Construction method for quadruple-resistant animal and use thereof

Abstract

A nucleic acid molecule, comprising a resistance gene PuroR, a first linker, a resistance gene NeoR / KanR, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, and an EF1α promoter. The success rate for constructing a quadruple-resistant animal can reach 55%. Cells prepared from an embryo in a surrogate animal in the construction of a quadruple-resistant animal or cells prepared from the constructed quadruple-resistant animal have very good resistance to four drugs: Puro, BSD, Hygro, and G418.

Description

[Revised according to Rule 26, 09.01.2026] Methods for constructing and applying four-resistant animals Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the construction method of four-resistant animals and their applications. Technical Background

[0002] Primary cultured mouse embryonic fibroblasts (MEFs) serve as feeder cells, effectively maintaining the growth of human embryonic stem cells. Furthermore, MEFs and other feeder cells have been widely used in the culture of totipotent / pluripotent stem cells. Previous studies have shown that feeder cells play a crucial role in maintaining the long-term stability of ESC telomeres and in the unlimited self-renewal and developmental pluripotency of ESCs.

[0003] With the increasing availability of transgenic pluripotent / multipotent stem cells carrying various resistance gene vectors, there is a need for feeder cells resistant to several types of selective drugs. However, it is often difficult to obtain large quantities of MEFs transfected with exogenous DNA (i.e., drug resistance gene expression vectors). Therefore, it is necessary to construct four-resistant animals and their cell lines, which can be used to isolate four-resistant MEF cells to support the editing of ESC multi-resistance gene vectors or for the isolation of other four-resistant primary cells. Summary of the Invention

[0004] The first aspect of the present invention is to provide a nucleic acid molecule.

[0005] A second aspect of the present invention aims to provide biomaterials related to nucleic acid molecules of the first aspect of the present invention.

[0006] The third aspect of this invention aims to provide the application of the nucleic acid molecules of the first aspect of this invention or the biological materials of the second aspect of this invention.

[0007] The fourth aspect of this invention aims to provide a method for constructing a four-resistant animal.

[0008] The fifth aspect of this invention aims to provide a product.

[0009] The sixth aspect of this invention aims to provide a somatic cell, tissue, or organ.

[0010] The seventh aspect of this invention aims to provide a method for culturing stem cells.

[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0012] In a first aspect, the present invention provides a nucleic acid molecule comprising: a resistance gene PuroR, a first linker, a resistance gene NeoR / KanR, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, and an EF1α promoter.

[0013] In some embodiments, the nucleic acid molecule comprises, from the 5' end to the 3' end: the resistance gene PuroR, a first linker, the resistance gene NeoR / KanR, a second linker, the resistance gene HygR, a third linker, the resistance gene BSD, and the EF1α promoter.

[0014] In some embodiments, the first linker, the second linker, and the third linker are each independently selected from one or more of the 2A peptide and the internal ribosome entry site (IRES).

[0015] In some embodiments, the 2A peptide comprises one or more of P2A peptide, T2A peptide, F2A peptide, and E2A peptide; and further comprises one or more of P2A peptide and T2A peptide.

[0016] In some embodiments, the internal ribosome entry site (IRES) comprises one or more of the following: Kaposi's sarcoma-associated herpesvirus (KSHV) IRES, hepatitis virus IRES, pedisvirus IRES, cripavirus IRES, Rhopalosiphumpadi virus IRES, fibroblast growth factor IRES, platelet-derived growth factor IRES, vascular endothelial growth factor IRES, insulin-like growth factor IRES, small RNA virus IRES, encephalocarditis virus (EMCV) IRES, Pim-1 IRES, p53 IRES, Apaf-1 IRES, TDP2 IRES, L-myc IRES, and c-myc IRES.

[0017] In some embodiments, the nucleotide sequence of the resistance gene PuroR comprises:

[0018] a0) The coding sequence of the PuroR protein, wherein the amino acid sequence of the PuroR protein is the amino acid sequence encoded by nucleotides 1756-2355 of SEQ ID NO: 17; or

[0019] a1) Nucleotides 1756-2355 of SEQ ID NO: 17; or

[0020] a2) A nucleotide sequence of a1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in a1); or

[0021] a3) has at least 99%, 98%, 97%, 96%, and 95% homology with a1) and has the same function as the nucleic acid molecule shown in a1).

[0022] In some implementations, the first linker is an internal ribosome entry site (IRES).

[0023] In some embodiments, the nucleotide sequence of the first linker comprises:

[0024] b1) Nucleotides 2382-2949 of SEQ ID NO: 17; or

[0025] b2) A nucleotide sequence from b1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in b1); or

[0026] b3) has at least 99%, 98%, 97%, 96%, and 95% homology with b1) and has the same function as the nucleic acid molecule shown in b1).

[0027] In some embodiments, the nucleotide sequence of the resistance gene NeoR / KanR comprises:

[0028] c0) The coding sequence of the NeoR / KanR protein, wherein the amino acid sequence of the NeoR / KanR protein is the amino acid sequence encoded by nucleotides 2950-3744 of SEQ ID NO: 17; or

[0029] c1) Nucleotides 2950-3744 of SEQ ID NO: 17; or

[0030] c2) A nucleotide sequence of c1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in c1); or

[0031] c3) has at least 99%, 98%, 97%, 96%, and 95% homology with c1) and has the same function as the nucleic acid molecule shown in c1).

[0032] In some embodiments, the second linker is a T2A peptide.

[0033] In some embodiments, the nucleotide sequence of the second linker comprises:

[0034] d0) The coding sequence of the T2A peptide, wherein the amino acid sequence of the T2A peptide is the amino acid sequence encoded by nucleotides 3745-3813 of SEQ ID NO: 17; or

[0035] d1) Nucleotides 3745-3813 of SEQ ID NO: 17; or

[0036] d2) A nucleotide sequence of d1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in d1); or

[0037] d3) has at least 99%, 98%, 97%, 96%, and 95% homology with d1), and has the same function as the nucleic acid molecule shown in d1).

[0038] In some embodiments, the nucleotide sequence of the resistance gene HygR comprises:

[0039] e0) The coding sequence of the HygR protein, wherein the amino acid sequence of the HygR protein is the amino acid sequence encoded by nucleotides 3814-4836 of SEQ ID NO: 17; or

[0040] e1) Nucleotides 3814-4836 of SEQ ID NO: 17; or

[0041] e2) A nucleotide sequence of e1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in e1); or

[0042] e3) has at least 99%, 98%, 97%, 96%, and 95% homology with e1) and has the same nucleotide sequence as the nucleic acid molecule shown in e1).

