Peptides specifically binding to CCR8, and use thereof

Abstract

The present invention relates to a peptide, an antibody or an immunologically active fragment thereof, each specifically binding to CCR8, and a use thereof. It has been identified that CCR8-binding peptides newly discovered in the present invention bind to the TM sub-pocket of CCR8 in a pattern similar to that of CCL1, and actually specifically bind to cells having CCR8 expressed in the cell membrane thereof, and thus the proteins can be used as target materials for drug design targeting Tregs in which CCR8 is expressed and, when used, cytotoxic drugs can be specifically delivered to a tumor microenvironment or cancer cells without affecting other effector T cells or peripheral Tregs, and thus side effects of a conventional cancer immunotherapy agent can be reduced.

Description

Peptide that specifically binds to CCR8 and uses thereof

[0001] The present invention relates to the use of a peptide, antibody, or fragment having the same’s immunological activity that specifically binds to CCR8.

[0002] Cancer cells occur periodically in the human body, but immune cells such as NK cells and cytotoxic T cells kill them, preventing them from developing into cancer. However, if cancer cells evade immunity by inducing immunosuppressive effects through immune checkpoints such as PD-1 and CTLA-4, or by inducing regulatory T cells (Treg), the normal immune response breaks down and cancer develops (Van Damme et al., 2021).

[0003] Conventional anticancer treatments have been researched in the direction of directly attacking cancer cells or enhancing the activity of the body's immune cells that attack cancer cells. However, these anticancer drugs also attack normal cells other than cancer cells, leading to numerous side effects such as hair loss, nausea, and vomiting, as well as causing adverse reactions due to the excessive proliferation of immune cells. Anticancer immunotherapy, which can minimize side effects compared to conventional chemotherapy or radiation therapy, is a method of treating cancer by utilizing the body's immune system. Among these anticancer immunotherapy techniques, active research is being conducted on cell therapy methods, which involve activating therapeutic immune cells such as T cells (including CAR-T), dendritic cells, and natural killer cells outside the body and injecting them directly into the body, and anticancer vaccine methods, which enhance anticancer efficacy by directly activating existing immune cells through the injection of cancer antigens and immune-activating substances. However, these cell therapies and cancer vaccines are primarily used for blood cancers, and they have the disadvantage of generally having very low therapeutic efficacy in solid tumors. One of the reasons for this is attributed to microenvironmental factors that suppress immune function around solid tumors. In fact, cells that impair immune cell function (MDSC: myeoloid-derived stromal cells, Treg: regulatory T cell, TAM: tumor-assisted macrophages), as well as immunosuppressive cytokines and metabolites, act actively within the tumor microenvironment, thereby drastically reducing the activity of immune-activating substances and therapeutic immune cells. Therefore, it is becoming important to develop therapeutic agents that possess anticancer effects by regulating only the microenvironment surrounding tumor cells without directly affecting tumor cells or immune cells, thereby blocking the supply of nutrients to tumor cells and angiogenesis around tumor cells.The tumor microenvironment is considered a major therapeutic target as it contributes to the proliferation and survival of malignant cells, angiogenesis, metastasis, abnormal adaptive immunity, and reduced response to hormones and chemotherapy agents.

[0004] Accordingly, efforts are being made to develop immunotherapies that activate the immune response of T effector cells by reducing regulatory T cells (Tregs) in the tumor microenvironment. Most strategies to reduce Tregs target peripheral Tregs; while the death of Tregs can reduce cancer cells, it can destroy resistance to inflammation, thereby causing serious autoimmune risks. Therefore, there is a need to develop new markers to target and destroy only tumor-infiltrating regulatory T cells (Ti-Tregs) without affecting other effector T cells or peripheral Tregs (Hatzioannou et al., 2021; Moser, 2022).

[0005] The objective of the present invention is to discover novel CCR8 (CC chemokine receptor 8) binding peptides.

[0006] In addition, the objective of the present invention is to provide a composition for detecting tumor-infiltration-regulating T cells.

[0007] In addition, the objective of the present invention is to provide a drug delivery system.

[0008] In addition, the objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of cancer.

[0009] In addition, the objective of the present invention is to provide an anticancer adjuvant.

[0010] In addition, the objective of the present invention is to provide a method for preventing or treating cancer.

[0011] To solve the above problem, the present invention provides a CCR8 binding peptide comprising any one selected from the group consisting of the amino acid sequences of SEQ ID NOs 1 to 3.

[0012] In addition, the present invention provides a composition for detecting tumor-infiltration-regulating T cells comprising the above-mentioned CCR8 binding peptide.

[0013] In addition, the present invention provides a drug delivery system comprising the CCR8 binding peptide and a drug bound thereto.

[0014] In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of cancer comprising the above-mentioned drug delivery system.

[0015] In addition, the present invention provides an anticancer adjuvant comprising the above drug delivery system.

[0016] In addition, the present invention provides a method for preventing or treating cancer comprising the step of administering the above pharmaceutical composition or anticancer adjuvant to an individual.

[0017] The CCR8-binding peptides newly discovered in the present invention bind to the TM subpocket of CCR8 in a pattern similar to CCL1 and have been confirmed to bind specifically to cells expressing CCR8 on the cell membrane. Therefore, they can be used as target substances for designing drugs targeting Tregs that express CCR8. By using this, cytotoxic drugs can be specifically delivered to the tumor microenvironment or cancer cells without affecting other effector T cells or peripheral Tregs, thereby having the effect of reducing the side effects of existing immunotherapies.

[0018] Figure 1 is a diagram showing the process of selecting peptides that bind to CCR8 through M13 phage display biopanning and NGS.

[0019] Figures 2 and 3 confirm the selective increase of peptides attached to the target according to the biopanning round:

[0020] FIG. 2: Tittering results of eluted phage and amplified phage; and

[0021] Fig. 3: Number of eluted and amplified phages (log 10 ).

[0022] Figures 4 through 8 show the number of NGS reads in each round:

[0023] Fig. 4: Total sorted reads; and

[0024] Figures 5 to 8: Number of peptides according to the number of NGS reads for each lead.

[0025] Figure 9 is a figure showing a heatmap of clustered 336 peptides with a read count of 10 or more in 4 rounds.

[0026] Figure 10 is a figure showing the derivation of the common sequence of cluster A.

[0027] Figure 11 is a figure showing the derivation of the common sequence of cluster B.

[0028] Figure 12 is a figure showing the derivation of the common sequence of cluster C.

[0029] Figure 13 is a figure confirming the actual read number change of three candidate peptides.

[0030] Figures 14 to 16 show the secondary and tertiary structures of human CCR8 predicted by an in silico method:

[0031] TMs: transmembranes;

[0032] ECL: extracellular loop;

[0033] Fig. 14: Secondary structure of human CCR8 predicted by PSIPRED 4.0;

[0034] Fig. 15: Predicted human CCR8 structure & regions, and amino acid sequence number; and

[0035] Fig. 16: 3D structure of human CCR8 predicted by trRosetta server:

[0036] Purple: Spiral;

[0037] Yellow: strand; and

[0038] Other: Coil structure.

[0039] FIGS. 17 to 22 show the simulation results predicting the binding of three types of peptides (cbpc-000001, cbpc-000002, and cbpc-000003) derived in the present invention with CCR8:

[0040] Fig. 17: Structure of CCL1(1EL0);

[0041] Fig. 18: Overview of the binding of CCL1 and CCL8 (binding of the C-terminal of CCL1 with the N-terminal region and extracellular loop of CCR8; and binding of the N-terminal region of CCL1 with the transmembrane region of CCR8);

[0042] Fig. 19: Predicted binding model of the N-terminus of CCL1 (purple) and CCR8 (blue) predicted by CABSdock;

[0043] Fig. 20: Combined prediction model of cbpc-000001 (violet) and CCR8 (blue);

[0044] Fig. 21: Combined prediction model of cbpc-000002 (violet) and CCR8 (blue); and

[0045] Fig. 22: Combined prediction model of cbpc-000003 (violet) and CCR8 (blue).

[0046] FIGS. 23 to 27 show the attachment sites of CCR8™ subpockets of CCL1 and three types of peptides (cbpc-000001, cbpc-000002, and cbpc-000003):

[0047] Fig. 23: Sequence of the predicted CCR8 binding site at the N-terminus of CCL1;

[0048] Fig. 24: Sequence of the predicted CCR8 binding site of cbpb-000001;

[0049] Fig. 25: CCR8 binding predicted site sequence of cbpc-000002;

[0050] Fig. 26: CCR8 binding predicted site sequence of cbpc-000003; and

[0051] Fig. 27: Binding sites of each peptide based on the whole human CCR8 sequence:

[0052] L1 (Orange): CCL1;

[0053] P1 (Green): cbpc-000001;

[0054] P2 (Green): cbpc-000002; and

[0055] P3 (Green): cbpc-000003.

