A novel nucleic acid molecule with improved expression efficiency and sustainability and uses thereof
By inserting a virus-derived stem-loop α (SLα) structure in the 3' UTR of mRNA, the stability and translational efficiency of mRNA are enhanced, addressing the short half-life issue and improving protein expression levels and duration.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- GC BIOPHARMA CORP
- Filing Date
- 2025-10-30
- Publication Date
- 2026-05-07
AI Technical Summary
mRNA-based therapeutics face challenges due to short half-life and instability, limiting their efficacy, primarily through mechanisms like deadenylation and degradation by enzymes, which affect protein expression levels and duration.
Insertion of a virus-derived stem-loop α (SLα) structure in the 3' untranslated region (UTR) of mRNA maintains optimal spatial distance from the poly(A) tail, enhancing stability and translational efficiency.
The SLα structure significantly improves mRNA stability and target protein expression levels and duration, enabling stable and continuous production of therapeutically effective amounts of proteins.
Smart Images

Figure KR2025017527_07052026_PF_FP_ABST
Abstract
Description
A NOVEL NUCLEIC ACID MOLECULE WITH IMPROVED EXPRESSION EFFICIENCY AND SUSTAINABILITY AND USES THEREOF
[0001] The present invention relates to a recombinant mRNA molecule in which a virus-derived stem-loop α (SLα) sequence is artificially introduced at a specific location to dramatically enhance the expression level and persistence of a target protein.
[0002]
[0003] In gene therapy and related fields, DNA is known to be relatively stable and easier to handle compared to RNA. However, DNA has several drawbacks: when delivered into the genome of a target organism, it may insert at undesirable locations, potentially damaging the host's genes; it can be damaged by anti-DNA antibodies generated by the host's immune response; and the expression level of the desired antigen protein is limited by various variables affecting transcription. Furthermore, DNA must pass through both the plasma membrane and the nuclear membrane of the cell to achieve protein expression, making high levels of protein production difficult. In contrast, mRNA may synthesize proteins directly in the cytoplasm without the need for transcription in the nucleus, and it does not pose the risk of damaging the host cell's genetic structure. Moreover, because of its short half-life, it does not induce long-term genetic modifications, and it offers advantages over DNA in terms of safety and ease of large-scale production. Based on the success of mRNA vaccine technology during the COVID-19 pandemic, many global pharmaceutical companies have expanded their basic research and clinical trials using the mRNA platform not only for vaccines against infectious diseases but also for immuno-oncology therapeutics, treatments for rare diseases, and therapies for autoimmune diseases.
[0004] Nevertheless, mRNA has a relatively short half-life in cells, which acts as a major limiting factor for the efficacy of mRNA-based therapeutics. One of the mechanisms that promotes mRNA degradation is the deadenylation of the poly(A) tail at the 3' end of the mRNA. In this process, the poly(A) tail is completely removed by the PAN2 / 3 complex and the CNOT complex, followed by removal of the 5′cap by the DCP1 / 2 complex. Finally, the mRNA is completely degraded by enzymes such as Xrn1 and the exosome complex.
[0005] Meanwhile, recent studies have reported that certain viruses exploit host terminal nucleotidyl transferase (TENT4) to add a mixed tail to the 3' end of their RNA, thereby slowing down RNA degradation, extending half-life, and increasing stability within the host. In this mechanism, a stem-loop structure located in the post-transcriptional regulatory element (PRE) plays a crucial role. Accordingly, the present inventors sought to insert viral stem-loop structures into the 3' UTR sequence of mRNA encoding the desired protein, in order to enhance the stability and translational efficiency of the mRNA, thereby improving protein production efficiency and maximizing the therapeutic effect of mRNA-based therapeutics.
[0006]
[0007] Throughout the present specification, a number of publications and patent documents are referred to and cited. The disclosure of the cited publications and patent documents is incorporated herein by reference in its entirety to more clearly describe the state of the art to which the present invention pertains and the content of the present invention.
[0008]
[0009] The present inventors have made intensive studies to identify the optimal structure of a modified mRNA molecule capable of maintaining high stability over an extended period and efficiently expressing a target proteinin vivoor in a biological sample. As a result, the present inventors have found that when a virus-derived stem-loop α (SLα) structure or an analogue thereof is inserted at an appropriate position within the 3' UTR so as to maintain an optimal spatial distance from the poly(A) tail, the stability and translational efficiency of the RNA molecule are markedly improved and the yield of the target protein can be maximized, thereby completing the present invention.
[0010] Accordingly, it is an object of the present invention to provide a modified RNA molecule comprising a 3' UTR into which a virus-derived stem-loop structure is inserted.
[0011] It is another object of the present invention to provide a DNA molecule encoding the modified RNA molecule described above, a gene delivery system comprising the same, and a host cell into which the gene delivery system is introduced.
[0012] Other objects and advantages of the present invention will become more apparent from the following detailed description, the appended claims, and the accompanying drawings.
[0013]
[0014] In one aspect of this invention, there is provided an RNA molecule comprising:
[0015] (1) an open reading frame (ORF) encoding a target protein;
[0016] (2) a 3' untranslated region (UTR) bound to the 3' end of the open reading frame and comprising a stem-loop structure; and
[0017] (3) a poly-adenyl sequence bound to the 3' end of the 3'UTR.
[0018] The present inventors have made intensive studies to identify the optimal structure of a modified mRNA molecule capable of maintaining high stability over an extended period and efficiently expressing a target proteinin vivoor in a biological sample. As a result, the present inventors have found that the insertion of a stem-loop structure, specifically a stem-loop α (SLα) structure in the post-transcriptional regulatory element (PRE) of the hepatitis B virus, or an analogue thereof, at an appropriate position within the 3' UTR significantly increases the half-life of the RNA molecule and remarkably improves both the expression level and the expression duration of the target protein.
[0019] As used herein, the term "untranslated region (UTR)" refers to an untranslated region within an mRNA that is bound to both ends of the coding sequence encoding the target protein. 5'-UTR and 3'-UTR are located upstream and downstream of the coding sequence, respectively. The 5' cap may be attached to the upstream portion of the 5' UTR.
