Methods and compounds for treating, ameliorating and / or preventing fibrotic diseases

Targeting GPR87 with specific compounds addresses the limitations of current IPF treatments by reducing fibrosis-related genes and proteins, providing a promising therapeutic approach for IPF and other fibrotic diseases.

WO2026096962A1PCT designated stage Publication Date: 2026-05-07YALE UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
YALE UNIVERSITY
Filing Date
2025-10-31
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Current treatments for idiopathic pulmonary fibrosis (IPF) are inadequate as they do not cure the disease and have significant side effects, necessitating the development of novel therapies that can treat, ameliorate, and/or prevent fibrotic diseases.

Method used

Administering compounds that downregulate GPR87, such as small molecule inhibitors, protein inhibitors, nucleic acids, ribozymes, CRISPR components, or antibodies, to target and reduce the expression and activity of GPR87 in lung cells, thereby inhibiting fibrosis.

Benefits of technology

Downregulating GPR87 effectively reduces fibrosis-related genes and proteins, offering a viable treatment for IPF and other fibrotic diseases by mitigating disease progression and potentially reversing fibrotic tissue changes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025053636_07052026_PF_FP_ABST
    Figure US2025053636_07052026_PF_FP_ABST
Patent Text Reader

Abstract

Described herein are methods of treating, ameliorating, and / or preventing a fibrotic disease in a subject in need thereof. In certain embodiments, the methods comprise administering to the subject an effective amount of a compound that downregulates GPR87. Also described are compounds, compositions, and kits for carrying out the methods of the disclosure.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS AND COMPOUNDS FOR TREATING, AMELIORATING AND / OR PREVENTING FIBROTIC DISEASES CROSS-REFERENCE TO RELATED APPLICATIONS The present application claims priority under 35 U. S. C. § 119(e) to U. S. Provisional Patent Application No. 63 / 714,827, filed October 31, 2024, which is incorporated herein by reference in its entirety.

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0003] This invention was made with government support under HT9425-23-1-0126 awarded by the U. S. Department of Defense. The government has certain rights in the invention.

[0004] BACKGROUND

[0005] Idiopathic pulmonary’ fibrosis (IPF) is a fatal disease, characterized by excessive deposition of extracellular matrix proteins in the pulmonary interstitium. Current available treatments may slow disease progression, but do not cure the disease. In addition, current treatments have multiple side effects, which hamper proper disease management.

[0006] Thus, there is a need for novel treatments that can be used to treat, ameliorate, and / or prevent IPF as well as other fibrotic diseases. The present invention addresses this need.

[0007] SEQUENCE LISTING

[0008] The XML file named "047162-7538W01(02690)_Sequence Listing" created on October 31, 2025, comprising 654,040 bytes, is hereby incorporated by reference in its entirety.

[0009] SUMMARY

[0010] In some aspects, the present invention is directed to the following non-limiting embodiments:

[0011] Methods of treating, ameliorating and / or preventing fibrotic disease

[0012] In some aspects, the present invention is directed to a method of treating, ameliorating and / or preventing a fibrotic disease.

[0013] In some embodiments, the method comprises administering to the subject an effective amount of a compound that downregulates GPR87. In some embodiments, the fibrotic disease is pulmonary fibrosis.

[0014] In some embodiments, the fibrotic disease is idiopathic pulmonary fibrosis (IPF). liver fibrosis, or skin fibrosis.

[0015] In some embodiments, the compound comprises a small molecule inhibitor of GPR87. In some embodiments, the compound comprises a protein inhibitor of GPR87.

[0016] In some embodiments, the compound comprises a nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference.

[0017] In some embodiments, the compound comprises a ribozyme that downregulates the expression level and / or activity of GPR87, and / or an expression vector expressing the ribozyme.

[0018] In some embodiments, the compound comprises an expression vector comprising an expression cassette, wherein the expression cassette expresses CRISPR components that downregulate the expression level and / or activity of GPR87 by CRISPR knockout or CRISPR knockdown.

[0019] In some embodiments, the compound comprises a trans-dominant negative mutant protein of GPR87, and / or an expression vector that expresses the trans-dominant negative mutant protein of GPR87.

[0020] In some embodiments, the compound comprises an antibody that binds GPR87.

[0021] In some embodiments, the compound comprises an siRNA for knocking down GPR87.

[0022] In some embodiments, the compound comprises an antisense oligonucleotide (ASO) for inhibiting GPR87.

[0023] In some embodiments, the siRNA comprises a sequence set forth in any one of SEQ ID NOs:9-59.

[0024] In some embodiments, the siRNA comprises a sequence set forth in any one of SEQ ID NOs:4-6 and 104-151.

[0025] In some embodiments, the ASO comprises a sequence set forth in any one of SEQ ID NOs:60-81.

[0026] In some embodiments, the ASO comprises a sequence set forth in any one of SEQ ID NOs: 66, 70, and 75.

[0027] In some embodiments, the ASO comprises a sequence set forth in any one of SEQ ID NOs:82-103. In some embodiments, the ASO comprises a sequence set forth in any one of SEQ ID NOs: 88, 92, and 97

[0028] In some embodiments, the subject is a human.

[0029] Kits

[0030] In some aspects, the present invention is directed to a kit for treating, ameliorating, and / or preventing a fibrotic disease in a subject.

[0031] In some embodiments, the kit comprises: a compound that downregulates GPR87; and an instruction manual instructing that the compound that downregulates GPR87 is to be administered to the subject in an effective amount.

[0032] In some embodiments, the fibrotic disease is pulmonary fibrosis.

[0033] In some embodiments, the fibrotic disease is idiopathic pulmonary fibrosis (IPF). liver fibrosis, or skin fibrosis.

[0034] In some embodiments, the compound comprises a small molecule inhibitor of GPR87. In some embodiments, the compound comprises a protein inhibitor of GPR87.

[0035] In some embodiments, the compound comprises a nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference.

[0036] In some embodiments, the compound comprises a ribozyme that downregulates the expression level and / or activity of GPR87, and / or an expression vector expressing the ribozyme.

[0037] In some embodiments, the compound comprises an expression vector comprising an expression cassette, wherein the expression cassette expresses CRISPR components that downregulate the expression level and / or activity of GPR87 by CRISPR knockout or CRISPR knockdown.

[0038] In some embodiments, the compound comprises a trans-dominant negative mutant protein of GPR87, and / or an expression vector that expresses the trans-dominant negative mutant protein of GPR87.

[0039] In some embodiments, the compound comprises an antibody that binds GPR87.

[0040] In some embodiments, the compound comprises an siRNA for knocking down GPR87, or an antisense oligonucleotide (ASO) for inhibiting GPR87.

[0041] In some embodiments, the siRNA comprises a sequence set forth in any one of SEQ ID NOs:9-59. In some embodiments, the siRNA comprises a sequence set forth in any one of SEQ ID NOs:4-6 and 104-151.

[0042] In some embodiments, the ASO comprises a sequence set forth in any one of SEQ ID NOs:60-81.

[0043] In some embodiments, the ASO comprises a sequence set forth in any one of SEQ ID NOs: 66, 70, and 75.

[0044] In some embodiments, the ASO comprises a sequence set forth in any one of SEQ ID NOs:82-103.

[0045] In some embodiments, the ASO comprises a sequence set forth in any one of SEQ ID NOs: 88, 92, and 97.

[0046] In some embodiments, the subject is a human.

[0047] Molecules

[0048] In some aspects, the present invention is directed to a molecule.

[0049] In some embodiments, the molecule comprises an siRNA molecule comprising a sequence set forth in any one of SEQ ID NOs:9-59.

[0050] In some embodiments, an antisense oligonucleotide (ASO) comprising a sequence set forth in any one of SEQ ID NOs: 60-81.

[0051] In some embodiments, the ASO comprises a sequence set forth in any one of SEQ ID NOs: 66, 70, and 75.

[0052] In some embodiments, the siRNA comprises a sequence set forth in any one of SEQ ID NOs:4-6 and 104-151.

[0053] In some embodiments, the ASO comprises a sequence set forth in any one of SEQ ID NOs:82-103.

[0054] In some embodiments, the ASO comprises a sequence set forth in any one of SEQ ID NOs: 88, 92, and 97.

[0055] Compositions

[0056] In some aspects, the present invention is directed to a composition.

[0057] In some embodiments, the composition comprises the molecule herein, and a pharmaceutically acceptable carrier.

[0058] BRIEF DESCRIPTION OF THE DRAWINGS

[0059] The following detailed description of exemplary embodiments will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating, non-limiting embodiments are shown in the drawings. It should be understood, however, that the instant specification is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0060] Figs. 1A-1L demonstrate that GPR87 is highly expressed in IPF lungs and mainly in basal and aberrant basaloid cells, and correlates with disease severity, in accordance with some embodiments. Fig. 1A: G-coupled receptor 87 (GPR87) expression in IPF and control lungs. Fig. 1B: Correlation between GPR87 expression and FVC (Forced vital capacity). Fig.

[0061] 1C: Correlation between GPR87 expression and DLCO (diffusion capacity of carbon monoxide). Fig. 1D: Uniform Manifold Approximation and Projection (UMAP) representation 47,296 epithelial cells from 107 different lungs in two different datasets, each dot represents a single cell, and cells are labeled as one of 11 discrete cell varieties. AT: alveolar type; PNEC: pulmonary neuroendocrine cell. Fig. 1E: Umap presenting GPR87 in different cells. Fig. 1F: Umap presenting distribution of cells among datasets. Fig. 1G: Umap presenting distribution of cells among lung diseases. Fig. 1H: Umap presenting distribution of cells among subject donors. Fig. 1I: Heat map of unity-normalized gene expression of curated markers observed to different cell types; each column is representative of the average expression value per cell type for one subject. Figs. 1J-1K: Expression of GPR87 among different cell types in Adams et al. (Set Adv 6, eabal983 (2020)) and Habermann et al. (Set Adv 6, eaba!972 (2020)) datasets, respectively. Fig. 1L: IPF tissue, GPR87 in situ hybridization (Red), P63 (Green), and KRT5 (Silver) immunofluorescence and DAPI.

[0062] Yellow arrow-heads showing GPR87 and P63 positive, KRT5 negative cells, probably aberrant basaloid cells, and red arrows showing GPR87, P63 and KRT5 positive cells, probably airway basal cells. IPF: idiopathic pulmonary fibrosis; ILD: interstitial lung disease; PNEC: pulmonary neuroendocrine cells.

[0063] Figs. 2A-2K demonstrates that GPR87 knockout protected subjects against pulmonary fibrosis, in accordance with some embodiments. Fig. 2A: Survival curve of wildtype (WT) and GPR87 KO (knockout) mice after bleomycin or saline injection. Fig. 2B: weight change between day zero and day 21 (grams) in the indicated groups of mice. Fig. 2C: Pressure volume loops at day 21 in the indicated groups of mice. Fig. 2D: lung compliance in the indicated groups of mice. Fig. 2E: Modified Ashcroft score for WT and GPR87 KO mice 21 days after bleomycin or saline. Fig. 2F: Quantitative analysis of hydroxy proline in lung homogenates from indicated groups of mice. Fig. 2G: Coll Al gene expression measured using real-time quantitative polymerase chain reaction (RT qPCR) in the indicated groups of mice. Fig. 2H: Representative images of Hematoxylin & Eosin and Trichrome staining of lung sections in the indicated groups of mice. Fig. 2I: Heatmap of all genes in the indicated groups of mice showing a similarity between WT and KO saline groups, but a difference response after bleomycin injection. Fig. 2J: three-dimensional Principal Component Analysis (PCA) plot was generated using Qlucore Omics Explorer to visualize the variance in [e.g., gene expression] data across the indicated groups of mice. Fig. 2K: TNF measured in BAL from mice lungs on sacrifice day, using ELISA. Bleo: bleomycin; WT: wildtype; KO: GPR87 global knockout; BAL: bronchoalveolar lavage; TNF: Tumor necrosis factor.

[0064] Figs. 3A-3H demonstrate that, in airway basal cells, LPA induces fibrosis related genes, microRNAs and proteins, while GPR87 knockdown inhibits the same, in accordance with some embodiments. Fig. 3A: qPCR of gene expression in induced basal cells (iBC), comparing GPR87, LPAR1, MMP7. ITGB6, CDH2, KRT17 and P63 after GPR87 knockdown, LPAR1 knockdown, lysophosphatidic acid (LPA) compared to control. Fig. 3B: Heat map of the top differentially expressing genes in iBC after LPA stimulation and GPR87 knockdown. Figs. 3C-3D: Enriched pathways after GPR87 knockdown or LPA stimulation, showing involvement of PI3K, mTOR, TNF, NFkB, and MAPK1 / MAPK3 pathw ays. Fig. 3E: qPCR of gene expression in iBC, after PI3K pathway inhibition using A66, with or without stimulation of LPA, and PI3K stimulation using YP-740, with or without GPR87 Knockdown. Fig. 3F: Western blot analysis after GPR87 knockdown in iBC, showing the expression of ITGB6, CDH2 and GPR87 protein expression. Figs. 3G-3H: micro-RNA panel showing significantly differentially expressed micro-RNAs after GPR87 knockdown, or LPA stimulation of iBC. KD: knockdown (using siRNA); LPA: lysophosphatidic acid.

[0065] Figs. 4A-4J demonstrate that GPR87 knockdown protected disease-free lung tissues against induced pulmonary' fibrosis, and reverted fibrosis in IPF lung tissues, in accordance with some embodiments. Fig. 4A: Uniform Manifold Approximation and Projection (UMAP) representation 20,000 nuclei from precision cut lung slices (PCLS). treated with fibrotic cocktail or control medium, harvested immediately after cutting, and every 24 hours up to day 5, presented: epithelial cell types, cells by' day and by' condition. Fig. 4B: UMAP presenting gene expression of selected genes. Fig. 4C: UMAP presenting the origin of the cells: fibrotic cocktail and control. Fig. 4D: violin plot presenting MMP7, CDH2, GPR87 and ITGB6 from day 0 through day 5. Fig. 4E: Heatmap presenting expression of some signature genes in different cell types in control and fibrotic cocktail. Fig. 4F: Hematoxylin & Eosin (H& E), and Manson trichrome stain of no-disease PCLS treated with fibrotic control medium or fibrotic cocktail with either scrambled RNA, GPR87 siRNA or nintedanib. Fig. 4G:

[0066] Trichrome quantification of Fig. 4F. Fig. 4H: Hematoxylin & eosin and Manson trichrome staining of idiopathic pulmonary fibrosis (IPF) PCLS treated with scrambled RNA, GPR87 siRNA or nintedanib. Fig. 41: Trichrome quantification of Fig. 4F. Fig. 4J: collagen in the medium of the IPF PCLS at day 5. 48 hours after the last media change.

[0067] Fig. 5A: correlation between GPR87 and alveolar surface density in LGRC dataset. Fig. 5B: Correlation between GPR87 expression and top directly or inversely correlated genes, and genes of interest.

[0068] Fig. 6A: Top enriched pathways in bleomycin GPR87 knockout mice and wildtype mice. Figs. 6B-6E: Heatmaps of differentially expressed genes in bleomycin GPR87 knockout mice and wildtype mice in different pathways.

[0069] Figs. 7A-7B illustrate certain aspects of the top enriched pathways in iBC after GPR87 siRNA knockdown or lysophosphatidic acid treatment, in accordance with some embodiments.

[0070] Figs. 8A-8D demonstrate that down-regulating of GPR87 with antisense oligonucleotides (ASOs) resulted in the downregulation of fibrotic genes in both healthy and fibrotic cells, in accordance with some embodiments. Fig. 8A: MALAT1 expression after different ASO concentration exposure. The MALAT1 ASO was used as a control in the screening of GPR87 ASOs. Fig. 8B: GPR87 expression after exposure to different anti GPR87 ASOs. The circled ASOs were found to be particularly effective and used in subsequent tests. Fig. 8C: Relative expression of fibrotic genes (MMP7, ITGB6, and CDH2) and a non-fibrotic gene (P63) after GPR87 ASO knockdown. Fig. 8D: GPR87 and MMP7 expression after GPR87 ASO knockdown and stimulation with LPA. LPA induced fibrotic MMP7 expression, which was downregulated by GPR87 ASOs.