[0056] FIGS. 28 to 30 show a CCR8 that stably expresses CCR8 using a lentivirus. + This is the diagram showing the production of Jurkat cells:

[0057] Fig. 28: pLV[Exp]-mCherry:T2A:Puro-EF1A>hCCR8[NM_005201.4] plasmid vector;

[0058] Fig. 29: Control Jurkat cells; and

[0059] Fig. 30: CCR8 transfected with a lentivirus containing the vector of A and exhibiting mcherry fluorescence + Jurkat cells.

[0060] FIGS. 31 to 37 are CCR8 + This is a diagram confirming the binding affinity of Jurkat cells and three types of peptides (cbpc-000001, cbpc-000002, and cbpc-000003) by flow cytometry:

[0061] FIGS. 31 to 33: Binding affinities of three peptides (cbpc-000001, cbpc-000002 and cbpc-000003) on control Jurkat cells;

[0062] FIGS. 34 to 36: CCR8 +Binding affinity of three peptides (cbpc-000001, cbpc-000002, and cbpc-000003) to Jurkat cells; and

[0063] Fig. 37: Quantification graph of binding affinity.

[0064] Hereinafter, the present invention will be described in detail with reference to the attached drawings for embodiments of the present invention. However, the following embodiments are presented as examples of the present invention, and if it is determined that a detailed description of a technology or configuration well known to those skilled in the art may unnecessarily obscure the essence of the present invention, such detailed description may be omitted, and the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of the claims set forth below and the equivalents interpreted therefrom.

[0065] Furthermore, the terminology used in this specification is used to appropriately describe preferred embodiments of the present invention, and may vary depending on the intent of the user or operator, or the conventions of the field to which the present invention belongs. Accordingly, the definitions of these terms should be based on the content throughout this specification. Throughout the specification, when a part is described as "comprising" a certain component, unless specifically stated otherwise, this means that it does not exclude other components but may include additional components.

[0066] All technical terms used in this invention, unless otherwise defined, are used in the sense generally understood by those skilled in the art in the relevant field of this invention. Additionally, while preferred methods or samples are described herein, similar or equivalents are also included within the scope of this invention. The contents of all publications cited as references in this specification are incorporated into this invention.

[0067] Throughout this specification, not only are conventional one- and three-character codes for naturally occurring amino acids used, but generally accepted three-character codes for other amino acids, such as Aib (α-aminoisobutyric acid), Sar (N-methylglycine), etc., are also used. Additionally, amino acids referred to by abbreviations in this invention are described according to the IUPAC-IUB nomenclature as follows:

[0068] Alanine: A, Arginine: R, Asparagine: N, Aspartic acid: D, Cysteine: C, Glutamic acid: E, Glutamine: Q, Glycine: G, Histidine: H, Isoleucine: I, Leucine: L, Lysine: K, Methionine: M, Phenylalanine: F, Proline: P, Serine: S, Threonine: T, Tryptophan: W, Tyrosine: Y, and Valine: V.

[0069]

[0070]

[0071] In one aspect, the present invention relates to a peptide, an antibody, or a fragment having immunological activity thereof, which specifically binds to an epitope comprising an amino acid at position 20 to 50 of CCR8 (CC chemokine receptor 8), an amino acid at position 80 to 120, an amino acid at position 160 to 210, or an amino acid at position 250 to 290.

[0072] In one embodiment, the antibody may be a chimeric antibody, a humanized antibody, a bivalent, a bispecific molecule, a minibody, a domain antibody, a bispecific antibody, an antibody mimic, a diabody, a triabody, or a tetrabody, and the fragment having immunological activity thereof may be any one selected from the group consisting of Fab, Fd, Fd', Fab', dAb, F(ab'), F(ab')2, scFv (single chain fragment variable), Fv, a single-chain antibody, an Fv dimer (dsFv), or a complementarity determining region (CDR) fragment.

[0073] In one embodiment, the antibody or peptide may comprise any one selected from the group consisting of the amino acid sequences of SEQ ID NOs 1 to 6.

[0074] The above antibody is in the form of a whole antibody as well as includes functional fragments of the antibody molecule. The whole antibody has a structure comprising two full-length light chains and two full-length heavy chains, with each light chain connected to the heavy chain by a disulfide bond. A functional fragment of the antibody molecule refers to a fragment possessing antigen-binding function, and examples of antibody fragments include: (i) a Fab fragment consisting of the variable region (VL) of the light chain and the variable region (VH) of the heavy chain, and the constant region (CL) of the light chain and the first constant region (CH1) of the heavy chain; (ii) an Fd fragment consisting of the VH and CH1 domains; and (iii) an Fv fragment consisting of the VL and VH domains of a monoclonal antibody. (iv) a dAb fragment consisting of a VH domain (Ward ES et al., Nature 341:544-546 (1989)]; (v) a separated CDR region; (vi) a divalent fragment F(ab')2 fragment containing two linked Fab fragments; (vii) a single-stranded Fv molecule (scFv) linked by a peptide linker that links the VH domain and VL domain to form an antigen-binding site; (viii) a bispecific single-stranded Fv dimer (PCT / US92 / 09965); and (ix) a diabody WO94 / 13804, a multivalent or multispecific fragment produced by gene fusion.

[0075] The antibody of the present invention or the fragment having immunological activity thereof may be selected from the group consisting of animal-derived antibodies, chimeric antibodies, humanized antibodies, human antibodies, and fragments having immunological activity thereof. The antibody may be produced recombinantly or synthetically.

[0076] Animal-derived antibodies, produced by immunizing animals with a desired antigen, can generally cause immune rejection when administered to humans for therapeutic purposes; chimeric antibodies were developed to suppress this rejection. Chimeric antibodies are created by using genetic engineering methods to replace the constant region of animal-derived antibodies—which causes anti-isotype reactions—with the constant region of human antibodies. While chimeric antibodies show significant improvement in anti-isotype reactions compared to animal-derived antibodies, they still carry potential side effects related to anti-idiotypic reactions because animal-derived amino acids remain in the variable region. Humanized antibodies were developed to address these side effects. They are produced by transplanting the Complementarity Determining Regions (CDRs), which play a crucial role in antigen binding within the variable region of chimeric antibodies, into a human antibody framework.

[0077] In CDR grafting technology for producing humanized antibodies, the most critical aspect is selecting an optimized human antibody capable of best accepting the CDR site of an animal-derived antibody; to achieve this, techniques such as antibody databases, crystal structure analysis, and molecular modeling are utilized. However, even when the CDR site of an animal-derived antibody is grafted onto an optimized human antibody scaffold, there are a significant number of cases where antigenic binding affinity is not preserved due to the presence of amino acids on the animal antibody scaffold that affect antigen binding. Therefore, the application of additional antibody engineering techniques to restore antigenic binding affinity is essential.

[0078] The above antibody or the fragment having immunological activity thereof may be isolated from a living organism (not present in the living organism) or non-naturally occurring, for example, may be produced synthetically or recombinantly.

[0079] In the present invention, the term "antibody" refers to a substance produced within the immune system by stimulation of an antigen; its type is not particularly limited and can be obtained naturally or unnaturally (e.g., synthetically or recombinantly). Antibodies are advantageous for mass expression and production because they are very stable and have a long half-life, both in vitro and in vivo. Furthermore, antibodies have a very high avidity because they inherently possess a dimer structure. A complete antibody has a structure comprising two full-length light chains and two full-length heavy chains, with each light chain connected to a heavy chain by a disulfide bond. The constant region of the antibody is divided into a heavy chain constant region and a light chain constant region. The heavy chain constant region has gamma (γ), mu (μ), alpha (α), delta (δ), and epsilon (ε) types, and has subclasses gamma 1 (γ1), gamma 2 (γ2), gamma 3 (γ3), gamma 4 (γ4), alpha 1 (α1), and alpha 2 (α2). The light chain constant region has kappa (κ) and lambda (λ) types.

[0080] In the present invention, the term "heavy chain" refers to a variable region domain V comprising an amino acid sequence having a variable region sequence sufficient to confer specificity to an antigen. H and 3 invariant domains C H1 , C H2 and C H3 It is interpreted to include both the full-length heavy chain containing the hinge and its fragments. Additionally, the term "light chain" refers to a variable region domain V containing an amino acid sequence having a sufficient variable region sequence to confer specificity to an antigen.L and invariant domain C L It is interpreted to mean that it includes all of the battlefield light chains and fragments thereof.

[0081] In the present invention, the term "variable region" or "variable domain" refers to a part of an antibody molecule that performs the function of specifically binding to an antigen and exhibits many variations in sequence, and the variable region contains complementary determining regions CDR1, CDR2, and CDR3. Between the CDRs, there exists a framework region (FR) that serves to support the CDR loop. The "complementary determining region" is a loop-shaped region involved in antigen recognition, and the specificity of the antibody for the antigen is determined as the sequence of this region changes.

[0082] The term "scFv (single chain fragment variable)" as used in the present invention refers to a single-chain antibody produced by expressing only the variable region of an antibody through genetic recombination, and refers to a single-chain antibody in which the VH region and the VL region of the antibody are connected by a short peptide chain. Unless otherwise specified or understood from the context, the term "scFv" is intended to include scFv fragments, including antigen-binding fragments. This is obvious to a person skilled in the art.