[0020] As used herein, the term "5'-cap" refers to a component of an mRNA that is linked to the 5'-UTR and serves to bind the 40S ribosomal subunit to the mRNA by binding eukaryote translation initiation factor 4E (elF4E), which allows to initiate protein synthesis from the 5' initiation site of the mRNA, as well as to protect the mRNA from nucleases.
[0021] As used herein, the term "stem" refers to a region of nucleotide sequence that, within a certain length, contains reverse complementary sequences, such that base pairs are formed between opposing nucleotide strands, allowing for the formation of a hairpin structure through the binding of a loop sequence located between the two reverse complementary sequences. The stem region is also referred to as an "inverted repeat sequence" since base pairs are formed by complementary sequences that are arranged in opposite directions and face each other spatially.
[0022] As used herein, the term "complementary" means having complementary enough to selectively hybridize to a spatially opposite reverse complementary sequence under a certain annealing or hybridization condition. The term "complementary" encompasses both "substantially complementary" and "perfectly complementary". The term "substantially complementary sequence" is meant to include not only a completely matching sequence, but also a sequence partially mismatching with the sequence to be compared within a range where it can anneal to a particular sequence therefore can form a sequence-specific hybridization.
[0023] As used herein, the term "loop" refers to a sequence located between two inverted repeat sequences that does not hybridize with either side nor internally, thereby inducing the formation of an overall hairpin structure. The loop region is composed of the sequence corresponding to the loop portion within the hairpin structure.
[0024] As used herein, the term "stem-loop structure" refers to a hairpin structure formed by the binding of a loop region between two reverse complementary sequences constituting the stem region.
[0025] As used herein, the term "nucleotide" refers to deoxyribonucleotide or ribonucleotide that exists in single-stranded or double-stranded form and includes nucleotide analogues with modified sugar or base, as well as natural-occurring nucleotides unless otherwise specifically noted (Scheit,Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman,Chemical Reviews, 90:543-584(1990)). Considering the technical problem to be solved, the nucleotide of the present invention is ribonucleotide either synthesized or transcribed from deoxyribonucleotide.
[0026] As used herein, the term "poly-adenyl sequence", "poly A sequence" or "poly(A) tail" refers to an adenine-repeating nucleotide sequence located at the 3' end of an RNA molecule that protects the RNA molecule from enzymatic degradation. The length of the poly A tail affects not only the stability of the mRNA, but also the translation of the protein.
[0027] The poly-adenyl sequence used in the present invention may, for example, contain 80-180 consecutive adenine bases, more specifically, 100-150 consecutive adenine bases, even more specifically, 110-130 consecutive adenine bases, and most specifically, approximately 120 consecutive adenine bases. The poly-adenyl sequence may optionally include non-adenine bases at appropriate positions between the consecutive adenine bases as needed.
[0028] As used herein, the term "target protein" refers to a protein translated from a gene delivered into the subject's cells for the purpose of enabling the subject to acquire a specific phenotype or biological activity, specifically a protein for which expression efficiency is intended to be enhanced using the RNA molecules of the present invention.
[0029] According to a specific embodiment of the invention, the stem-loop structure comprises (i) a first nucleotide sequence of arbitrary sequence; (ii) a second nucleotide sequence that is reverse complementary to the first nucleotide sequence; and (iii) a loop sequence comprising 4 to 7 bases located between the first nucleotide sequence and the second nucleotide sequence.
[0030] According to a specific embodiment, the first nucleotide sequence and the second nucleotide sequence each independently comprise 7 to 35 bases. More specifically, the first nucleotide sequence and the second nucleotide sequence each independently comprise 7 to 30 bases, more specifically, 7 to 27 bases, more specifically, 7 to 23 bases, more specifically, 7 to 20 bases, more specifically, 7 to 17 bases, more specifically, 7 to 13 bases, more specifically, 8 to 11 bases, even more specifically, 9 to 10 bases. Most specifically, the first nucleotide comprises 10 bases and the second nucleotide comprises 9 bases.
[0031] As shown in FIG. 1, an exemplary first nucleotide sequence may be TTGCTCGCAG and an exemplary second nucleotide sequence may be CTGGAGCAA, which are included as part of SEQ ID NO:1. When the first nucleotide and second nucleotide have 10 and 9 bases, respectively, one base of the first nucleotide that does not participate in hybridization forms a bulge.
[0032]
[0033] According to a specific embodiment of the invention, the loop sequence comprises 5 to 6 bases, and more specifically, comprises 5 bases.
[0034] More specifically, the loop sequence is represented by following Formula 1:
[0035] Formula 1
[0036] C-X1-G-G-X2
[0037] wherein X1is A, U, G or C; and X2is A, U, C or absent.
[0038] The present inventors have found that when a pentaloop sequence composed of five nucleotides is used, high protein expression may be maintained in case the first (C), the third (G), and the fourth (G) bases are conserved, whereas the second (X1) and fifth (X2) nucleotides can vary, under the condition that the fifth nucleotide (X2) is any base other than G. In addition, the present inventors discovered that, in the case where the fifth nucleotide (X2) is absent to form a tetraloop, efficient and sustained expression of the target protein may also be induced (Loop 20 of FIG. 8).
[0039] According to a specific embodiment of the invention, the 3' UTR is a heterologous or synthetic 3' UTR selected from the group consisting of human alpha globin (hAG)-derived 3' UTR, human beta globin(hBG)-derived 3' UTR, AES / mtRNR1 (Pfizer, COMIRNATY®) 3' UTR and a GC#15 3′UTR having the nucleotide sequence of SEQ ID NO:14. More specifically, the 3' UTR is hAG-derived 3' UTR.
[0040]
[0041] According to a specific embodiment of the invention, the stem-loop structure is located at a distance of 10 to 40 nucleotides in the 5' direction from the initiation site of the poly-adenyl sequence. More specifically, the stem-loop structure is located at a distance of 10 to 30 nucleotides, and most specifically, 10 to 20 nucleotides, from the initiation site of the poly-adenyl sequence.