[0043] In some embodiments, the third linker is a P2A peptide.

[0044] In some embodiments, the nucleotide sequence of the third linker comprises:

[0045] f0) The coding sequence of the P2A peptide, wherein the amino acid sequence of the P2A peptide is the amino acid sequence encoded by nucleotides 4837-4902 of SEQ ID NO: 17; or

[0046] f1) Nucleotides 4837-4902 of SEQ ID NO: 17; or

[0047] f2) A nucleotide sequence of f1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in f1); or

[0048] f3) has at least 99%, 98%, 97%, 96%, and 95% homology with f1), and has the same nucleotide sequence as the nucleic acid molecule shown in f1).

[0049] In some embodiments, the nucleotide sequence of the resistance gene BSD comprises:

[0050] g0) The coding sequence of the BSD protein, wherein the amino acid sequence of the BSD protein is the amino acid sequence encoded by nucleotides 4912-5307 of SEQ ID NO: 17; or

[0051] g1) Nucleotides 4912-5307 of SEQ ID NO: 17; or

[0052] g2) A nucleotide sequence of g1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in g1); or

[0053] g3) has at least 99%, 98%, 97%, 96%, and 95% homology with g1) and has the same nucleotide sequence as the nucleic acid molecule shown in g1).

[0054] In some embodiments, the nucleotide sequence of the EF1α promoter comprises:

[0055] h1) Nucleotides 5341-6599 of SEQ ID NO: 17; or

[0056] h2) A nucleotide sequence of h1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in h1); or

[0057] h3) has at least 99%, 98%, 97%, 96%, and 95% homology with h1) and has the same nucleotide sequence as the nucleic acid molecule shown in h1).

[0058] In some embodiments, the 5' end of the resistance gene PuroR also includes a posttranscriptional regulatory element.

[0059] In some embodiments, the post-transcriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

[0060] In some embodiments, the 5' end of the posttranscriptional regulatory element further includes a polyadenylation signal.

[0061] In some embodiments, the polyadenylation signal is selected from one or more of SV40polyA, human growth hormone (HGH) polyA, bovine growth hormone (BGH) polyA, β-globin polyA, α-globin polyA, ovalbumin polyA, κ-light chain polyA, and synthetic polyA; more specifically, SV40polyA.

[0062] In some embodiments, the nucleotide sequence of the polyadenylation signal comprises:

[0063] j1) Nucleotides 1013-1134 of SEQ ID NO: 17; or

[0064] j2) A nucleotide sequence of j1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in j1); or

[0065] j3) has at least 99%, 98%, 97%, 96%, and 95% homology with j1) and has the same function as the nucleic acid molecule shown in j1).

[0066] In some embodiments, the nucleotide sequence of the post-transcriptional regulatory element comprises:

[0067] k1) Nucleotides 1170-1755 of SEQ ID NO: 17; or

[0068] k2) is a nucleotide sequence of k1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in k1); or

[0069] k3) has at least 99%, 98%, 97%, 96%, and 95% homology with k1) and has the same function as the nucleic acid molecule shown in k1).

[0070] In some embodiments, the EF1α promoter further includes a Kozak sequence (nucleotides 5304-5313 of SEQ ID NO: 17) between it and the resistance gene BSD.

[0071] In some embodiments, the 3' end of the EF1α promoter further includes a 3' homologous arm.

[0072] In some embodiments, the nucleotide sequence of the 3' homologous arm comprises:

[0073] l1) Nucleotides 6644-8143 of SEQ ID NO: 17; or

[0074] l2) A nucleotide sequence of l1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in l1); or

[0075] l3) has at least 99%, 98%, 97%, 96%, and 95% homology with l1) and has the same function as the nucleic acid molecule shown in l1).

[0076] In some embodiments, the 5' end of the polyadenylation signal further includes a 5' homologous arm.

[0077] In some embodiments, the nucleotide sequence of the 5' homologous arm comprises:

[0078] m1) Nucleotides 7-1006 of SEQ ID NO: 17; or

[0079] m2) is a nucleotide sequence of m1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in m1); or

[0080] m3) has at least 99%, 98%, 97%, 96%, and 95% homology with m1) and has the same nucleotide sequence as the nucleic acid molecule shown in m1).

[0081] In some embodiments, the nucleic acid molecule includes, from the 5' end to the 3' end: a 5' homologous arm, a polyadenylation signal, a posttranscriptional regulatory element, the resistance gene PuroR, a first linker, the resistance gene NeoR / KanR, a second linker, the resistance gene HygR, a third linker, the resistance gene BSD, a Kozak sequence, an EF1α promoter, and a 3' homologous arm.

[0082] In some embodiments, the nucleotide sequence of the nucleic acid molecule comprises:

[0083] n1) Nucleotides 7-8143 of SEQ ID NO: 17; or

[0084] n2) A nucleotide sequence of n1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in n1); or

[0085] n3) has at least 99%, 98%, 97%, 96%, and 95% homology with n1) and has the same function as the nucleic acid molecule shown in n1).

[0086] A second aspect of the invention provides a biomaterial related to the nucleic acid molecule of the first aspect of the invention, said biomaterial comprising any one of (o1)-o7):

[0087] o1) An expression cassette comprising the nucleic acid molecule of the first aspect of the present invention;

[0088] o2) Plasmids containing nucleic acid molecules from the first aspect of this invention;

[0089] o3) contains a plasmid containing the expression cassette described in o1);

[0090] o4) Cells containing nucleic acid molecules from the first aspect of this invention;

[0091] o5) Cells containing the expression cassette described in o1);

[0092] o6) Cells containing the plasmid described in o2);

[0093] o7) contains cells containing the plasmid described in o3).

[0094] In some embodiments, the cells described in o4)-o7) do not contain reproductive material.

[0095] In some embodiments, the plasmids described in o2)-o3) are homologous recombinant plasmids.

[0096] In some embodiments, the plasmids described in o2)-o3) further comprise a basic plasmid (preferably the Rosa26 plasmid).

[0097] In some embodiments, the nucleotide sequence of the plasmid described in o2)-o3) comprises:

[0098] p1)SEQ ID NO: 17; or

[0099] p2) A nucleotide sequence of p1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in p1); or

[0100] p3) has at least 99%, 98%, 97%, 96%, and 95% homology with p1) and has the same nucleotide sequence as the nucleic acid molecule shown in p1).

