Sirnas targeting complement factor h-related (CFHR) gene transcripts and methods of use

Abstract

The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the CFHR genes including CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5, as well as methods of inhibiting expression of CFHR genes including CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5, and methods of treating subjects that would benefit from reduction in expression of CFHR genes including CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5, such as subjects having a CFHR-associated disease, disorder, or condition, using such dsRNA compositions.

Description

[0001] SIRNAS TARGETING COMPLEMENT FACTOR H-RELATED (CFHR) GENE TRANSCRIPTS AND METHODS OF USE

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of priority to U. S. Provisional Application No.

[0004] 63 / 716,577, filed on November 5, 2024, and claims the benefit of priority to U. S. Provisional Application No. 63 / 906,901, filed October 28, 2025. The entire contents of the foregoing applications are hereby incorporated herein by reference.

[0005] SEQUENCE LISTING

[0006] The instant application contains a Sequence Listing which has been filed electronically in extensible Markup Language (XML) format and is hereby incorporated by reference in its entirety. Said XML copy, created on October 31, 2025, is named A108868_1810WO_SL.xml and is 59,957,248 bytes in size.

[0007] FIELD OF THE INVENTION

[0008] The instant disclosure relates generally to complement factor H-related (CFHR)-targeting dsRNA agents and methods for their use.

[0009] BACKGROUND OF THE INVENTION

[0010] Age-related macular degeneration (AMD) is a leading cause of blindness among older adults worldwide. Major factors that contribute to AMD include advanced age, environmental factors such as smoking, and genetic risk factors. Current treatments often slow but do not halt vision loss and can be burdensome due to a need for regular intravitreal injections. Hence, there is a need for more effective and easily maintained treatments.

[0011] There is a significant association between AMD and the complement factor H (CFH) and complement factor H-related (CFHR) genes. In humans, there are five CFHR plasma proteins, CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5, produced in the liver, that are structurally and genetically related to CFH. CFHRs act by competing with CFH, a negative regulator of complement. The regulation of complement by CFHRs is thought to be predominantly on extracellular matrix (ECM)Zcell surfaces primarily of the kidney and back of the eye. Genetic analysis has shown that CFHR5 loss of function and deletion of CFHR1 / 3 are protective for AMD, including wet AMD. Increased circulating CFHR1 and CFHR5 proteins are also associated with AMD. There is also evidence that CFHR2 and CFHR4 may be protective in AMD.

[0012] Genetic mutations / fusions in CFHR genes have also been associated with the kidney diseases atypical hemolytic uremic syndrome (aHUS), C3 glomerulopathy (C3g), Cypriot C3g which is caused by a genetic mutation in the CFHR5 gene, and immunoglobulin A nephropathy (IgAN). Additional kidney diseases in which complement dysregulation is believed to have a role include, for example, IgA-associated vasculitis with nephritis (IgAVN), anti-neutrophil cytoplasmic antibody mediated vasculitis (ANCA), immune complex membranoproliferative glomerulonephritis (IC-MPGN), ischemic reperfusion injury, Lupus nephritis, systemic lupus erythematosus (SLE), membranous nephropathy (MN), chronic transplant mediated glomerulopathy, diabetic nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis (AAV), thrombotic microangiopathy (TMA), and focal segmental glomerulosclerosis (FSGS).

[0013] Accordingly, there is a need for methods of treating diseases involving complement dysregulation, such as AMD, including agents that can selectively and efficiently inhibit the CFHR genes.

[0014] BRIEF SUMMARY OF THE INVENTION

[0015] There is a need for improved methods of treating CFHR-associated diseases, such as age-related macular degeneration (AMD), atypical hemolytic uremic syndrome (aHUS), C3 glomerulopathy (C3g), and immunoglobulin A nephropathy (IgAN), including agents that can selectively and efficiently inhibit a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene. Current standards of care for subjects with AMD include vitamin C, vitamin E, lutein, zeaxanthin, zinc, copper, and / or vascular endothelial growth factor (VEGF) inhibitors, including antibodies targeting VEGF.