[0042] According to another specific embodiment, the stem-loop structure is located at a distance of 5 to 15 nucleotides in the 5' direction from the initiation site of the poly-adenyl sequence. More specifically, the stem-loop structure is located at a distance of 7 to 13 nucleotides, more specifically 8 to 12 nucleotides, and most specifically approximately 10 nucleotides, from the initiation site of the poly-adenyl sequence.
[0043] According to another specific embodiment, the stem-loop structure is located at a distance of 15 to 25 nucleotides in the 5' direction from the initiation site of the poly-adenyl sequence. More specifically, the stem-loop structure is located at a distance of 17 to 23 nucleotides, more specifically 18 to 22 nucleotides, and most specifically approximately 20 nucleotides, from the initiation site of the poly-adenyl sequence.
[0044] According to a specific embodiment of the invention, the stem-loop structure is located at a distance corresponding to 9% to 36% of the total length of the 3' UTR in the 5′direction from the initiation site of the poly-adenyl sequence. More specifically, the stem-loop structure is located at a distance corresponding to 9 to 27%, and most specifically 9 to 18%, of the total length of the 3' UTR.
[0045] According to another specific embodiment, the stem-loop structure is located at a distance corresponding to 4% to 14% of the total length of the 3' UTR in the 5′direction from the initiation site of the poly-adenyl sequence. More specifically, the stem-loop structure is located at a distance corresponding to 6 to 12%, even more specifically 7 to 11%, and most specifically approximately 9%, of the total length of the 3' UTR
[0046] According to another specific embodiment, the stem-loop structure is located at a distance corresponding to 13% to 23% of the total length of the 3' UTR in the 5' direction from the initiation site of the poly-adenyl sequence. More specifically, the stem-loop structure is located at a distance corresponding to 15 to 21%, even more specifically 16 to 20%, and most specifically approximately 18%, of the total length of the 3' UTR.
[0047] The distance from the initiation site of the poly-adenyl sequence to the stem-loop structure, as referred in the present invention, does not include sequences other than the nucleotide constituting the 3' UTR region (e.g., restriction enzyme recognition sites).
[0048]
[0049] According to a specific embodiment of the invention, all or a portion of the uracil (U) in the RNA molecule is substituted with a modified U represented by following Formula 2:
[0050] Formula 2
[0051]
[0052] wherein R1and R2are each independently hydrogen, C1-C3alkyl or C1-C3alkoxy, X and A are carbon or nitrogen and are different from each other, and is a single bond or a double bond.
[0053] As used herein, the term "alkyl" refers to a straight-chain or branched saturated hydrocarbon group, and includes, for example, methyl, ethyl, propyl, isopropyl, etc. C1-C3alkyl refers to an alkyl group having an alkyl unit having 1 to 3 carbon atoms, and when the C1-C3alkyl is substituted, the carbon atom number of the substituent is not included.
[0054] As used herein, the term "alkoxy" refers to a radical formed by the removal of hydrogen from an alcohol. When C1-C3alkoxy is substituted, the number of carbons in the substituent is not included.
[0055] According to the octet rule, it is obvious that when X or A is nitrogen, represents a single bond.
[0056] According to one embodiment, X is nitrogen, A is carbon, R1and R2are hydrogen. The compound represented by Formula 2 wherein X is nitrogen, A is carbon, and R1and R2are hydrogen is pseudouridine.
[0057] According to one embodiment, X is nitrogen, A is carbon, R1is C1alkyl (methyl) and R2is hydrogen. The compound represented by Formula 2 wherein X is nitrogen, A is carbon, R1is C1alkyl and R2is hydrogen is N1-methyl-pseudouridine.
[0058] According to one embodiment, X is carbon, A is nitrogen, R1is C1alkoxy (methoxy), and R2is hydrogen. The compound represented by Formula 2 wherein X is carbon, A is nitrogen, R1is methoxy, and R2is hydrogen is 5-methoxyuridine.
[0059]
[0060] According to a specific embodiment of the invention, the RNA molecule of the invention is an IVT (in vitrotranscribed) mRNA molecule. As used herein, the term "IVT mRNA" refers to a mRNA molecule transcribed DNA-dependentlyin vitro. The template DNA may be linearized with an appropriate restriction enzyme prior toin vitrotranscription or may be synthesized in a linear form without restriction enzyme reaction. Reagents used forin vitrotranscription of RNA typically include bacteriophage-encoded RNA polymerases (T7, T3, SP6, or Syn5); NTPs (nucleoside triphosphates) for the four bases (adenosine triphosphate, guanosine triphosphate, cytidine triphosphate, and uridine triphosphate) and, optionally, cap analogs; modified nucleosides; RNase inhibitors, etc.
[0061]
[0062] In another aspect of this invention, there is provided a DNA molecule encoding the RNA molecule of the present invention described above.
[0063] The DNA molecule may include, in addition to the coding region capable of transcribing the aforementioned RNA molecule of the present invention, an expression regulatory sequence operably linked thereto. As used herein, the term "expression regulatory sequence" refers to a sequence operably linked to a target nucleic acid molecule to be expressed, which regulates the initiation of its expression, and encompasses promoters, signal sequences, and arrays of transcription factor binding sites. More specifically, the expression regulatory sequence refers to a promoter.
[0064] As used herein, the term "promoter" refers to a regulatory nucleic acid sequence that directs the transcription of a nucleic acid and affects the expression of a target sequence to which it is operatively linked. A promoter may include a distal enhancer or repressor element, which may be arbitrarily located at a distance of several thousand base pairs from the transcription initiation site. The term "operatively linked" refers to a functional binding between an expression regulatory sequence and a target nucleic acid sequence, whereby the regulatory sequence regulates the transcription and / or decoding of the target nucleic acid molecule.
[0065]
[0066] In still another aspect of this invention, there is provided a gene delivery system comprising the RNA molecule of the present invention described above.