[0083] In the present invention, the term "complementarity determining region (CDR)" refers to the amino acid sequence of a hypervariable region of the heavy chain and light chain of an immunoglobulin. The heavy chain and light chain may each contain three CDRs (CDRH1, CDRH2, CDRH3 and CDRL1, CDRL2, CDRL3). The CDRs may provide major contact residues for the antibody to bind to an antigen or an epitope.

[0084] In the present invention, the terms "specifically binding" or "specifically recognizing" have the same meaning as commonly known to those skilled in the art, and refer to an antigen and an antibody specifically interacting to produce an immunological reaction.

[0085] In the present invention, the term "antigen-binding fragment" refers to a fragment of the entire immunoglobulin structure thereof, meaning a part of a polypeptide comprising a portion capable of binding to an antigen. For example, it may be scFv, (scFv) 2, scFv-Fc, Fab, Fab', or F(ab') 2, but is not limited thereto. Among the antigen-binding fragments, Fab comprises a variable region of the light chain and heavy chain, a constant region of the light chain, and a first constant region of the heavy chain (C H1 It has a structure containing ) and possesses one antigen-binding site. Fab' is heavy chain C H1It differs from Fab in that it has a hinge region containing one or more cysteine ​​residues at the C-terminus of the domain. F(ab')2 antibodies are generated when the cysteine ​​residues in the hinge region of Fab' form disulfide bonds. Recombinant techniques for generating Fv fragments from minimal antibody fragments that possess only a heavy chain variable region and a light chain variable region are widely known in the art. Two-chain Fv has the heavy chain variable region and the light chain variable region connected by non-covalent bonds, while single-chain Fv generally has the heavy chain variable region and the single chain variable region connected by covalent bonds or directly at the C-terminus via a peptide linker, thereby forming a dimer-like structure similar to that of two-chain Fv. The linker may be a peptide linker composed of any 1 to 100 or 2 to 50 amino acids, and suitable sequences are known in the art. The above antigen-binding fragment can be obtained using a proteolytic enzyme (for example, if the whole antibody is restricted to papain, Fab can be obtained, and if it is restricted to pepsin, the F(ab') 2 fragment can be obtained), and can be produced through genetic recombination technology.

[0086] In one aspect, the present invention relates to a peptide that specifically binds to CCR8 (CC chemokine receptor 8).

[0087] In one embodiment, the CCR8 binding peptide of the present invention may include the amino acid sequence of SEQ ID NO. 1 and may be cpbp-000001 including the amino acid sequence of SEQ ID NO. 4.

[0088] In one embodiment, the CCR8 binding peptide of the present invention may include the amino acid sequence of SEQ ID NO. 2 and may be cpbp-000001 including the amino acid sequence of SEQ ID NO. 5.

[0089] In one embodiment, the CCR8 binding peptide of the present invention may include the amino acid sequence of SEQ ID NO. 3 and may be cpbp-000001 including the amino acid sequence of SEQ ID NO. 6.

[0090] In one embodiment, the CCR8 binding peptide of the present invention may additionally include a label, and the label may be a chromogenic enzyme, a radioisotope, a chromopore, a luminescent material, a fluorescent material, a probe, or a tag.

[0091] In one embodiment, the fluorescent material is FAM (6-carboxyfluorescein), Texas Red, fluorescein, HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, FITC (fluorescein isothiocyanate), Oregon Green, Alexa Fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), TET (Tetrachloro-Fluorescein), TRITC (tertramethylrodamine isothiocyanate), It may be TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine series dyes, or thiadicarbocyanine.

[0092] In one embodiment, the CCR8 binding peptide of the present invention may include a variant of a peptide comprising one or more of the amino acid sequences of SEQ ID NOs. 1 to 6 or an analog thereof.

[0093] In one embodiment, the CCR8 binding peptide of the present invention may include an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with respect to any one or more of the amino acid sequences of SEQ ID NOs 1 to 6.

[0094] In one embodiment, the CCR8 binding peptide of the present invention may bind to amino acids at positions 20 to 50, amino acids at positions 80 to 120, amino acids at positions 160 to 210, or amino acids at positions 250 to 290 of human CCR8, and human CCR8 may include the amino acid sequence of SEQ ID NO. 7.

[0095] In one embodiment, the peptide may be an immunocouple that specifically binds to CCR8.

[0096] As used in the present invention, the term "peptide variant" refers to a corresponding amino acid sequence comprising at least one amino acid difference (substitution, insertion, or deletion) when compared to a reference material. In certain embodiments, the "variant" has high amino acid sequence homology and / or conservative amino acid substitution, deletion, and / or insertion when compared to the reference sequence.

[0097] As used in the present invention, the term "peptide analog" may include an analog in which one or more other functional groups are substituted for the side chain or alpha-amino acid backbone of an amino acid. Examples of side chain or backbone modified peptide analogs include, but are not limited to, hydroxyproline in which a pyrrolidine ring is substituted with a hydroxyl group, or N-methylglycine "peptoid." Types of peptide analogs are known in the art.

[0098] The peptide variant according to the present invention is interpreted to include variants in which an amino acid residue is conservatively substituted at a specific amino acid residue position.

[0099] In the present invention, "conservative substitution" means a modification of a variant comprising substituting one or more amino acids with amino acids having similar biochemical properties that do not cause a loss of biological or biochemical function of the corresponding CCR8-linked peptide variant. "Conservative amino acid substitution" is a substitution that replaces an amino acid residue with an amino acid residue having a similar side chain. A class of amino acid residues having a similar side chain is defined in the art and is well known. These classes include amino acids having basic side chains (e.g., lysine, arginine, histidine), amino acids having acidic side chains (e.g., aspartic acid, glutamic acid), amino acids having uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids having non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids having beta-branched side chains (e.g., threonine, valine, isoleucine), and amino acids having aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

[0100] The peptides according to the present invention may be prepared by standard synthesis methods, recombinant expression systems, or any other methods in the art. Accordingly, the peptides according to the present invention may be synthesized by a number of methods, for example, including methods comprising the following:

[0101] (a) a method for synthesizing a peptide stepwise or by fragment assembly by means of a solid-phase or liquid-phase method, and isolating and purifying the final peptide product; or

[0102] (b) a method of expressing a nucleic acid construct encoding a peptide in a host cell and recovering the expression product from a host cell culture; or

[0103] (c) a method for performing cell-free in vitro expression of a nucleic acid construct encoding a peptide and recovering the expression product; or

[0104] A method for obtaining a peptide fragment by any combination of (a), (b) and (c), then linking the fragments to obtain a peptide, and recovering the peptide.

[0105] In one aspect, the present invention relates to a nucleic acid molecule encoding a peptide, an antibody, or a fragment having the immunological activity thereof that specifically binds to CCR8 of the present invention, a vector comprising said molecule, and a host cell comprising said vector.

[0106] As used in the present invention, the term “nucleic acid molecule” refers to a deoxyribonucleotide or ribonucleotide existing in a single-stranded or double-stranded form, and includes natural nucleic acid analogs unless otherwise specifically noted (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).

[0107] The term "vector" as used in the present invention refers to any nucleic acid comprising a competent nucleotide sequence that is inserted into a host cell, recombines with the host cell genome, is inserted therein, or spontaneously replicates as an episome. Examples of such vectors include linear nucleic acids, plasmids, phagesmids, cosmids, RNA vectors, viral vectors, etc.

[0108] The term "host cell" as used in the present invention refers to a eukaryotic or prokaryotic cell into which one or more DNA or vectors are introduced, and should be understood to refer not only to a specific target cell but also to its offspring or potential offspring. Although the offspring are not identical to the parent cell in fact because modifications may occur in subsequent generations due to mutations or environmental influences, they are still included within the scope of the term as used in the present invention.

[0109] In one aspect, the present invention relates to a composition for detecting tumor-infiltrating regulatory T cells (Ti-Treg), comprising a peptide, an antibody, or a fragment having immunological activity thereof that specifically binds to CCR8 of the present invention.

[0110] In one embodiment, the composition may additionally include a label.

[0111] In one embodiment, the composition can detect tumor-infiltration regulatory T cells or quantify their levels.

[0112] In one aspect, the present invention relates to a cancer diagnostic composition comprising a peptide, an antibody, or a fragment having immunological activity thereof that specifically binds to CCR8 of the present invention.

[0113] In one aspect, the present invention relates to a cancer diagnostic kit comprising a cancer diagnostic composition of the present invention.

[0114] In one embodiment, the kit may further include tools and / or reagents for collecting biological samples from a subject or patient, as well as tools and / or reagents for preparing genomic DNA, cDNA, RNA, or protein from the sample.

[0115] In the present invention, the term "cancer diagnostic kit" refers to a kit containing the cancer diagnostic composition of the present invention. Accordingly, the expression "cancer diagnostic kit" may be used interchangeably or in combination with "cancer diagnostic composition." In this specification, the term "diagnosis" includes determining the susceptibility of an object to a specific disease or condition, determining whether an object currently has a specific disease or condition, determining the prognosis of an object with a specific disease or condition (e.g., identification of a pre-metastatic or metastatic cancer state, determination of the stage of cancer, or determination of the responsiveness of cancer to treatment), or therametrics (e.g., monitoring the condition of an object to provide information on therapeutic efficacy).