[0016] The present invention provides iRNA compositions which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene. The CFHR gene may be within a cell, e.g., a cell within a subject, such as a human. The present invention also provides methods of using the iRNA compositions of the invention for inhibiting the expression of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene and / or for treating a subject who would benefit from inhibiting or reducing the expression of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene, e.g., a subject suffering or prone to suffering from an CFHR-associated disease, for example, AMD, aHUS, C3g, or IgAN.

[0017] Accordingly, in one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of a complement factor H-related (CFHR) gene in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding CFHR which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 3-19.

[0018] In one embodiment, the CFHR is CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5. In certain embodiments, the CFHR is CFHR1, CFHR2, and CFHR5.

[0019] In another aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement factor H-related 1 (CFHR1) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding CFHR1 which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 3-19.

[0020] In another aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement factor H-related 5 (CFHR5) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding CFHR5 which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 3-19.

[0021] In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the sense sequences listed in any one of Tables 3-19.

[0022] In another aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement factor H-related 1 and complement factor H-related 5 in a cell, wherein the dsRNA agent comprises: (a) a sense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’-UCCUGUGAAUAUAAUUUUGUA-3’ (SEQ ID NO: 6065); and (b) an antisense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’-UACAAAAUUAUAUUCACAGGAGU-3’ (SEQ ID NO: 6340).

[0023] In another aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement factor H-related 1 and complement factor H-related 5 in a cell, wherein the dsRNA agent comprises: (a) a sense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’-UGUGAAUAUAAUUUUGUGUCA-3’ (SEQ ID NO: 8083); and (b) an antisense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’-UGACACAAAAUUAUAUUCACAGG-3’ (SEQ ID NO: 8084).

[0024] In another aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement factor H-related 1 and complement factor H-related 5 in a cell, wherein the dsRNA agent comprises: (a) a sense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’-ACUCCUGUGAAUAUAAUUUUA-3’ (SEQ ID NO: 6066); and (b) an antisense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’-UAAAAUTAUAUTCACAGGAGUAA-3’ (SEQ ID NO: 6341).

[0025] In one embodiment, the dsRNA agent comprises at least one modified nucleotide.

[0026] In one embodiment, substantially all of the nucleotides of the sense strand comprise a modification. In another embodiment, substantially all of the nucleotides of the antisense strand comprise a modification. In another embodiment, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a modification.

[0027] In one embodiment, all of the nucleotides of the sense strand comprise a modification. In one embodiment, all of the nucleotides of the antisense strand comprise a modification. In certain embodiments, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification.

[0028] In one embodiment, the at least one modified nucleotide is selected from the group consisting of a deoxy-nucleotide, a 3 ’-terminal deoxy-thymine (dT) nucleotide, a 2’-O-methyl modified nucleotide, a 2’-fluoro modified nucleotide, a 2 ’-deoxy -modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2 ’ -O-allyl -modified nucleotide, 2’-C-alkyl-modified nucleotide, 2 ’-hydroxyl -modified nucleotide, a 2 ’-methoxyethyl modified nucleotide, a 2’-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5’-phosphate, a nucleotide comprising a 5’-phosphate mimic, a glycol modified nucleotide, and a 2-O-(N-methylacetamide) modified nucleotide, and combinations thereof. In certain embodiments, the nucleotide modifications are 2 ’-0 -methyl and / or 2 ’-fluoro modifications.

[0029] In one embodiment, the antisense strand comprises two phosphorothioate intemucleotide linkages at the 5 ’-terminus and two phosphorothioate intemucleotide linkages at the 3 ’-terminus

[0030] In one embodiment, the region of complementarity is at least 17 nucleotides in length.

[0031] In one embodiment, the region of complementarity is 19 to 30 nucleotides in length. In another embodiment, the region of complementarity is 19-25 nucleotides in length. In another embodiment, the region of complementarity is 21 to 23 nucleotides in length.

[0032] In one embodiment, each of the sense strand and the antisense strand is no more than 30 nucleotides in length.