[0067] As used herein, the term "gene delivery system" refers to any means used to introduce and express a desired target gene in a target cell. As used herein, the term "gene delivery" refers to the transport of a gene into a cell and has the same meaning as transduction of the gene into the cell. At the tissue and cellular level, "gene delivery" is synonymous with the spread of the gene; therefore, the gene delivery vector may be described as a gene transduction system or a gene spreading system.
[0068] As used herein, the term "express" refers to being artificially replicated as an extrachromosomal factor or by chromosomal integration in a target cell via a gene delivery system to cause the target cell to express an exogenous gene or overexpress an endogenous gene. Accordingly, "express" may be used interchangeably with "transformation", "transfection", or "transduction".
[0069] The gene delivery system of the present invention may comprise all elements necessary for self-expression of the gene to be introduced in the form of an expression cassette. The expression cassette usually includes a promoter operably linked to the gene, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication.
[0070] The gene delivery system of the present invention may be any one used for conventional gene insertion in the art, and examples thereof include, but are not limited to, plasmids, adenovirus, adeno-associated virus (AAV), retrovirus, lentivirus, herpes simplex virus, vaccinia virus, liposomes, and niosomes.
[0071]
[0072] In still another aspect of this invention, there is provided a cell into which the gene delivery system of the present invention described above in introduced.
[0073] The RNA molecules and the gene delivery system comprising them already been described above in detail and are therefore omitted to avoid undue redundancy.
[0074] The RNA molecules of the present invention may be used for therapeutics such as genetic vaccines, as well as for the recombinant production of target proteins, due to their ability to maintain their length for extended periods of time or extended cycles of full-length sequence shortening while maintaining structural stability within various gene carriers or host cells. Thus, the cell into which the gene delivery system of the present invention has been introduced are not limited to human cells, but may include various types of cells that can be used for the recombinant production of a desired protein, such as prokaryotic cells (e.g.,E. coli), plant cells (e.g.,Nicotiana benthamianacells), mammalian cells (e.g., CHO cells), and insect cells (e.g., Sf-9 cells), without limitation.
[0075]
[0076] The features and advantages of the present invention are summarized as follows:
[0077] (a) The present invention provides a modified mRNA molecule capable of efficiently expressing a target proteinin vivoor in a biological sample.
[0078] (b) The RNA molecule of the present invention exhibits significantly improved expression level and expression duration of a target protein by inserting a virus-derived stem-loop α (SLα) structure or an analogue thereof at an appropriate position within the 3' UTR such that an optimal spatial distance from the poly(A) tail is maintained.
[0079] (c) Accordingly, the present invention may be advantageously used as an excellent nucleic acid therapeutic composition capable of stably and continuously producing therapeutically effective amounts of the target protein even at a low dosage.
[0080]
[0081] FIG. 1 shows a schematic illustration of stem-loop α (SLα) structure located within the post-transcriptional regulatory element (PRE) of Hepatitis B virus (HBV).
[0082] FIG. 2 is a schematic diagram of human alpha globin (hAG) 3' UTR variants into which the SLα structure has been introduced at various positions.
[0083] FIG. 3 shows the nucleotide sequences of SLα, mutated SLα, hAG 3' UTR variants into which SLα and mutated SLα have been introduced, as well as control group.
[0084] FIG. 4 presents the results of electrophoresis analysis for each hAG 3' UTR variant containing various SLα structure (M: RiboRuler High Range RNA Ladder, Lane 1: HBV PREα, Lane 2: hAG+SLα-0, Lane 3: hAG+SLα-10, Lane 4: hAG+SLα-20, Lane 5: hAG+SLα-30, Lane 6: hAG+SLα-30-mut, Lane 7: hAG+SLα-40, Lane 8: hAG+SLα-50, Lane 9: AES / mtRNR1, Lane 10: hAG).
[0085] FIG. 5 shows images (FIG. 5a) and quantification (FIG. 5b) of bioluminescence measured after administering hAG 3' UTR variants with the SLα structures and controls to BALB / c mice.
[0086] FIG. 6 shows the changes of luciferase activity over time (FIG. 6a) and AUC values (FIG. 6b) after transfecting HEK293T cells with the hAG 3' UTR variant containing the SLα structure and the control group.
[0087] FIG. 7 shows the nucleotide sequences of each variant with mutations applied to the loop region within the SLα structure.
[0088] FIG. 8 shows the changes of luciferase activity over time and AUC values after transfecting HEK293T cells with hAG 3' UTR-containing mRNA with the mutated loop sequences indicated in FIG. 7.
[0089] FIG. 9 shows the expression efficiency of EGFP and d2EGFP mRNA, into which the SLα structure of the present invention was introduced, in HEK293T cells (FIG. 9a) and Huh7 cells (FIG. 9b), respectively.
[0090] FIG. 10 shows the results of animal experiments confirming the expression level of human erythropoietin (EPO) mRNA introduced with the SLα structure of the present invention in mice. It shows the changes in EPO concentration in mouse serum over time (FIG. 10a) and the AUC value (FIG. 10b), respectively.
[0091] FIG. 11 shows the results of evaluating the sustained expression of mRNA containing the SLα structure of the present invention in the lung. It represents an image showing the luminescence measured after intranasally administering IVT mRNA formulated as an inhalable lipid nanoparticle followed by intraperitoneally administering Luciferin (FIG. 11a), changes in expression levels over time (FIG. 11b), and AUC values (FIG. 11c), respectively.
[0092] FIG. 12 shows the expression efficiency of Farnesoid X receptor (FXR) mRNA into which the SLα structure of the present invention is introduced, in HEK293T cells.
[0093] FIG. 13 shows the nucleotide sequences of AES / mtRNR1 3' UTR variants into which the SLα structure of the present invention is introduced at various positions, and of the control.
[0094] FIG. 14 shows the luciferase activity 72 hours after transfecting HEK293T cells with the AES / mtRNR1 3' UTR variants into which the SLα structure of the present invention is introduced at various positions, and the control.
