, non-limiting, examples.

[0096] Example 1

[0097]

[0095] gRNA sequences were designed to function within the CRISPR-MAD7 ribonucleoprotein complex and target tomato gene J2 (Solyc12g038510, SL3). The gRNAs were synthesised using a commercial manufacturer. The gRNA designs were also checked against the tomato reference genome SL3 (NCBI RefSeq assembly GCF_000188115.5) using RGEN CRISPR guide tool (http: / / www.rgenome.net / ), to ensure no fewer than two mismatches against potential off targets. gRNAs together with MAD7 protein were tested in vivo in tomato cotyledon protoplasts for editing efficiency, using DNA extraction, J2 amplicon amplification via PCR, Amplicon-sequencing with NGS using PE150 reads. The raw data was analysed using freely accessible CRISPRESSO2 software (https: / / crispresso2.pinellolab.org / ). High- efficiency guides moved on to the editing pipeline. The gRNA ‘g11064F’ (SEQ ID NO: 11) was designed and used in this experiment. g11064F targets the intron 4 I exon 5 junction (Figure 5).

[0098]

[0096] Editing was performed in isolated tomato protoplasts by PEG-mediated ribonucleoprotein (RNP) transfection followed by full plant regeneration from single cells according to a proprietary protoplasting and regeneration protocol with a similar basis to Liu et al. (2022), “Establishment of a DNA-free genome editing and protoplast regeneration method in cultivated tomato (Solanum lycopersicum)" , Plant Cell Reports, vol. 41 , pp. 1843-1852. Using CRISPR-MAD7 genome editing, j2 was edited into two parental lines of a hybrid tomato variety Maverick, with working names TQM105 and TOM117. The specific edit (as shown in Figure 2) removed a splice site, causing loss of the 5th exon (exon 5) by trans-splicing (Figure 1) confirmed cDNA amplification by RT-PCR and Sanger sequencing (Figure 7).

[0099]

[0097] The -6 edit located at the intron-exon junction (as shown in Figure 2) was chosen to enable exon 5 skipping and results in-frame mutation which results in a truncated protein being translated (SEQ ID NO: 8).

[0100]

[0098] Briefly, RNP complexes were assembled and transfected into tomato protoplasts isolated from cotyledons. Transfected protoplasts were immobilised in an alginate matrix and maintained until microcalli had formed ~2 weeks after embedding. Microcalli were then released and maintained on several sequential media until shoots had formed. These shoots were then isolated and instigated to form roots and then moved to soil once established.

[0101]

[0099] Regenerated shoots were genotyped using Sanger sequencing of the targeted region for editing events. Editing events were selected for those that were unlikely to remove total function of the gene, i.e. in-frame mutations.

[0100] After detecting the recessive EJ2 allele in the TOM105 and TOM117 genome (Figure 6) it was not certain whether the j2 recessive allele caused by the CRISPR / CAS mutation would result in the unwanted excessive branching of the flower truss. Although the approach employed minimises the likelihood of the excessive flower truss branching it was hypothesised that this would not guarantee that is enough to cause jointlessness, as all other previously reported j2 recessive alleles resulted in out of frame deletions, whereas our -6 mutation still had a potential to result in a functional protein. Surprisingly, however, and as was observed in Figure 4, jointlessness was present.

[0102]

[0101] Selected edited shoots were grown to maturity and phenotyped for the jointless phenotype (Figure 4) and no extreme branching of the flowering truss (Figure 11).

[0103] Example 2

[0104]

[0102] Using the method as described in Example 1 , with the same sgRNA sequence, enzyme, and regeneration protocol, a jointless Ailsa Craig variety was generated. Ailsa Craig is an indeterminate medium red tomato variety and is shown in Figure 13 in comparison to the wild type variety. The jointless Ailsa Craig variety is hemizygous for edits at the g11064f target site, having a -8 and -5 edit (see Sequences shown in Figures 14 and 15 respectively (SEQ ID NOs; 18 and 19). These edits have the same biological function and phenotype as the TOM105 and TOM117 edits described in Example 1 . The hemizygous nature is not expected to be necessary for the phenotype, as both mutations remove the splice site for exon 5.