[0033] In one embodiment, each of the sense strand and the antisense strand is independently 19-30 nucleotides in length. In another embodiment, each of the sense strand and the antisense strand is independently 19-25 nucleotides in length. In another embodiment, each of the sense strand and the antisense strand is independently 21-23 nucleotides in length.

[0034] In one embodiment, the at least one of the sense strand or the antisense strand comprises a 3’ overhang of at least 1 nucleotide. In another embodiment, the at least one of the sense strand or the antisense strand comprises a 3’ overhang of at least 2 nucleotides.

[0035] In one embodiment, the dsRNA agent further comprises a ligand. In one embodiment, the ligand is conjugated to the 3’ end of the sense strand of the dsRNA agent. In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0036] In one embodiment, the sense strand is conjugated to the GalNAc derivative through a monovalent, bivalent or trivalent branched linker at the 3 ’-terminus.

[0037] In one embodiment, the ligand is

[0038]

[0039] In one embodiment, the dsRNA agent is conjugated to the ligand as shown in the following schematic

[0040]

[0041] and, wherein X is 0 or S.

[0042] In one embodiment, the X is 0.

[0043] In one embodiment, the dsRNA agent comprises any one of the antisense sequences listed in any one of Tables 3-19.

[0044] In one embodiment, the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of the nucleotide sequences of any one of the agents listed in any one of Tables 3-19.

[0045] In one embodiment, the dsRNA agent is selected from the group consisting of AD-2288789, AD-2443565, AD-2443574, AD-2787983, AD-3002629, AD-3002631, AD-3002632, AD-3002633, AD-3002634, AD-3002635, AD-3002636, AD-3002637, AD-3002638, AD-3002639, AD-2905718, AD-2905719, AD-2905723, and AD-2905726. In one embodiment, the dsRNA agent targets a hotspot region of an mRNA encoding a CFHR. In one embodiment, the CFHR is CFHR1 and / or CFHR5. In another embodiment, the CFHR is CFHR1, CFHR2, and CFHR5.

[0046] In one aspect, the present invention provides a dsRNA agent that targets a hotspot region of a complement factor H-related (CFHR) mRNA. In one embodiment, the CFHR is CFHR1 and / or CFHR5. In another embodiment, the CFHR is CFHR1, CFHR2, and CFHR5.

[0047] In one aspect, the present invention provides a cell containing the dsRNA agent of any one of claims 1-45.

[0048] In another aspect, the present invention provides a vector encoding at least one of the sense strand or the antisense strand of the dsRNA agent of any one of claims 1-45.

[0049] In one aspect, the present invention provides a pharmaceutical composition for inhibiting expression of a CFHR gene comprising any of the dsRNA agents provided herein.

[0050] In one embodiment, the CFHR is CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5. In another embodiment, the CFHR is CFHR1, CFHR2, and CFHR5.

[0051] In one embodiment, the dsRNA agent is formulated in an unbuffered solution. In some embodiments, the unbuffered solution is saline or water.

[0052] In one embodiment, the dsRNA agent is formulated with a buffered solution. In some embodiments, the buffered solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. In another embodiment, the buffered solution is phosphate buffered saline (PBS).

[0053] In one aspect, the present invention provides a method of inhibiting CFHR expression in a cell, the method comprising introducing into the cell any of the dsRNA agents provided herein, or a pharmaceutical composition provided herein, thereby inhibiting expression of CFHR in the cell.

[0054] In one embodiment, the CFHR is CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5. In another embodiment, the CFHR is CFHR1, CFHR2, and CFHR5.

[0055] In one embodiment, the cell is within a subject. In one embodiment, the subject is a human.

[0056] In one embodiment, the CFHR expression is inhibited by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or to below the level of detection of CFHR1 and / or CFHR5 expression.

[0057] In one embodiment, the human subject suffers from a CFHR-associated disease, disorder, or condition.

[0058] In one embodiment, the CFHR-associated disease, disorder, or condition is age-related macular degeneration (AMD).