[0071] DETAILED DESCRIPTION

[0072] The following disclosure provides many different embodiments, or examples, for implementing different features of the provided subject matter. Specific examples of components and arrangements are described below to simplify the present disclosure. These are, of course, merely examples and are not intended to be limiting. For example, the formation of a first feature over or on a second feature in the description that follows may include embodiments in which the first and second features are formed in direct contact, and may also include embodiments in which additional features may be formed betw een the first and second features, such that the first and second features may not be in direct contact. In addition, the present disclosure may repeat reference numerals and / or letters in the various examples. This repetition is for the purpose of simplicity and clarity and does not in itself dictate a relationship between the various embodiments and / or configurations discussed. Multiple novel pathways of idiopathic pulmonary fibrosis (IPF) development are being studied to design more effective treatments. Basal cells in IPF patients highly express G-coupled receptor-87 (GPR87), a lysophosphatidic acid (LPA) receptor (Heinzelmann et al., European Respiratory Journal 202259: 2102373; Kim et al., BMC Genomics. 2015 Nov 11;16:924; McDonough et al., JCI Insight. 2019 Nov 14;4(22):el31597). A unique cell population, aberrant basaloid cells, which plays a role in IPF development, also expresses GPR87. However, whether GPR87 can be targeted to treat, ameliorate, and / or prevent IPF remains unknown.

[0073] In the present study, GPR87 was down regulated (such as by siRNA) in stem cell derived basal cells (iBC) cell culture, which led to the downregulation of various fibrosis related genes and proteins, as well as the upregulation of miRNA having anti-fibrosis activity. Furthermore, the present study shows that blocking GPR87 using siRNA in human precision cut lung slices led to lower fibrosis related genes and reduced fibrin deposition. These data, among others described herein, demonstrate that the downregulation of GPR87 is a viable treatment for fibrotic diseases, such as pulmonaiy fibrosis, such as IPF.

[0074] Non-limiting examples of compounds for downregulating GPR87 are described herein. Further compounds for downregulating GPR87 are known in the art. For example, some non-limiting examples of GPR87 siRNAs described herein are a novel therapeutic approach to downregulate GPR87. Therapeutic GPR87 antibodies have been experimented in the treatment of cancer (Yasui et al. EBioMedicine 67, 103372 (2021)). and the inhibition of GPR87 using adenoviral vector has been shown to disturb tumor proliferation in lung cancer (see e.g., Kita et al. Anticancer Res 40, 733-741 (2020)). As such, various therapeutic agents are available for treating, ameliorating and / or preventing fibrotic diseases, such as IPF, by downregulating GPR87.

[0075] Accordingly, in some aspects, the present invention is directed to methods of treating, ameliorating, and / or preventing fibrotic diseases, such as IPF.

[0076] In some aspects, the present invention is directed to compounds, compositions, or kits for treating, ameliorating, and / or preventing fibrotic diseases, such as IPF.

[0077] Definitions

[0078] As used herein, each of the following terms has the meaning associated with it in this section. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Generally, the nomenclature used herein and the laboratory procedures in animal pharmacology, pharmaceutical science, peptide chemistry, and organic chemistry are those well-known and commonly employed in the art. It should be understood that the order of steps or order for performing certain actions is immaterial, so long as the present teachings remain operable. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference.

[0079] In the application, where an element or component is said to be included in and / or selected from a list of recited elements or components, it should be understood that the element or component can be any one of the recited elements or components and can be selected from a group consisting of two or more of the recited elements or components.

[0080] In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process.

[0081] In this document, the terms "a." "an." or “the’' are used to include one or more than one unless the context clearly dictates otherwise. The term “or” is used to refer to a nonexclusive “or” unless otherw ise indicated. The statement “at least one of A and B” or “at least one of A or B” has the same meaning as “A, B, or A and B.”

[0082] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, in certain embodiments ±5%, in certain embodiments ±1%, in certain embodiments ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

[0083] Methods of Treating, Ameliorating and / or Preventing Fibrotic Diseases

[0084] In some aspects, the present invention is directed to methods of treating, ameliorating and / or preventing a fibrotic disease in a subject in need thereof.

[0085] In some embodiments, the fibrotic disease is a pulmonary fibrosis.

[0086] In some embodiments, the fibrotic disease is idiopathic pulmonary fibrosis (IPF), liver fibrosis, or skin fibrosis.

[0087] In some embodiments, the method comprises administering to the subject an effective amount of a compound that downregulates an activity and / or expression level of G-coupled receptor 87 (GPR87), such as in a lung cell, a pro-fibrotic cell, a pro-fibrotic lung cell, a pro-fibrotic lung cell of IPF, and / or a basal or aberrant basaloid cells in IPF.

[0088] What is considered as “effective amount” by the specification is described elsewhere herein and / or is known in the art.

[0089] In some embodiments, the compound that downregulates the expression level and / or activity of GPR87 includes a small molecule inhibitor of GPR87, a protein inhibitor of GPR87, or a compound that downregulates the expression level or the activity of GPR87 by RNA interference, by ribozy me, by CRISPR knockout / knockdown, or by producing a transdominant negative mutant, and so forth.

[0090] In some embodiments, the compound that downregulates the expression level or the activity of GPR87 acts at the genomic level. For example, the expression level of GPR87 can be downregulated by gene knockout, such as CRISPR knockout and other knockout techniques.

[0091] In some embodiments, the compound that downregulates the expression level or the activity of GPR87 acts at the transcriptional level or the translational level. For example, the expression level of GPR87 can be downregulated by gene knockdown, such as by RNA interference technique, ribozyme knockdown, or CRISPR knockdown.

[0092] In some embodiments, the compound that downregulates the expression level or the activity of GPR87 acts at the post-translational level. For example, the expression level of GPR87 can be downregulated by targeted protein degradation, such as proteolysis-targeting chimera (PROTAC) and other protein degradation strategies. For example, the activity7of GPR87 can be downregulated by small molecules inhibitors of GPR87, antibodies that neutralizes GPR87, and trans-dominant negative mutant of GPR87.

[0093] In some embodiments, the compound that downregulates the expression level or the activity7of GPR87 includes a small molecule inhibitor of GPR87, a protein inhibitor of GPR87, or a compound that downregulates the expression level and / or activity of GPR87 by RNA interference, by ribozyme, by CRISPR knockout / knockdown. or by producing a trans-dominant negative mutant, and so forth.

[0094] In some embodiments, the compound contemplated herein can be delivered by a vector, such as a plasmid or a viral vector. One of ordinary skill in the art w ould understand that such vectors can be used to deliver compounds in the form of nucleic acids, such as RNA or DNA. Such vectors are described herein below. Downregulating GPR87 by small molecule inhibitors

[0095] In some embodiments, the compound that downregulates the expression level or the activity of GPR87 includes a small molecule that inhibits the activity of GPR87. As used herein, the term ‘'small molecule” refers to a molecule having a size of less than 2000, 1800, 1600, 1400, 1200, 1000, 800, or 600 daltons.

[0096] In some embodiments, the small molecule inhibitor comprises a PROTAC or a Proteolysis Targeting Chimeric Molecule. PROTACs are heterobifunctional nanomolecules that can target any protein for ubiquitination and degradation. In certain embodiments, the PROTAC contemplated in the present invention comprises a group that is recognized by the E3 ubiquitin ligase and a group that is recognized by GPR87. The PROTAC is able to simultaneously bind to the GPR87 and the E3 ligase. Formation of such trimeric complex formation leads to the transfer of ubiquitins to the GPR87, marking it for degradation.

[0097] PROTAC molecules possess good tissue distribution and the ability to target intracellular proteins, thus can be directly applied to cells or injected into animals without the use of vectors. PROTACS useful within the invention can be prepared using any know n compound that binds to and / or recognizes and / or inhibits GPR87, which is linked through a linker to an E3 ubiquitin ligase, such as but not limited to those described in WO 2013 / 106643, WO 2013 / 106646, and WO 2019 / 148055.

[0098] Downregulating GPR87 by protein inhibitors

[0099] In some embodiments, the compound that downregulates the expression level or the activity of GPR87 includes a protein that downregulates the expression level or the activity of GPR87.

[0100] Since GPR87 is a G protein-coupled receptor having an trans -membranous portion, GPR87 protein is especially targetable by antibodies, such as monoclonal and / or polyclonal antibodies. Indeed, a humanized anti-GPR87 antibody has already been used in the treatment of GPR87 positive lung cancer (Yasui et al. EBioMedicine 67, 103372 (2021)).

[0101] Apart from the antibody of Yasui et al, additional examples of monoclonal and / or polyclonal antibodies that target GPR87 include PA5-33781 (RRID: AB 2551152) and PAS-28751 (RRID: AB_2546227) from Invitrogen (Waltham, MA, US), and GPCR87-101AP from Fabgennix (Frisco, TX, US), and any humanized derivatives thereof.

[0102] In some embodiments, the protein that downregulates the expression level and / or activity of GPR87 is administered in form of a protein. In some embodiments, the protein that downregulates the expression level and / or activity of GPR87 is administered in form of a nucleic acid that expresses the protein, such as an expression vector. The expression vector is described in the "‘Vector' section elsewhere in the instant specification.

[0103] Downregulating GPR87 by RNA Interference

[0104] In some embodiments, the compound that downregulates the activity or expression level of GPR87 includes a nucleic acid that downregulates the activity and / or expression level of GPR87 by the means of RNA interreference.

[0105] In some embodiments, the nucleic acid that downregulates the expression level of GPR87 by the means of RNA interreference includes an isolated nucleic acid. In other embodiments, the modulator is an RNAi molecule (such as but not limited to siRNA and / or shRNA and / or miRNAs) or antisense molecule, which inhibits the expression and / or activity of GPR87. In yet other embodiments, the nucleic acid comprises a promoter / regulatory sequence, such that the nucleic acid is preferably capable of directing expression of the nucleic acid. Thus, the instant specification provides expression vectors and methods for the introduction of exogenous DNA into cells with concomitant expression of the exogenous DNA in the cells such as those described, for example, in Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory. New York), and in Ausubel et al. (1997, Current Protocols in Molecular Biology7, John Wiley & Sons, New York) and as described elsewhere herein.

[0106] In certain embodiments, siRNA is used to decrease the level of GPR87. RNA interference (RNAi) is a phenomenon in which the introduction of double-stranded RNA (dsRNA) into a diverse range of organisms and cell types causes degradation of the complementary mRNA. In the cell, long dsRNAs are cleaved into short 21-25 nucleotide small interfering RNAs, or siRNAs, by a ribonuclease known as Dicer. The siRNAs subsequently assemble with protein components into an RNA-induced silencing complex (RISC), unwinding in the process. Activated RISC then binds to complementary transcript by base pairing interactions between the siRNA antisense strand and the mRNA. The bound mRNA is cleaved and sequence specific degradation of mRNA results in gene silencing. See, for example, U. S. Patent No. 6,506,559; Fire et al., 1998, Nature 391(19);306-311; Timmons et al., 1998, Nature 395:854; Montgomery et al., 1998, TIG 14 (7):255-258; Engelke, Ed., RNA Interference (RNAi) Nuts & Bolts of RNAi Technology, DNA Press, Eagleville, PA (2003); and Hannon, Ed., RNAi A Guide to Gene Silencing, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2003). Soutschek et al. (2004, Nature 432: 173-178) describes a chemical modification to siRNAs that aids in intravenous systemic delivery. Optimizing siRNAs involves consideration of overall G / C content, C / T content at the termini, Tm and the nucleotide content of the 3' overhang. See, for instance, Schwartz et al., 2003, Cell, 115:199-208 and Khvorova et al., 2003, Cell 115:209-216. Therefore, the instant specification also includes methods of decreasing levels of GPR87 using RNAi technology.

[0107] In certain embodiments, the instant specification provides a vector comprising an siRNA or antisense polynucleotide. In other embodiments, the siRNA or antisense polynucleotide inhibits the expression of GPR87. The incorporation of a desired polynucleotide into a vector and the choice of vectors is well-known in the art.

[0108] In certain embodiments, the expression vectors described herein encode a short hairpin RNA (shRNA) inhibitor. shRNA inhibitors are well known in the art and are directed against the mRNA of a target, thereby decreasing the expression of the target. In certain embodiments, the encoded shRNA is expressed by a cell, and is then processed into siRNA. For example, in certain instances, the cell possesses native enzymes (e.g, dicer) that cleaves the shRNA to form siRNA.

[0109] The siRNA, shRNA, or antisense polynucleotide can be cloned into various types of vectors as described elsewhere herein. For expression of the siRNA or antisense polynucleotide, at least one module in each promoter functions to position the start site for RNA synthesis.

[0110] In order to assess the expression of the siRNA, shRNA, or antisense polynucleotide, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected using a viral vector. In certain embodiments, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers are known in the art and include, for example, antibiotic-resistance genes, such as neomycin resistance and the like.

[0111] Following the generation of the siRNA polynucleotide, a skilled artisan will understand that the siRNA polynucleotide has certain characteristics that can be modified to improve the siRNA as a therapeutic compound. Therefore, in some embodiments, the siRNA polynucleotide is further designed to resist degradation by modifying it to include phosphorothioate, or other linkages, methylphosphonate, sulfone, sulfate, ketyl, phosphorodithioate, phosphoramidate. phosphate esters, and the like (see, e.g., Agrwal et al., 1987, Tetrahedron Lett. 28:3539-3542; Stec etal., 1985 Tetrahedron Lett. 26:2191-2194; Moody et al., 1989 Nucleic Acids Res. 12:4769-4782; Eckstein, 1989 Trends Biol. Sci. 14:97-100; Stein, In: Oligodeoxynucleotides. Antisense Inhibitors of Gene Expression, Cohen, ed., Macmillan Press, London, pp. 97-117 (1989)).

[0112] In some embodiments, the RNA interreference oligonucleotides are specifically designed to increase the cellular uptake of these oligonucleotides. Methods of designing oligonucleotides having desirable cellular uptake are described in, e.g., Geary et al., Adv Drug Deliv Rev 87, 46-51 (2015) and Crooke et al.. Nature biotechnology 35, 230-237 (2017).

[0113] Any polynucleotide may be further modified to increase its stability in vivo. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5 ’ and / or 3’ ends; the use of phosphoro thioate or 2' O-methyl rather than phosphodiester linkages in the backbone; and / or the inclusion of nontraditional bases such as inosine, queosine, and wybutosine and the like, as well as acetyl- methyl-, thio- and other modified forms of adenine, cytidine, guanine, thymine, and uridine.

[0114] In certain embodiments, an antisense nucleic acid sequence expressed by a plasmid vector is used to inhibit GPR87 protein expression. The antisense expressing vector is used to transfect a mammalian cell or the mammal itself, thereby causing reduced endogenous expression of GPR87.

[0115] Antisense molecules and their use for inhibiting gene expression are well known in the art (see, e.g., Cohen, 1989. In: Oligodeoxyribonucleotides, Antisense Inhibitors of Gene Expression, CRC Press). Antisense nucleic acids are DNA or RNA molecules that are complementary, as that term is defined elsewhere herein, to at least a portion of a specific mRNA molecule (Weintraub, 1990, Scientific American 262:40). In the cell, antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule thereby inhibiting the translation of genes.

[0116] The use of antisense methods to inhibit the translation of genes is known in the art, and is described, for example, in Marcus-Sakura (1988, Anal. Biochem. 172:289). Such antisense molecules may be provided to the cell via genetic expression using DNA encoding the antisense molecule as taught by Inoue, 1993, U. S. Patent No. 5,190,931.

[0117] Alternatively, antisense molecules of the instant specification may be made synthetically and then provided to the cell. Antisense oligomers of between about 10 to about 30, and more preferably about 15 nucleotides, are preferred, since they are easily synthesized and introduced into a target cell. Synthetic antisense molecules contemplated by the instant specification include oligonucleotide derivatives known in the art which have improved biological activity compared to unmodified oligonucleotides (see U. S. Patent No. 5,023,243). In some embodiments, the GPR87 is downregulated by an siRNA molecule having comprising a following sequence (optional modifications, such as modifications to the 5’- or 3’ - end, the phosphodiester bond, the nucleoside, and / or the sugar groups are not shown):

[0118] Table 1.

[0119]

[0120]

[0121] In some embodiments, the GPR87 is downregulated by an ASO molecule.

[0122] In some embodiments, the ASO is an RNA molecule, a DNA molecule, or a DNA-RNA hybrid molecule. In some embodiments, the ASO includes modified nucleobase(s), modified linkage(s) and / or modified sugar group(s).

[0123] In some embodiments, the modified sugar groups include a 2’-O-methylation (2’-O-Me) modified sugar group, a locked nucleic acid (LNA) modified sugar group, a 2 -0-methoxyethyl (2‘-0-M0E) modified sugar group, a (S)-constrained ethyl nucleic acid (cEt) modified sugar group, or a 2’fluoro (2’F) modified sugar group.