[0116] In one aspect, the present invention relates to a method for providing information for cancer diagnosis, comprising the steps of: contacting a biological sample isolated from a target with a composition for cancer diagnosis of the present invention; determining the level of tumor-infiltration regulatory T cells; and comparing the level of said tumor-infiltration regulatory T cells with that of a normal control sample.

[0117] As used in the present invention, the term "sample" means a biological sample obtained from a subject or patient. Sources of the biological sample may be fresh, frozen and / or preserved organ or tissue samples or solid tissue from a biopsy or aspirate; blood or any blood component; or cells at any point in the subject's pregnancy or development.

[0118] In one aspect, the present invention relates to a drug delivery system comprising a peptide, an antibody, or a fragment having immunological activity thereof that specifically binds to CCR8 of the present invention, and a drug bound thereto.

[0119] In one embodiment, the drug delivery system can specifically deliver a drug to the tumor microenvironment or cancer cells.

[0120] In one embodiment, the drug delivery system can specifically reduce tumor-infiltration regulatory T cells.

[0121] In one embodiment, the drug may be a compound, RNA, DNA, antibody, effector, prodrug, toxin, peptide, or radionuclide.

[0122] In one embodiment, the drug may be an immunogenic apoptosis inducer, a pro-apoptotic peptide, a microtubulin structure formation inhibitor, a meiosis inhibitor, a topoisomerase inhibitor, a DNA intercalator, a toxin, or an anticancer agent.

[0123] In one embodiment, the whole-cell-killing peptide may be selected from the group consisting of KLA, alpha-defensin-1, BMAP-28, Brevenin-2R, Buforin IIb, cecropin A-Magainin 2 (CA-MA-2), cecropin A, cecropin B, chrysophsin-1, D-K6L9, Gomesin, Lactoferricin B, LLL27, LTX-315, Magainin 2, Magainin II-bombesin conjugate (MG2B), Pardaxin, and combinations thereof.

[0124] In one embodiment, the immunogenic apoptosis inducer may be selected from the group consisting of anthracycline-based anticancer agents, taxane-based anticancer agents, anti-EGFR antibodies, BK channel agonists, bortezomib, cardiac glycosides, cyclophosphamide-based anticancer agents, GADD34 / PP1 inhibitors, LV-tSMAC, Measles virus, bleomycin, mitoxantrone, oxaliplatin, and combinations thereof.

[0125] In one embodiment, the anticancer agent is SN-38 (7-ethyl-10-hydroxy-camptothecin), daunorubicin, doxorubicin, epirubicin, idarubicin, pixantrone, sabarubicin, valrubicin, paclitaxel, docetaxel, mechloethamine, chlorambucil, phenylalanine, mustard, cyclophosphamide, ifosfamide, carmustine (BCNU), lomustine (CCNU), Streptozotocin, busulfan, thiotepa, cisplatin, carboplatin, dactinomycin (actinomycin D), plicamycin, mitomycin C, vincristine, vinblastine, teniposide, topotecan, iridotecan, uramustine, melphalan, bendamustine, dacarbazine, temozolomide, altretamine, duocarmycin, nedaplatin, oxaliplatin, satraplatin, Triplatin tetranitrate, 5-fluorouracil, 6-mercaptopurine,Capecitabine, cladribine, clofarabine, cystarbine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, pentostatin, thioguanine, etoposide, mitoxantrone, izabepilone, vindesine, vinorelbine, estramustine, maytansine, DM1 (mertansine), DM4, dolastatin, auristatin E, auristatin It may be selected from the group consisting of F(auristatin F), monomethyl auristatin E (MMAE), monomethyl auristatin F (monomethyl auristatin F), and derivatives thereof.

[0126] In one embodiment, the anticancer agent may be an immunotherapeutic agent, and the immunotherapeutic agent may be an immune checkpoint inhibitor, an immunosuppressant control drug, a cancer vaccine, an immunoadjuvant, an immune cell for cancer treatment, an immune cell activation cofactor, an antibody for cancer treatment, or a cytokine necessary for maintaining the activity of an immune cell for cancer treatment.

[0127] In one embodiment, the immunosuppressant controlling drug may be a drug that reduces the level of regulatory T cells (Treg), and by reducing regulatory T cells, may activate the immune response of T effector cells.

[0128] In one embodiment, the immune checkpoint inhibitor may be an inhibitor of CTLA-4, PD-1, PD-L1, PD-L2, LAG-3, BTLA, B7H3, B7H4, TIM3, KIR, TIGIT, CD47, VISTA, or A2aR, and may be an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-CTLA-4 antibody, or a variant thereof.

[0129] A peptide, antibody, or fragment having the same immunological activity and a drug that specifically bind to CCR8 of the present invention may be connected / bound via a linker, and any linker having a functional group capable of binding through an amine group, carboxyl group, or sulfhydryl group of a protein such as a peptide, ligand, antibody, or antibody fragment, or a phosphate group or hydroxyl group of a nucleic acid such as an aptamer may be used. The functional groups of such linkers include isothiocyanate, isocyanates, acyl azide, NHS ester, sulfonyl chloride, aldehyde, glyoxal, epoxide, oxirane, carbonate, aryl halide, The linker may be an imidoester, carbodiimide, anhydride, fluorophenyl ester, hydroxymethyl phosphine, maleimide, haloacetyl, pyridyldisulfide, thiosulfonate, or vinylsulfone. The linker may be a linker that can be cleaved by a protease, cleaved under acidic or basic conditions, cleaved by high temperature or light irradiation, or cleaved under reducing or oxidizing conditions, or a linker that cannot be cleaved under these conditions.Examples of cleavable linkers include hydrazone linkers that are cleaved under acidic conditions, peptide linkers that are cleaved by proteases, and linkers having a disulfide functional group that is cleaved under reducing conditions. Examples of non-cleavable linkers include MCC (Maleimidomethyl cyclohexane-1-carboxylate) linkers, MC (maleimidocaproyl) linkers, or derivatives thereof such as succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) linkers or sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC).

[0130] In addition, the linker may be a self-immolative linker or a traceless linker. Examples of self-immolative linkers include the linker disclosed in U.S. Patent No. 9,089,614, titled "Hydrophilic self-immolative linkers and conjugates thereof," and the linker disclosed in International Publication No. WO2015038426, titled "SELF-IMMOLATIVE LINKERS CONTAINING MANDELIC ACID DERIVATIVES, DRUG-LIGAND CONJUGATES FOR TARGETED THERAPIES AND USES THEREOF." Examples of traceless linkers include phenylhydrazide linkers, aryl-triazene linkers, and [Blaney, et al., "Traceless solid-phase organic synthesis," Chem Rev. It may be a linker, etc. disclosed in 102: 2607-2024 (2002)].

[0131] In the ordinary art, in addition to the linkers exemplified above, numerous linkers applicable to the present invention are known through a significant number of literatures. Specifically, such literature includes [Castaneda, et al, "Acid-cleavable thiomaleamic acid linker for homogeneous antibody-drug conjugation," Chem Commun. 49: 8187-8189 (2013)], [Lyon, et al, "Self-hydrolyzing maleimides improve the stability and pharmacological properties of antibody-drug conjugates," Nat Biotechnol. 32(10):1059-1062 (2014)], [Dawson, et al "Synthesis of proteins by native chemical ligation," Science 1994, 266, 776-779], and [Dawson, et al "Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives," J Am Chem Soc. 1997, 119, 4325-4329] Hackeng, et al "Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology," Proc Natl Acad Sci USA 1999, 96, 10068-10073], Wu, et al "Building complex glycopeptides: Development of a cysteine-free native chemical ligation protocol," Angew Chem Int Ed 2006, 45, 4116-4125],References [Geiser et al. "Automation of solid-phase peptide synthesis" in Macromolecular Sequencing and Synthesis, Alan R Liss, Inc., 1988, pp 199-218], [Fields, G and Noble, R. (1990) "Solid phase peptide synthesis utilizing 9-fluoroenylmethoxycarbonyl amino acids", Int. J Peptide Protein Res. 35:161-214], etc., or U.S. Patent No. 6,884,869, U.S. Patent No. 7,498,298, U.S. Patent No. 8,288,352, U.S. Patent No. 8,609,105, U.S. Patent No. 8,697,688, U.S. Patent Publication No. 2014 / 0127239, U.S. Patent Publication No. 2013 / 028919, U.S. Patent Publication No. 2014 / 286970, You may refer to U.S. Patent Publication No. 2013 / 0309256, U.S. Patent Publication No. 2015 / 037360, U.S. Patent Publication No. 2014 / 0294851, International Patent Publication WO2015057699, International Patent Publication WO2014080251, International Patent Publication No. WO2014197854, International Patent Publication WO2014145090, International Patent Publication WO2014177042, etc.