[0059] In another embodiment, the CFHR-associated disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), C3 glomerulopathy (C3g), Cypriot C3g, immunoglobulin A nephropathy (IgAN), IgA-associated vasculitis with nephritis (IgAVN), anti-neutrophil cytoplasmic antibody mediated vasculitis (ANCA), immune complex membranoproliferative glomerulonephritis (IC-MPGN), ischemic reperfusion injury, Lupus nephritis, systemic lupus erythematosus (SLE), membranous nephropathy (MN), chronic transplant mediated glomerulopathy, diabetic nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis (AAV), thrombotic microangiopathy (TMA), or focal segmental glomerulosclerosis (FSGS).

[0060] In one embodiment, the subject has a complement factor H (CFH) Y402H polymorphism.

[0061] In another aspect, the present invention provides a method of inhibiting the expression of CFHR in a subject, the method comprising administering to the subject a therapeutically effective amount of any of the dsRNA agents provided herein, or a pharmaceutical composition provided herein, thereby inhibiting the expression of CFHR in the subject.

[0062] In another aspect, the present invention provides a method of treating a subject suffering from a CFHR-associated disease, disorder, or condition, comprising administering to the subject a therapeutically effective amount of any of the dsRNA agents provided herein, or a pharmaceutical composition provided herein, thereby treating the subject suffering from a CFHR-associated disease, disorder, or condition.

[0063] In another aspect, the present invention provides a method of preventing at least one symptom in a subject having a disease, disorder or condition that would benefit from reduction in expression of a CFHR gene, comprising administering to the subject a prophylactically effective amount of any of the dsRNA agents provided herein, or a pharmaceutical composition provided herein, thereby preventing at least one symptom in a subject having a disease, disorder or condition that would benefit from reduction in expression of a CFHR gene.

[0064] In one embodiment, the subject is suffering from a CFHR-associated disease, disorder, or condition. In one embodiment, the CFHR-associated disease, disorder, or condition is AMD.

[0065] In another embodiment, the CFHR-associated disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), C3 glomerulopathy (C3g), Cypriot C3g, immunoglobulin A nephropathy (IgAN), IgA-associated vasculitis with nephritis (IgAVN), anti-neutrophil cytoplasmic antibody mediated vasculitis (ANCA), immune complex membranoproliferative glomerulonephritis (IC-MPGN), ischemic reperfusion injury, Lupus nephritis, systemic lupus erythematosus (SLE), membranous nephropathy (MN), chronic transplant mediated glomerulopathy, diabetic nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis (AAV), thrombotic microangiopathy (TMA), and focal segmental glomerulosclerosis (FSGS).

[0066] In one embodiment, the subject has a complement factor H (CFH) Y402H polymorphism.

[0067] In one embodiment, the CFHR is CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5. In another embodiment, the CFHR is CFHR1, CFHR2, and CFHR5.

[0068] In one embodiment, the methods provided herein further comprise administering an additional therapeutic to the subject.

[0069] In one embodiment, the dsRNA agent is administered to the subject intravenously, intramuscularly, or subcutaneously.

[0070] In one embodiment, the methods provided herein further comprise determining the level of the CFHR in the subject. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] FIG. 1A and FIG. IB illustrate the results of a PXB mouse study for human CFHR1, CFHR2, and CFHR5 mRNA knockdown. Mice were administered 1 mg / kg (mpk), 3 mpk, or 10 mpk of selected dsRNA duplexes subcutaneously. qPCR was performed on liver samples at day 14 and day 21. FIG. 1A shows the results for the percent CFHR1 mRNA remaining. FIG. 1B shows the results of the percent CFHR5 mRNA remaining. FIG. 1C shows the percent CFHR2 mRNA remaining.