[0124] In some embodiments, the modified linkage includes a phosphorothioate (PS) linkage, a phosphorodiamidate morpholino (PMO) linkage, a positively charged PMO linkage, a phosphoramidate linkage, a methylphosphonate (MP) linkage, a phosphorothioate linkage, or a peptide nucleic acid (PNA) linkage. In some embodiments, the ASO includes a combination of the modified linkages and the natural phosphodiester (PO) linkages, such as a combination of the PS linkages and the PO linkages.

[0125] In some embodiments, the modified nucleobase includes a 5 ’methylcytosine nucleobase, or a G-clamp nucleobase.

[0126] In some embodiments, the ASO is conjugated to an N-acetylgalactosamine (GalNAc) group, or a cholesterol group. In some embodiments, the conjugation improves the delivery of the ASO, such as the delivery across cell membrane.

[0127] In some embodiments, the ASO is of a Gapmer design. In some embodiments, the Gapmer includes a DNA-based internal “gap’' and RNA-like flanking regions. In some embodiments, the RNA-like flanking regions includes one or more modifications, such as those described above, such as 2'-0Me or LNA modifications. In some embodiments, the ASO comprises one or more following sequence (optional modifications, such as modifications to the 5’- or 3’- end. the phosphodiester bond, the nucleoside, and / or the sugar groups are not shown):

[0128] Table 2.

[0129]

[0130] Downregulating GPR87 by ribozyme

[0131] In some embodiments, the compound that downregulates the activity or expression level of GPR87 includes a ribosome that inhibits GPR87 protein expression.

[0132] A ribozyme is used to inhibit GPR87 protein expression. Ribozymes useful for inhibiting the expression of a target molecule may be designed by incorporating target sequences into the basic ribozyme structure which are complementary, for example, to the mRNA sequence encoding GPR87. Riboz mes are antisense RNAs which have a catalytic site capable of specifically cleaving complementary RNAs. Therefore, ribozymes having sequence complementary to GPR87 mRNA sequences are capable of downregulating the expression of GPR87 by reduces the level of GPR87 mRNA. Ribozymes targeting GPR87 may be synthesized using commercially available reagents (Applied Biosystems, Inc., Foster City, CA) or they may be genetically expressed from DNA encoding them. In some embodiments, the DNA encoding the ribozymes are incorporated in a vector, which is described in the ‘'Vector” section elsewhere in the instant specification.

[0133] Downregulating GPR87 by CRISPR knockout / knockdown and other knockouts / knockdown techniques

[0134] In some embodiments, the compound that downregulates the activity or expression level of GPR87 comprises a nucleic acid that downregulates the expression level of GPR87 by the means of CRISPR knockout.

[0135] In some embodiments, the compound downregulates the activity or expression level of GPR87 comprises a CRISPR / Cas9 system for knocking out GPR87.

[0136] The CRISPR / Cas9 system is a facile and efficient system for inducing targeted genetic alterations. Target recognition by the Cas9 protein requires a “seed” sequence within the guide RNA (gRNA) and a conserved di -nucleotide containing protospacer adjacent motif (PAM) sequence upstream of the gRNA-binding region. The CRISPR / Cas9 system can thereby be engineered to cleave virtually any DNA sequence by redesigning the gRNA in cell lines (such as 293T cells), primary cells, and CAR T cells. The CRISPR / Cas9 system can simultaneously target multiple genomic loci by co-expressing a single Cas9 protein with two or more gRNAs, making this system uniquely suited for multiple gene editing or synergistic activation of target genes.

[0137] The Cas9 protein and guide RNA form a complex that identifies and cleaves target sequences. Cas9 is comprised of six domains: REC I, REC II, Bridge Helix, PAM interacting, HNH, and RuvC. The Red domain binds the guide RNA, while the Bridge helix binds to target DNA. The HNH and RuvC domains are nuclease domains. Guide RNA is engineered to have a 5’ end that is complementary to the target DNA sequence. Upon binding of the guide RNA to the Cas9 protein, a conformational change occurs activating the protein. Once activated, Cas9 searches for target DNA by binding to sequences that match its protospacer adjacent motif (PAM) sequence. A PAM is a two or three nucleotide base sequence within one nucleotide downstream of the region complementary to the guide RNA. In one nonlimiting example, the PAM sequence is 5’-NGG-3’. When the Cas9 protein finds its target sequence with the appropriate PAM, it melts the bases upstream of the PAM and pairs them with the complementary region on the guide RNA. Then the RuvC and HNH nuclease domains cut the target DNA after the third nucleotide base upstream of the PAM.

[0138] One non-limiting example of a CRISPR / Cas system used to inhibit gene expression, CRISPRi, is described in U. S. Patent Appl. Publ. No. US2014 / 0068797. CRISPRi induces permanent gene disruption that utilizes the RNA-guided Cas9 endonuclease to introduce DNA double stranded breaks which trigger error-prone repair pathways to result in frame shift mutations. A catalytically dead Cas9 lacks endonuclease activity. When coexpressed with a guide RNA, a DNA recognition complex is generated that specifically interferes with transcriptional elongation, RNA polymerase binding, or transcription factor binding. This CRISPRi system efficiently represses expression of targeted genes.

[0139] CRISPR / Cas gene disruption occurs when a guide nucleic acid sequence specific for a target gene and a Cas endonuclease are introduced into a cell and form a complex that enables the Cas endonuclease to introduce a double strand break at the target gene. In certain embodiments, the CRISPR / Cas system comprises an expression vector, such as, but not limited to, an pAd5F35-CRISPR vector. In other embodiments, the Cas expression vector induces expression of Cas9 endonuclease. Other endonucleases may also be used, including but not limited to, T7, Cas3, Cas8a, Cas8b, CaslOd, Csel, Csyl, Csn2, Cas4, CaslO, Csm2, Cmr5, Fokl, other nucleases know n in the art. and any combinations thereof.

[0140] In certain embodiments, inducing the Cas expression vector comprises exposing the cell to an agent that activates an inducible promoter in the Cas expression vector. In such embodiments, the Cas expression vector includes an inducible promoter, such as one that is inducible by exposure to an antibiotic (e.g., by tetracycline or a derivative of tetracycline, for example doxycycline). However, it should be appreciated that other inducible promoters can be used. The inducing agent can be a selective condition (e.g., exposure to an agent, for example an antibiotic) that results in induction of the inducible promoter. This results in expression of the Cas expression vector.

[0141] In certain embodiments, guide RNA(s) and Cas9 can be delivered to a cell as a ribonucleoprotein (RNP) complex. RNPs are comprised of purified Cas9 protein complexed with gRNA and are well known in the art to be efficiently delivered to multiple types of cells, including but not limited to neurons, stem cells and immune cells (Addgene, Cambridge, MA, Minis Bio LLC, Madison, WI).

[0142] The guide RNA is specific for a genomic region of interest and targets that region for Cas endonuclease-induced double strand breaks. The target sequence of the guide RNA sequence may be within a loci of a gene or within a non-coding region of the genome. In certain embodiments, the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32. 33. 34. 35. 36, 37, 38, 39, 40 or more nucleotides in length. Guide RNA (gRNA), also referred to as “short guide RNA” or “sgRNA”, provides both targeting specificity and scaffolding / binding ability for the Cas9 nuclease. The gRNA can be a synthetic RNA composed of a targeting sequence and scaffold sequence derived from endogenous bacterial crRNA and tracrRNA. gRNA is used to target Cas9 to a specific genomic locus in genome engineering experiments. Guide RNAs can be designed using standard tools well known in the art.

[0143] In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have some complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In certain embodiments, a target sequence is in the nucleus or cytoplasm of a cell. In other embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or nucleus. Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g., within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs) the target sequence. As with the target sequence, it is believed that complete complementarity is not needed, provided this is sufficient to be functional.

[0144] In certain embodiments, one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell, such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulator}7elements may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5’ with respect to (“upstream” of) or 3’ with respect to ("dow nstream" of) a second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In certain embodiments, a single promoter drives expression of a transcript encoding a CRISPR enzyme and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g.. each in a different intron, two or more in at least one intron, or all in a single intron).

[0145] In certain embodiments, the CRISPR enzy me is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme). A CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally' a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity' and nucleic acid binding activity. Additional domains that may form part of a fusion protein comprising a CRISPR enzy me are described in U. S. Patent Appl. Publ. No. US20110059502, incorporated herein by reference. In certain embodiments, a tagged CRISPR enzyme is used to identify the location of a target sequence.

[0146] Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian and non-mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery' vehicle, such as a liposome. Viral vector delivery' systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell (Anderson, 1992, Science 256:808-813; and Yu, et al., 1994, Gene Therapy 1:13-26).

[0147] In certain embodiments, the CRISPR / Cas is derived from a ty pe II CRISPR / Cas system. In other embodiments, the CRISPR / Cas system is derived from a Cas9 protein. The Cas9 protein can be from Streptococcus pyogenes, Streptococcus thermophilus, or other species.

[0148] In general, Cas proteins comprise at least one RNA recognition and / or RNA binding domain. RNA recognition and / or RNA binding domains interact with the guiding RNA. Cas proteins can also comprise nuclease domains (i.e., DNase or RNase domains), DNA binding domains, helicase domains, RNAse domains, protein-protein interaction domains, dimerization domains, as well as other domains. The Cas proteins can be modified to increase nucleic acid binding affinity and / or specificity, alter an enzy matic activity', and / or change another property of the protein. In certain embodiments, the Cas-like protein of the fusion protein can be derived from a wild type Cas9 protein or fragment thereof. In other embodiments, the Cas can be derived from modified Cas9 protein. For example, the amino acid sequence of the Cas9 protein can be modified to alter one or more properties (e.g., nuclease activity, affinity’, stability, and so forth) of the protein. Alternatively, domains of the Cas9 protein not involved in RNA-guided cleavage can be eliminated from the protein such that the modified Cas9 protein is smaller than the wild type Cas9 protein. In general, a Cas9 protein comprises at least two nuclease (i.e., DNase) domains. For example, a Cas9 protein can comprise aRuvC-like nuclease domain and aHNH-like nuclease domain. The RuvC and HNH domains work together to cut single strands to make a double-stranded break in DNA. (Jinek, et al., 2012, Science, 337:816-821). In certain embodiments, the Cas9-derived protein can be modified to contain only one functional nuclease domain (either a RuvC-like or a HNH-like nuclease domain). For example, the Cas9-derived protein can be modified such that one of the nuclease domains is deleted or mutated such that it is no longer functional (i.e., the nuclease activity is absent). In some embodiments in which one of the nuclease domains is inactive, the Cas9-derived protein is able to introduce a nick into a doublestranded nucleic acid (such protein is termed a “nickase”), but not cleave the double-stranded DNA. In any of the above-described embodiments, any or all of the nuclease domains can be inactivated by one or more deletion mutations, insertion mutations, and / or substitution mutations using well-known methods, such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis, as well as other methods known in the art.

[0149] In one non-limiting embodiment, a vector drives the expression of the CRISPR system. The art is replete with suitable vectors that are useful in the instant specification. The vectors to be used are suitable for replication and, optionally, integration in eukaryotic cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence. The vectors of the instant specification may also be used for nucleic acid standard gene delivery protocols. Methods for gene delivery are known in the art (U. S. Patent Nos. 5,399,346. 5,580,859 & 5,589,466, incorporated by' reference herein in their entireties).

[0150] Further, the vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (4thEdition, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 2012), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, Sindbis virus, gammaretrovirus and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (e.g., WO 01 / 96584; WO 01 / 29058; and U. S. Patent No. 6,326,193).

[0151] In some embodiments, the compound that downregulates the activity or expression level of GPR87 comprises a nucleic acid that downregulates the expression level of GPR87 by the means of CRISPR knockdown. CRISPR knockdown includes, but not limited to, CRISPRCasl3 knockdown. (See e.g., Mendez-Mancilla et al., Cell Chemical Biology 29, 1-7, 2021 Jul l ' l, and Kushawah et al., Dev Cell. 2020 Sep 28;54(6):805-817. The entireties of which are incorporated herein by reference).

[0152] In some embodiments, the present invention includes any other methods for effecting gene knockdown and / editing, which allow for deletion and / or inactivation of GPR87 such as but not limited to those described in WO 2018 / 236840 (which is incorporated herein in its entirety by reference).

[0153] Downregulating GPR87 by inactivating and / or sequestering

[0154] In some embodiments, the compound that dow nregulates the activity or expression level of GPR87 includes a protein that downregulates the activity of GPR87 by inactivating and / or sequestering GPR87. In some embodiment, the compound includes a nucleic acid that express the protein that downregulates the activity of GPR87 by inactivating and / or sequestering GPR87. In some embodiments, the compound includes an expression vector that express the protein that downregulates the activity of GPR87 by inactivating and / or sequestering GPR87 (see ‘“Vector” section for descriptions on vectors).

[0155] In some embodiments, the compound that downregulates the expression level of GPR87 is a trans-dominant negative mutant of GPR87, and / or a nucleic acid or a vector expressing the trans-dominant negative mutant of GPR87.

[0156] Compositions and Kits

[0157] In some aspects, the present invention is directed to compositions and / or kits.

[0158] In some embodiments, the composition or kit herein is suitable for carrying out the methods herein.

[0159] In some embodiments, the composition comprises the compound for downregulating GPR87 herein, as well as a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is described elsewhere herein.

[0160] In some embodiments, the composition herein is a pharmaceutical composition. In some embodiments, the kit herein comprises the compound for downregulating GPR87 herein or the composition herein, as well as an instruction manual.

[0161] In some embodiments, the instruction manual instructs that the compound or composition herein is to be administered to a subject suffering from a fibrotic disease in an effective amount to treat, ameliorate, and / or prevent the fibrotic disease.

[0162] In some embodiments, the fibrotic disease is a pulmonary fibrosis.

[0163] In some embodiments, the fibrotic disease is idiopathic pulmonary fibrosis (IPF).

[0164] Vectors

[0165] Vectors can increase the stability7of the nucleic acids, make the delivery easier, or allow the expression of the nucleic acids or protein products thereof in the cells.

[0166] Therefore, in some embodiments, the protein inhibitors or the nucleic acids that that modulates the activity or expression level of GPR87 is incorporated into a vector.

[0167] In some embodiments, the instant specification relates to a vector, including the nucleic acid sequence of the instant specification or the construct of the instant specification. The choice of the vector will depend on the host cell in which it is to be subsequently introduced. In certain embodiments, the vector of the instant specification is an expression vector. Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. In certain embodiments, the expression vector is selected from the group consisting of a viral vector, a bacterial vector and a mammalian cell vector. Prokary ote- and / or eukaryote-vector based systems can be employed for use with the instant specification to produce polynucleotide, or their cognate polypeptides. Many such systems are commercially and widely available.

[0168] In some embodiments, the vector is a viral vector. Viral vector technology is w ell known in the art and is described, for example, in virology and molecular biology' manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers. (See, e.g., WO 01 / 96584; WO 01 / 29058; and U. S. Patent No. 6,326,193.

[0169] In some embodiments, the viral vector is a suitable adeno-associated virus (AAV), such as the AAV1-AAV8 family of adeno-associated viruses. In some embodiments, the viral vector is a viral vector that can infect a human. The desired nucleic acid sequence, such as the nucleic acids that modulate GPR87 described above, can be inserted between the inverted terminal repeats (ITRs) in the AAV. In various embodiments, the viral vector is an AAV2 or an AAV8. The promoter can be a thyroxine binding globulin (TBG) promoter. The AAV can be a recombinant AAV, in which the capsid comes from one AAV serotype and the ITRs come from another AAV serotype. In various embodiments, the AAV capsid is selected from the group consisting of a AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, and a AAV8 capsid. In various embodiments, the ITR in the AAV is at least one ITR selected from the group consisting of a AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, and an AAV8 ITR. In various embodiments, the instant specification contemplates an AAV 8 viral vector (recombinant or non-recombinant) containing a desired nucleic acid expression sequence and at least one promoter sequence that, when administered to a subject, causes elevated systemic expression of the desired nucleic acid. In some embodiments, the viral vector is a recombinant or non-recombinant AAV2 or AAV5 containing any of the desired nucleic acid expression sequences described herein.

[0170] In some embodiments, the vector in which the nucleic acid sequence is introduced is a plasmid that is or is not integrated in the genome of a host cell when it is introduced in the cell. Illustrative, non-limiting examples of vectors in which the nucleotide sequence of the instant specification or the gene construct of the instant specification can be inserted include a tet-on inducible vector for expression in eukaryote cells.

[0171] The vector may be obtained by conventional methods known by persons skilled in the art. In certain embodiments, the vector is a vector useful for transforming animal cells.

[0172] In certain embodiments, the recombinant expression vectors may also contain nucleic acid molecules which encode a peptide or peptidomimetic inhibitor of the instant specification, described elsewhere herein.