[0095] FIG. 15 shows the AUC values obtained by quantifying the luminescence after administering the AES / mtRNR1 3' UTR variants into which the SLα structure of the present invention is introduced at various positions, and the control, to BALB / c mice.
[0096] FIG. 16 shows the nucleotide sequences of GC#15 3' UTR variants into which the SLα structure of the present invention is introduced at various positions, and of the control.
[0097] FIG. 17 shows the AUC values (left) and luciferase activity (right) after transfecting HEK293T cells with the GC#15 3' UTR variants into which the SLα structure of the present invention is introduced at various positions, and the control.
[0098] FIG. 18 shows the images of luminescence (FIG. 18a), the AUC values (FIG. 18b, left), and the total flux values at 72 hours, obtained after administering the GC#15 3' UTR variants into which the SLα structure of the present invention is introduced at various positions, and the control, to BALB / c mice.
[0099]
[0100] Hereinafter, the present invention will be described in more detail by way of examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention according to the subject matter of the present invention is not limited by these examples.
[0101]
[0102] Examples
[0103] Design of hAG 3' UTR variants
[0104] SLα consists of an A-helix stem, a G-bulge, and a CAGGU pentaloop (FIG. 1) and is an essential element for RNA stability and export. Recent studies have reported that certain viruses recognize the ZCCHC14-TENT4 complex via a CNGGN-type pentaloop, thereby adding a mixed tail to the viral RNA terminus to protect their RNA. Accordingly, the present inventors sought to introduce the viral RNA protection mechanism mediated by SLα into mRNA molecules to enhance the intracellular stability and translation efficiency ofin vitrotranscribed (IVT) mRNA. The hAG 3'UTR, a potent natural UTR sequence, was used as a control, and the variants designated as SLα-0, SLα-10, SLα-20, SLα-30, SLα-40, and SLα-50 were constructed by inserting the SLα element into the hAG 3' UTR at various distances (0, 10, 20, 30, 40, or 50 nt) from the poly(A) tail. An additional mutant (SLα-30 mut) was generated by modifying the loop sequence of SLα-30 (FIG. 2). The nucleotide sequences of each construct are summarized in FIG. 3.
[0105] To verify whether the synthesized SLα structures enhance IVT mRNA translation efficiency, hAG, HBV PREα, and AES / mtRNR1 were used as controls. The 3' UTR variant was prepared by inserting SLα into the 3' UTR region using restriction enzyme A at the 5' end and restriction enzyme B at the 3' end, via a primer annealing method.
[0106]
[0107] Quality verification of the synthesized mRNA molecules
[0108] 3' UTR cloning was performed based on the sequence indicated in FIG. 3. The other components were fixed as the 5' UTR sequence disclosed in U.S. Patent No. US10881730B2 (ModernaTX, Inc.), the firefly luciferase coding sequence, and the poly(120A) sequence. pDNA was accordingly constructed, and IVT mRNA was synthesized from the secured pDNA. The mRNA purity and integrity were confirmed via electrophoresis analysis, verifying that the synthesized mRNA possessed quality suitable for the experiment (FIG. 4).
[0109]
[0110] Evaluation of in vivo expression of the mRNA molecules
[0111] The IVT mRNA used in animal experiments was synthesized using the modified uridine N1-methylpseudouridine (m1Ψ). The IVT mRNA was formulated into ionizable lipid nanoparticles (LNP) and administered intravenously at a dose of 0.5 mg / kg to 6-week-old male BALB / c mice. Luminescence was visualized by measuring bioluminescence using the IVIS Luminar XR (PerkinElmer) system after intraperitoneal administration of RediJect D-Luciferin (Revvity) at 24, 48, 72, 96, 168 and 192 hours post-administration.
[0112] All six hAG 3' UTR variants incorporated with SLα structure (SLα-0, SLα-10, SLα-20, SLα-30, SLα-40, SLα-50) demonstrated superior expression persistence compared to the control hAG (FIGS. 5a and 5b). These results were predicted to be derived by the effect of SLα's pentaloop based on the results of SLα-30 and SLα-30-mut. Furthermore, differences in expression persistence were observed depending on the position of the SLα structure within hAG. Notably, SLα-20 exhibited the highest persistence, while persistence tended to decrease as the SLα structure was positioned closer to the 3' end of the hAG 3' UTR (e.g., SLα-0) or farther from the Poly(A) tail (e.g., SLα-50). Wild-type HBV PREα containing SLα also exhibited expression persistence similar to the hAG 3' UTR variants. Furthermore, compared to AES / mtRNR1, the hAG 3' UTR variants of the present invention showed superior expression persistence, which holds high value in the development of mRNA-based therapeutics.
[0113]
[0114] Evaluation of in vitro expression of the mRNA molecules
[0115] The IVT mRNA used in cell experiments was synthesized using m1Ψ. HEK293T cells (ATCC) were seeded at a density of 1 x 104cells / well in a 96-well plate. After 24 hours, the IVT mRNA was transfected using LipofectamineTMMessengerMAXTM(Invitrogen). Luminescence corresponding to protein expression was analyzed at 24, 8 and 72 hours post-transfection using the Bright-GloTMLuciferase Assay System (Promega).
[0116] The results showed that all six hAG 3' UTR variants introduced with the SLα structure (SLα-0, SLα-10, SLα-20, SLα-30, SLα-40, SLα-50) outperformed the control hAG, HBV PREα, and COMIRNATY® 3' UTRs in both total expression levels and expression persistence (FIGS. 6a and 6b). A trend was also observed, consistent with animal studies, where expression persistence tended to decrease relatively as the SLα structure was positioned closer to the 3' terminus of hAG (e.g., SLα-0) or further away from the Poly(A) tail (e.g., SLα-50).
[0117]
[0118] Application of mutations to loop sequences
[0119] The SLα structure forms a protein-RNA interaction within cells through sequence-specific recognition with the sterile alpha motif (SAM) domain of ZCCHC14 and adds a mixed tail to the RNA end via TENT4. The present inventors sought to evaluate the effect of specific nucleotide sequences and their positions within the 3' UTR on binding to the SAM domain by modifying the CAGGU sequence, which is the loop region within the SLα structure.