[0072] FIG. 2A-2D depict the results of a PXB mouse study for human CFHR1, CFHR2, and CFHR5 mRNA knockdown. Mice were administered a single dose of 3 mpk of selected duplexes subcutaneously. qPCR was performed on liver samples at day 14. FIG. 2A shows the results for the percent CFHR1 mRNA remaining. FIG. 2B shows the results of the percent CFHR5 mRNA remaining. FIG. 2C shows the percent CFHR2 mRNA remaining. FIG. 2D illustrates the sequences and modifications of the dsRNA agents tested in the study. The sense / antisense SEQ ID NOs are as follows AD-2152635 (SEQ ID NOs: 6358 / 6633), AD-2288789 (SEQ ID NOs: 6616 / 6890), AD-2443575 (SEQ ID NOs: 6617 / 6892), AD-2443565 (SEQ ID NOs: 8085 / 8086), AD-2443568 (SEQ ID NOs: 8105 / 8114), AD-2443566 (SEQ ID NOs: 8106 / 8115), AD-2443574 (SEQ ID NOs: 6616 / 6891), AD-2288781 (SEQ ID NOs: 8107 / 8116), AD-2443573 (SEQ ID NOs: 8108 / 8117), AD-2443572 (SEQ ID NOs: 8109 / 8118), AD-2288788 (SEQ ID NOs: 8110 / 8119), AD-2443569 (SEQ ID NOs: 8111 / 8120), AD-2443571 (SEQ ID NOs: 8112 / 8121), and AD-2443570 (SEQ ID NOs: 8113 / 8122).

[0073] FIG. 3A-3C depict the results of in vitro and in vivo studies of dsRNA agent AD-2288789. FIG.

[0074] 3A illustrates the sequences and modifications of AD-2288789. FIG. 3B depicts the results of a free uptake dose-response assay in primary human hepatocytes (PHH) for AD-2288789. mRNA was measured by qPCR for CFHR1 and CFHR5 and the results are presented as the percent mRNA remaining. FIG. 3C depicts the results of an in vivo PXB mouse study. Mice were administered 3 mpk AD-2288789 or PBS. The percent mRNA remaining in the liver was assessed at day 14 for CFHR1, CFHR2, CFHR5, and CFH.

[0075] FIG. 4A and FIG. 4B depict the results of a PXB mouse study assessing the dose response for knockdown of CFHR1 and CFHR5. The mice were administered Impk, 3mpk, or lOmpk of selected dsRNA duplexes. The results are presented as the percent mRNA remaining in both table and graph formats. FIG. 4A illustrates the results for CFHR1. FIG. 4B illustrates the results for CFHR5. The first data bar for each dsRNA duplex in FIG. 4A and 4B represents Impk, the second bar represents 3mpk, and the third bar represents lOmpk.

[0076] FIG. 5 depicts the results of a PXB mouse study assessing the knockdown of CFHR1. PXB mice were administered an exemplary siRNA duplex, AD-2152719, which targets only CFHR1, at 10 mg / kg subcutaneous in a single dose at day 0. CFHR1 mRNA levels were measured in the liver at day 21. The percent liver mRNA remaining was determined. FIG. 6 depicts the results of a PXB mouse study assessing the knockdown of CFHR5. PXB mice were administered an exemplary siRNA duplex, AD-2152745, which targets only CFHR5, at 10 mg / kg subcutaneous in a single dose at day 0. CFHR5 mRNA levels were measured in the liver at day 21. The percent liver mRNA remaining was determined.

[0077] FIG. 7 depicts the results of a PXB mouse study assessing the knockdown of CFHR3. PXB mice were administered an exemplary siRNA duplex, AD-2152779, which targets CFHR3 and CFHR4 (CFHR3 / 4), at 10 mg / kg subcutaneous in a single dose at day 0. CFHR3 mRNA levels were measured in the liver at day 21. The percent liver mRNA remaining was determined.

[0078] FIG. 8A-FIG. 8D depict the results of a PXB mouse study. PXB mice were administered exemplary siRNA duplexes AD-2787983, AD-2288789.2, AD-3002629, AD-3002631, AD-3002632, AD-3002633, AD-3002634, AD-3002635, AD-3002636, AD-3002637, AD-3002638, AD-3002639, AD-2905718, AD-2905719, AD-2905723, AD-2905726 at 2 mg / kg subcutaneous in a single dose at day 0. CFHR1 (FIG. 8A) and CFHR5 (FIG. 8B) mRNA levels were measured in the liver at day 14. The percent liver mRNA remaining was determined. The protein levels of CFHR2 (FIG. 8C) and CFHR5 (FIG. 8D) in serum were measured by ELISA. The percent CFHR2 or CFHR5 protein remaining was determined.