[0101] A third aspect of the invention provides the use of the nucleic acid molecule of the first aspect of the invention, or the biological material of the second aspect of the invention, in any one of q1)-q2):

[0102] q1) Construct animals with four resistances;

[0103] q2) Prepare products for constructing animals with four resistances.

[0104] In some implementations, the animal is a non-human mammal.

[0105] In some embodiments, the non-human mammal is a rodent.

[0106] In some embodiments, the rodent is a rat or a mouse.

[0107] In some implementations, the product is a reagent kit.

[0108] A fourth aspect of the present invention provides a method for constructing a four-resistant animal by introducing a nucleic acid molecule from the first aspect of the present invention into the fertilized egg or somatic cell of the animal.

[0109] In some embodiments, the method for constructing the four-resistant animal further includes the following steps:

[0110] Fertilized eggs infused with the nucleic acid molecules of the first aspect of this invention are transplanted into the oviduct of a surrogate animal to obtain animals with four types of resistance; or

[0111] The nucleus of a somatic cell infused with the nucleic acid molecule of the first aspect of this invention is transplanted into an enucleated oocyte, and then the enucleated oocyte after nuclear transfer is transplanted into the oviduct of a surrogate animal to obtain a four-resistant animal.

[0112] In some embodiments, the method of introducing the nucleic acid molecule of the first aspect of the present invention into the fertilized egg or somatic cell of the animal is: microinjecting the plasmid of the second aspect of the present invention into the fertilized egg or somatic cell of the animal.

[0113] In some embodiments, the microinjection system further includes Cas protein and sgRNA.

[0114] In some embodiments, the Cas protein is the Cas9 protein.

[0115] In some embodiments, the sgRNA is sgRNA-Rosa26 (sgRNA targeting Rosa26).

[0116] In some embodiments, the animal is the animal described in the third aspect of the invention.

[0117] A fifth aspect of the present invention provides a product comprising: a nucleic acid molecule of the first aspect of the present invention or a biological material of the second aspect of the present invention.

[0118] In some embodiments, the product comprises: the plasmid of the second aspect of the present invention.

[0119] In some embodiments, the product further comprises: Cas protein and sgRNA.

[0120] In some embodiments, the Cas protein is the Cas9 protein.

[0121] In some embodiments, the sgRNA is sgRNA-Rosa26.

[0122] In some implementations, the product is used to construct animals with four resistances.

[0123] In some embodiments, the animal is the animal described in the third aspect of the invention.

[0124] In some implementations, the product is a reagent kit.

[0125] A sixth aspect of the present invention provides a somatic cell, tissue, or organ prepared from a four-resistant animal obtained by the construction method of the fourth aspect of the present invention.

[0126] In some embodiments, the somatic cells, tissues, or organs are prepared from embryos of fertilized animals after being caged by the construction method of the fourth aspect of the present invention.

[0127] In some embodiments, the somatic cells, tissues, or organs are not embryos.

[0128] In some embodiments, the somatic cells are feeder cells.

[0129] In some embodiments, the feeder cells are fibroblasts; more specifically, mouse embryonic fibroblasts.

[0130] A seventh aspect of the present invention provides a method for culturing stem cells, comprising the step of using feeder layer cells as described in the sixth aspect of the present invention.

[0131] In some embodiments, the method includes the step of seeding stem cells onto feeder cells as described in the sixth aspect of the invention for culture.

[0132] In some embodiments, the stem cells are mouse embryonic stem cells.

[0133] The beneficial effects of this invention are:

[0134] This invention provides a nucleic acid molecule comprising: a resistance gene PuroR, a first linker, a resistance gene NeoR / KanR, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, and an EF1α promoter; the success rate of constructing a four-resistant animal using this nucleic acid molecule can reach 55%; and the embryos from surrogate animals used in the construction of the four-resistant animal, or cells prepared from the constructed four-resistant animal, exhibit excellent resistance to four drugs: Puro, BSD, Hygro, and G418. Attached Figure Description

[0135] Figure 1 shows a graph of segment 1 in Example 1.

[0136] Figure 2 shows the plasmid spectrum and flow rate test results of the four-antibody plasmid in Example 1.

[0137] Figure 3 shows the results of 5' homologous arm directional insertion identification in the genotyping of four-resistant mice in Example 1 (WT is the wild-type mouse genome control).

[0138] Figure 4 shows the results of 3' homologous arm directional insertion identification in the genotyping of four-resistant mice in Example 1 (WT is the wild-type mouse genome control).

[0139] Figure 5 shows the results of the directional insertion identification of resistance genes in the genotyping of four-resistant mice in Example 1 (WT is the wild-type mouse genome control).

[0140] Figure 6 shows the results of the four-antibiotic feeder resistance test in Example 1.

[0141] Figure 7 shows the test results of mES seeding onto the four-resistance feeder in Example 1.

[0142] Figure 8 shows the plasmid pattern and flow rate results of the four-antibody plasmid in Comparative Example 1.

[0143] Figure 9 shows the results of 3' homologous arm directional insertion identification in the genotyping of four-resistant mice in Comparative Example 1 (WT is the wild-type mouse genome control).

[0144] Figure 10 shows the results of the four-antibiotic feeder resistance test in Comparative Example 1.

[0145] Figure 11 shows the plasmid pattern and flow rate results of the four-antibody plasmid in Comparative Example 2.

[0146] Figure 12 shows the results of 5' homologous arm directional insertion identification in the genotyping of four-resistant mice in Comparative Example 2 (WT is the wild-type mouse genome control).

[0147] Figure 13 shows the results of the four-antibiotic feeder resistance test in Comparative Example 2. Detailed implementation method:

[0148] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of this application in any way. The actual scope of protection of this application is set forth in the claims.

[0149] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0150] The present invention will be further described in detail below through specific embodiments.

[0151] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0152] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available. For reagents whose manufacturers are listed, similar products from other manufacturers are substituted.

[0153] Example 1: Preparation of tetra-resistant mice and their MEF cells

[0154] 1. Construction of four-resistance plasmids

[0155] 1.1. Plasmid backbone digestion: Plasmid Rosa-EF1a-rtTA-2A-puro was digested with NheⅠ and PacⅠ restriction sites. After confirming the digestion was correct by agarose gel electrophoresis, the target fragment was purified and recovered using a HiPure Gel Pure DNA Mini Kit to obtain fragment 1 (the pattern is shown in Figure 1, and the sequence of fragment 1 is shown in SEQ ID NO:1). The digestion system and reaction procedure are shown in Tables 1 and 2.