[0120] The present inventors first designed a total of 20 variant sequences: 15 loop variant sequences (Loop 1-15) where the second and fifth nucleotides of the CAGGU sequence were substituted with A, U, G, or C, along with the variant sequences of UNGAN, GNGCN, and CNGG (Loop 16-20) (FIG. 7). Variants were prepared based on the hAG+SLα-20 structure, which demonstrated excellent expression levels and persistence in animal and cell experiments. These variants were synthesized with polymerase chain reaction (PCR) with forward and reverse primers, using the hAG+SLα-20 structure as a template. The IVT mRNA used in cell experiments was synthesized using m1Ψ. Following the method described in the aforementioned cell experiment process, IVT mRNA was transfected into HEK293T cells, and luminescence corresponding to protein expression was analyzed at 24, 48 and 72 hours post-transfection. The results showed that the variants where annealing was induced between the first and fourth nucleotides, UNGAN and GNGCN (Loop 16-19), exhibited lower expression levels at 48 and 72 hours of post-transfection. Conversely, the 20 loop variants (Loop 1-20) included in the experiment exhibited superior expression levels compared to the human alpha globin 3UTR control during the initial 24 hours and showed high or similar expression trends at 48 hours (FIG. 8). Finally, at 72 hours, Loop 1, 2, 4, 5, 7, 8, 9, 11-13, and 15 tended to maintain expression levels (FIG. 8). However, variants where the fifth nucleotide is G, such as Loop 3, 6, 10, and 14, showed reduced translational efficiency persistence. This indicates that sequence alterations at specific positions can affect binding to the SAM domain, potentially reducing expression persistence. This contributes to understanding sequence specificity in the interaction between the SAM domain of ZCCHC14 and the SLα structure, providing crucial evidence for developing mRNA platforms utilizing SLα
[0121]
[0122] Evaluation for in vitro expression of EGFP and d2EGFP mRNA
[0123] The present inventors sought to confirm whether the novel SLα structure discovered in this invention also significantly improves protein expression efficiency for mRNA encoding various target proteins. To this end, SLα-20 was applied to the 3' UTR of Enhanced Green Fluorescent Protein (EGFP) and d2EGFP mRNA and their expressions were measured. HEK293T and Huh7 cells (ATCC) were seeded at a density of 1 x 105cells / well in 24-well plates. After 24 hours, IVT mRNA was transfected using LipofectamineTMMessengerMAXTM(Invitrogen). Subsequently, green fluorescence corresponding to protein expression was analyzed for 48 hours using Live-Cell Imaging Microscopy (Incucyte® S3).
[0124] Similar to the results for firefly luciferase, introducing the SLα structure into the 3' UTR of EGFP and d2EGFP mRNA significantly improved both total expression levels and expression persistence compared to the naturally occurring hAG sequence (FIGS. 9a and 9b), confirming that the SLα structure discovered in this invention improves expression efficiency independently of the type of gene of interest (GOI).
[0125]
[0126] Evaluation of human EPO mRNA expression in animals
[0127] To further validate the versatility of the SLα structure for various target genesin vivo, the SLα structure was introduced into 3' UTR of hEPO mRNA, the IVT mRNA was formulated into ionizable lipid nanoparticles (LNP) and administered intravenously at a dose of 0.5 mg / kg to 6-week-old male BALB / c mice. Blood samples were collected at days 1, 2, 8, 10, 14, and 21 post-administration. Serum was separated by centrifugation (3,000 rpm, 10 min). Serum hEPO concentrations were measured using an immunological assay (Human EPO ELISA Kit, Invitrogen).
[0128] The results showed that, similar to the findings for firefly luciferase, introducing the SLα structure into the 3' UTR of hEPO significantly increased total expression levels compared to the naturally occurring hAG SLα structure (FIG. 10b). This further confirmed that the SLα structure identified in this invention enhances expression in a target gene-independent manner.
[0129]
[0130] Evaluation of expression persistence in Lung by introduction of the SLα structure
[0131] To confirm the tissue versatility of the SLα structure, its expression was evaluated in organs other than the liver. For this, IVT mRNA for firefly luciferase was formulated into inhalable lipid nanoparticles and administered via the intranasal inhalation route to 6-week-old male BALB / c mice. At 6 hours, and on days 1, 2, 3 and 6 after administration, RediJect D-Luciferin (Revvity) was administered intraperitoneally, and the expression pattern in the lungs was quantified and visualized using an IVIS Lumina XR (PerkinElmer) device.
[0132] The results confirmed that introducing the SLα structure into the 3' UTR significantly enhanced both the total expression level and expression persistence in the lung tissues, comparable to the findings in the liver, relative to the natural sequence (FIG. 11). This demonstrates that the SLα structure of the present invention can be universally applied regardless of specific tissue and / or organ, and can be usefully applied not only to the liver but also to inhalable mRNA-based therapeutics targeting the lungs.
[0133]
[0134] Evaluation of in vitro expression of FXR mRNA with the SLα structure
[0135] To further confirm the universality of the SLα structure of the present invention, the SLα structure was applied to the 3' UTR of Farnesoid X receptor (FXR) mRNA. HEK293T cells (ATCC) were seeded at a density of 1.5 x 105cells / well in a 12-well plate. After 24 hours, IVT mRNA was transfected using LipofectamineTMMessengerMAXTM(Invitrogen). Cells were harvested at 6 and 24 hours post-transfection, lysed, and intracellularly expressed FXR protein was measured via Western blot analysis.
[0136] The results showed that introducing the SLα structure into the 3' UTR of FXR mRNA improved both total expression levels and expression persistence compared to the naturally occurring hAG sequence (FIG. 12), further confirming that the SLα structure of the present invention acts independently of the target gene being expressed.