[0105]

[0103] Although particular embodiments of the invention have been disclosed herein in detail, this has been done by way of example and for the purposes of illustration only. The aforementioned embodiments are not intended to be limiting with respect to the scope of the appended claims, which follow. The choice of nucleic acid starting material, the clone of interest, or types of library used are believed to be a routine matter for the person of skill in the art with knowledge of the presently described embodiments. It is contemplated by the inventors that various substitutions, alterations, and modifications may be made to the invention without departing from the spirit and scope of the invention as defined by the claims. Genetic resources utilised within the conception, execution and exemplification of the invention as defined in the claims were obtained within the United Kingdom.

Claims

CLAIMS1. A tomato (Solatium lycopersicum) plant that exhibits a jointless phenotype, wherein the jointless phenotype is defined as the elimination of an abscission zone within a pedicel of the plant, wherein the plant comprises at least one Jointless-2 (j2) allele that comprises the removal or disruption of a splice site that results in the complete or partial loss of at least one exon in an mRNA transcribed from a SIMBP21 gene (Solyc12g038510).

2. The plant of claim 1 , wherein the at least one exon is exon 5.

3. The plant of claims 1 or 2, wherein the plant comprises more than one Jointless-2 (J2) allele.

4. The plant of any one of claims 1 to 3, wherein the splice site is disrupted by a mutation.

5. The plant of claim 4, wherein, the mutation is selected from an insertion, substitution, or a deletion mutation.

6. The plant of any preceding claim, wherein the complete or partial loss of the at least one exon from the mRNA is due to a deletion mutation of at least 12 nucleotides, at least 10 nucleotides, at least 9 nucleotides, at least 8 nucleotides, at least 7 nucleotides, at least 6 nucleotides, or optionally at least s nucleotides.

7. The plant of any preceding claim, wherein the complete or partial loss of the at least one exon from the mRNA is due to a deletion mutation of 5 or more nucleotides.

8. The plant of claim 7, wherein the deletion mutation corresponds to a deletion of nucleotides 23 to 28 of SEQ ID NO: 2.

9. The plant of claim 7, wherein the deletion mutation corresponds to a deletion of nucleotides 11 ,826 to 11 ,831 of SEQ ID NO: 3.

10. The plant of any preceding claim, wherein the complete or partial loss of the at least one exon from the mRNA is due to a deletion mutation of 10 nucleotides.

11. The plant of claim 10, wherein the deletion mutation corresponds to a deletion of nucleotides 18 to 27 of SEQ ID NO: 2.

12. The plant of claim 10, wherein the deletion mutation corresponds to a deletion of nucleotides 11 ,821 to 11 ,830 of SEQ ID NO: 3.

13. The plant of any preceding claim, wherein the mutation is the result of a deletion during non-homologous end joining (NHEJ) repair or homology directed repair (HDR) following a staggered double strand break in the DNA, optionally wherein the staggered double strand break in the DNA is due to gene editing.

14. The plant of claim 13, wherein the gene editing is effected by a CRISPR / Cas ribonucleoprotein (RNP) complex comprising an endonuclease and a guide RNA (gRNA), wherein the gRNA hybridises with a target sequence comprised within a SIMBP21 (Solyc12g038510) gene of the plant.

15. The plant of claim 13 or 14, wherein the gene editing is effected by a Cas12a / Cpf1 ribonucleoprotein (RNP) complex comprising a Cas12a / Cpf1 endonuclease, or homologue or derivative thereof, and a guide RNA (gRNA), wherein the gRNA hybridises with a target sequence comprised within a SIMBP21 (Solyc12g038510) gene of the plant.

16. The plant of claim 13 or 14, wherein the gene editing is effected by a CRISPR / Cas gene editing complex comprising a nuclease selected or derived from the group consisting of MbCas12a, ErCas12a, Lb5Cas12a, BsCas12a, Mb2Cas12a, Mb3Cas12a, TsCas12a, and SpCas9.