[0156] Table 1 Enzyme digestion system

[0157] Table 2 Enzyme digestion reaction procedures

[0158] 1.2. Primers were designed based on the sequences, and the following fragments were amplified by PCR: WPRE+PolyA, Puro, IRES, NeoR / KanR, Hygr, and BSD+P2A. The primer sequences are shown in Table 3.

[0159] Table 3 Primer sequences

[0160] 1.3. BSD+P2A, HygR, and NeoR / KanR were ligated using overlap PCR, and T2A was introduced between HygR and NeoR / KanR to form fragment 2 (the sequence of fragment 2 is shown in SEQ ID NO:14); IRES, PuroR, and WPRE+PolyA were ligated using overlap PCR to form fragment 3 (the sequence of fragment 3 is shown in SEQ ID NO:15). The overlap PCR system is shown in Tables 4 and 5. The PCR program is shown in Table 7.

[0161] Table 4. Fragment 2: Overlap PCR System

[0162] Table 5. Fragment 3: Overlap PCR System

[0163] 1.4. Fragment 2 and fragment 3 were ligated using overlap PCR to form fragment 4 (the sequence of fragment 4 is shown in SEQ ID NO:16). The overlap PCR system is shown in Table 6, and the PCR program is shown in Table 7.

[0164] Table 6. Fragment 4: Overlap PCR System

[0165] Table 7 Overlap PCR Program

[0166] 1.5. Fragment 1 and fragment 4 were used to construct a four-antibody plasmid via homologous recombination. The specific steps of the homologous recombination reaction are as follows:

[0167] The optimal amount of linearized carrier (fragment 1) used in the recombination reaction is 0.03 pmol, and the optimal molar ratio of carrier to insert fragment is 1:2 or 1:3. Taking 1:2 as an example:

[0168] The optimal linearization carrier dosage (0.03 pmol) = [0.02 × number of base pairs] ng;

[0169] The optimal amount of insert used (0.06 pmol) = [0.02 × number of base pairs × 2] ng;

[0170] Conversion and identification of assembled products:

[0171] Thawing competent cells (e.g., DH5α) for cloning on ice;

[0172] Add 5 μL of the assembly product to 100 μL of competent cells (the volume of the recombinant product should not exceed 10% of the volume of competent cells), gently tap the tube wall to mix (do not shake to mix), and let stand on ice for 30 min.

[0173] After heat shock in a 42℃ water bath for 45 seconds, immediately place it on ice to cool for 2-3 minutes;

[0174] Add 900 μL of LB medium (without antibiotics) and incubate at 37°C for 1 hour (200-250 rpm).

[0175] Centrifuge at 4000 rpm for 3 min, discard 800 μL, resuspend in the remaining 200 μL of liquid, and incubate on a plate containing the correct antibiotic.

[0176] After overnight incubation at 37°C, hundreds of single colonies can be formed on the plate. Several single colonies are selected for colony PCR identification.

[0177] The bacterial cultures corresponding to the correctly identified single clones were used to extract plasmids using the Tiangen Micrograft Kit for subsequent enzyme digestion and sequencing identification.

[0178] The final spectrum and throughput results of the constructed four-antibody plasmid (C009-4KX-ROSA_EF1α-BSD-Hgy-Neo-Puro) are shown in Figure 2.

[0179] The sequence of the four-antibody plasmid is shown in SEQ ID NO: 17, wherein nucleotides 07-1006 are 5' homologous arms (5'arm); nucleotides 1013-1134 are SV40. ploy(A)signal; nucleotides 1170-1755 are WPRE; nucleotides 1756-2355 are PuroR; nucleotides 2382-2949 are IRES; nucleotides 2950-3744 are NeoR / KanR; nucleotides 3745-3813 are T2A; nucleotides 3814-4836 are HygR; nucleotides 4837-4902 are P2A; nucleotides 4912-5307 are BSD; nucleotides 5304-5313 are the Kozak sequence; nucleotides 5341-6599 are the EF-1α promoter; nucleotides 6644-8143 are the 3' homologous arm (3' arm).

[0180] 2. In situ microinjection

[0181] Three- to five-week-old ICR female mice were selected as superovulatory donors and injected intraperitoneally with 5 IU of pregnant mare serum gonadotropin (PMSG). Forty-eight hours later, 5 IU of human chorionic gonadotropin (HCG) was injected. After HCG injection, each female mouse was placed in a separate cage with a normal ICR male mouse, and the vaginal plug was examined the following morning. The donor female mice were then euthanized by cervical dislocation, and the intact oviducts were excised and placed in M2 culture medium containing 0.3 mg / mL hyaluronidase. The bulging ampulla was located under a dissecting microscope and torn open with forceps. The fertilized eggs, with granulosa cells removed, were transferred to M16 culture medium and then incubated at 37°C with 5% CO2.

[0182] Zygotes with binucleates and good morphology were selected, and the laboratory-available high-efficiency sgRNA-Rosa26 90pmol (Genscript), the corresponding four-antibody plasmid 1ug, and Cas9 protein 30pmol (NEB0646) were injected into the nucleus of ICR fertilized eggs.

[0183] After weighing the surrogate female mice, anesthesia was administered intraperitoneally at the prescribed concentration. The mice were placed on the lid of a 9mm plastic culture dish until fully anesthetized. The fertilized eggs to be transferred were aspirated into the transfer tube. Before aspirating the fertilized eggs, a small air bubble was aspirated into the transfer tube, followed by M2 culture medium (M7167, Sigma-Aldrich), the fertilized eggs, and another small air bubble at the end. The transfer tube was then hung on a stereoscope for later use. The anesthetized female mouse was disinfected, and a small incision was made in the skin along the midline of the back, starting from the last rib. The wound and fur were wiped with 70% ethanol. The fallopian tubes and ovaries could be accessed through a dorsal incision parallel or perpendicular to the spine. An opening was made in the body wall near the fallopian tubes using micromanipulation forceps. The fat pads were removed with forceps, exposing the fallopian tubes and ovaries outside the body cavity, and secured with small spring clips. Under the stereoscope, the opening of the fallopian tube (fimbriae) was located, the position of the mouse and fallopian tubes was adjusted, and the ovarian sac was torn open. Using microinjection forceps in one hand, lift the fallopian tube and the fimbrial opening with the other. Insert the transfer cannula into the fimbrial opening and place the fertilized egg inside. The presence of air bubbles within the fallopian tube indicates successful transfer. Release the spring clamps and return the fallopian tube and ovary to the body. Suture the body wall and skin wounds. After the procedure, place the mouse in a clean cage and keep it warm until fully awake before returning it to the cage rack. Await the surrogate female's delivery.