[0137]
[0138] Construction of AES / mtRNR1 3' UTR variants with the SLα Structure
[0139] In order to determine whether the outstanding improvement in expression efficiency observed with the introduction of the SLα-20 structure of the present invention into the hAG (human alpha globin)-derived 3' UTR is also maintained in other diverse 3′UTRs, the SLα was introduced at various positions of the AES / mtRNR1 3' UTR (BioNTech), which is a conjugation of the 3' UTR sequences of the Amino-terminal Enhancer of Split (AES) gene and the mitochondrial ribosomal RNA 1 (mtRNR1) gene. The 3' UTR sequence variants were generated by annealing primers, and inserting the 3′UTR region using restriction enzyme A at 5′end and restriction enzyme B at 3′end (FIG. 13).
[0140]
[0141] Evaluation ofin vitroexpression of mRNA containing AES / mtRNR1 3' UTR variants with the SLαs structure
[0142] HEK293T cells (ATCC) were seeded in 96-well plates at a density of 1 x 104cells / well. After 24 hours, luciferase IVT mRNA containing the AES / mtRNR1 3' UTR variants was transfected using LipofectamineTMMessengerMAXTM(Invitrogen). Protein expression was analyzed by measuring luminescence using the Bright-GloTMLuciferase Assay System (Promega).
[0143] As a result, consistent with the results obtained in the hAG 3' UTR with the SLα structure, the SLα-20 structure where the SLα is positioned 20 nt upstream from the 3' end (the starting point of the polyadenylation sequence) of the AES / mtRNR1 3′UTR, exhibited the most superior expression persistence (FIG. 14).
[0144]
[0145] Evaluation for expression of mRNA containing AES / mtRNR1 3' UTR variants with the SLα structure in animals
[0146] The IVT mRNA was formulated into ionizable lipid nanoparticles (LNPs) and intravenously administered at a dose of 0.5 mg / kg to 6-week-old male BALB / c mice. At 1, 2, 3, 4 and 6 days post-administration, RediJect D-Luciferin (Revvity) was administered intraperitoneally, and luminescence was quantified and visualized using an IVIS Lumina XR (PerkinElmer) device.
[0147] As a result, consistent within vitroexperiments, the SLα-20 structure where the SLα is positioned 20 nt upstream from the 3' end (the starting point of the polyadenylation sequence) of the AES / mtRNR1 3' UTR, exhibited the highest protein expression and persistence (FIG. 15). Therefore, the SLα-20 structure of the present invention was reconfirmed to function as a universal mRNA module that induces the most stable and elevated expression by being inserted at 20 nt, regardless of the specific type of 3' UTR into which it is introduced.
[0148]
[0149] Construction of GC#15 3' UTR variants with the SLα Structure
[0150] To further verify whether the effect of the SLα-20 structure of the present invention is maintained across various 3' UTRs, the SLα was introduced into different positions of the synthetic GC#15 3' UTR sequence previously developed by the present inventors (KR 10-2025-0063952, SEQ ID NO:14). The 3' UTR sequence variants were generated by annealing primers and inserting the 3' UTR region using restriction enzyme A at 5' end and restriction enzyme B at 3' end (FIG. 16).
[0151]
[0152] Evaluation of in vitro expression of mRNA containing GC#15 3' UTR variants with the SLαs structure
[0153] HEK293T cells (ATCC) were seeded in 96-well plates at a density of 1 x 104cells / well. After 24 hours, luciferase IVT mRNA was transfected using LipofectamineTMMessengerMAXTM(Invitrogen). Protein expression was analyzed at 24, 8 and 72 hours using the Bright-GloTMLuciferase Assay System (Promega).
[0154] As a result, consistent with the findings for hAG with SLα applied, it was again confirmed that the SLα-20 structure where the SLα is positioned 20 nt upstream from the 3' end (the starting point of the polyadenylation sequence) of the GC#15 3' UTR, exhibited the highest protein expression and expression persistence (FIG. 17).
[0155]
[0156] Evaluation for expression of mRNA containing GC#15 3' UTR variants with the SLα structure in animals
[0157] The IVT mRNA was formulated into ionizable lipid nanoparticles (LNPs) and intravenously administered at a dose of 0.5 mg / kg to 6-week-old male BALB / c mice. At 1, 2, 3, 4, and 6 days post-administration, RediJect D-Luciferin (Revvity) was administered intraperitoneally, and luminescence was quantified and visualized using an IVIS Lumina XR (PerkinElmer) device.
[0158] As a result, consistent with thein vitroexperiments, the SLα-20 structure where the SLα is positioned 20 nt upstream from the 3' end (the starting point of the polyadenylation sequence) of the GC#15 3' UTR, exhibited the most superior total protein expression and persistence (FIGS. 18a and 18b). Therefore, it was demonstrated from multiple perspectives that the SLα structure can function as a universal mRNA module that induces stable and high expression when inserted at 20 nt, regardless of the specific type of 3' UTR into which it is introduced.