[0173] A promoter may be one naturally associated with a gene or polynucleotide sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and / or exon. Such a promoter can be referred to as “endogenous.” Similarly, an enhancer may be one naturally associated with a polynucleotide sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding polynucleotide segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a polynucleotide sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a polynucleotide sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not “naturally occurring,” i.e., containing different elements of different transcriptional regulatory regions, and / or mutations that alter expression. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and / or nucleic acid amplification technology, including PCR™, in connection with the compositions disclosed herein (U. S. Patent No. 4,683,202, U. S. Patent No. 5,928,906). Furthermore, it is contemplated the control sequences that direct transcription and / or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.

[0174] It will be important to employ a promoter and / or enhancer that effectively directs the expression of the DNA segment in the cell ty pe, organelle, and organism chosen for expression. Those of skill in the art of molecular biology generally know how to use promoters, enhancers, and cell type combinations for protein expression. The promoters employed may be constitutive, tissue-specific, inducible, and / or useful under the appropriate conditions to direct high-level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and / or peptides. The promoter may be heterologous or endogenous.

[0175] The recombinant expression vectors may also contain a selectable marker gene which facilitates the selection of transformed or transfected host cells. Suitable selectable marker genes are genes encoding proteins such as G418 and hygromycin which confer resistance to certain drugs, 0-galactosidase, chloramphenicol acetyltransferase, firefly luciferase, or an immunoglobulin or portion thereof such as the Fc portion of an immunoglobulin preferably IgG. The selectable markers may be introduced on a separate vector from the nucleic acid of interest.

[0176] Combination Therapies

[0177] In some embodiments, the method of treating, ameliorating, and / or preventing fibrotic diseases includes administering to the subject the effective amount of at least one compound and / or composition contemplated within the disclosure.

[0178] In some embodiments, the composition for treating fibrotic diseases includes at least one compound and / or composition contemplated within the disclosure. In some embodiments, the subject is further administered at least one additional agent that treats, ameliorates, and / or prevents a disease and / or disorder contemplated herein. In other embodiments, the compound and the at least one additional agent are co-administered to the subj ect. In yet other embodiments, the compound and the at least one additional agent are co-formulated.

[0179] The compounds contemplated within the disclosure are intended to be useful in combination with one or more additional compounds. These additional compounds may comprise compounds of the present disclosure and / or at least one additional agent for treating fibrotic diseases, and / or at least one additional agent that treats one or more diseases or disorders contemplated herein.

[0180] A synergistic effect may be calculated, for example, using suitable methods such as, for example, the Sigmoid-Emax equation (Holford & Scheiner, 1981, Clin. Pharmacokinet. 6:429-453), the equation of Loewe additivity (Loewe & Muischnek, 1926, Arch. Exp. Pathol Pharmacol. 114:313-326) and the median-effect equation (Chou & Talalay, 1984, Adv.

[0181] Enzyme Regul. 22:27-55). Each equation referred to above may be applied to experimental data to generate a corresponding graph to aid in assessing the effects of the drug combination. The corresponding graphs associated with the equations referred to above are the concentration-effect curve, isobologram curve and combination index curve, respectively.

[0182] Administration / Dosage / Formulations

[0183] The regimen of administration may affect what constitutes an effective amount. The therapeutic formulations contemplated within the disclosure may be administered to the subject either prior to or after the onset of a disease and / or disorder contemplated herein. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages of the therapeutic formulations contemplated within the disclosure may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.

[0184] Administration of the compositions contemplated within the disclosure to a patient, preferably a mammal, more preferably a human, may be carried out using known procedures, at dosages and for periods of time effective to treat a disease and / or disorder contemplated herein in the patient. An effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary according to factors such as the state of the disease or disorder in the patient; the age, sex, and weight of the patient; and the ability of the therapeutic compound contemplated within the disclosure to treat a disease and / or disorder contemplated herein in the patient. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A nonlimiting example of an effective dose range for a therapeutic compound contemplated within the disclosure is from about 1 and 5,000 mg / kg of body weight / per day. One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation.

[0185] Actual dosage levels of the active ingredients in the pharmaceutical compositions contemplated within the disclosure may be varied to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

[0186] In particular, the selected dosage level depends upon a variety’ of factors including the activity of the particular compound employed, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds or materials used in combination with the compound, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well, known in the medical arts.

[0187] A medical doctor, e.g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds contemplated within the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

[0188] In particular embodiments, it is especially advantageous to formulate the compound in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary' dosages for the patients to be treated: each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The dosage unit forms contemplated within the disclosure are dictated by’ and directly dependent on (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding / formulating such a therapeutic compound for the treatment of a disease and / or disorder contemplated herein. In certain embodiments, the compositions of the disclosure are formulated using one or more pharmaceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions of the disclosure comprise a therapeutically effective amount of a compound of the disclosure and a pharmaceutically acceptable carrier.

[0189] The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars, sodium chloride, or poly alcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.

[0190] In certain embodiments, the compositions of the disclosure are administered to the patient in dosages that range from one to five times per day or more. In another embodiment, the compositions of the disclosure are administered to the patient in range of dosages that include, but are not limited to, once every day, every two. days, every three days to once a week, and once every two weeks. It is readily apparent to one skilled in the art that the frequency of administration of the various combination compositions of the disclosure varies from individual to individual depending on many factors including, but not limited to, age, disease or disorder to be treated, gender, overall health, and other factors. Thus, the disclosure should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient is determined by the attending physical taking all other factors about the patient into account.

[0191] Compounds of the disclosure for administration may be in the range of from about 1 pg to about 10.000 mg, about 20 pg to about 9,500 mg, about 40 pg to about 9.000 mg, about 75 pg to about 8,500 mg, about 150 pg to about 7,500 mg, about 200 pg to about 7,000 mg, about 3050 pg to about 6,000 mg, about 500 pg to about 5,000 mg, about 750 pg to about 4,000 mg, about 1 mg to about 3,000 mg, about 10 mg to about 2,500 mg, about 20 mg to about 2,000 mg, about 25 mg to about 1,500 mg, about 30 mg to about 1,000 mg, about 40 mg to about 900 mg. about 50 mg to about 800 mg, about 60 mg to about 750 mg, about 70 mg to about 600 mg, about 80 mg to about 500 mg, and any and all whole or partial increments therebetween.

[0192] In some embodiments, the dose of a compound of the disclosure is from about 1 mg and about 2,500 mg. In some embodiments, a dose of a compound of the disclosure used in compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg. or less than about 500 mg. or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, a dose of a second compound as described herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof.

[0193] In certain embodiments, the present disclosure is directed to a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of a compound of the disclosure, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or reduce one or more symptoms of the fibrotic disease in a patient.

[0194] Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for intracranially, intrathecal, oral, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, known to the art. The pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g, lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring and / or aromatic substances and the like. They may also be combined where desired with other active agents, e.g., other analgesic agents.

[0195] Routes of administration of any of the compositions of the disclosure include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical. The compounds for use in the disclosure may be formulated for administration by any suitable route, such as for oral or parenteral, for example, transdermal, transmucosal (e.g., sublingual, lingual, (trans)buccal, (trans )urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal and (trans)rectal), intravesical, intrapulmonary. intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.

[0196] Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry' powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration and the like. It should be understood that the formulations and compositions that would be useful in the present disclosure are not limited to the particular formulations and compositions that are described herein.

[0197] Oral Administration

[0198] For oral application, particularly suitable are tablets, dragees, liquids, drops, suppositories, or capsules, caplets and gelcaps. The compositions intended for oral use may be prepared according to any method known in the art and such compositions may contain one or more agents selected from the group consisting of inert, non-toxic pharmaceutically excipients that are suitable for the manufacture of tablets. Such excipients include, for example an inert diluent such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricating agents such as magnesium stearate. The tablets may be uncoated or they may be coated by known techniques for elegance or to delay the release of the active ingredients. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert diluent.

[0199] For oral administration, the compounds of the disclosure may be in the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., polyvinylpyrrolidone, hydroxypropylcellulose or hydroxypropylmethylcellulose); fdlers (e.g, cornstarch, lactose, microcrystalline cellulose or calcium phosphate); lubricants (e.g, magnesium stearate, talc, or silica); disintegrates (e.g, sodium starch gly collate); or wetting agents (e.g, sodium lauryl sulphate). If desired, the tablets may be coated using suitable methods and coating materials such as OPADRY™ fdm coating systems available from Colorcon, West Point. Pa. (e.g, OPADRY™ OY Type, OYC Type, Organic Enteric OY-P Type, Aqueous Enteric OY-A Type, OY-PM Type and OPADRY™ White, 32K18400). Liquid preparation for oral administration may be in the form of solutions, syrups or suspensions. The liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g, sorbitol syrup, methyl cellulose or hydrogenated edible fats); emulsifying agent (e.g, lecithin or acacia); non-aqueous vehicles (e.g, almond oil, oily esters or ethyl alcohol); and preservatives (e.g., methyl or propyl p-hydroxy benzoates or sorbic acid).

[0200] The present disclosure also includes a multi-layer tablet comprising a layer providing for the delayed release of one or more compounds of the disclosure, and a further layer providing for the immediate release of another medication. Using a wax / pH-sensitive polymer mix, a gastric insoluble composition may be obtained in which the active ingredient is entrapped, ensuring its delayed release.

[0201] Parenteral Administration

[0202] For parenteral administration, the compounds of the disclosure may be formulated for injection or infusion, for example, intravenous, intramuscular or subcutaneous injection or infusion, or for administration in a bolus dose and / or continuous infusion. Suspensions, solutions or emulsions in an oily or aqueous vehicle, optionally containing other formulatory agents such as suspending, stabilizing and / or dispersing agents may be used.

[0203] Additional Administration Forms

[0204] Additional dosage forms of this disclosure include dosage forms as described in U. S. Patents Nos. 6.340,475; 6,488.962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790.

[0205] Additional dosage forms of this disclosure also include dosage forms as descnbed in U. S. Patent Applications Nos. 20030147952; 20030104062; 20030104053; 20030044466;

[0206] 20030039688; and 20020051820. Additional dosage forms of this disclosure also include dosage forms as described in PCT Applications Nos. WO 03 / 35041; WO 03 / 35040; WO 03 / 35029; WO 03 / 35177; WO 03 / 35039; WO 02 / 96404; WO 02 / 32416; WO 01 / 97783; WO 01 / 56544; WO 01 / 32217; WO 98 / 55107; WO 98 / 11879; WO 97 / 47285; WO 93 / 18755; and WO 90 / 11757.

[0207] Controlled Release Formulations and Drug Delivery Systems

[0208] In certain embodiments, the formulations of the present disclosure may be, but are not limited to, short-term, rapid-offset, as well as controlled, for example, sustained release, delayed release and pulsatile release formulations.

[0209] The term sustained release is used in its conventional sense to refer to a drug formulation that provides for gradual release of a drug over an extended period of time, and that may, although not necessarily, result in substantially constant blood levels of a drug over an extended time period. The period of time may be as long as a month or more and should be a release which is longer that the same amount of agent administered in bolus form.

[0210] For sustained release, the compounds may be formulated with a suitable polymer or hydrophobic material which provides sustained release properties to the compounds. As such, the compounds for use the method of the disclosure may be administered in the form of microparticles, for example, by injection or in the form of wafers or discs by implantation. In certain embodiments of the disclosure, the compounds of the disclosure are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation.

[0211] The term delayed release is used herein in its conventional sense to refer to a drug formulation that provides for an initial release of the drug after some delay following drug administration and that mat, although not necessarily, includes a delay of from about 10 minutes up to about 12 hours.

[0212] The term pulsatile release is used herein in its conventional sense to refer to a drug formulation that provides release of the drug in such a way as to produce pulsed plasma profiles of the drug after drug administration.

[0213] The term immediate release is used in its conventional sense to refer to a drug formulation that provides for release of the drug immediately after drug administration.

[0214] As used herein, short-term refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes and any or all whole or partial increments thereof after drug administration after drug administration.

[0215] As used herein, rapid-offset refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes, and any and all whole or partial increments thereof after drug administration.

[0216] Dosing

[0217] The therapeutically effective amount or dose of a compound of the present disclosure depends on the age, sex and weight of the patient, the current medical condition of the patient and the progression of the fibrotic disease in the patient being treated. The skilled artisan is able to determine appropriate dosages depending on these and other factors.

[0218] A suitable dose of a compound of the present disclosure may be in the range of from about 0.01 mg to about 5,000 mg per day, such as from about 0.1 mg to about 1,000 mg, for example, from about 1 mg to about 500 mg, such as about 5 mg to about 250 mg per day. The dose may be administered in a single dosage or in multiple dosages, for example from 1 to 4 or more times per day. When multiple dosages are used, the amount of each dosage may be the same or different. For example, a dose of 1 mg per day may be administered as two 0.5 mg doses, with about a 12-hour interval between doses. It is understood that the amount of compound dosed per day may be administered, in non-limiting examples, every day. every other day, every 2 days, every 3 days, every 4 days, or every 5 days. For example, with every other day administration, a 5 mg per day dose may be initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on.

[0219] In the case wherein the patient’s status does improve, upon the doctor’s discretion the administration of the modulator of the disclosure is optionally given continuously; alternatively, the dose of drug being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a “drug holiday’’). The length of the drug holiday optionally varies between 2 days and 1 year, including by way of example only, 2 days, 3 days. 4 days. 5 days. 6 days, 7 days, 10 days, 12 days. 15 days, 20 days, 28 days. 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday includes from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%. 70%, 75%. 80%. 85%. 90%. 95%. or 100%.

[0220] Once improvement of the patient’s conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, is reduced, as a function of the patient’s condition, to a level at which the improved disease is retained. In certain embodiments, patients require intermittent treatment on a longterm basis upon any recurrence of symptoms and / or infection.

[0221] The compounds for use in the method of the disclosure may be formulated in unit dosage form. The term “unit dosage form” refers to physically discrete units suitable as unitary dosage for patients undergoing treatment, with each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier. The unit dosage form may be for a single daily dose or one of multiple daily doses (e.g., about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose.

[0222] Toxicity and therapeutic efficacy of such therapeutic regimens are optionally determined in cell cultures or experimental animals, including, but not limited to, the determination of the LDso (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50 and ED50. Capsid assembly modulators exhibiting high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies are optionally used in formulating a range of dosage for use in human. The dosage of such capsid assembly modulators lies preferably within a range of circulating concentrations that include the EDso with minimal toxicity. The dosage optionally varies within this range depending upon the dosage form employed and the route of administration utilized.

[0223] Those skilled in the art recognizes, or is able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents were considered to be within the scope of this disclosure and covered by the claims appended hereto. For example, it should be understood, that modifications in assay and / or reaction conditions, with art-recognized alternatives and using no more than routine experimentation, are within the scope of the present application.

[0224] It is to be understood that wherever values and ranges are provided herein, all values and ranges encompassed by these values and ranges, are meant to be encompassed within the scope of the present disclosure. Moreover, all values that fall within these ranges, as well as the upper or lower limits of a range of values, are also contemplated by the present application.

[0225] Delivery

[0226] In certain embodiments, the compound contemplated herein (including but not limited to nucleic acids) can be more efficiently delivered to the cell nucleus by coupling the compound with the monoclonal anti-DNA antibody 3E10, which penetrates living cells and localizes in the nucleus without causing any apparent harm to the cell (Hansen JE, et al., Intranuclear protein transduction through a nucleoside salvage pathway. J Biol Chem 2007;282:20790-3; see also WO 2020 / 047353 and WO 2021 / 042060, all of which are incorporated herein in their entireties by reference). 3E10 and its single-chain variable fragment (3E10 scFv) have been developed as an intracellular delivery system for macromolecules. After localizing in the cell nucleus, 3E10 scFv is largely degraded within 4 hours, thus further minimizing any potential toxicity.

[0227] In certain embodiments, the compounds contemplated herein (including but not limited to nucleic acids) can be more efficiently delivered to the central nervous system using certain lipid nanoparticle formulations know n in the art, such as but not limited to those described in Cullis, P. R. et al., Molecular Therapy Vol. 25 No 7 July 2017. See also US20150165039 and WO 2014 / 008334, all of which are incorporated herein in their entireties by reference. In certain embodiments, the compounds contemplated herein can be more efficiently delivered to tissue by coupling with certain protein fragments, called 'pHLIP " (pH (Low) Insertion Peptide), which allow for the cargo to accumulate in acidic environments within the body. In certain embodiments, a polypeptide with a predominantly hydrophobic sequence long enough to span a membrane lipid bilayer as a transmembrane helix (TM) and comprising one or more dissociable groups inserts across a membrane spontaneously in a pH-dependent fashion placing one terminus inside cell. The polypeptide conjugated with various functional moieties delivers and accumulates them at cell membrane with low extracellular pH. The functional moiety conjugated with polypeptide terminus placed inside cell are translocated through the cell membrane in cytosol. The peptide and its variants or nonpeptide analogs can be used to deliver therapeutic, prophylactic, diagnostic, imaging, gene regulation, cell regulation, or immunologic agents to or inside of cells in vitro or in vivo in tissue at low extracellular pH. See also US20080233107, WO2012 / 021790, US20120039990, US20120142042, US20150051153, US20150086617, and US20150191508, all of which are incorporated herein in their entireties by reference.