[0184] 3. Genotyping of mice with four resistances

[0185] After the surrogate female mice gave birth, the pups were harvested at approximately 0.5 cm in length for genome extraction and identification once they reached two weeks of age. PCR analysis was performed on the HDR and resistance insert fragments used for targeted insertion into the mouse Rosa26 locus.

[0186] The upstream of the primer for directional insertion of the 5' homologous arm was located on the outer side of the 5' homologous arm (Rosa-5KI-F1: gccaataatcaaattactctttaagcactgg (SEQ ID NO:18)), and the downstream was located on the WPRE+PolyA fragment (WPRE-F1: cctccttgtataaatcctggctgtct (SEQ ID NO:19)). The upstream primer for identifying the 3' homologous arm directional insertion was located on the EF1-alpha fragment (EF1a-R1: aacacgacatcactttcccagtttacc (SEQ ID NO:20)), and the downstream primer was located on the outer side of the 3' homologous arm (Rosa-3KI-R1: ttctgagaccattctcagtggctcaac (SEQ ID NO:21)). The upstream and downstream primers for identifying the resistance insertion were located on the WPRE+PolyA and Puro fragments, respectively (PolyA-F2: TAGATACATTGATGAGTTTGGACAAACC (SEQ ID NO:22); Puro-R2: GTGCCCGCCTTCCTGGAG (SEQ ID NO:23)).

[0187] If the recombinant vector is inserted in the correct position, a band of 1875 bp should appear at the 5' homologous arm oriented insertion site, a band of 2133 bp should appear at the 3' homologous arm oriented insertion site, and the fragment size for resistance insertion identification should be 878 bp.

[0188] The PCR identification results are shown in Figures 3, 4, and 5: The four-antibiotic mice (2#, 3#, 4#, 5#, 11#, 12#, 13#, 15#, 17#, 18#, and 20#) were successfully constructed (genotypes are shown in Table 8), with a construction success rate of 55%.

[0189] Table 8. Genotyping results of mice with four resistances

[0190] 4. Separation of MEFs with four resistances

[0191] 4.1. The pregnant mice that were obtained in step 3 above and were positive for four types of antibodies were euthanized by cervical dislocation and kept in the same cage for 3.5-14.5 days after birth (the mice were disinfected by immersing their bodies in 75% medical alcohol).

[0192] 4.2. Line the intercellular biosafety cabinet with clean plastic wrap, and place the sterilized pregnant mouse supine on the sterile plastic wrap. Wipe the abdomen three times with iodine tincture, and then wipe it three times with 75% alcohol.

[0193] 4.3. Use sterile ophthalmic scissors to make a small incision above the mouse urethra, and pull it open by hand to expose the peritoneum.

[0194] 4.4. Using fresh scissors, cut open the peritoneum to expose segments of the enlarged uterus. Lift one uterine horn with ophthalmic forceps and remove the connective tissue with scissors. Cut off the uterus and place it in a 100mm culture dish containing DPBS with 100x antibiotics.

[0195] 4.5. Wash three times with DPBS containing double antibiotics, carefully cut open the uterine wall with ophthalmic scissors, separate the embryos, count them, and transfer the embryos to a new 100mm culture dish.

[0196] 4.6. Use tweezers to forcefully pull open the uterine wall of the pregnant mouse to separate the E13.5-14.5 day embryos encased in amniotic fluid. Then tear open the amnion and transfer the embryos to a new culture dish containing DPBS.

[0197] 4.7. Using scissors and tweezers, remove the head, tail, limbs, and darker-colored internal organs from the embryo. Wash the remaining part three times with DPBS.

[0198] 4.8. Remove the embryo and place it in a clean 100mm culture dish. Use ophthalmic scissors to cut the tissue for 5-10 minutes. Add 2mL of 0.15% trypsin (0.05% and 0.25% mixed in equal proportions) and continue cutting for 2 minutes.

[0199] 4.9. Add 3 mL of trypsin to each embryo, then add fresh 15% trypsin and incubate at 37°C for 15 minutes. During this time, remove the pipette and blow air through it for about 1 minute. Repeat this process three times.

[0200] 4.10. Add an equal volume of 15% FBS medium containing antibiotics to stop digestion, mix well, transfer to a 50mL centrifuge tube, centrifuge at 250g for 5 minutes, discard the supernatant, the precipitate contains MEF cells.

[0201] 4.11. Resuspend the cells in 10% FBS medium and seed them into three 15cm culture dishes at a rate of one embryo per dish. Incubate overnight at 37°C. Observe cell morphology under a microscope the next day. Change the medium daily and freeze the cells when the cell density reaches 90%.

[0202] 4.12. When freezing, first aspirate the culture medium, wash the cells once with 5 mL of DPBS to remove the DPBS, add 3 mL of 0.05% trypsin, and digest at 37°C for 3-5 minutes. When most of the cells have been digested, add an equal volume of 10% FBS culture medium, gently and repeatedly pipette the cells to mix them evenly, then transfer them to a 50 mL centrifuge tube and centrifuge at 250 g for 5 minutes.

[0203] 4.13. Count the cells under a microscope, according to a count of 2-3 × 10⁻³. 6Add 500 μL of cryopreservation solution to the cells, resuspend the cells in the solution, and aliquot 500 μL into each cryovial. Quickly transfer the cells to a cryopreservation box and place them in a -80°C freezer overnight. The next day, transfer them to a liquid nitrogen tank for long-term storage.

[0204] 5. Preparation of four-resistant feeders

[0205] 5.1 Remove one of the four-resistance MEFs obtained above from the liquid nitrogen tank, place the cryovial in a 37°C water bath, and gently shake it, being careful not to let the water overflow the cap. Stop the water bath when only small ice clumps remain.

[0206] 5.2. Wipe the cryovial with 75% ethanol, aspirate into a 15 mL centrifuge tube, slowly add 10% FBS high-glucose DMEM medium, and gently shake.

[0207] 5.3. Centrifuge at 250g for 5 minutes, discard the supernatant, and resuspend the cells in 5mL of culture medium.

[0208] 5.4. Add 6 mL of 0.1% gelatin to the petri dish and incubate for 30 min. Discard the gelatin before use.