[0159]
[0160] Nucleotide sequences of each nucleic acid moleculeSequence(SEQ ID NO)Stem-loop α (SLα)TTGCTCGCAGCAGGTCTGGAGCAA(1)Stem-loop α (SLα)-mutTTGCTCGCAGAATTTCTGGAGCAA(2)Human alpha globin (hAG)GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA(3)hAG + SLα-0GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCATTGCTCGCAGCAGGTCTGGAGCAA(4)hAG + SLα-10GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGATTGCTCGCAGCAGGTCTGGAGCAAGTGGGCGGCA(5)hAG + SLα-20GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATTGCTCGCAGCAGGTCTGGAGCAATAAAGTCTGAGTGGGCGGCA(6)hAG + SLα-30GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTTTGCTCGCAGCAGGTCTGGAGCAAGGTCTTTGAATAAAGTCTGAGTGGGCGGCA(7)hAG + SLα-30-mutGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTTTGCTCGCAGAATTTCTGGAGCAAGGTCTTTGAATAAAGTCTGAGTGGGCGGCA(8)hAG + SLα-40GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCTTGCTCGCAGCAGGTCTGGAGCAAGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA(9)hAG + SLα-50GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTTGCTCGCAGCAGGTCTGGAGCAATCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA(10)HBV PREαGCCCGGCAACGGCCAGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGCTGGGGCTTGGTCATGGGCCATCAGCGCATGCGTGGAACCTTTTCGGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCCGCTTGTTTTGCTCGCAGCAGGTCTGGAGCAAACATTATCGGGACTGATAACTCTGTTGTCCT(11)AES / mtRNR1CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCA(12)Human beta globin (hBG)GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCT(13)3’UTR #15AATCCACGCCTGCCCCGTATTTACTCGGCCGGTTATGCCGTTATGCGGTAACATAGCCACTCTTTTGCGATGCTCGAGCTATTCGGCTATGACTGGGC(14)Control LoopCAGGU(15)Loop 11CGGGU(26)Loop 1CAGGA(16)Loop 12CUGGA(27)Loop 2CAGGC(17)Loop 13CUGGC(28)Loop 3CAGGG(18)Loop 14CUGGG(29)Loop 4CCGGA(19)Loop 15CUGGU(30)Loop 5CCGGC(20)Loop 16UUGAC(31)Loop 6CCGGG(21)Loop 17UAGAU(32)Loop 7CCGGU(22)Loop 18GUGCC(33)Loop 8CGGGA(23)Loop 19GAGCU(34)Loop 9CGGGC(24)Loop 20CUGG(35)Loop 10CGGGG(25)
[0161] Nucleotide sequences of each nucleic acid molecule - continuedSequence(SEQ ID NO)AES / mtRNR1+ SLα-0CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCATTGCTCGCAGCAGGTCTGGAGCAA(36)AES / mtRNR1+ SLα-10CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTTTGCTCGCAGCAGGTCTGGAGCAAGGAGCTAGCA(37)AES / mtRNR1+ SLα-20CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCATTGCTCGCAGCAGGTCTGGAGCAAGCCACACCCTGGAGCTAGCA(38)AES / mtRNR1+ SLα-30CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTGCTCGCAGCAGGTCTGGAGCAATTTCGTGCCAGCCACACCCTGGAGCTAGCA(39)AES / mtRNR1+ SLα-40CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGTTGCTCGCAGCAGGTCTGGAGCAAGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCA(40)AES / mtRNR1+ SLα-50CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATATTGCTCGCAGCAGGTCTGGAGCAACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCA(41)AES / mtRNR1+ SLα-70CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACTTGCTCGCAGCAGGTCTGGAGCAAGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCA(42)AES / mtRNR1+ SLα-90CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGTTGCTCGCAGCAGGTCTGGAGCAAATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCA(43)AES / mtRNR1+ SLα-110CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACTTGCTCGCAGCAGGTCTGGAGCAACCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCA(44)GC#15 + SLα-0AATCCACGCCTGCCCCGTATTTACTCGGCCGGTTATGCCGTTATGCGGTAACATAGCCACTCTTTTGCGATGCTCGAGCTATTCGGCTATGACTGGGCTTGCTCGCAGCAGGTCTGGAGCAA(45)GC#15+ SLα-10AATCCACGCCTGCCCCGTATTTACTCGGCCGGTTATGCCGTTATGCGGTAACATAGCCACTCTTTTGCGATGCTCGAGCTATTCGGCTTTGCTCGCAGCAGGTCTGGAGCAAATGACTGGGC(46)GC#15+ SLα-20AATCCACGCCTGCCCCGTATTTACTCGGCCGGTTATGCCGTTATGCGGTAACATAGCCACTCTTTTGCGATGCTCGAGTTGCTCGCAGCAGGTCTGGAGCAACTATTCGGCTATGACTGGGC(47)GC#15+ SLα-40AATCCACGCCTGCCCCGTATTTACTCGGCCGGTTATGCCGTTATGCGGTAACATAGCCTTGCTCGCAGCAGGTCTGGAGCAAACTCTTTTGCGATGCTCGAGCTATTCGGCTATGACTGGGC(48)
[0162] Having described specific embodiment of the present invention in detail above, it is to be understood that variants and modifications thereof falling within the spirit of the invention may become apparent to those skilled in this art, and the scope of this invention is to be determined by appended claims and their equivalents.
Claims
1.An RNA molecule comprising:(1) an open reading frame (ORF) encoding a target protein;(2) a 3' untranslated region (UTR) bound to the 3' end of the open reading frame and comprising a stem-loop structure; and(3) a poly-adenyl sequence bound to the 3' end of the 3'UTR.2.The RNA molecule of claim 1, wherein the stem-loop structure comprises (i) a first nucleotide sequence of arbitrary sequence; (ii) a second nucleotide sequence that is reverse complementary to the first nucleotide sequence; and (iii) a loop sequence comprising 4 to 7 bases located between the first nucleotide sequence and the second nucleotide sequence.3.The RNA molecule of claim 2, wherein the loop sequence is represented by following Formula 1:Formula 1C-X1-G-G-X2wherein X1is A, U, G or C; and X2is A, U, C or absent.4.The RNA molecule of claim 1, wherein the stem-loop structure is located at a distance of 10 to 40 nucleotides in the 5' direction from the initiation site of the poly-adenyl sequence.5.The RNA molecule of claim 1, wherein the stem-loop structure is located at a distance corresponding to 9% to 36% of the total length of the 3' UTR in the 5′direction from the initiation site of the poly-adenyl sequence.6.The RNA molecule of claim 1, wherein all or a portion of the uracil (U) is substituted with a modified U represented by following Formula 2:Formula 2wherein R1and R2are each independently hydrogen, C1-C3alkyl or C1-C3alkoxy, X and A are carbon or nitrogen and are different from each other, andis a single bond or a double bond.7.A DNA molecule encoding the RNA molecule of any one of claims 1 to 6.8.A gene delivery system comprising the RNA molecule of any one of claims 1 to 6.9.A cell into which the gene delivery system of claim 8 is introduced.