[0132] A peptide, antibody, or fragment having immunological activity thereof that specifically binds to the CCR8 of the drug delivery system of the present invention and a drug may be bound via a biocompatible polymer or as a carrier. A biocompatible polymer refers to a polymer having tissue compatibility and blood compatibility that does not cause tissue necrosis or blood coagulation when in contact with biological tissue or blood. The synthetic polymer as the above-mentioned biocompatible polymer is a polyester, polyhydroxyalkanoate (PHAs), poly(α-hydroxy acid), poly(β-hydroxy acid), poly(3-hydroxybutyrate-co-valerate; PHBV), poly(3-hydroxypropionate; PHP), poly(3-hydroxyhexanoate; PHH), poly(4-hydroxy acid), poly(4-hydroxybutyrate), poly(4-hydroxyvalerate), poly(4-hydroxyhexanoate), poly(esteramide), polycaprolactone, polylactide, polyglycolide, poly(lactide-co-glycolide;PLGA), polydioxanone, polyorthoester, polyanhydride, poly(glycolic acid-co-trimethylene carbonate), polyphosphoester, polyphosphoester urethane, poly(amino acid), polycyanoacrylate, poly(trimethylene carbonate), poly(iminocarbonate), poly(tyrosine carbonate), polycarbonate, poly(tyrosine arylate), polyalkylene oxalate, polyphosphazenes, PHA-PEG, ethylene vinyl alcohol copolymer (EVOH), polyurethane, silicone, polyester, polyolefin, polyisobutylene and ethylene-alphaolefin copolymer, styrene-isobutylene-styrene triblock copolymer, acrylic polymers and copolymers, vinyl halide polymers and copolymers, polyvinyl chloride, polyvinyl ether, polyvinyl methyl ether, polyvinylidene halide, polyvinylidene fluoride, Polyvinylidene chloride, polyfluoroalkene, polyperfluoroalkene, polyacrylonitrile, polyvinyl ketone, polyvinyl aromatics, polystyrene, polyvinyl ester, polyvinyl acetate, ethylene-methyl methacrylate copolymer, acrylonitrile-styrene copolymer, ABS resin and ethylene-vinyl acetate copolymer, polyamide, alkyd resin, polyoxymethylene, polyimide, polyether, polyacrylate, polymethacrylate, polyacrylic acid-co-maleic acid, or polyaminoamine, and natural polymers are chitosan, dextran, cellulose, heparin, hyaluronic acid, alginate, inulin, starch, or glycogen.

[0133] The linker used for binding a drug to a peptide, antibody, or fragment having immunological activity thereof that specifically binds to CCR8 of the present invention is preferably a linker that is stable outside the target cell and is not cleaved, and is not cleaved in the acidic conditions inside the target cell, such as endosomes or lysosomes. By being stable outside the target cell and not cleaved, such a linker allows the drug to move into the cell, and by not being cleaved in the acidic conditions inside the target cell, it allows the drug to move from the endosomes or lysosomes to the cytoplasm.

[0134] In the drug delivery system of the present invention, the drug may be non-covalently bound to a peptide, antibody, or fragment having immunological activity thereof that specifically binds to CCR8 of the present invention.

[0135] In one embodiment, RNA, DNA, antibody, effector, drug, prodrug, toxin, peptide, or delivery molecule may be further conjugated to a peptide, antibody, or fragment having the same immunological activity that specifically binds to CCR8 of the present invention (see Shoari et al., Pharmaceutics 13:1391, pp. 1-32 (2021)).

[0136] In the drug delivery system of the present invention, there are no specific limitations on the drug as long as it is a drug capable of moving into a cell and exerting an effect. Such a drug may be any biopharmaceutical, such as a drug in the form of any small molecule compound, such as a cytotoxic anticancer agent, recombinant protein, or siRNA. In addition, in terms of efficacy, the drug may be an anti-inflammatory agent, an analgesic, an anti-arthritic, an antispasmodic, an antidepressant, an antipsychotic drug, a tranquilizer, an anxiolytic, an opioid antagonist, an anti-Parkinson's disease drug, a cholinergic agonist, an anticancer agent, an angiogenesis inhibitor, an immunosuppressant, an immunomodulator, an antiviral agent, an antibiotic, an appetite suppressant, analgesic, an anticholinergic, an antihistamine, an antimigraine agent, a hormone, a coronary artery agent, a vasodilator, a contraceptive, an antithrombotic agent, a diuretic, an antihypertensive agent, a cardiovascular disease treatment agent, a contrast agent, or a diagnostic agent. In addition, the drug may be a gene, plasmid DNA, antisense oligonucleotide, siRNA, peptide, ribozyme, viral particle, immunomodulator, protein, contrast agent, etc. More specifically, the drug may be a gene encoding Rb94, a variant of the retinoblastoma tumor suppressor gene, a gene encoding apoptin that induces apoptosis only in tumor cells, an antisense oligonucleotide against HER-2, which is a therapeutic target (sequence: 5'-TCC ATG GTG CTC ACT-3'), and a diagnostic contrast agent such as Gd-DTPA, an MRI contrast agent.

[0137] The drug delivery system of the present invention may be prepared into a pharmaceutical composition in the form of an oral or parenteral formulation according to the route of administration by conventional methods known in the art, including a pharmaceutically acceptable carrier. Herein, "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not irritate living organisms and does not impair the biological activity and properties of the administered compound. Acceptable pharmaceutical carriers for compositions formulated as liquid solutions include saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and a mixture of one or more of these components, provided that they are sterile and biocompatible. Additionally, other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed.

[0138] In one embodiment, the drug delivery system of the present invention can specifically deliver the drug to tumor-infiltration-regulating T cells.

[0139] In the present invention, a peptide, antibody, or fragment having immunological activity that specifically binds to CCR8 of the present invention can selectively bind to CCR8 expressed on the cell membrane of tumor-infiltration regulatory T cells, thereby providing a targeting function for tumor-infiltration regulatory T cells. This peptide, antibody, or fragment having immunological activity that specifically binds to CCR8 specifically binds to CCR8 present on the surface of tumor-infiltration regulatory T cells and induces endocytosis, thereby enabling the movement of a drug bound thereto into the cell.

[0140] In one aspect, the present invention relates to a peptide-drug conjugate (PDC) comprising a peptide, an antibody, or a fragment having immunological activity thereof that specifically binds to CCR8 of the present invention, and a drug bound thereto.

[0141] In one embodiment, the PDC may bind to the amino acid at the 20th to 50th position, the amino acid at the 80th to 120th position, the amino acid at the 160th to 210th position, or the amino acid at the 250th to 290th position of CCR8.

[0142] In one aspect, the present invention relates to a pharmaceutical composition for the prevention or treatment of cancer comprising a drug delivery system or a peptide-drug conjugate of the present invention as an active ingredient.

[0143] In one embodiment, the cancer may be one or more selected from the group consisting of brain tumor, melanoma, multiple myeloma, non-small cell lung cancer, oral cancer, liver cancer, stomach cancer, colon cancer, breast cancer, lung cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cervical cancer, ovarian cancer, colorectal cancer, small intestine cancer, rectal cancer, fallopian tube carcinoma, pro-anal cancer, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, lymphoma, bladder cancer, gallbladder cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, kidney or ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma and pituitary adenoma.

[0144] The pharmaceutical composition of the present invention may be used as a monotherapy, but may also be used in combination with other conventional biological therapies, chemotherapy, or radiotherapy, and cancer can be treated more effectively when such combination therapy is performed. When the present invention is used for the prevention and treatment of cancer, chemotherapy agents that may be used together with the composition include cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide, tamoxifen, taxol, transplatinum, and 5-fluorouracil. It includes vincristine, vinblastin, and methotrexate, etc. Radiation therapy that can be used with the composition of the present invention includes X-ray irradiation and γ-ray irradiation.

[0145] In the present invention, the term "prevention" refers to any act of suppressing or delaying the occurrence, spread, and recurrence of cancer by administering a composition according to the present invention.

[0146] The therapeutically effective amount of the composition of the present invention may vary depending on various factors, such as the method of administration, the target site, and the patient's condition. Therefore, when used in humans, the dosage should be determined as an appropriate amount by considering both safety and efficacy. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. These considerations for determining the effective amount are described, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and EW Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

[0147] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. As used in the present invention, the term "pharmaceuticalally effective amount" refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment and that does not cause adverse effects. The effective dose level may be determined based on factors including the patient's health status, type and severity of the disease, drug activity, sensitivity to the drug, method of administration, time of administration, route of administration and elimination rate, duration of treatment, drugs used in combination or concurrently, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. Considering all of the above factors, it is important to administer an amount that obtains maximum effect with a minimum amount without adverse effects, and this can be easily determined by a person skilled in the art.