[0209] 5.5. Transfer the cell suspension to a 15cm culture dish treated with gelatin, add 18mL of culture medium, and incubate at 37°C in a carbon dioxide incubator.

[0210] 5.6. Generally, it will be fully grown in 2 days and can then be propagated (generally, the better-growing ones can propagate to 3 or 4 generations as P2 generation).

[0211] 5.7. After one day, it can be passaged again, from 1 to 4, which is the P3 generation. At this time, it can be used to prepare feeder cells.

[0212] 5.8. Preparation of mitomycin C working solution: Mitomycin C stock solution (1 mg / mL) is diluted 100 times with culture medium to obtain mitomycin C working solution (working concentration is 10 μg / mL).

[0213] 5.9. Remove the culture medium from the P3 generation MEF culture dishes, add 15 mL of mitase C working solution to each 15 cm culture dish, and incubate at 37°C in a carbon dioxide incubator for 3 hours.

[0214] 5.10. Remove the culture medium, add 5 mL of PBS to each 15 cm culture dish and wash 3 times, then remove the PBS.

[0215] 5.11. Add 3 mL of 0.05% trypsin. After digestion, add culture medium to stop digestion. Collect the cells by blowing them off into a 50 mL centrifuge tube and centrifuge at 250 g for 5 min.

[0216] 5.12. Discard the supernatant and resuspend in culture medium.

[0217] 5.13. Frozen each tube for 5 × 10 6 cell.

[0218] 5.14. Quickly transfer the cells to a cryopreservation box and incubate at -80°C overnight.

[0219] 6. Detection of four-resistant feeders

[0220] Embryos from E13.5WT pregnant mice were directly isolated from the four-resistant feeder and WT feeder (refer to "4. Isolation of four-resistant MEF") and revived into 24-well plates. Each well was treated with 10% FBS medium containing 1 μg / mL Puro (Puromycin dihydrochloride), 10% FBS medium containing 10 μg / mL BSD (Blasticidin S), 10% FBS medium containing 200 μg / mL Hygro (Hygromycin B), and 10% FBS medium containing 500 μg / mL G418 (neomycin), respectively. The feeder was used to test for resistance, and one well of each was left as a control with 10% FBS medium containing the corresponding concentration of antibiotic. The 24-well plate was placed in a 37°C CO2 incubator and cultured for 3 days. The medium was changed and observed every day. The results of the four drug resistance tests on day 3 are shown in Figure 6: the cell mortality rate of the WT group was 100%, and the cell mortality rate of the four resistance groups was 0%.

[0221] The mESCs (micetic embryonic stem cells) were seeded onto a four-antibiotic feeder for testing, as follows: The four-antibiotic feeder was revived into 12-well plates one day in advance. On the second day, 10,000 mESCs were revived into the four-antibiotic feeder per well. The cells were shaken using the "cross method" to mix them and then placed in a 37℃ / CO2 incubator for 3 days. The medium was changed and the cells were observed daily. The state of the mESCs on day 3 is shown in Figure 7. The mESCs were in good condition, with raised colonies and smooth edges.

[0222] Comparative Example 1: Preparation of Four-Antibiotic Mice and Their MEF Cells

[0223] Compared with Example 1, the four resistance plasmids in this comparative example are driven by the EF-1α promoter for BSD, HygR, and NeoR / KanR, and linked by P2A and T2A respectively, while PuroR is driven by the PGK promoter alone. In order to avoid the influence of the Rosa26 forward promoter, the four resistance genes in Comparative Example 1 are inserted in reverse at the Rosa26 site.

[0224] 1. Plasmid backbone digestion: The four-antibody plasmid constructed in point 1 of Example 1 was digested with NheⅠ and Notl restriction sites. After confirming the digestion was correct by agarose gel electrophoresis, the target fragment was purified and recovered using a gel recovery kit (HiPure Gel Pure DNA Mini Kit) to obtain fragment 5 (the sequence of fragment 5 is shown as SE Q ID NO:24). The digestion system and reaction procedure are the same as those in Tables 1 and 2.

[0225] 2. Design PCR primers (specific primer sequences are shown in Table 9), and amplify fragment 6 (the sequence of fragment 6 is shown in SEQ ID NO:25), WPRE+PolyA and PGK promoter+PuroR sequences by PCR. Primer sequences are shown in Table 9.

[0226] Table 9 PCR Primer Sequences

[0227] 3. The above three fragments (fragment 6, WPRE+PolyA and PGK promoter+PuroR) were ligated into fragment 7 (the sequence of fragment 7 is shown in SEQ ID NO:32) by overlap PCR. The system of overlap PCR is shown in Table 10, and the PCR program is shown in Table 7.

[0228] Table 10. Fragment 7: Overlap PCR System

[0229] 4. Fragment 5 and fragment 7 obtained from the enzyme digestion vector were used to construct a four-antibody plasmid (the sequence of the four-antibody plasmid is shown in SEQ ID NO:33). The plasmid sequencing chromatogram is shown in Figure 8. The homologous recombination reaction was performed in the same manner as in Example 1.

[0230] 5. The in-situ microinjection method is the same as in Example 1, except that the four-antibody plasmid prepared in point 4 of this comparative example is used.

[0231] 6. Genotyping of the four-antibiotic mice was the same as in Example 1, except that the primers used were 3' homologous arm directional insertion primers (3KI-F1: AACCTCCCCTTCTACGAGCG, SEQ ID NO: 50; 3KI-R1: tggagtagttactccactttcaagttcc, SEQ ID NO: 51). If inserted correctly, the PCR band size was close to 2000bp. As shown in Figure 9, mice #16 and #20 were positive, with a success rate of 5.5%.

[0232] 7. Following the methods outlined in Example 1, "4. Isolation of the four-resistant MEF", "5. Preparation of the four-resistant feeder", and "6. Detection of the four-resistant feeder", the four-resistant feeder was isolated, prepared, and detected. The results are shown in Figure 10: In the WT group, the mortality rate of PURO, BSD, and Hygro groups was 100%, and that of the G418 group was 99%; in the four-resistant group, the mortality rate of PURO, BSD, and Hygro groups was 0%, and that of the G418 group was 99%.

[0233] Comparative Example 2: Preparation of Four-Antibiotic Mice and Their MEF Cells

[0234] Compared with Example 1, the four-resistance plasmid in this comparative example has the EF-1α promoter replaced with the strongly expressed CAG promoter, and the order of the resistance genes has been changed to BSD, PuroR, NeoR / KanR, HygR, and the last resistance gene has been changed to use E2A linker.