17. The plant of any one of claims 14 to 16, wherein the gRNA has a sequence having at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to SEQ ID NO 11 .

18. The plant of any one of claims 14 to 16, wherein the gRNA has a sequence according to SEQ ID NO 11.

19. The plant of claim 13, wherein the gene editing is effected by a gene editing technique selected from the group consisting of TALENs, ZFN, Base Editing, Prime Editing, MegaTALs, Homologous Recombination, RNA Interference, AAV-mediated Gene Editing, Lentiviral Gene Editing, and PiggyBac Transposon System.

20. The plant of any preceding claim, wherein the plant is an indeterminate tomato (Solatium lycopersicum).21 . The plant of any preceding claim, wherein the plant is a cultivar selected from one of: Ailsa Craig, Amelia, Bella Rosa, BHN 602, BHN 730, BHN 975, Camara, Charger, Crista, Everglade, Fletcher, FL 47, FL 91 , Grand Marshall, HM 1823, Maverick, Phoenix, Raceway, Red Morning, Red Rave, Resolute, Rocky Top, Sanibel, Sebring, Skyway, Solar Fire, Soraya, Southern Ripe, SV 7631 , Tasti-Lee, Volante, BHN 685, Daytona, Mariana, Monticello, Sunoma, Supremo, or Tachi.

22. The plant of any one of the preceding claims, wherein the plant comprises a j2 allele having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 4.

23. The plant of any one of the preceding claims, wherein the j2 allele is defined by a mutated SIMBP21 gene (Solyc12g038510) gene having a sequence of SEQ ID NO: 4.

24. The plant of any one of claims 1 to 21 , wherein the plant comprises a j2 allele having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 12.

25. The plant of any one of claims 1 to 21 , wherein the j2 allele is defined by a mutated SIMBP21 gene (Solyc12g038510) gene having a sequence of SEQ ID NO: 12.

26. The plant of any one of the preceding claims, wherein the plant comprises a protein having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 8.

27. The plant of any one of the preceding claims, wherein the plant comprises a protein having a sequence according to SEQ ID NO: 8.

28. The plant of any one of the preceding claims wherein the jointless phenotype comprises elimination of substantially all abscission zones within the pedicels of the plant.

29. The plant of any one of the claims 1 to 27, wherein the jointless phenotype comprises reduction in the number of abscission zones within a pedicel of the plant, compared to a wild type plant.

30. The plant of any one of the preceding claims, wherein the jointless phenotype does not result in increased branching, compared to a wild type plant.31 . The plant of claim 30, wherein the branching is of the truss.

32. A Solanum species plant cell comprising a mutation in at least one allele of a SIMBP21 gene (Solyc12g038510) or a homologue thereof, wherein the mutation results in a jointless phenotype, wherein the jointless phenotype is defined as a Jointless-2 (J2) allele that comprises elimination of an abscission zone within a pedicel of a plant grown from the plant cell when compared to a plant grown from a Solanum species plant cell without the mutation, and wherein the Jointless-2 (J2) allele comprises loss of at least one exon in an mRNA obtained from the SIMBP21 gene (Solyc12g038510).

33. The plant cell of claim 32, wherein the Jointless-2 (J2) allele comprises loss of exon 5 in an mRNA obtained from the SIMBP21 gene (Solyc12g038510).

34. The plant cell of any one of claims 32 or 33, wherein the mutation comprises a deletion mutation of at least 12 nucleotides, at least 10 nucleotides, at least 9 nucleotides, at least 8 nucleotides, at least 7 nucleotides, at least 6 nucleotides, or optionally at least 5 nucleotides within a splice site that leads to loss of at least one exon in an mRNA obtained from the SIMBP21 (Solyc12g038510) gene.

35. The plant cell of any one of claims 32 to 34, wherein the mutation comprises a deletion mutation of 6 nucleotides within a splice site that leads to loss of at least one exon in an mRNA obtained from the SIMBP21 (Solyc12g038510) gene.