[0148] The pharmaceutical composition of the present invention may include a carrier, a diluent, an excipient, or a combination of two or more of these commonly used in biological preparations. As used in the present invention, the term "pharmaceutical acceptable" means exhibiting properties that are not toxic to normal cells or humans exposed to the composition. The carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, and may be used, for example, compounds listed in Merck Index, 13th ed., Merck & Co. Inc., saline solution, sterile water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and a mixture of one or more of these components, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed. Additionally, diluents, dispersants, surfactants, binders, and lubricants may be added to formulate the composition into primary formulations such as aqueous solutions, suspensions, and emulsions, as well as pills, capsules, granules, or tablets. Furthermore, it can be preferably formulated according to each disease or component using appropriate methods in the field or methods disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

[0149] In one embodiment, the pharmaceutical composition may be one or more formulations selected from the group comprising oral formulations, topical formulations, suppositories, sterile injectable solutions, and sprays.

[0150] The composition of the present invention may also include carriers, diluents, excipients, or combinations of two or more thereof that are commonly used in biological preparations. Pharmaceutically acceptable carriers are not particularly limited as long as they are suitable for in vivo delivery of the composition, and may be used, for example, compounds listed in Merck Index, 13th ed., Merck & Co. Inc., saline solution, sterile water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and mixtures of one or more of these components, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed. Additionally, diluents, dispersants, surfactants, binders, and lubricants may be added to formulate the composition into primary formulations such as aqueous solutions, suspensions, and emulsions, as well as pills, capsules, granules, or tablets. Furthermore, it can be preferably formulated according to each disease or component using appropriate methods in the field or methods disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

[0151] The composition of the present invention may additionally contain one or more active ingredients exhibiting the same or similar functions. The composition of the present invention comprises the protein in an amount of 0.0001 to 10 weight %, preferably 0.001 to 1 weight %, based on the total weight of the composition.

[0152] The pharmaceutical composition of the present invention may further include pharmaceutically acceptable additives, wherein the pharmaceutically acceptable additives may include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, malt syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sucrose, dextrose, sorbitol, and talc. The pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight with respect to the composition, but is not limited thereto.

[0153] The composition of the present invention may be administered parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) or orally depending on the intended method, and the dosage varies depending on the patient's body weight, age, gender, health condition, diet, time of administration, method of administration, excretion rate, and severity of the disease. The daily dosage of the composition according to the present invention is 0.0001 to 10 mg / ml, preferably 0.0001 to 5 mg / ml, and it is more preferable to administer it once or several times a day.

[0154] Liquid formulations for oral administration of the composition of the present invention include suspensions, liquid formulations, emulsions, syrups, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients, such as humectants, sweeteners, flavorings, and preservatives, may be included. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories, etc.

[0155] In one aspect, the present invention relates to an anticancer adjuvant comprising the drug delivery system or peptide-drug conjugate of the present invention as an active ingredient.

[0156] In one embodiment, the anticancer adjuvant of the present invention may be administered in combination with an immunotherapy agent simultaneously, separately, or sequentially.

[0157] In one embodiment, the anticancer adjuvant of the present invention can reduce the side effects of an immunotherapy drug.

[0158] In one embodiment, the immunotherapeutic agent may be an immune checkpoint inhibitor, an immunosuppressant control drug, a cancer vaccine, an immunoadjuvant, an immune cell for cancer treatment, an immune cell activation cofactor, an antibody for cancer treatment, or a cytokine necessary for maintaining the activity of an immune cell for cancer treatment.

[0159] In one embodiment, the immunosuppressant controlling drug may be a drug that reduces the level of regulatory T cells (Treg).

[0160] In one embodiment, the immune checkpoint inhibitor may be an inhibitor of CTLA-4, PD-1, PD-L1, PD-L2, LAG-3, BTLA, B7H3, B7H4, TIM3, KIR, TIGIT, CD47, VISTA, or A2aR.

[0161] The above-mentioned immunosuppressant control drugs activate the immune response of T effector cells by reducing regulatory T cells (Treg), but this acts on systemic Tregs to induce immune-related adverse events (irAE), and immune checkpoint inhibitors cause various side effects as they involve the activation of the immune system. Therefore, by using the peptide, antibody, or fragment having immunological activity thereof that specifically binds to CCR8, which is specifically expressed in tumor-infiltrating regulatory T cells, cytotoxic drugs can be specifically delivered to the tumor microenvironment or cancer cells, and only tumor-infiltrating regulatory T cells can be destroyed without affecting other effector T cells or peripheral Tregs, thereby providing an effect of anti-tumor immunity and minimizing side effects when used in combination with immunotherapies.

[0162] In one aspect, the present invention relates to a method for preventing or treating cancer comprising the step of administering a pharmaceutical composition or an anticancer adjuvant of the present invention to an individual.

[0163] The term "individual" as used in this invention refers to a subject requiring a method for the prevention, control, or treatment of a disease, and may be used without limitation and includes humans, dogs, monkeys, cats, rodents, e.g., mice, genetically modified mice, etc. More specifically, it refers to mammals such as humans or non-human primates, mice, rats, dogs, cats, horses, and cattle.

[0164]

[0165] The present invention will be explained in more detail through the following examples. However, the following examples are intended only to illustrate the content of the present invention and do not limit the present invention.

[0166]

[0167] Example 1. Screening of CCR8-binding proteins via biopanning

[0168] To find peptides that bind to human CCR8 (CC chemokine receptor 8 / chemokine (cc motif) receptor 8), a phage library was bound to the CCR8 protein using the Ph.D.™-C7C Phage Display Peptide Library Kit, and the process of titrating, counting, and amplifying the acquired phages was repeated three times, and in the fourth round, Peripheral Blood Mononuclear Cell (PBMC) negative screening was performed to select phages that bind to CCR8 (Figs. 1A to E). Specifically, to coat and pan the surface of the human CCR8 protein, 1.5 mL of a solution containing 10 μg / mL of full-length human CCR8 protein-VLP (HEK293) (ACRO Biosystems, Newark, DE, USA) dissolved in 0.1 M NaHCO3 (pH 8.6) was placed in a 60 x 15 mm Petri dish (SPL life science, Gyeonggi-do, Korea) and incubated overnight at 4°C with light stirring in a humidified container. After blocking for 1 hour at 4°C with blocking buffer (0.1 M NaHCO3 (pH 8.6) and 5 mg / mL BSA), the sample was washed 6 times with TBST (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, and 0.1% [v / v] Tween-20). Subsequently, the phage display peptide library of the M13 peptide library screening kit (Ph.D.-C7C phage display peptide library kit) (1 × 10 per 10 μL) 11The canine phage) was diluted 100-fold with 1 mL of TBST (TBS and 0.1% [v / v] Tween-20) and added to a plate (Petri dish) coated with the human CCR8 protein, and gently stirred at room temperature for 60 minutes. The dish was washed 10 times with TBST, and the bound phage was eluted by gently stirring at room temperature for 60 minutes using elution buffer (10 µg / mL Trypsin from porcine pancreas (T4799-5G) (Sigma, St. Louis, MO, US) in PBS (pH 7.4)). To titrate the eluted phage, 10 to 10 3Each phage was diluted, and 10 μL of each was mixed with 200 μL of ER2738 and cultured in LB (Per liter: 10 g Bacto-Tryptone, 5 g yeast extract, 5 g NaCl) until the mid-log phase (OD600 ~ 0.5), followed by inoculation at RT for 5 minutes. Each tube was mixed with Top Agar at 45°C in a culture tube, poured onto an LB / IPTG (isopropyl β-D-1-thiogalacto-pyranoside) / X-Gal (5-Bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside) plate, and incubated overnight at 37°C. Plaques were counted on a plate containing approximately 100 plaques, and the phage titer in pfu (plaque forming units) per 10 μL was calculated by multiplying the resulting number by the corresponding dilution factor for each plate. Subsequently, to amplify the phages, ER2738 was cultured overnight in 5 mL of culture medium containing LB and tetracycline (10 μg / mL), and E. coli culture was inoculated overnight into 20 mL of culture medium in a 250 mL Erlenmeyer flask. 1 μL of phage suspension was added to the flask and stirred at 250 rpm at 37°C for 4 to 5 hours. Cells were removed by centrifugation at 4500 g for 10 minutes, the supernatant was transferred to a new tube, and centrifugation was repeated. Subsequently, the top 16 mL of the supernatant was transferred to a new tube, 4 mL of 2.5 M NaCl / 20% PEG-8000 (w / v) was added, and the phages were precipitated overnight at 4°C. The precipitated phage pellet was centrifuged at 12,000 × g for 15 minutes to separate the supernatant; the pellet was then resuspended in 1 mL of TBS (Tris-buffered saline) and lightly centrifuged to remove cellular debris. This was transferred to a new tube and 2.200 μL of 5 M NaCl / 20% PEG-8000 was added and incubated on ice for 60 minutes, followed by centrifugation at 14,000 rpm for 10 minutes. The supernatant was completely removed, and the pellet was resuspended in 200 μL of TBS and titrated using the phage tittering method. Using the phage obtained from the first amplification, it was poured onto a human CCR8-coated plate, bound, washed, and eluted to obtain the phage, after which a second amplification was performed, and phage titration was carried out at each step. A total of four panning cycles were repeated using the above method; starting from the second panning, the concentration of CCR8 and tween-20 dissolved in TBST during washing after phage binding was increased to 0.3%, and in the third and fourth cycles, it was increased to 0.5%. In addition, in the final 4th panning stage, 1.2 × 10 PBMCs separated from whole blood. 5 The sample was suspended in 10 mL of TBS and incubated with 100 μL of tertiary amplified phage in a 10 cm culture dish at 4000 rpm for 1 hour at 4°C with stirring. Afterward, the sample was centrifuged at 4°C for 5 minutes, and only the supernatant was collected, bound to a human CCR8-coated plate, and then quaternary panning was performed.