[0228] Examples

[0229] The instant specification further describes in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless so specified. Thus, the instant specification should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

[0230] Example 1-1: The role of GPR87 in pulmonary fibrosis

[0231] G-protein coupled receptor 87 (GPR87), an alternative lysophosphatidic acid (LPA) receptor implicated in cancer, is highly expressed in basal and aberrant basaloid cells in idiopathic pulmonary’ fibrosis (IPF). The present study sought to determine whether signaling through GPR87 is important to the development of pulmonary fibrosis.

[0232] In the study described herein, analysis of bulk and single cell RNA sequencing dataset was performed to confirm the increased expression of GPR87 in pulmonary’ fibrosis. The role of GPR87 in fibrosis in-vivo was assessed using global GPR87 knockout (GPR87 / _) and wildtype mice in the bleomycin model of pulmonary fibrosis, in-vitro in induced pluripotent stem cells (iPSCs) derived airway basal cells (iBC) using GPR87 siRNAs, and ex-vivo in human precision cut slices using disease free tissues in the fibrotic cocktail model as well as IPF tissues treated with GPR87 siRNA.

[0233] The present study demonstrates that GPR87 is highly expressed in IPF lungs, and its expression correlates with disease severity. Furthermore, it is highly expressed in basal and aberrant basaloid cells. GPR87" ' mice are protected against bleomy cin induced pulmonary fibrosis. GPR87 knockdown is protective against fibrosis development in normal PCLS treated with fibrotic cocktail and leads to fibrosis regression in IPF PCLS. In iBC, GPR87 knockdown leads to decreased expression of fibrosis related genes, proteins and microRNAs. GPR87 stimulation with LPA leads to the opposite results. The main downstream pathways are PI3K, mTOR, and TNF / NFkB; stimulation or inhibition of PI3K pathway mimics GPR87 stimulation or inhibition responses, respectively.

[0234] GPR87 is highly expressed in basal and aberrant basaloid cells in IPF lungs and seems to mediate profibrotic effects based on in-vivo, ex-vivo and in-vitro models of disease, suggesting that it should be studied as a potential epithelial specific therapeutic target in pulmonary fibrosis.

[0235] Example 1-2:

[0236] Idiopathic pulmonary fibrosis (IPF) is a chronic, fatal, progressive disease, characterized by aberrant wound healing caused by repetitive alveolar epithelial cell injury and excessive deposition of extracellular matrix proteins in the interstitial space of the lung. Furthermore, pulmonary fibrosis (PF) is a common final pathway of multiple primary and secondary pulmonary diseases, such as connective-tissue disease-related interstitial lung diseases, pneumoconiosis and irradiation exposure. Median survival of IPF is 3-5 years after initial diagnosis, while incidence continues to rise. Currently, there are no proven curative treatments for PF. Previously, multicenter randomized clinical trials showed promising results for two drugs, pirfenidone and nintedanib, in slowing dow n disease progression. However, neither drug improves lung function and, in the best case, patients are left significant pulmonary disability.

[0237] Growing evidence supports the role of aberrant and ectopic epithelial cells in the development of pulmonary fibrosis. Aberrant basaloid cells (AbBaC) localize to the edge of fibroblastic foci in the IPF lung. These cells express basal cell markers such as P63 and KRT17, but not KRT5, however; co-express known makers and regulators of fibrosis such as ITGB6, MMP7, senescence markers such as CDKN2A and CDKN2B, and epithelial-mesenchymal transition (EMT) markers such as CDH2, COL 1 Al, and HMGA2. Because of the location and their gene expression, these cells are thought to have a role in the development of PF. IPF distal airway basal cells (ABC), unlike AbBaC, carry the canonical basal cell markers, but are also strongly implicated in the pathogenesis of IPF. Cultured IPF ABC from lesions mimicking human pulmonary fibrosis in organoid models when installed into the lungs of immunosuppressed mice. ABC signature in the transcriptome of bronchoalveolar lavage is associate with more severe outcome.

[0238] The present study focuses on G Protein-Coupled Receptor 87 (GPR87). a lysophosphatidic acid (LPA) receptor expressed in ABC, and AbBaC in IPF and also expressed in lung, pancreas and urethral epithelial tumors. Rare variants of GPR87 (p. X359E and c.842-845del) were segregated in two small kindreds with familial pulmonary fibrosis, suggesting it was a disease-causing variant.

[0239] Based on GPR87’s expression in epithelial cells in human pulmonary fibrosis, it’s association with familial pulmonary fibrosis and the interest in targeting LPA and its receptors in pulmonary fibrosis the present study studied the role of GPR87 in pulmonary7fibrosis. The present study found that in humans, GPR87 is highly expressed in ABC or AbBaC in the IPF lung but is rarely found in the disease-free lung, and its expression is associated with more severe disease; in models of fibrosis, including in-vitro stimulation of epithelial cells, ex-vivo induction of fibrosis of human precision cut lung slices (PCLS), and in-vivo in mice, GPR87 was invariably highly expressed; gain of function experiments had profibrotic effects and loss of function experiments in-vitro, in-vivo and ex-vivo blunted fibrosis.

[0240] Example 1-3: Materials and Methods

[0241] Measuring GPR87 gene expression in human lung samples

[0242] Correlation between GPR87 expression and pulmonary function tests: Gene expression data for the GPR87 gene was extracted from the publicly available Lung Genomics Research Consortium (LGRC) data at the probe-level from the Agilent-014850 Whole Human Genome Microarray 4x44K G4112F (Agilent, Santa Clara, CA). Data from individuals with idiopathic pulmonary fibrosis (IPF) and controls, including forced vital capacity (FVC) and carbon monoxide diffusion capacity (DLCO) were used for this analysis. The gene expression data is available on the Gene Expression Omnibus (GEO) database (www dot ncbi dot nlm dot nih dot gov / geo / ) under the accession number GSE47460.

[0243] Differential expression was calculated using linear mixed-effects models for each IPF group with an FDR-adjusted P < 0.05 considered significant for gene expression. Correlation between GPR87 expression and surface density: Expression data was extracted from McDonough et al. (JCI Insight 4 (2019)). RNA-seq dataset (NCBI’s GEO GSE124685), that analyzed 95 samples, obtained from 10 IPF lungs and 6 controls.

[0244] Correlation with extent of fibrosis in each sample was assessed by microCT-measured alveolar surface density (ASD) that accurately reflects tissue histology7.

[0245] scRNAseq Data Acquisition and Processing

[0246] Raw scRNAseq data from two datasets: Adams et al. (Sei Adv 6, eabal983 (2020)) and Habermann et al. (Sci Adv 6, eabal972 (2020)) were downloaded from GEO (GSE136831 and GSE135893, respectively). Cutadapt was used to trim the following read 2 contaminants: 5-prime terminally anchored TSO and 3-prime terminally poly(A) in the 10X 3’ v2 assayed samples from Adams et al.,' 5-prime terminal RT-primer and 3 -prime-terminal poly(T) from the 10X 5’ vl assayed samples from Habermann et al. After trimming, reads were mapped using STARsolo (version 2.7.6a) to GRCh38 using GENCODE annotation release; cell barcode parameters were adjusted accordingly for samples from each dataset based on their respective 10X assay. Gene expression count’s from STAR’S ‘GeneFull’ output were used for downstream analysis.

[0247] scRNAseq Analysis

[0248] Analysis was performed in R (version 4.3.3) using the package Seurat (version 4.4.0). Cells from each dataset classified as epithelial in their original analyses were isolated; data integration between the two datasets was performed with the Seurat’s reciprocal PCA (rPCA) implementation prior to UMAP embedding and cluster analysis. Cell types were collectively reclassified and a gene expression heatmap was created to demonstrate the reproducibility of the updated classifications across samples from both datasets; heatmap data was scaled independently for each dataset to avoid batch effects.

[0249] Sample-level differential expression tests between IPF and Control samples for each epithelial cell type were performed independently for each dataset. For each cell type, samples with at least 5 cells had their gene expression values averaged prior to comparison in an unpaired Wilcoxon rank-sum test. When calculating log2 fold change differences between IPF and Control, a pseudocount of 0.01 was added to each disease group's mean to avoid distortion. Only genes with an absolute fold change greater than 0.5 were tested for significance. Precision cut lung slices (PCLS) single nuclei RNA sequencing

[0250] Sample preparation and nuclei extraction from human PCLS'. The present study performed a time course analysis of human PCLS treated with or without Fibrotic Cocktail from day 1 (DI) through day 5 (D5). Four PCLS slices from a control donor at day 0 and at DI to D5 stimulated with or without fibrotic cocktail were washed in cold IX PBS and snap frozen. Nuclei were extracted using the Nuclei Isolation kit (CG000505, 10X Genomics,). Briefly and based on the manufacturer’s protocol and reagents, the tissue was dissociated on ice, centrifugated and washed. The pellet was resuspended, and cellular debris were removed. Following another centrifugation step, nuclei were resuspended and counted.

[0251] Single-cell barcoding, library preparation, and sequencing-. Around 20,000 nuclei were loaded on a Chip G with Chromium Single Cell 3’ v3.1 gel beads and reagents (3’ GEX v3.1, lOx Genomics). Final libraries were analyzed on an Agilent Bioanalyzer High Sensitivity DNA chip for qualitative control purposes. cDNA libraries were sequenced on a HiSeq 4000 Illumina platform aiming for 150 million reads per library and a sequencing configuration of 26 base pair (bp) on readl and 98 bp on read2.).

[0252] Fastq generation and read trimming-. Basecalls w ere converted to reads with the software Cell Ranger’s (v4.0.0) implementation mkfastq. Multiple fastq files from the same library and strand were catenated to single files. Read2 files were subject to two passes of contaminant trimming with cutadapt (i) for the template switch oligo sequence (AAGCAGTGGTATCAACGCAGAGTACATGGG, SEQ ID NO: 1) anchored on the 5’ end and (ii) for poly(A) sequences on the 3’ end. Following trimming, read pairs were removed if the read2 was trimmed below 30 bp. Paired reads were filtered if either the cell barcode or unique molecular identifier (UMI) sequence had more than 1 bp with a phred of <20. Reads were aligned with STAR (v2.7.9a) to the human genome reference GRCh38 release 99 from ensemble. Collapsed UMIs with reads that span both exonic and intronic sequences w ere retained as both separate and combined gene expression assays.

[0253] Filtering cell barcodes and quality) control'. After preprocessing, analysis of the ex-vivo human PCLS snRNA-seq data was conducted using the Seurat package (version 1.8.2). Cells with less than 750 transcripts and more that 3% mitochondrial gene ration were then removed. Integration and analysis'. To minimize the possible effect of potential batch correction methods, the present study first processed and annotated each library separately, before integrating them together and annotating them jointly. To integrate the multiple snRNA-seq datasets, the present study employed Robust Principal Component Analysis (RPCA). RPCA is a powerful technique for decomposing a data matrix into low-rank and sparse components. Briefly, the low-rank component represents shared biological signals across datasets, while the sparse component captures dataset-specific variations and technical noise. Based on the cellular diversity, the present study chose to use PCLS treated with DMSO as the reference for the integration. Following the RPCA decomposition, the present study utilized the low-rank component as the integrated representation of the snRNA-seq datasets. This component captured shared biological signals across conditions while mitigating dataset-specific variations. However, subsequent analyses, such as clustering and differential expression analysis, were performed on the non-integrated but normalized gene expression values. To validate the effectiveness of the integrated representation, the present study performed various analyses, including cell-type clustering, identification of marker genes. The present study also compared the results of these analyses to those obtained from individual datasets to evaluate the improvement gained through the integration process. Marker genes were computed using a Wilcoxon rank-sum test, and genes were considered marker genes if the FDR-corrected p- value was below 0.05 and the log2 fold change was above 0.5.

[0254] In- Vivo Experiments

[0255] Generation of GPR87 knockout mice (GPR87’ / _): C57BL / 6N-GPR87emlCya mice were purchased from Cyagen (Santa Clara, CA) as heterozygous animals. After mating and reproducing, genotype was determined using the following primers:

[0256] Forward primer (Fl): 5 -CTTCTTGTATTCCTGTGGACTG-3’ (SEQ ID NO: 2) Reverse primer (Rl): 5’-GGACTTCTCTTAGCCTTGCTCC-3’ (SEQ ID NO:3) Bleomycin-induced mice model of PF: Homozy gous GPR87- / - and wildtype littermates, age 10-12 weeks were used for experiments. Briefly, Pulmonary fibrosis was induced by intratracheal delivery of bleomycin (2 U / kg) or 0.9% saline administered by oropharyngeal instillation. Mice were euthanized and lungs were harvested on day 21 for fibrosis analysis. Mice were randomly assigned to groups. The present study used male mice only, 8-16 mice were included in each group, and the experiment was repeated 3 times. Although bleomycin challenge was not blinded, the results were analyzed in a blinded manner. Modified Ashcroft score

[0257] For Ashcroft score calculation, slides were scanned using bright field with Nikon inverted microscope at 20X magnification, at least 3 photographs per slide, followed by evaluation as described earlier with modified Ashcroft scale, by two blinded observers.

[0258] In-Vitro experiments

[0259] Cells, cell cultures, treatment and gene knockdown: Airway basal cells (iBC) derived from induced pluripotent stem cells (iPSCs) were received from the Center for Regenerative Medicine (CReM)- Boston University. These cells were chosen because they have some similarity with both airway basal, and aberrant basaloid cells with key-signature genes: as in aberrant basaloid cells, these cells express GPR87, MMP7, ITGB6, CDH2, KRT17, P63, and their expression of KRT5 is relatively low; a unique gene signature that could not be found in other cell ty pes. The cells were cultured into Matrigel in a density of 20X103 cells / 50 pl Matrigel per well, and exposed to a commercially available basal cell medium PneumaCult-Ex Plus, (StemCell technologies, Cambridge, MA) with supplements. iBC were exposed to different stimuli: lysophosphatidic acid 5 pM (Santa Cruz biotechnology, Dallas, TX), the Phosphoinositide 3-kinase (PI3K) inhibitor A6632 nM (Tocris, Bristol, UK), or PI3K stimulator 740Y-P (1 mg / ml, Tocris, Bristol, UK). Cells were harvested after 10-14 days of exposure. To perform gene knockdown, the present study used commercially available siRNA for GPR87 SR324210 (Origene- Rockville, MD), and for LPAR1 SR319990 (Ongene Rockville, MD), and compared yvith scrambled RNA negative control that does not align with any published human, mouse or rat genes. Knockdown was performed based on the manufacturer's manual before cell seeding in Matrigel, followed by 250-500 xlO3cells per well, then cells were harvested 36-72 hours after knockdown.

[0260] qPCR'. RNA isolation, and RT-qPCR yvere performed. Briefly, tissues yvere homogenized in Qiazole using Qiagen (Hilden, Germany) mini-kit for tissue. While cells in 3D cell cultures were incubated with dispase to cleave the Matrigel, then RNA was extracted using Qiagen (Hilden, Germany) micro-kit following the manufacturer’s protocols. qPCR yvas done using QuantiStudio 6 Pro PCR System using TaqMan gene expression assays.

[0261] In situ hybridization

[0262] To stain lung tissue samples, 4-pm sections of formalin-fixed, paraffin-embedded (FFPE) healthy and IPF-diseased lungs were cut with a microtome and placed on slides. These sections were stained and visualized using ACD Bio Techni-Fast Red Kit (ACD, Newark, CA). Specific probe for human GPR87 was purchased from ACD. The RNAscope assay followed the manufacturer’s instructions, and the probes were detected at a wavelength of 550 nm.

[0263] Immunofluorescence

[0264] Immunofluorescence staining of paraffin embedded slides was performed. In Brief, after rehydration, antigen retrieval was done using pH=6 retrieval buffer 95°C for 30 minutes, followed by serum blocking, and 4°C incubation with primary antibody overnight, flowed by 1 hour room temperature with secondary antibody, nuclear staining with DAPI and signal detection.

[0265] Western Blot

[0266] Protein extraction and Western blot were performed. Briefly, cells were incubated with dispase to cleave the Matngel, then washed 3 times with phosphate buffered saline, followed by cell lysis, protein extraction and denaturation, gel running, membrane transfer, blocking and antigen detection.