[0235] 1. Primers were designed, and six fragments, namely CAG promoter, BSD, PuroR, NeoR / KanR, Hygr, and WPRE+PolyA, were amplified by PCR. The primer sequences are shown in Table 11.

[0236] Table 11 Primer sequences

[0237] 2. The above six fragments (CAG promoter, BSD, PuroR, NeoR / KanR, Hygr, and WPRE+PolyA) were ligated using overlap PCR, and P2A, T2A, and E2A sequences were introduced between BSD and Puro, Puro and NeoR / KanR, and NeoR / KanR and Hygr, respectively, to form fragment 8 (the sequence of fragment 8 is shown in SEQ ID NO:46). The overlap PCR system is shown in Table 12, and the PCR program is shown in Table 7.

[0238] Table 12. Fragment 7: Overlap PCR System

[0239] 3. The enzyme digestion vector fragment 5 and fragment 8 obtained in Comparative Example 1 were used to construct a four-antibody plasmid (the sequence of the four-antibody plasmid is shown in SEQ ID NO:47) via homologous recombination. The plasmid sequencing chromatogram is shown in Figure 11. The homologous recombination reaction was performed in the same manner as in Example 1.

[0240] 4. The in-situ microinjection method is the same as in Example 1, except that the four-antibody plasmid prepared in point 3 of this comparative example is used.

[0241] 5. Genotyping of the four-resistant mice was the same as in Example 1, except that the primers were (5KI-F2: tgcagacttgtgggatacagaagacc, SEQ ID NO:48; 5KI-R2: tggcgttactatgggaacatacgtc, SEQ ID NO:49), and the positive band size was 1345 bp. The identification results are shown in Figure 12. Mice #3 and #8 were positive, and the success rate of construction was 11.1%.

[0242] 6. Following the methods described in Example 1, "4. Isolation of the four-resistant MEF", "5. Preparation of the four-resistant feeder", and "6. Detection of the four-resistant feeder", the four-resistant feeder was isolated, prepared, and detected. The results are shown in Figure 13: In the WT group, the mortality rate of PURO, BSD, Hygro, and G418 groups was 100%; in the four-resistant group, the mortality rate of PURO and BSD groups was 0%, while the mortality rate of Hygro group was 100%, and the mortality rate of G418 group was 90%.

[0243] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A nucleic acid molecule comprising: a resistance gene PuroR, a first linker, a resistance gene NeoR / KanR, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, and an EF1α promoter. 2.The nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises, from 5’-end to 3’-end: a resistance gene PuroR, a first linker, a resistance gene NeoR / KanR, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, and an EF1α promoter. Preferably, each of the first linker, the second linker, and the third linker is independently selected from one or more of a 2A peptide and an internal ribosome entry site (IRES). Preferably, the 2A peptide comprises one or more of a P2A peptide, a T2A peptide, a F2A peptide, and an E2A peptide. Preferably, the internal ribosome entry site comprises one or more of a Kaposi's sarcoma-associated herpesvirus IRES, a hepatitis virus IRES, a Pestivirus IRES, a Crinivirus IRES, a Aphid IRES, a Fibroblast growth factor IRES, a Platelet-derived growth factor IRES, a Vascular endothelial growth factor IRES, an Insulin-like growth factor IRES, a Picornavirus IRES, a Encephalomyocarditis virus IRES, a Pim-1 IRES, a p53 IRES, an Apaf-1 IRES, a TDP2 IRES, an L-myc IRES, and a c-myc IRES. 3.The nucleic acid molecule of any one of claims 1-2, wherein the nucleotide sequence of the resistance gene PuroR comprises: a0) a coding sequence of a PuroR protein, wherein the amino acid sequence of the PuroR protein is the amino acid sequence encoded by the nucleotides 1756-2355 of SEQ ID NO: 17; or a1) the nucleotides 1756-2355 of SEQ ID NO: 17; or a2) a nucleotide sequence which is identical to the nucleotide sequence of a1) except for one or several nucleotide substitutions, deletions and / or additions, and which has the same function as the nucleic acid molecule of a1); or a3) a nucleotide sequence which has at least 99%, 98%, 97%, 96%, 95% homology to a1) and which has the same function as the nucleic acid molecule of a1). Preferably, the first linker is an internal ribosome entry site. Preferably, the nucleotide sequence of the first linker comprises: b1) the nucleotides 2382-2949 of SEQ ID NO: 17; or b2) a nucleotide sequence which is identical to the nucleotide sequence of b1) except for one or several nucleotide substitutions, deletions and / or additions, and which is identical to the nucleic acid molecule of b1); or b3) a nucleotide sequence which has at least 99%, 98%, 96%, 95% homology to b1) and which has the same function as the nucleic acid molecule of b1). Preferably, the nucleotide sequence of the resistance gene NeoR / KanR comprises: ​ ​ ​ ​ ​ ​ ​ ​ ​ c0) The coding sequence of the NeoR / KanR protein, wherein the amino acid sequence of the NeoR / KanR protein is the amino acid sequence encoded by nucleotides 2950-3744 of SEQ ID NO: 17; or c1) Nucleotides 2950-3744 of SEQ ID NO: 17; or c2) A nucleotide sequence of c1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in c1); or c3) has at least 99%, 98%, 97%, 96%, and 95% homology with c1), and has the same function as the nucleic acid molecule shown in c1); Preferably, the second linker is a T2A peptide; Preferably, the nucleotide sequence of the second linker comprises: d0) The coding sequence of the T2A peptide, wherein the amino acid sequence of the T2A peptide is the amino acid sequence encoded by nucleotides 3745-3813 of SEQ ID NO: 17; or d1) Nucleotides 3745-3813 of SEQ ID NO: 17; or d2) A nucleotide sequence of d1) that has undergone substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in d1); or d3) has at least 99%, 98%, 97%, 96%, and 95% homology with d1), and has the same function as the nucleic acid molecule shown in d1); Preferably, the nucleotide sequence of the resistance gene HygR comprises: e0) The coding sequence of the HygR protein, wherein the amino acid sequence of the HygR protein is the amino acid sequence encoded by nucleotides 3814-4836 of SEQ ID NO: 17; or e1) Nucleotides 3814-4836 of SEQ ID NO: 17; or e2) A nucleotide sequence of e1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in e1); or e3) has at least 99%, 98%, 97%, 96%, and 95% homology with e1), and has the same nucleotide sequence as the nucleic acid molecule shown in e1); Preferably, the third linker is a P2A peptide; Preferably, the nucleotide sequence of the third linker comprises: f0) The coding sequence of the P2A peptide, wherein the amino acid sequence of the P2A peptide is the amino acid sequence encoded by nucleotides 4837-4902 of SEQ ID NO: 17; or f1) Nucleotides 4837-4902 of SEQ ID NO: 17; or f2) A nucleotide sequence of f1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in f1); or f3) has at least 99%, 98%, 97%, 96%, and 95% homology with f1), and has the same nucleotide sequence as the nucleic acid molecule shown in f1); Preferably, the nucleotide sequence of the resistance gene BSD comprises: g0) The coding sequence of the BSD protein, wherein the amino acid sequence of the BSD protein is the amino acid sequence encoded by nucleotides 4912-5307 of SEQ ID NO: 17; or g1) Nucleotides 4912-5307 of SEQ ID NO: 17; or g2) A nucleotide sequence of g1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in g1); or g3) has at least 99%, 98%, 97%, 96%, and 95% homology with g1) and has the same nucleotide sequence as the nucleic acid molecule shown in g1); Preferably, the nucleotide sequence of the EF1α promoter comprises: h1) Nucleotides 5341-6599 of SEQ ID NO: 17; or h2) A nucleotide sequence of h1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in h1); or h3) has at least 99%, 98%, 97%, 96%, and 95% homology with h1) and has the same nucleotide sequence as the nucleic acid molecule shown in h1).