[0169] As a result of titrating the waste obtained from each round, 6.0 x 10 in the first round (R1) 12 pfu / mL, 1.85 × 10⁻⁶ in the second round (R2) 7 pfu / mL, 3 × 10⁻⁶ in the 3rd round (R3) 7 pfu / mL and 6.1 × 10⁻⁶ in the 4th round (R4). 7 It was shown as pfu / mL, and the amplification results in each round were 6.0 x 10⁻⁶ in the first round (R1). 12 pfu / mL, 3.4 × 10⁻⁶ in the second round (R2) 13 pfu / mL, 8.8 × 10⁻⁶ in the 3rd round (R3) 12pfu / mL and 8.5 × 10⁻⁶ in the 4th round (R4) 12 The result was found to be pfu / mL (Figs. 2 and 3). As the above titration and panning proceeded, the number of phages binding to CCR8 increased. This result was due to the removal of non-specific or low-binding phages by selecting and amplifying phages with high binding affinity for CCR8 through the panning step and PBMC negative selection, thereby confirming that phages having peptides that selectively bind to CCR8 were selected.

[0170]

[0171] Example 2. Screening of CCR8-binding proteins via NGS analysis

[0172] Targeted amplification was performed on phages amplified in rounds 1 through 4, and nucleotide sequences were analyzed using the Ilumina NGS method (Figs. 1F to G). Specifically, phages from the phage display peptide library were amplified, and ssDNA was extracted using the phage DNA Isolation Kit (Norgen # 4600). During the library preparation process, after the first PCR for adapter ligation (Forward: 5'-CCTTTAGTGGTACCTTTCTATTCTCACTCT-3' and Reverse: 5'-GTAAATGAATTTTCTGTATGGGATTTTGCT-3'), a second PCR was performed using different primers for sample multiplexing (Table 1). Subsequently, the samples were electrophoresed on a 1% agarose gel, and only the corresponding portions were cut and eluted to prepare the library using the TruSeq DNA kit, thereby constructing the final library. The targeted NGS process utilized a cluster-based MiSeq sequencing device that uses bridge amplification to generate templates for sequencing. 5 Gb of data was obtained using a multi-run method with Illumina SBS (Sequencing by synthesis) technology, and FASTQ file data was generated using RTA (Real Time Analysis) software.

[0173] Library NameForward SequenceReverse SequenceRunning ScaleR1AGGTCAGATATATCTTGTAG250bp x 2(paired-end)R2CGTCTCATATAGCTACTATA250bp x 2(paired-end)R3ATTCCATAAGCCACCAGGCA250bp x 2(paired-end)R4GACGAGATTAAGGATAATGT250bp x 2 (paired-end)

[0174] In each round, 850,818 (R0), 983,417 (R1), 1,163,329 (R2), 703,429 (R3), and 743,870 (R4) reads were obtained, and among these, peptide sequences with 10 or more reads were found to be 3,717 in R1, 1,995 in R2, 726 in R3, and 336 in R4 (Figs. 4 to 8). When the number of NGS reads in each round is divided by 1 to 100,000, it was found that the number of peptide reads decreased only once from round 1 to round 4, indicating that as the panning process is repeated, peptides that do not bind to CCR8 are gradually filtered out and removed.

[0175]

[0176] Example 3. Screening of CCR8-binding peptides through clustering analysis

[0177] Quantitative analysis using heatmaps (Babicki et al., 2016) was performed on 336 peptides with 10 or more reads in the 4th round using Pearson distance measurement methods and average linkage variables. Specifically, among the peptide sequences obtained from the NGS results of Example 2 above, sequences with 10 or more reads in the 4th round PBMC competition were selected, substituted with amino acids, and then analyzed using the heatmapper online program (http: / www.heatmapper.ca). Pearson distance measurement methods and average linkage were used, and heatmaps were generated based on Z-scores derived from the number of reads according to the panning round. In addition, hierarchical clustering was performed using the MEGA11 program to align the sequences, common (consensus) sequences between clusters were identified, and trees were generated.

[0178] As a result, based on quantitative changes in each bio-panning step (R1-R4), 336 peptides were divided into three main clusters, A, B, and C, and within each cluster, based on precise quantification, they were divided into four groups (A0, A1, A2, and A3; B0, B1, B2, and B3; and C0, C1, C2, and C3) (Fig. 9). Among these, Cluster A (n = 135) was the group that showed the most significant quantitative increase as the bio-panning step progressed, and amino acid sequence alignment analysis revealed that all peptides belonging to Cluster A (peptides in groups A0 to A3) shared a common sequence of EKMVATH (Sequence No. 1) (Fig. 10). In addition, in Cluster B (n = 59), the B0 group (n = 27) accounted for the largest number and was found to share the common sequence of HNYHNAT (Sequence No. 3) (Fig. 11). The alignment results of the C0 group (n = 38), which accounted for the largest number in Cluster C, showed that it shared the common sequence of DGRPDRA (Sequence No. 2) (Fig. 12). The three peptides derived from the above results ranked high in actual read counts, and the change in read counts of the three peptides according to the panning rounds was found to correspond with the change in Z-scores of each cluster. Accordingly, to analyze the direct binding affinity of the three peptides with CCR8, disulfide bonds were formed by adding the amino acid sequences of AC to the N-terminus and CGGG to the C-terminus of each peptide, similar to the morphology of M13 phage. The three types of peptides produced in this way were named cpbp-000001 (ACEKMVATHCGGG) (Sequence No. 4), cpbp-000002 (ACDGRPDRACGGG) (Sequence No. 5), and cpbp-000003 (ACHNYHNATCGGG) (Sequence No. 6), and FITC was attached to the C-terminus of each peptide as a label (Fig. 13).

[0179]

[0180] Example 4. Analysis of binding between the CCR8-binding peptide of the present invention and CCR8

[0181] 4-1. Prediction of the structure of human CCR8

[0182] Since only AlphaFold structural prediction data is currently available for human CCR8, secondary and tertiary structural predictions were performed using the human CCR8 amino acid sequence to generate a data format suitable for molecular docking simulations to predict whether the three peptides derived in Example 3 bind to human CCR8. The amino acid sequence information for human CCR8 (355 amino acids, 40,844 Da) was obtained from the UniProt database (https: / www.uniprot.org / uniprotkb / P51685) (Fig. 15). Secondary structure prediction was performed on the PSIPRED workbench (http: / bioinf.cs.ucl. ac. uk / psirped) using PSIPRED 4.0 (Fig. 14), and tertiary structure prediction models for CCR8, CCL1 fragment, cpbp-000001, cpbp-000002, and cpbp-000003 were generated as PDB files using the trRosetta algorithm (https: / yanglab.nankai.edu.cn / trRosetta). Analysis of the tertiary structure models predicted that CCR8 would consist of N-terminal and C-terminal structures similar to other CCR protein families, as well as seven transmembranes (TMs) and extracellular loops (Fig. 16).

[0183]

[0184] 4-2. Modeling Protein-Peptide Binding through Protein-Peptide Docking Simulation

[0185] The binding structures of CCR8 as the target protein and cpbp-000001, cpbp-000002, and cpbp-000003 derived in Example 3 as binding peptides were analyzed, and to confirm whether their binding sites were related to the binding sites of CCL1 and CCR8, the N-terminal fragment of CCL1 (SKSMQVPFSRCCFSFA) was also analyzed as a binding peptide. Specifically, protein-peptide docking simulations were performed using the structural PDB files and amino acid sequences of each protein and peptide, and a prediction model was generated using the trRosetta server and the CABS-dock server (http: / biocomp.chem.uw.edu.pl / CABSdock). First, the results of the binding simulation of CCL1 and CCR8 (model no. 1 among 10 binding prediction models) showed that the peptide fragment of the N-terminus of CCL1 was bound in a form that included the TM subpocket (transmembrane subpocket) formed by the aggregation of 7 TMs of the predicted binding CCR8 (Figs. 17 to 19).

[0186] In addition, the results of the coupling simulation of cpbp-000001, cpbp-000002, and cpbp-000003 with CCR8 showed that cbpc-000002 (model no. 1) attached to the CCR8 TM subpocket, similar to the model of CCL1 (Fig. 21). Furthermore, cbpb-000001 (model no. 3) and cbpc-000003 (model no. 5) were also found to bind to the TM subpocket of human CCR8, respectively (Figs. 20 and 22). The peptide fragment binding prediction model attached to the TM subpocket of CCR8 was found to have similar binding sites, and as a result of deriving the CCR8 binding prediction sites of the N-terminus of CCL1 and the CCR8 binding peptides of the present invention cpbp-000001, cpbp-000002, and cpbp-000003, it was confirmed that they were 20 to 50, 80 to 120, 160 to 210, and 250 to 290 based on the total sequence of human CCR8 (Figs. 23 to 27).