[0267] Confocal microscope

[0268] Images were captured using the Leica SP8 and Leica SP5 confocal microscopes (Leica Microsystems). Sequential imaging was conducted with a x40 or x63 / 1.4 NA objective lens. The images were analyzed with Imaris 9.7.2 software and the ImageJ bundle with Java 1.8.0.

[0269] MicroRNA panel

[0270] MicroRNA panel was revealed using nCounter® miRNA Expression Assay Kit (Nanostring, Seattle, WA) based on the manufacturer's protocol. The data was analyzed using nSolver 4.0 software.

[0271] Ex-vivo Experiments

[0272] Human precision cut lung slices (hPCLS): were generated from the lungs of the IPF patients and no-disease lungs as described in Alsafadi et al. (Am J Physiol Lung Cell Mol Physiol 312, L896-L902 (2017)). Briefly, right-middle and lower lung lobes were inflated by injecting 2% warm (37°C) low-melting agarose, cooled down in 4°C, then tissue cores were obtained using 10 mm punch biopter, and peripheral slices (300 pm) were cut with a vibratome (Precisionary VF-300, Natick, MA).

[0273] PCLS were incubated with DMEM / F12 (Gibco), 0.1% heat deactivated fetal bovine serum (FBS) (Gibco), and incubated in 5% CO2, 37°C incubator. No disease PCLS w ere treated with fibrotic cocktail (FC) as described in Alsafadi et al. (Am J Physiol Lung Cell Mol Physiol 312, L896-L902 (2017)), consisted of 5 ng / ml recombinant transforming growth factor-0 (TGF-0) R& D Systems), 5 pM platelet-derived growth factor-AB (PDGF-AB) (GIBCO), 10 ng / ml tumor necrosis factor-a (TNF-a) (R& D Systems), and 5 pM lysophosphatidic acid (LPA) (Santa Cruz Biotechnology).

[0274] At day 3. PCLS were treated with GPR87 or scrambled RNA for 24 hours, nintedanib 1 pM or vehicle (DMSO) for 3 days. PCLS were harvested at the end of day 5.

[0275] Trichrome quantification

[0276] Microscopic scanning of the slides was conducted in a bright field using a Nikon inverted microscope at 20X magnification. Four representative images were acquired for each sample and at least 20 different random fields of view- were used for collagen quantification. Trichrome quantification w as done using ImageJ software with deconvoluter 2.0 plugin.

[0277] Collagen concentration in medium

[0278] PCLS medium w as collected on the end of day 5, 48 hours after the last medium change. Collagen concentration was measured using R& D systems Human Pro-Collagen I alpha 1 DuoSet ELISA kit (R& D Minneapolis, MN), following the manufacturer’s manual.

[0279] Statistical analysis

[0280] Statistical analysis of in-vitro, in-vivo, and ex-vivo results was carried out in GraphPad Prism version 10. Mann- Whitney U test was used in case comparing two groups are not normally distribution, and Student’s t-test for normal distribution. For parametric set of data characterized by normal distribution, differences between two groups were assessed through unpaired Student’s t-test. One-way ANOVA with Student-Newman-Keuls post hoc test w-as used for pairwise comparisons of three or more groups or more than 10 per group. Efficacy experiments in-vivo were designed to achieve 82% power to detect 20% difference between the groups at 0.05 level of significance, 6 animals in control group and 8 in the treated group. However, due to mortality, the observed group sizes in practice deviated. All data are expressed as mean ± standard error of the mean (SEM) taking into consideration that P < 0.05 is statistically significant, except for scRNAseq and RNAseq experiments were FDR was used to control for multiple hypothesis testing.

[0281] Measuring GPR87 levels in human lungs and correlation with physiologic measurements Gene expression data for the GPR87 gene was measured in The Lung Genomics Research Consortium (LGRC) Cohort at the probe-level from the Agilent-014850 Whole Human Genome Microarray 4x44K G4112F (Agilent, Santa Clara, CA), used in the LGRC cohort. Data from individuals with idiopathic pulmonary fibrosis (IPF) and controls, including forced vital capacity (FVC) and carbon monoxide diffusion capacity (DLCO) were used for this analysis. The gene expression data is available on the GEO database (http: / / www.ncbi.nlm.nih.gov / geo / ) under the accession number GSE47460.

[0282] In situ hybridization (ISH)

[0283] To stain lung tissue samples. 4-pm sections of formalin-fixed, paraffin-embedded (FFPE) healthy and IPF-diseased lungs were cut with a microtome and placed on slides. These sections were stained and visualized using ACD Bio Techni-Fast Red Kit (ACD, Newark, CA) following the manufacturer’s protocol. In brief, slides were incubated in 60° C for 60 minutes, and cooled down in room temperature overnight. The next day. after rehydration process, sections were incubated with hydrogen peroxide, followed by retrieval buffer, probe hybridization for 2 hours, amplification, and color detection. Specific probe for human GPR87 was purchased from ACD. Following color detection, sections were blocked with 2.5% goat serum, then primary antibodies overnight in 4° C, followed by the next immunofluorescence staining protocol steps (immunofluorescence section). The ISH probes were detected at a wavelength of 550 nm.

[0284] Immunocytochemistry / Immunofluorescence:

[0285] Immunohistochemistry (IHC) was performed. In brief, slides were rehydrated, heat-mediated antigen retrieval was performed in citrate buffer (pH=6. 95°C for 30 minutes) followed by 2.5% goat serum blocking in room temperature for 1 hour. Then samples were incubated with primary antibodies overnight at 4°C after blocking. To reduce autofluorescence, slides were incubated in TrueView reagent for 3 minutes before mounting with a mounting medium containing DAPI. IHC quantification was performed in a blinded fashion by using ImageJ’s deconvolution tool. Antibodies used:

[0286]

[0287] Mice Pulmonary function tests

[0288] Mice were anesthetized with 18% urethane 300 |iL intraperitoneal injection and paralyzed with an intraperitoneal injection of pancuronium bromide (1 mg / kg) depth of anesthesia was assessed as the lack of response to a toe pinch, with supplemental injections given as needed. Once adequate anesthesia and paralysis was achieved, the mice were placed in a supine position, and the trachea was canulated with 20G tube, through a ventral incision in the rostral-most part of the trachea and advanced 3 mm caudal to the incision. Mice were mechanically ventilated using the SCIREQ FlexiVent apparatus with 150 breaths / min, a tidal volume of 10 mL / kg body mass, and a positive end-expiratory pressure of 3 cmH2O prior to lung function measurements.

[0289] With the maximal vital capacity perturbation (called total lung capacity by SCIREQ), the inspiratory capacity of the lungs was determined using the SCIREQ software (Flexiware v.7.6, Service Pack 6). Forced oscillation perturbations (“quickprime-3”) subsequently measured tissue damping, reflecting energy dissipation within the lung parenchyma.

[0290] Pres sure- volume loops were calculated through quasi-static stepwise pressure-guided measurements of pressure P and volume V. SCIREQ software calculated static compliance by fitting the Salazar-Knowles equation. All maneuvers were performed till three consecutive consistent measurements were achieved per animal. A coefficient of determination of 0.9 was the lower limit for accepting a measurement.

[0291] RNA extraction

[0292] In induced basal cells (iBC) were incubated with dispase 2 mg / ml for 15 minutes, then mixed by pipetting to cleave the Matrigel. The complex was centrifuged and the supernatant was discarded. Qiazole (Qiagen (Hilden, Germany)) was added, and mixed by vortexing. Using Qiagen miRNeasy micro-kit, following the manufacturer’s manual, RNA was extracted.

[0293] For tissue RNA extraction, tissue was homogenized using a D1000 Hand-Held Homogenizer (Benchmark, Tempe, AZ), followed by RNA extraction using miRNeasy minikit, following the manufacturer’s manual.

[0294] The purity of the RNA was verified using a NanoDrop at 260 nm, and the quality of the RNA was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies)

[0295] Gene knockdown using siRNA

[0296] Target genes were knockdow n before being seeded in Matrigel, following the manufacturer’s manual. The three different sequences of each gene were mixed together in the lx transfection buffer, and siTran 2.0 siRNA transfection reagent. After incubation with transfection cocktail, cells were seeded into Matrigel, and harvested after 36-48 hours.

[0297] SiRNA GPR87 sequences SR324210A rArUrUrCrUrUrCrArGrUrUrGrUrGrArUrGrCrArCrUrGrUrArArGrC (SEQ ID NO:4)

[0298] SR324210B rGrUrArCrArUrArUrCrGrArUrUrCrCrArArCrArArArCrArArUrArA

[0299] (SEQ ID NO:5)

[0300] SR324210C TArGrArArUrArArArCrUrUrGrArArGrUrArCrCrArArGrGrUrCrCrA

[0301] (SEQ ID NO:6)

[0302] Negative control SiRNA sequences

[0303] Sense 5’ rCrGrUrUrArArUrCrGrCrGrUrArUrArArUrArCrGrCrGrUAT

[0304] (SEQ ID NO:7)

[0305] Antise 5 ’ rArUrArCrGrCrGrUrArUrUrArUr ArCrGrCrGrArUrUr ArArCrGrArC

[0306] (SEQ ID NO: 8)

[0307] qPCR

[0308] Real-time Quantitative Reverse Transcription-Polymerase Chain Reaction (qPCR) for RNA expression:

[0309] Relative expressions of messenger RNAs from all in vitro, in vivo, and ex vivo experiments were determined by real-time quantitative reverse transcription-polymerase chain reaction (qRTPCR) on QuantiStudio 6 Pro PCR System using TaqMan gene expression assays. Reverse transcription with random primers and subsequent PCR were performed with TaqMan RNA-CtoT one-step kit (Applied Biosystems). Raw data for cycle threshold (Ct) values were calculated using the QuantiStudio 6 Pro PCR with an automatically set baseline. The results were analyzed by the AACt method and GUS-B (0-glucuronidase) or GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) were used as a housekeeping gene. Fold change was calculated by taking the average over all the control samples as the baseline. All the probes used in this study were purchased from Thermo Fisher Scientific.

[0310] Western Blot

[0311] For Western blot, isolated cells were lysed and in M-Per (Thermo Fisher Scientific) added phosphatase and protease inhibitor (100 pl per IxlO6cells, Abeam, ab201119) on ice for 10 minutes. Protein content was measured using ELISA and Pierce BCA Protein Assay-Kit (Thermo Scientific) and denaturation was performed at 95°C for 5 min in the presence of mercaptoethanol and Laemmli buffer. 20 pg protein per lane was loaded onto a 4-20% gel (bio rad) and samples were run at 25 mA followed by transfer on PVDF membranes using the Trans-Blot Turbo Transfer System (Bio-Rad). Membranes were washed and blocked in 5% dry milk (American Bio-Inc) for 60 min followed by incubation overnight (at 4°C) with primary antibody according to the manufacturer’s instruction. Primary antibodies used as follows; (Lactin (sc-47778) Santa Cruz Biotechnology- (Dallas, TX), GPR87 (ab272873) Abeam (Cambridge, United Kingdom), CDH2 (V3391-) NSJ bioreagents (San Diego, CA), Signal was detected using appropriate HRP conjugated secondary antibody (1: 1000 for Ih at room temperature) using ECL substrate (Bio-Rad). Visualization was performed using an enhanced chemiluminescent detection kit (Bio-Rad, Hercules, CA, USA). Quantification of blots was done by densitometry using Bio-Rad Image Lab Software 6.1 (Bio-Rad Laboratories) and actin as a loading control.

[0312] Bulk seq gene analysis and enrichment

[0313] Poly-A mRNA was enriched from 200 ng of total RNA, followed by fragmentation of the mRNA to -200-300 bp and cDNA synthesis. Equimolar amounts of indexed libraries were pooled and loaded onto an Illumina HiSeq platform for paired-end 100 bp sequencing. Data was analyzed using Qlucore omics explorer 3.8 and normalized using Trimmed Mean of M-values (TMM), considering the gene length of each gene.

[0314] In induced basal cells (iBC) Genes which have significant differential expression (P<0.05) between treatment and control groups were selected from two experiments: LPA vs Control, and GPR87 KD vs Control. Then genes which were upregulated when treated with LPA and down regulated with GPR87 KD or downregulated when treated with LPA and upregulated with GPR87 KD, were selected.

[0315] Genes where enriched using Gene enrichment w as performed using National Institute of Health- DAVID Bioinformatics and Enrich MSiGDB hallmark (can be found at: https: / / maayanlab.cloud / Enrichr / enrich MSigDB Hallmark 2020).

[0316] For mouse experiments, two-way anova was used to compare the groups, with P<0.05 considered significant. Furthermore, a direct companson between knockout (KO) bleomycin and wildtype (WT) bleomycin groups was done using student T test with P<0.05 considered significant, all differentially expressed genes between these two groups w ere ran through Gene enrichment w as performed using National Institute of Health- DAVID Bioinformatics or KEGG pathway, wikipathway selected.

[0317] Human PCLS processing and culturing

[0318] Human precision cut lung slices (hPCLS) were generated from the lungs of IPF patients and no-disease lungs as described in Wijsenbeek et al. (N Engl J Med 383. 958-968 (2020)). Briefly, right-middle and lower lung lobes were inflated by injecting 2% warm (37°C) low-melting agarose, cooled down in 4°C, then tissue cores were obtained using 10 mm punch biopter, and peripheral slices (300 pm) were cut with a vibratome (Precisionary VF-300, Natick, MA).

[0319] PCLS were incubated with DMEM / F 12 (Gibco), 0.1% heat deactivated fetal bovine serum (FBS) (Gibco), and incubated in 5% CO2, 37°C incubator. No disease PCLS were treated with fibrotic cocktail (FC) as described in Wijsenbeek et al. (N Engl J Med 383, SS-O S (2020)), consisted of 5 ng / ml recombinant transforming growth factor- (TGF- ) R& D Systems), 5 pM platelet-derived growth factor- AB (PDGF-AB) (GIBCO), 10 ng / ml tumor necrosis factor-a (TNF-a) (R& D Systems), and 5 pM lysophosphatidic acid (LPA) (Santa Cruz Biotechnology).

[0320] Human PCLS time-course and single nuclei sequencing

[0321] Sample preparation and nuclei extraction from human PCLS: The present study performed a time course analysis of human PCLS treated w ith or w ithout Fibrotic Cocktail from day 1 (DI) to day 5 (D5). Four PCLS slices from a control donor at day 0 and at DI to D5 stimulated with or without fibrotic cocktail were washed in cold IX PBS and snap frozen. Nuclei were extracted using the Nuclei Isolation kit (CG000505, 10X Genomics.). Briefly and based on the manufacturer’s protocol and reagents, the tissue was dissociated on ice, centrifugated and washed. The pellet was resuspended and cellular debris were removed. Following another centrifugation step, nuclei were resuspended and counted.

[0322] Single-cell barcoding, library preparation, and sequencing'. Around 20,000 nuclei were loaded on a Chip G with Chromium Single Cell 3' v3.1 gel beads and reagents (3' GEX v3.1, lOx Genomics). Final libraries were analyzed on an Agilent Bioanalyzer High Sensitivity DNA chip for qualitative control purposes. cDNA libraries were sequenced on a HiSeq 4000 Illumina platform aiming for 150 million reads per library and a sequencing configuration of 26 base pair (bp) on readl and 98 bp on read2.).

[0323] Fastq generation and read trimming'. Basecalls were converted to reads with the software Cell Ranger’s (v4.0.0) implementation mkfastq. Multiple fastq files from the same library and strand were catenated to single files. Read2 files were subject to two passes of contaminant trimming with cutadapt (i) for the template switch oligo sequence (AAGCAGTGGTATCAACGCAGAGTACATGGG, SEQ ID NOT) anchored on the 5' end and (ii) for poly(A) sequences on the 3' end. Following trimming, read pairs were removed if the read2 was trimmed below 30 bp. Paired reads were filtered if either the cell barcode or unique molecular identifier (UMI) sequence had more than 1 bp with a phred of <20. Reads were aligned with STAR (v2.7.9a) to the human genome reference GRCh38 release 99 from ensemble. Collapsed UMIs with reads that span both exonic and intronic sequences were retained as both separate and combined gene expression assays.

[0324] Filtering cell barcodes and quality control'. After preprocessing, analysis of the ex vivo human PCLS snRNA-seq data was conducted using the Seurat package (version 1.8.2). Cells with less than 750 transcripts and more that 3% mitochondrial gene ration were then removed.