36. The plant cell of any one of claims 32 to 36, wherein the mutation comprises a deletion mutation of at 10 nucleotides within a splice site that leads to loss of at least one exon in an mRNA obtained from the SIMBP21 (Solyc12g038510) gene.

37. The plant cell of any one of claims 32 to 36, wherein the plant cell comprises a j2 allele having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 4.

38. The plant cell of any one of claims 32 to 36, wherein j2 allele is defined by a mutated SIMBP21 (Solyc12g038510) gene having a sequence of SEQ ID NO: 4.

39. The plant cell of any one of claims 32 to 36, wherein the plant cell comprises a j2 allele having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 12.

40. The plant cell of any one of claims 32 to 36, or claim 39, wherein j2 allele is defined by a mutated SIMBP21 (Solyc12g038510) gene having a sequence of SEQ ID NO: 12.41 . The plant cell of any one of the claims 32 to 40, wherein the plant cell comprises a protein having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 8.

42. The plant cell of any one of the claims 32 to 41 , wherein the plant cell comprises a protein having a sequence according to SEQ ID NO: 8.

43. The plant cell of any one of the claims 32 to 42, wherein the plant cell expresses a protein having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 8.

44. The plant cell of any one of the claims 32 to 43, wherein the plant cell expresses a protein having a sequence according to SEQ ID NO: 8.

45. The plant cell of any one of the claims 32 to 44, wherein the gene product of the SIMBP21 (Solyc12g038510) gene comprises a protein having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 8.

46. The plant cell of any one of the claims 32 to 44, wherein the gene product of the SIMBP21 (Solyc12g038510) gene is a protein having a sequence according to SEQ ID NO: 8.

47. The plant cell of any one of claims 32 to 46 wherein the cell is comprised within a leaf, pollen, an ovule, a fruit, a seed, a rootstock, a scion, an explant or a flower.

48. The plant cell of any one of claims 32 to 47, wherein the plant cell is from a tomato plant (Sola num lycopersicum).

49. A tissue culture comprising regenerable plant cells of any one of claims 32 to 48.

50. A tomato fruit comprising a plant cell of any one of claims 32 to 48.51 . A tomato plant (Solanum lycopersicum) comprising a plant cell of any one of claims 32 to 48.

52. A plant from the Solanaceae family comprising a plant cell of any one of claims 32 to 48.

53. A plant selected from Table 1 comprising a plant cell of any one of claims 32 to 47.

54. A method for modifying a plant cell from the Solanaceae family in order to introduce a jointless phenotype, the method comprising mutating one or more copies of a SIMBP21 (Solyc12g038510) gene within the genome of the plant cell, wherein the mutation comprises a substitution of at least one nucleotide, a deletion of at least one nucleotide, an insertion of at least one nucleotide or any combination thereof so as to induce removal or disruption of a splice site within the SIMBP21 gene, wherein the removal or disruption of a splice site within the SIMBP21 gene results in the loss of at least one exon in an mRNA transcribed from the mutated SIMBP21 (Solyc12g038510) gene.

55. The method of claim 54, wherein the removal or disruption of a splice site within the SIMBP21 gene results in the loss of exon 5 in an mRNA transcribed from the mutated SIMBP21 (Solyc12g038510) gene.

56. The method of claim 54 or 55, wherein the mutation comprises a deletion mutation of at least 12 nucleotides, at least 10 nucleotides, at least 9 nucleotides, at least 8 nucleotides, at least 7 nucleotides, at least 6 nucleotides, or optionally at least 5 nucleotides within a splice site that leads to loss of at least one exon in an mRNA obtained from the SIMBP21 (Solyc12g038510) gene.

57. The method of any one of claims 54 to 56, wherein the mutation comprises a deletion mutation of 6 or more nucleotides within a splice site that leads to loss of at least one exon in an mRNA obtained from the SIMBP21 (Solyc12g038510) gene.