[0187]

[0188] Example 5. Confirmation of binding of the peptide of the present invention to CCR8 on the cell membrane

[0189] To confirm whether the CCR8-binding peptides cpbp-000001, cpbp-000002, and cpbp-000003 derived in this invention bind to CCR8 on the actual cell membrane, Jurkat cells overexpressing CCR8 were constructed, and the binding of said peptides was verified by flow cytometry. Specifically, a plasmid vector pLV[Exp]-mCherry:T2A:Puro-EF1A>hCCR8 [NM_005201.4] expressing hCCR8 labeled with mCherry fluorescence and conferring resistance to puromycin was synthesized (VectorBuilder Inc.) (Fig. 28), and a lentivirus was constructed using this vector and lentivirus vector packaging. 2.5 × 10⁶ Jurkat cells suspended in RPMI supplemented with 10% FBS 5cells / mL were dispensed into a 24-well plate, and the lentivirus particles prepared above (2.80 × 10⁶ 8 5 µl / well (MOI 5) and 8 µg / mL polybrene were added. The plates were sealed and centrifuged at 931 × g for 90 minutes at 30 °C; after removing the seal, the plates were incubated overnight at 37 °C and 5% CO2. The supernatant was removed, and the plates were resuspended in RPMI (Welgene) containing 8 µg / mL puromycin (Sigma) and 10% FBS (Welgene). The medium was changed over several days, and when the number of cells expressing mcherry increased under a fluorescence microscope, the cells were subcultured to produce stable CCR8 + Jurkat cells were constructed (Figs. 29 and 30). The constructed CCR8 + Jurkat cells 2 × 10⁶ 5 Dogs were washed with FBS staining buffer (BD bioscience, CA, USA), mixed with 1 μg / mL each of cpbp-000001, cpbp-000002, and cpbp-000003, and incubated at 4°C for 1 hour. They were washed twice with FBS staining buffer and flow cytometry was performed.

[0190] As a result, the peptides cpbp-000001, cpbp-000002, and cpbp-000003 of the present invention exhibited binding affinities of 1.8%, 1.62%, and 1.01%, respectively, to the control group (Jurkat cells), whereas CCR8 + In Jurkat cells, the peptides showed binding affinities of 27.77%, 24.14%, and 18.55%, respectively (Fig. 13), confirming that the peptide derived from the present invention specifically binds to CCR8 on the actual cell membrane.

Claims

1. A peptide, antibody, or fragment having the same immunological activity that specifically binds to an epitope comprising an amino acid at position 20 to 50, an amino acid at position 80 to 120, an amino acid at position 160 to 210, or an amino acid at position 250 to 290 of CCR8 (CC chemokine receptor 8).

2. The peptide, antibody, or fragment having the same’s immunological activity comprising any one selected from the group consisting of the amino acid sequences of SEQ ID NOs. 1 to 3.

3. In claim 1, a peptide, antibody, or fragment having the immunological activity thereof comprising the amino acid sequence of SEQ ID NO.

5.

4. In claim 1, a peptide, antibody, or fragment having the immunological activity thereof comprising the amino acid sequence of SEQ ID NO.

6.

5. In claim 1, human CCR8 is a peptide, antibody, or fragment having the same’s immunological activity, comprising the amino acid sequence of SEQ ID NO.

7.

6. A composition for detecting tumor-infiltrating regulatory T cells (Ti-Treg), comprising the peptide of claim 1, an antibody, or a fragment having the immunological activity thereof.

7. A composition for detecting tumor-infiltration-regulating T cells, wherein, in claim 6, a label is additionally included.

8. A composition for detecting tumor-infiltration-regulating T cells, wherein the label in claim 7 is a chromogenic enzyme, a radioisotope, a chromopore, a luminescent substance, a fluorescent substance, a probe, or a tag.

9. A drug delivery system comprising the peptide of claim 1, an antibody or a fragment having immunological activity thereof, and a drug combined therewith.

10. In paragraph 9, the drug is a drug delivery vehicle that is a compound, RNA, DNA, antibody, effector, prodrug, toxin, peptide, or radionuclide.

11. In paragraph 9, the drug is a drug delivery vehicle that is an immunogenic apoptosis inducer, a pro-apoptotic peptide, a microtubulin structure formation inhibitor, a meiosis inhibitor, a topoisomerase inhibitor, a DNA intercalator, a toxin, or an anticancer agent.

12. In claim 11, the pre-apoptotic peptide is a drug delivery vehicle selected from the group consisting of KLA, alpha-defensin-1, BMAP-28, Brevenin-2R, Buforin IIb, cecropin A-Magainin 2 (CA-MA-2), cecropin A, cecropin B, chrysophsin-1, D-K6L9, Gomesin, Lactoferricin B, LLL27, LTX-315, Magainin 2, Magainin II-bombesin conjugate (MG2B), Pardaxin, and combinations thereof.

13. In claim 11, the immunogenic apoptosis inducer is a drug delivery vehicle selected from the group consisting of anthracycline anticancer agents, taxane anticancer agents, anti-EGFR antibodies, BK channel agonists, bortezomib, cardiac glycosides, cyclophosphamide anticancer agents, GADD34 / PP1 inhibitors, LV-tSMAC, Measles virus, bleomycin, mitoxantrone, oxaliplatin, and combinations thereof.

14. In paragraph 11, the anticancer agents are SN-38 (7-ethyl-10-hydroxy-camptothecin), daunorubicin, doxorubicin, epirubicin, idarubicin, pixantrone, sabarubicin, valrubicin, paclitaxel, docetaxel, mechloethamine, chlorambucil, phenylalanine, mustard, cyclophosphamide, ifosfamide, carmustine (BCNU), lomustine (CCNU), Streptozotocin, busulfan, thiotepa, cisplatin, carboplatin, dactinomycin (actinomycin D), plicamycin, mitomycin C, vincristine, vinblastine, teniposide, topotecan, iridotecan, uramustine, melphalan, bendamustine, dacarbazine, temozolomide, altretamine, duocarmycin, nedaplatin, oxaliplatin, satraplatin, Triplatin tetranitrate, 5-fluorouracil, 6-mercaptopurine,Capecitabine, cladribine, clofarabine, cystarbine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, pentostatin, thioguanine, etoposide, mitoxantrone, izabepilone, vindesine, vinorelbine, estramustine, maytansine, DM1 (mertansine), DM4, dolastatin, auristatin E, auristatin A drug delivery system selected from the group consisting of F(auristatin F), monomethyl auristatin E (MMAE), monomethyl auristatin F (monomethyl auristatin F), and derivatives thereof.

15. A drug delivery system according to claim 9 that specifically delivers a drug to the tumor microenvironment or cancer cells.

16. A drug delivery system that specifically reduces tumor-infiltration regulatory T cells in claim 9.

17. A pharmaceutical composition for the prevention or treatment of cancer comprising the drug delivery system of claim 9 as an active ingredient.

18. In paragraph 17, cancer is any one selected from the group consisting of brain tumor, melanoma, multiple myeloma, non-small cell lung cancer, oral cancer, liver cancer, gastric cancer, colon cancer, breast cancer, lung cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cervical cancer, ovarian cancer, colorectal cancer, small intestine cancer, rectal cancer, fallopian tube carcinoma, proanal cancer, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, lymphoma, bladder cancer, gallbladder cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, kidney or ureteral cancer, renal cell carcinoma, renopelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma and pituitary adenoma A pharmaceutical composition for the prevention or treatment of cancer.

19. An anticancer adjuvant comprising a drug delivery system of Clause 9 as an active ingredient.

20. An anticancer adjuvant administered in combination with an immunotherapy agent, simultaneously, separately, or sequentially, according to Clause 19.

21. An anticancer adjuvant that reduces the side effects of an immunotherapy drug in paragraph 19.

22. In paragraph 21, the immunotherapeutic agent is an immune checkpoint inhibitor, an immunosuppressant controlling drug, a cancer vaccine, an immunoadjuvant, an immune cell for cancer treatment, an immune cell activation cofactor, an antibody for cancer treatment, or a cytokine necessary for maintaining the activity of an immune cell for cancer treatment.

23. In paragraph 22, the immunosuppressant controlling drug is an anticancer adjuvant that is a drug that reduces the level of regulatory T cells (Treg).

24. In paragraph 22, the immune checkpoint inhibitor is an anticancer adjuvant that is an inhibitor of CTLA-4, PD-1, PD-L1, PD-L2, LAG-3, BTLA, B7H3, B7H4, TIM3, KIR, TIGIT, CD47, VISTA, or A2aR.

25. A method for preventing or treating cancer comprising the step of administering the pharmaceutical composition of claim 17 or the anticancer adjuvant of claim 19 to an individual.

Images