[0325] Integration and analysis: To minimize the possible effect of potential batch correction methods, the present study first processed and annotated each library separately, before integrating them together and annotating them jointly. To integrate the multiple snRNA-seq datasets, the present study employed Robust Principal Component Analysis (RPCA). RPCA is a powerful technique for decomposing a data matrix into low-rank and sparse components. Briefly, the low-rank component represents shared biological signals across datasets, while the sparse component captures dataset-specific variations and technical noise. Based on the cellular diversity, the present study chose to use PCLS treated with DMSO as the reference for the integration. Following the RPCA decomposition, the present study utilized the low-rank component as the integrated representation of the snRNA-seq datasets. This component captured shared biological signals across conditions while mitigating dataset-specific variations. However, subsequent analyses, such as clustering and differential expression analysis, were performed on the non-integrated but normalized gene expression values. To validate the effectiveness of the integrated representation, the present study performed various analyses, including cell-type clustering, identification of marker genes. The present study also compared the results of these analyses to those obtained from individual datasets to evaluate the improvement gained through the integration process. Marker genes were computed using a Wilcoxon rank-sum test, and genes were considered marker genes if the FDR-corrected p-value was below 0.05 and the log2 fold change was above 0.5.

[0326] Example 1-4: GPR87 is highly expressed in IPF lungs, mainly in basal and aberrant basaloid cells, and correlates with disease severity

[0327] Comparing 160 IPF patients with 132 age match control participants revealed that GPR87 is significantly increased in IPF lung cells compared with controls (Log2 Fold change = 2.12; FDR adjusted PO. OOOl) (Fig. 1A). In the overall cohort GPR87 was significantly inversely correlated with forced vital capacity (FVC), forced expiratory volume in 1stsecond (FEV1), and carbon monoxide diffusion capacity (DLCO), but because IPF patients had significantly lower pulmonary functions (Table 1), the present study assessed the correlation within patients IPF. GPR87 expression was inversely correlated with FVC, (r2=0.083, P=0.002) and with DLCO (r2=0.0783, P<0.001) (Figs. 1B-1C). GPR87 was also correlated alveolar surface density (which inversely correlates with extent of fibrosis) (r=0.404. p=0.002). In the same dataset, a strong correlation between GPR87 and KRT5, COL7A1, KRT17, MMP7, HMGA2, CDH2 and TP63 was noticed (r correlation coefficient 0.94, 0.9, 0.89, 0.64, 0.81, 0.64, 0.61 and 0.64, P0.001, respectively) (Fig. 5A). Table 3.

[0328]

[0329] For Carbos Memj de, SDssSwi arf Deviates

[0330] *:P-' Vstte fate dlst ery i -a j i -vahe,

[0331] 47,296 epithelial cells, from 107 different lungs were reanalyzed from single cell datasets. GPR87 is highly expressed in IPF lungs, mostly in airway basal and aberrant basaloid cells, and to a certain degree, in secretory cells (Figs. 1D-1K), but not in immune or mesenchymal cells. It is mostly expressed in IPF lungs in comparison with disease-free, chronic obstructive airway disease (COPD) or non-IPF interstitial lung diseases (ILD)s.

[0332] These results were validated using RNA ISH staining for GPR87 and immunofluorescence for the co-markers KRT5 and P63 (Fig. IL).

[0333] Example 1-5: GPR87 / _mice are protected against pulmonary fibrosis

[0334] The present study induced fibrosis using a single dose of bleomycin (2 U / kg) administered into the lung by oropharyngeal aspiration to GPR87’ ' mice and wildtype littermates. On Day 21, the present study sacrificed the mice and harvested the lungs. The mortality of the GPR87 / _mice group was lower than the WT group (25% Vs. 40%, P=0.048) (Fig. 3 A). All the mice in saline groups survived until the designated day. Weight loss provided additional evidence for relative protection of GPR87 / _mice; the mean weight change in GPR87" ' mice was significantly lower than WT mice after bleomycin (-0.8gr, -2.3 gr, respectively, fold change =2.87, p=0.05, n=19) (Fig. 2B). Lung function tests revealed similar trends: after bleomycin, pressure-volume loops were higher in GPR87' ' than WT, although saline groups were higher than both (Fig. 3C). Similarly, lung static-compliance in GPR87 / _mice was significantly higher compared to WT mice (0.04716 mL / cmFLO, 0.03291 mL / cmFhO, fold change=1.43, P=0.002, n=16). The modified Ashcroft score was significantly lower score in GPR87" ' compared to WT mice after bleomycin treatment (2.6, 4.4 respectively, fold change = 1.7, P=0.04, n=19) reflecting less tissue fibrosis (Fig. 2E). Quantification of collagen in the lung tissue using hydroxyproline assay revealed lower hydroxyproline in the GPR87" ' compared to WT mice after bleomycin treatment group (0.71pg, 0.89 pg, respectively, fold change= 1.25, P=0.027, n=25) (Fig. 2F). Relative expression of Coll Al RNA confirmed the findings and significantly lower in GPR87 ’ mice compared to WT after bleomycin (1.17, 1.8 respectively, fold ratio =0.65, P=0.02, n=20) (Fig. 2G).

[0335] Example 1-6: Loss of GPR87 mediated protection against pulmonary fibrosis is associated with reduced TGF, TNF and PI3K pathways activation

[0336] In order to reveal the pathways by which GPR87 protects against pulmonary fibrosis development in mouse model, the present study performed RNA bulk sequencing, which showed similarity between saline treated GPR87" ' and WT mice, but were very different among GPR87 ’ and WT mice after bleomycin (Figs. 2I-2J). Gene enrichment was performed using National Institute of Health-DAVID Bioinformatics, and KEGG PATHWAY Database. The most highly enriched gene clusters were related DNA repair and well documented pathways in pulmonary' fibrosis DNA replication and repair and cell cycle, and TGF beta signaling pathway, it was also noted that PI3K and TNF pathways were highly enriched (Figs. 6A-6E).

[0337] Example 1-7: In airway basal cells, LPA induces fibrosis related genes, microRNAs and proteins, while GPR87 knockdown inhibits it

[0338] GPR87 was reported in the literature as an LPA receptor. To determine the effect of GPR87 stimulation, iBC were cultured with or without LPA added to the medium, although this might also stimulate LPAR1, another LPA receptor in these cells. In order to study the effect on iBC, the present study chose a special gene panel, that includes genes highly increased in IPF in general, and in aberrant basaloid cells in particular: MMP7, ITGB6, CDH2, besides to GPR87 as the gene of interest, LPAR1 as an alternative LPA mediator, and the basal cell markers KRT17 and P63. Using qPCR to compare gene expression in LPA treated (n=l 1) Vs control (n=8), the present study noticed that LPA induced the expression of GPR87, LPARL MMP7, ITGP6, and KRT17 (1.3, 1.4, 10.5, 1.6 folds, respectively, PO. OOl) but not P63 or CDH2 (P>0.05). (Fig. 3A). On the other hand, knockdown of GPR87 by siRNA (n=8) led to decreased expression of GPR87, MMP7, ITGP6, CDH2 and P63 (fold change 0.44, 0.8, 0.85 and 0.7 respectively, P<0.01 for ITG 6, and P<0.001 for the reminder genes). A finding also confirmed at the protein level (Fig. 3F); however, did not change LPAR1 or KRT17 expression (P>0.05) (Fig. 3A). To compare the effect of GPR87 to another LPA receptor expressed in these cells, the present study knocked down LPAR1 using siRNA, with a comparable degree of knockdown: 63% and 47% for GPR87 and LPAR1, respectively (Fig. 3A). LPAR1 knockdown (n=8) led to decreases in GPR87, LPARL ITGB6, CDH2 and P63 (fold change 0.8, 0.7, 0.8. 0.7 and 0.7, PO. OOl). but not MMP7 and KRT17, which increased by 1.2 folds each, PO. OOl, suggesting that LPAR1 expression contributed to the expression of ITGB6, CDH2, but probably not to MMP7.

[0339] Example 1-8: GPR87 knockdown mediates antifibrotic effect through mTORCl, TNFa, P53 and PI3K pathways

[0340] The present study performed bulk RNA sequencing iBC treated with LPA vs control, and iBC subjected to GPR87 siRNA knockdown vs scrambled RNA (n= 4 in each group). The present study analyzed bulk RNA sequencing using Qlucore software and performed student T test with FDR adjusted PO.05 to distinguish the differentially expressed genes. 6359 genes were differentially expressed after LPA treatment, and 9520 genes after GPR87 knockdow n in iBC. Top differentially expressed genes are presented in Figs. 3B-3C. In order to determine the pathway through which GPR87 attenuates LPA stimulation, genes which were increased with GPR87 KD and decreased with LPA stimulation (603 genes), or decreased with GPR87 KD and increased with LPA stimulation (882 genes), were noted (Fig.

[0341] 7 A). Gene enrichment was performed using National Institute of Health-DAVID Bioinformatics and MSigDB Hallmark 2020. The present study identified that among the most highly enriched pathways were mTORCl. TNFa, and P53, although PI3K pathway was also highly enriched (Fig. 3D). It is noteworthy to mention that these pathways overlap in PI3K pathway.

[0342] To validate GPR87 effect through PI3K pathway, the present study treated iBC with A66 (selective PI3K inhibitor), with (n=6) or without LPA (n=8), and with PI3K specific stimulator 740YP (n=6), and 740YP treatment followed by GPR87 knockdown (n=8).

[0343] Results are shown in detail in Table 2, briefly, PI3K stimulation with either LPA or 740YP led to higher expression of fibrosis related genes - GPR87, MMP7, ITGB6 and CDH2, w hile inhibition of the pathway using A66 or GPR87 KD, blunted this effect (Fig. 3E).

[0344] Table 4.

[0345] Fold change compared to control

[0346]

[0347] Example 1-9: GPR87 knockdown leads to overexpression of microRNAs related to anti-fibrotic effects, while LPA leads to an opposite result

[0348] After RNA extraction from iBC 48 hours after GPR87 siRNA knockdown, or 10 days after LPA treatment, the present study ran nCounter® miRNA Expression Assay Kit (Nanostring, Seattle, WA) as mentioned above. Differentially expressed microRNAs are presented in Figs. 3G-3H. The present study noticed that GPR87 knockdown led to overexpression of microRNAs related to pulmonary anti-fibrotic activity, or downregulated in IPF, including let-7 family, miR-30, mir-15, mir-26. On the other hand, LPA stimulation of iBC led to downregulation of Let-7 family, miR-200 family and upregulation of miR-21, which is related to pro-fibrotic activity.

[0349] Example 1-10: GPR87 knockdown is protective against pulmonary fibrosis in the ex-vivo human disease-free PCLS fibrotic cocktail treatment model

[0350] In order to study the role of GPR87 in the development of PF in human ex-vivo model, first the present study exposed human disease-free PCLS to fibrotic cocktail. Slices were harvested every 24 hours after the initial exposure, up to 5 days and snap frozen for future analyses. Nuclei were extracted, and a single cell RNA sequencing was performed as mentioned in the methods above. No expression of GPR87 was seen before the exposure to fibrotic cocktail, and during the first 2 days of exposure, however; it was increased starting from day 3, through the end of the experiment at day 5 cells. GPR87 was expressed in basal and aberrant basaloid, more in fibrotic cocktail (Figs. 4A-4E). In parallel, the present study knocked down GPR87 in human disease-free PCLS at day 3 and harvested the tissue at day 5, as a control the present study used scrambled RNA, and compared to nintedanib, and to a naive group that was not treated with fibrotic cocktail. (n=4 in each group) (Fig. 4F). The present study quantified GPR87 RNA expression using qPCR, revealing that GPR87 knockdown group had lower expression of GPR87 in comparison to scrambled RNA (fold ratio 0.38, P<0.001). Quantification of trichrome staining (n=30 in naive group, and 24 in other groups) sho ed that the trichrome stained area in GPR87 knockdown, nintedanib and naive groups were 3.78, 4.25 and 4.23%, (statistically similar, P>0.05) but significantly lower in scrambled RNA group (7.78%, P<0.0001). (Fig. 4G).

[0351] Example 1-11: GPR87 knockdown reverted fibrosis in IPF PCLS ex-vivo model To determine whether GPR87 can affect pre-exisitng human pulmonary’ fibrosis, the present study knocked down GPR87 using siRNA in PCLS derived from IPF lungs, and compared to nintedanib (n=4 in each group) (Fig. 4H). The present study quantified GPR87 RNA expression using qPCR, revealing that GPR87 knockdown group had low er expression of GPR87 in comparison to scrambled RNA (fold ratio 0.63, P<0.01). Trichrome quantification (n= 29 in each group) showed significantly low er trichrome in GPR87 knockdown and nintedanib groups than scrambled RNA group (5.2%, 5.35%, and 8.2% respectively, P<0.0001) (Fig. 41). Furthermore, measurement of collagen in the supernatant of the PCLS at the harvesting day, shows that GPR87 knockdown group (n=4) and nintedanib (n=6) had lower collagen than control (346, 606 pg / and 1082 pg / ml, (fold ratio 0.32, 0.56) respectively, p= 0.008 and 0.03, respectively) (Fig. 4J). Example 1-12:

[0352] IPF airway basal cells and aberrant basaloid cells are increasingly recognized as key features and potential modulators in pulmonary fibrosis. Here, it was demonstrated that that GPR87, an LPA receptor, is highly expressed in both cell populations in IPF, while its expression in healthy cells and tissues is substantially lower. Moreover, its expression correlates with disease severity in two independent datasets. The present study demonstrated that the expression of GPR87 in healthy cells and murine or human tissues, is very low, but can be increased by profibrotic stimuli, such as bleomycin in mice or the profibrotic cocktail in PCLS, as well as LPA stimulation. In-vitro, GPR87 knockdown in iBC leads to decreased expression of fibrosis related genes, proteins and microRNAs, and GPR87 stimulation with LPA leads to a dependent increase in these genes, and microRNAs. In-vivo genetic knockout of GPR87 in mice is protective against development of bleomycin induced fibrosis, and ex-vivo, siRNA driven knockdown of GPR87 is blunts fibrosis in PCLS treated with fibrotic cocktail and IPF PCLS. Taken together, the results herein establish GPR87 as a novel therapeutic target for pulmonary fibrosis.

[0353] The present study provides the first demonstration that GPR87 has a crucial mechanistic role in the development of IPF. Although it has already been reported as an LPA receptor, and despite the well-established involvement of LPA in the development of IPF, it was not until very recently that GPR87 was reported in IPF, specifically in airway basal cells. This has been made possible with the application of cutting-edge technologies, specifically single-cell RNA sequencing that allows detection of those genes highly enriched in certain cell populations despite low overall expression in lung tissue, in this case in airway basal and aberrant basaloid cells, which growing evidence suggests their mechanistic role in IPF. The present study has shown that GPR87 is a key regulator that mediates profibrotic signaling in IPF. This is seen in multiple layers: GPR87 expression correlates with disease severity, and is very7rarely expressed in disease-free lungs, moreover, its expression is significantly enhanced by fibrosis stimulation, such as bleomycin, LPA or fibrotic cocktail. Importantly. GPR87 inhibition through genetic knockout, siRNA knockdown or by downstream blockade, is protective against the development of pulmonary fibrosis in in-vitro, in-vivo and ex-vivo models. Little was previously known about GPR87 expression in lung tissue, however, GPR87 w as previously reported in different carcinomas, and correlated with cell invasion, tumor aggressiveness and metastasis in lung adenocarcinoma, pancreatic carcinoma and bladder cancer. It was also described that inhibition of GPR87 using adenoviral vector, disturbed tumor proliferation in lung cancer cells; Furthermore, anti-GPR87 blocking monoclonal antibody led to regression of lung cancer in a mouse model, which highlights the mechanistic role of GPR87 in lung cancer. This leads to the conclusion that GPR87 plays a novel mechanistic role, rather than a disease marker, in the pathogenesis of IPF and presents a potential target for future therapeutic strategies.

[0354] LPA signaling in IPF has been addressed in multiple papers over the last two decades, however, the main focus was on LPAR1 due to its high expression, especially in fibroblasts and myofibroblasts. Indeed, the LPAR1 antagonist BMS-986020 showed efficacy in slowing FVC decline in IPF, however, it was associated with hepatic enzyme elevation. Here the present study shows that GPR87 knockdown has an opposite effect to LPA treatment in basal cells. Moreover, LPA treatment leads to over-expression of GPR87, while GPR87 siRNA knockdown in disease-free PCLS, blunted the effect of fibrotic cocktail, which LPA is one of its components. Furthermore, the effect of GPR87 knockdown was similar to the effect of LPAR1 knockdown on key genes in IPF development, such as CDH2 and ITGP6. However, GPR87 knockdown resulted in lower expression of MMP7, while LPAR1 knockdown did not. Moreover, GPR87 is almost exclusively expressed in IPF, specifically in airway basal and aberrant basaloid cells, whereas LPAR1 is expressed in a variety of cell types, in both healthy and IPF lungs. This might result in specificity' differences while targeting GPR87 in comparison to LPAR1.