4. The nucleic acid molecule according to claim 3, characterized in that, The 5' end of the resistance gene PuroR also contains a post-transcriptional regulatory element; Preferably, the 5' end of the posttranscriptional regulatory element further includes: a polyadenylation signal; Preferably, the post-transcriptional regulatory element is a post-transcriptional regulatory element of marmot hepatitis virus; Preferably, the polyadenylation signal is selected from one or more of SV40polyA, human growth hormone polyA, bovine growth hormone polyA, β-globin polyA, α-globin polyA, ovalbumin polyA, κ-light chain polyA, and synthetic polyA; Preferably, the polyadenylation signal is SV40polyA; Preferably, the EF1α promoter further includes a Kozak sequence between itself and the resistance gene BSD; Preferably, the 3' end of the EF1α promoter further includes a 3' homologous arm; Preferably, the 5' end of the polyadenylation signal further includes a 5' homologous arm; Preferably, the nucleic acid molecule comprises, from the 5' end to the 3' end: a 5' homologous arm, a polyadenylation signal, a posttranscriptional regulatory element, the resistance gene PuroR, a first linker, the resistance gene NeoR / KanR, a second linker, the resistance gene HygR, a third linker, the resistance gene BSD, a Kozak sequence, an EF1α promoter, and a 3' homologous arm; Preferably, the nucleotide sequence of the nucleic acid molecule comprises: n1) Nucleotides 7-8143 of SEQ ID NO: 17; or n2) A nucleotide sequence of n1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in n1); or n3) has at least 99%, 98%, 97%, 96%, and 95% homology with n1) and has the same function as the nucleic acid molecule shown in n1).

5. A biomaterial relating to the nucleic acid molecule according to any one of claims 1-4, said biomaterial comprising any one of o1)-o7): o1) An expression cassette comprising the nucleic acid molecule according to any one of claims 1-4; o2) contains a plasmid comprising the nucleic acid molecule according to any one of claims 1-4; o3) contains a plasmid containing the expression cassette described in o1); o4) A cell comprising the nucleic acid molecule according to any one of claims 1-4; o5) Cells containing the expression cassette described in o1); o6) Cells containing the plasmid described in o2); o7) contains cells containing the plasmid described in o3).

6. The biomaterial according to claim 5, characterized in that, The plasmids described in o2)-o3) are homologous recombinant plasmids; Preferably, the plasmids described in o2)-o3) further include basal plasmids; Preferably, the nucleotide sequence of the plasmid in (o2)-o3) comprises: p1)SEQ ID NO: 17; or p2) A nucleotide sequence of p1) that has undergone substitution, deletion, and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in p1); or p3) has at least 99%, 98%, 97%, 96%, and 95% homology with p1) and has the same nucleotide sequence as the nucleic acid molecule shown in p1).

7. The use of the nucleic acid molecule according to any one of claims 1-4, or the biological material according to any one of claims 5-6, in any one of q1)-q2): q1) Construct animals with four resistances; q2) Prepare products for constructing animals with four resistances; Preferably, the animal is a non-human mammal; Preferably, the non-human mammal is a rodent; Preferably, the rodent is a rat or a mouse.

8. A method for constructing a four-resistant animal, comprising introducing the nucleic acid molecule according to any one of claims 1-4 into the fertilized egg or somatic cell of the animal.

9. The construction method according to claim 8, characterized in that, The method for constructing the four-resistant animal also includes the following steps: Fertilized eggs infused with the nucleic acid molecules described in any one of claims 1-4 are transplanted into the oviduct of a surrogate animal to obtain animals with four types of resistance; or The nucleus of a somatic cell infused with the nucleic acid molecule described in any one of claims 1-4 is transplanted into an enucleated oocyte, and then the enucleated oocyte after nuclear transfer is transplanted into the oviduct of a surrogate animal to obtain a four-resistant animal.

10. The construction method according to any one of claims 8-9, characterized in that, The method for introducing the nucleic acid molecule according to any one of claims 1-4 into the fertilized egg or somatic cell of the animal is as follows: microinjecting the plasmid according to any one of claims 5-6 into the fertilized egg or somatic cell of the animal. Preferably, the microinjection system further comprises: Cas protein and sgRNA; Preferably, the animal is the animal described in claim 7.

11. A product comprising: a nucleic acid molecule as described in any one of claims 1-4 or a biological material as described in any one of claims 5-6.

12. The product according to claim 11, characterized in that: The product comprises: the plasmid as described in any one of claims 5-6; Preferably, the product further comprises: Cas protein and sgRNA; Preferably, the product is used to construct animals with four resistances; Preferably, the animal is the animal described in claim 7.

13. A somatic cell, tissue, or organ prepared from a four-resistant animal obtained by the construction method according to any one of claims 8-10.

14. The somatic cell, tissue, or organ according to claim 13, characterized in that, The somatic cells are feeder cells; Preferably, the feeder cells are fibroblasts; more preferably, they are mouse embryonic fibroblasts.

15. A method for culturing stem cells, comprising the step of using feeder layer cells as described in claim 14.

Images