58. The method of any one of claims 54 to 57, wherein the mutation comprises a deletion mutation of 10 or more nucleotides within a splice site that leads to loss of at least one exon in an mRNA obtained from the SIMBP21 (Solyc12g038510) gene.

59. The method of any one of claims 54 to 57, wherein the plant cell comprises a j2 allele having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 4.

60. The method of any one of claims 54 to 57, wherein j2 allele is defined by a mutated SIMBP21 (Solyc12g038510) gene having a sequence of SEQ ID NO: 4.61 . The method of any one of claims 54 to 57, or claim 59, wherein the plant cell comprises a j'2 allele having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 12.

62. The method of any one of claims 54 to 57, or claim 59, wherein j2 allele is defined by a mutated SIMBP21 (Solyc12g038510) gene having a sequence of SEQ ID NO: 12.

63. The method of any one of claims 54 to 62, wherein the plant cell comprises a protein having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 8.

64. The method of any one of claims 54 to 62, wherein the plant cell comprises a protein having a sequence according to SEQ ID NO: 8.

65. The method of any one of claims 54 to 64, wherein the plant cell expresses a protein having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 8.

66. The method of any one of claims 54 to 64, wherein the plant cell expresses a protein having a sequence according to SEQ ID NO: 8.

67. The method of any one of claims 54 to 66, wherein the gene product of the SIMBP21 (Solyc12g038510) gene comprises a protein having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 8.

68. The method of any one of claims 54 to 66, wherein the gene product of the SIMBP21 (Solyc12g038510) gene is a protein having a sequence according to SEQ ID NO: 8.

69. The method of any one of claims 54 to 68, wherein mutating of one or more copies is via a gene editing technique.

70. The method of claim 69, wherein the gene editing technique comprises use of a CRISPR / Cas gene editing complex comprising a nuclease and a gRNA.71 . The method of claim 70, wherein the CRISPR / Cas gene editing complex comprises a Cas endonuclease selected from: Cas9 (including derivatives and homologues thereof) and Cas12a / Cpf1 (including derivatives and homologues thereof).

72. The method of claim 71 , wherein the CRISPR / Cas gene editing complex comprises a nuclease selected or derived from the group consisting of MbCas12a, ErCas12a, Lb5Cas12a, BsCas12a, Mb2Cas12a, Mb3Cas12a, TsCas12a, and SpCas9.

73. The method of any one of claims 70 to 72, wherein the gRNA has a sequence having at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to SEQ ID NO 11 .

74. The method of any one of claims 70 to 73, wherein the gRNA has a sequence according to SEQ ID NO 11.

75. The method of claim 69, wherein the gene editing technique is selected from the group consisting of TALENs, ZFN, Base Editing, Prime Editing, MegaTALs, Homologous Recombination, RNA Interference, AAV-mediated Gene Editing, Lentiviral Gene Editing, and PiggyBac Transposon System.

76. The method of any one of claims 54 to 75, wherein the plant cell is from the species Solanum lycopersicum (tomato).

77. The plant, plant cell, or method of any preceding claim wherein the SIMBP21 (Solyc12g038510) gene has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 3.

78. The plant, plant cell, or method of any preceding claim wherein the SIMBP21 (Solyc12g038510) gene has a sequence according to SEQ ID NO: 3.

79. The plant, plant cell, or method of any preceding claim wherein the plant or plant cell comprises a j2 allele as defined by a mutated SIMBP21 (Solyc12g038510) gene having a sequence of SEQ ID NO: 18.

80. The plant, plant cell, or method of any preceding claim wherein the plant or plant cell comprises a j2 allele as defined by a mutated SIMBP21 (Solyc12g038510) gene having a sequence of SEQ ID NO: 19.

Citation Information

Patent Citations

  • Incorporation of unnatural nucleotides and methods of use in vivo thereof

    US20200224234A1

  • Jointless gene of tomato

    US6514760B1

  • Nucleic acid-guided nucleases

    US9982279B1

  • Methods for efficient tomato genome editing

    US11926835B1

  • Mutations in MADS-box genes and uses thereof

    US20200299706A1