[0355] The current paradigm of IPF development points to injury to the alveolar epithelial cells as a critical event driving the development of lung fibrosis. This leads to epithelial cell dysfunction and injury' repair failure, dysregulated epithelial-mesenchymal cross-talk, abnormal activation of epithelial-mesenchymal transition (EMT) and subsequently epithelial cells lose their polarity and cell-cell adhesion properties, acquiring migratory and invasive characteristics typical of mesenchymal cells. A recent study has found that IPF airway basal cells are fundamentally different from disease-free lung airways basal cells: in IPF, these cells are reprogrammed, located in areas of active remodeling and bronchi olization and adjacent to fibroblastic foci. Transcriptionally, these cells exhibit enhanced sternness, extracellular matrix sensing and epidermal growth factor signaling.

[0356] Airway basal do cells migrate from airway niche and populate in fibroblastic foci and honeycomb cysts. Since aberrant basaloid cells are a recently reported cell population, their origine is still not fully understood, however, they are located in highly dense fibrotic areas, present EMT and senescence markers. GPR87 activation in these cells is highly profibrotic, mediated through well documented fibrosis pathways, particularly in the PI3K pathway, which was found to be highly enriched in both in vitro and in vivo experiments.

[0357] Furthermore, mTOR. TNF and NFKB are enriched, and overlap with PI3K pathway. Based on this, it is highly likely that GPR87 activates profibrotic pathways in airway basal and aberrant basaloid cells, leading to a profibrotic effect on the cellular niche.

[0358] Taken together, the results herein establish a novel role for GPR87 in pulmonary fibrosis. The genetic, observational, and mechanistic studies the present study performed in-vitro, in-vivo and ex-vivo lead to the same conclusion. LPA signaling through GPR87 in lung epithelial cells contributes to the activation of profibrotic program. This is supported by gain and loss of function experiments in human and murine tissues. Thus, GPR87 is a novel therapeutic target for IPF.

[0359] Example 2-1: Testing of anti GPR87 antisense oligonucleotides (ASOs) in a 3D cell culture model for idiopathic pulmonary fibrosis (IPF)

[0360] The present study tested the concentration of antisense oligonucleotides in 3D cell culture model.

[0361] Referring to Fig. 8 A, the present study used MALAT1 ASO as positive control. Induced pluripotent stem cells derived basal cells (iBC) were incubated for 6 hours with pneumacult EX plus medium in 37 °C, in 1.5 ml Eppendorf tubes spinning, with different concentrations of MALAT1 ASO, or negative control. Cells then were seeded for 1 week in Matrigel. 37 °C in 5% CO2 cell culture incubator. Medium (pneumacult EX plus) was changed every 48 hours until harvesting. Then cells were harvested, RNA was extracted using Quiagene RNA microkit. qPCR was run for MALAT1 expression. Results show that 5 uM was the best in inhibition MALAT1 expression.

[0362] Example 2-2: GPR87 ASO screening

[0363] The present study designed several ASOs for GPR87 inhibition. These ASO were tested for efficacy in GPR87 knockdown. iBC cells were incubated for 6 hours with pneumacult EX plus medium in 37 °C, in 1.5 ml Eppendorf tubes spinning, with 5 uM of different GPR87 ASOs for one week as previously mentioned, and GPR87 qPCR was run.

[0364] Referring to Fig. 8B, anti GPR87 ASOs number 24, 28 and 33 were particularly effective in GPR87 knockdow n (e.g., knockdown by ~ 50% or more). The sequences of these ASOs are listed below: Table 5.

[0365]

[0366]

[0367] Addit ional information regarding these ASOs is listed below:

[0368] Table 6.

[0369]

[0370]

[0371]

[0372] Example 2-3: GPR87 ASO knockdown resulted in the down regulation of fibrosis related genes

[0373] Selected GPR87 ASOs were chosen based on the effect on GPR87. iBCs were cultured for 6 hours with ASO 24. 28. 33 or a negative control in 37 C. then where seeded in Matrigel. Cells were cultured for 1 week, with pneumacult EX+ medium with supplements. Cells were harvested after 1 week. qPCR was run using a selected panel of genes, relevant to fibrosis

[0374] Referring to Fig. 8C, GPR87 knockdown using ASOs 24, 28 or 33 led to a reduced expression in GPR87 by about -50%, as well as in fibrosis related genes including MMP7, ITGB6 and CDH2 by a similar percentage. The basal cell marker P63 remained unaffected.

[0375] The detailed results are shown in Table 7.

[0376] Table 7: relative expression of relevant genes after GPR87 ASO knockdown.

[0377]

[0378] Example 2-4: GPR87 ASO knockdown prevented the fibrotic effect of LPA

[0379] The present study has shown that LPA stimulation leads to profibrotic effects, which were opposite to GPR87 knockdown effect. To test the protective antifibrotic effect of GPR87 ASO knockdown, the present study incubated iBC with anti GPR87 ASOs (or negative control ASOs), and treated the cells with 5 nM LPA containing medium for 7 days. Then cells were harvested and RNA was extracted as previously discussed. qPCR was run for gene expression. Referring to Fig. 8D, GPR87 ASO knockdown led to less expression of GPR87 MMP7 by -30% and MMP7 by - 35% in comparison to control. The full results are shown in Table 8.

[0380] Table 8: GPR87 and MMP7 expression after GPR87 ASO knockdown and stimulation with LPA

[0381]

[0382] Example 3: Additional siRNA

[0383] The present study designed additional siRNAs. The sequences of these siRNAs are listed below:

[0384] Table 9.

[0385]

[0386]

[0387]

[0388]

[0389]

[0390]

[0391]

[0392]

[0393] Enumerated Embodiments

[0394] In some aspects, the present invention is directed to the following non-limiting embodiments: Embodiment 1: A method of treating, ameliorating and / or preventing a fibrotic disease, the method comprising administering to the subject an effective amount of a compound that downregulates GPR87.

[0395] Embodiment 2: The method of Embodiment 1, wherein the fibrotic disease is pulmonary fibrosis.

[0396] Embodiment 3: The method of any one of Embodiments 1 -2, wherein the fibrotic disease is idiopathic pulmonary fibrosis (IPF). liver fibrosis, or skin fibrosis.

[0397] Embodiment 4: The method of any one of Embodiments 1-3, wherein the compound comprises at least one selected from the group consisting of: a small molecule inhibitor of GPR87, a protein inhibitor of GPR87, a nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference, a ribozy me that downregulates the expression level and / or activity of GPR87, and / or an expression vector expressing the ribozyme, an expression vector comprising an expression cassette, wherein the expression cassette expresses CRISPR components that downregulate the expression level and / or activity of GPR87 by CRISPR knockout or CRISPR knockdown, and a trans -dominant negative mutant protein of GPR87, and / or an expression vector that expresses the trans -dominant negative mutant protein of GPR87.

[0398] Embodiment 5: The method of any one of Embodiments 1 -4, wherein the compound comprises an antibody that binds GPR87.

[0399] Embodiment 6: The method of any one of Embodiments 1-4, wherein the compound comprises an siRNA for knocking down GPR87, or an antisense oligonucleotide (ASO) for inhibiting GPR87.

[0400] Embodiment 7: The method of Embodiment 6, wherein the compound comprises the siRNA, and at least one of the following applies:

[0401] (a) the siRNA comprises a sequence set forth in any one of SEQ ID NOs:9-59, (b) the siRNA comprises a sequence set forth in any one of SEQ ID NOs: 104-151. Embodiment 8: The method of Embodiment 6, wherein the compound comprises the ASO, and at least one of the following applies:

[0402] (a) the ASO comprises a sequence set forth in any one of SEQ ID NOs:60-81, optionally SEQ ID NOs: 66, 70, and 75,

[0403] (b) the ASO comprises a sequence set forth in any one of SEQ ID NOs:82-103. optionally SEQ ID NOs: 88. 92, and 97. Embodiment 9: The method of any one of Embodiments 1-8, wherein the subject is a human.

[0404] Embodiment 10: A kit for treating, ameliorating, and / or preventing a fibrotic disease in a subject, the kit comprising: a compound that downregulates GPR87; and an instruction manual instructing that the compound that downregulates GPR87 is to be administered to the subject in an effective amount.

[0405] Embodiment 11: The kit of Embodiment 10. wherein the fibrotic disease is pulmonary fibrosis.

[0406] Embodiment 12: The kit of any one of Embodiments 10-11, wherein the fibrotic disease is idiopathic pulmonary fibrosis (IPF). liver fibrosis, or skin fibrosis.

[0407] Embodiment 13: The kit of any one of Embodiments 10-12. wherein the compound comprises at least one selected from the group consisting of: a small molecule inhibitor of GPR87, a protein inhibitor of GPR87, a nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference, a ribozy me that downregulates the expression level and / or activity of GPR87, and / or an expression vector expressing the ribozyme, an expression vector comprising an expression cassette, wherein the expression cassette expresses CRISPR components that downregulate the expression level and / or activity of GPR87 by CRISPR knockout or CRISPR knockdown, and a trans -dominant negative mutant protein of GPR87. and / or an expression vector that expresses the trans-dominant negative mutant protein of GPR87.

[0408] Embodiment 14: The kit of any one of Embodiments 10-13, wherein the compound comprises an antibody that binds GPR87.

[0409] Embodiment 15: The kit of any one of Embodiments 10-14. wherein the compound comprises an siRNA for knocking down GPR87, or an antisense oligonucleotide (ASO) for inhibiting GPR87.

[0410] Embodiment 16: The kit of Embodiment 15, wherein the compound comprises the siRNA, and at least one of the following applies:

[0411] (a) the siRNA comprises a sequence set forth in any one of SEQ ID NOs:9-59, (b) the siRNA comprises a sequence set forth in any one of SEQ ID NOs:104-151. Embodiment 17: The kit of Embodiment 15, wherein the compound comprises the ASO, and at least one of the following applies:

[0412] (a) the ASO comprises a sequence set forth in any one of SEQ ID NOs:60-81, optionally SEQ ID NOs: 66, 70, and 75, (b) the ASO comprises a sequence set forth in any one of SEQ ID NOs: 104-151, optionally SEQ ID NOs: 88, 92, and 97.

[0413] Embodiment 18: The kit of any one of Embodiments 10-17, wherein the subject is a human.

[0414] Embodiment 19: A molecule comprising:

[0415] (a) an siRNA molecule comprising a sequence set forth in any one of SEQ ID NOs: 9-59.

[0416] (b) an antisense oligonucleotide (ASO) comprising a sequence set forth in any one of SEQ ID NOs:60-81, or

[0417] (c) an ASO comprising a sequence set forth in any one of SEQ ID NOs: 66, 70, and 75.

[0418] Embodiment 20: The molecule of claim 19, wherein

[0419] (a) the siRNA comprises a sequence set forth in any one of SEQ ID NOs:4-6 and 104-151;

[0420] (b) the ASO comprises a sequence set forth in any one of SEQ ID NOs:82-103: or (c) the ASO comprises a sequence set forth in any one of SEQ ID NOs: 88, 92, and 97.

[0421] Embodiment 21: A composition comprising the molecule of any one of Embodiments 19-20, and a pharmaceutically acceptable carrier.

[0422] The foregoing outlines features of several embodiments so that those skilled in the art may better understand the aspects of the present disclosure. Those skilled in the art should appreciate that they may readily use the present disclosure as a basis for designing or modifying other processes and structures for carry ing out the same purposes and / or achieving the same advantages of the embodiments introduced herein. Those skilled in the art should also realize that such equivalent constructions do not depart from the spirit and scope of the present disclosure, and that they may make various changes, substitutions, and alterations herein without departing from the spirit and scope of the present disclosure.

Claims

CLAIMSWhat is claimed is:

1. A method of treating, ameliorating and / or preventing a fibrotic disease, the method comprising administering to the subject an effective amount of a compound that downregulates GPR87.

2. The method of claim 1, wherein the fibrotic disease is pulmonary fibrosis.

3. The method of any one of claims 1-2, wherein the fibrotic disease is idiopathic pulmonary fibrosis (IPF), liver fibrosis, or skin fibrosis.

4. The method of any one of claims 1-3, wherein the compound comprises at least one selected from the group consisting of:a small molecule inhibitor of GPR87,a protein inhibitor of GPR87,a nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference,a ribozyme that downregulates the expression level and / or activity of GPR87, and / or an expression vector expressing the ribozyme,an expression vector comprising an expression cassette, wherein the expression cassette expresses CRISPR components that downregulate the expression level and / or activity of GPR87 by CRISPR knockout or CRISPR knockdown, anda trans-dominant negative mutant protein of GPR87, and / or an expression vector that expresses the trans-dominant negative mutant protein of GPR87.

5. The method of any one of claims 1-4, wherein the compound comprises an antibody that binds GPR87.

6. The method of any one of claims 1-4, wherein the compound comprises an siRNA for knocking down GPR87, or an antisense oligonucleotide (ASO) for inhibiting GPR87.

7. The method of claim 6, wherein the compound comprises the siRNA, and at least oneof the following applies:(a) the siRNA comprises a sequence set forth in any one of SEQ ID NOs:9-59, (b) the siRNA comprises a sequence set forth in any one of SEQ ID NOs: 104-151.

8. The method of claim 6, wherein the compound comprises the ASO, and at least one of the following applies:(a) the ASO comprises a sequence set forth in any one of SEQ ID NOs:60-81, optionally SEQ ID NOs: 66, 70, and 75,(b) the ASO comprises a sequence set forth in any one of SEQ ID NOs:82-103, optionally SEQ ID NOs: 88, 92, and 97.

9. The method of any one of claims 1-8, wherein the subject is a human.

10. A kit for treating, ameliorating, and / or preventing a fibrotic disease in a subject, the kit comprising:a compound that downregulates GPR87; andan instruction manual instructing that the compound that downregulates GPR87 is to be administered to the subject in an effective amount.

11. The kit of claim 10, wherein the fibrotic disease is pulmonary fibrosis.

12. The kit of any one of claims 10-11, wherein the fibrotic disease is idiopathic pulmonary fibrosis (IPF), liver fibrosis, or skin fibrosis.

13. The kit of any one of claims 10-12, wherein the compound comprises at least one selected from the group consisting of:a small molecule inhibitor of GPR87,a protein inhibitor of GPR87,a nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates the expression level and / or activity of GPR87 by RNA interference,a ribozyme that downregulates the expression level and / or activity of GPR87, and / or an expression vector expressing the ribozyme.an expression vector comprising an expression cassette, wherein the expressioncassette expresses CRISPR components that downregulate the expression level and / or activity of GPR87 by CRISPR knockout or CRISPR knockdown, anda trans-dominant negative mutant protein of GPR87, and / or an expression vector that expresses the trans-dominant negative mutant protein of GPR87.

14. The kit of any one of claims 10-13, wherein the compound comprises an antibody that binds GPR87.

15. The kit of any one of claims 10-14, wherein the compound comprises an siRNA for knocking down GPR87, or an antisense oligonucleotide (ASO) for inhibiting GPR87.

16. The kit of claim 15, wherein the compound comprises the siRNA, and at least one of the following applies:(a) the siRNA comprises a sequence set forth in any one of SEQ ID NOs:9-59, (b) the siRNA comprises a sequence set forth in any one of SEQ ID NOs: 104-151.

17. The kit of claim 15, wherein the compound comprises the ASO, and at least one of the following applies:(a) the ASO comprises a sequence set forth in any one of SEQ ID NOs:60-81, optionally SEQ ID NOs:

66.

70. and 75.(b) the ASO comprises a sequence set forth in any one of SEQ ID NOs: 104-151, optionally SEQ ID NOs: 88, 92, and 97.

18. The kit of any one of claims 10-17, wherein the subject is a human.

19. A molecule comprising:(a) an siRNA molecule comprising a sequence set forth in any one of SEQ ID NOs: 9-59,(b) an antisense oligonucleotide (ASO) comprising a sequence set forth in any one of SEQ ID NOs:60-81, or(c) an ASO comprising a sequence set forth in any one of SEQ ID NOs: 66, 70, and 75.

20. The molecule of claim 19, wherein(a) the siRNA comprises a sequence set forth in any one of SEQ ID NOs:4-6 and 104- 151;(b) the ASO comprises a sequence set forth in any one of SEQ ID NOs:82-103; or (c) the ASO comprises a sequence set forth in any one of SEQ ID NOs: 88, 92, and 97.

21. A composition comprising the molecule of any one of claims 19-20, and a pharmaceutically acceptable carrier.