[0079] FIG. 9 is a scheme demonstrating the non-human primate (NHP) in vivo study design in cynomolgus monkeys.

[0080] FIG. 10A and FIG. 10B illustrate the mRNA results for the NHP study outlined in FIG. 9. AD-2288789 was administered at 3mg / kg and 20 mg / kg, AD-2443565 and AD-2443574 were administered at 3 mg / kg. FIG. 10A shows the percent of CFHR2 mRNA remaining in the liver over time and FIG. 10B shows the percent of CFHR5 mRNA remaining in the liver over time.

[0081] FIG. 11A and FIG. 11B illustrate the percent CFHR2 protein remaining (FIG. 11A) and the percent CFHR5 protein remaining (FIG. 11B) in serum from the NHP study outlined in FIG. 9. The protein was measured by mass spectrometry (MS).

[0082] FIG. 12 shows the protein level of CFH in the serum from the NHP study outlined in FIG. 9. The protein levels were determined by MS.

[0083] FIG. 13 is a scheme demonstrating the non-human primate (NHP) in vivo ocular study design in male cynomolgus monkeys.

[0084] FIG. 14A and FIG. 14B illustrate the percent CFHR2 protein remaining (FIG. 14A) and the percent CFHR5 protein remaining (FIG. 14B) in serum at various time points from the NHP study outlined in FIG. 13. The protein was measured by mass spectrometry (MS).

[0085] FIG. 15 shows the protein level of CFH in the serum from the NHP study outlined in FIG. 13. The protein levels were determined by MS. FIG. 16 shows the protein level of CFH, CFHR5, and CFHR2 in posterior eye cup tissue at day 63. The results are shown as percent protein remaining after multiple subcutaneous doses of AD-2288789. The protein levels were determined by liquid chromatography / mass spectrometry (LC / MS).

[0086] FIG. 17A and FIG. 17B illustrate the percent complement alternative pathway (CAP) activity normalized to predose average (FIG. 17A) and the percent complement classical pathway (CCP) activity normalized to predose average (FIG. 17B) at various time points from the NHP study outlined in FIG. 13.

[0087] DETAILED DESCRIPTION OF THE INVENTION

[0088] The present invention provides iRNA compositions, which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a complement factor H-related (CFHR) gene (e.g., CFRH1, CFHR2, CFHR3, CFHR4, and / or CFHR5). The CFHR gene may be within a cell, e.g.. a cell within a subject, such as a human. The present invention also provides methods of using the iRNA compositions of the invention for inhibiting the expression of a CFHR gene (e.g., CFRH1, CFHR2, CFHR3, CFHR4, and / or CFHR5), and for treating a subject who would benefit from inhibiting or reducing the expression of a CFHR gene (e.g., CFRH1, CFHR2, CFHR3, CFHR4, and / or CFHR5), e.g., a subject suffering or prone to suffering from a CFHR-associated disease disorder, or condition, such as a subject suffering or prone to suffering from age-related macular degeneration (AMD).

[0089] The five CFHR proteins, CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5, are plasma proteins produced predominantly by hepatocytes in the liver and released into circulation in humans. The CFHR genes are members of the complement factor H (CFH) gene cluster on chromosome 1. Each member of this gene family contains multiple short consensus repeats (SCRs) typical of regulators of complement activation. CFHRs function in the regulation of complement by competing with complement factor H (CFH). Proteomic and genetic data suggests CFHRs are key drivers of AMD (Cipriani, et al., 2021, Am J Hum Genet. 108(8): 1385-1400; Lores-Motta, et al., 2021, Am J Hum Genet. 108(8): 1367-1384;

[0090] Emilsson, et al., 2022, Nat Commun. 13( 1): 3401, each of which is herein incorporated by reference).

[0091] CFRH5 loss of function, CFRH2 loss of function, and CFHR1 / 3 deletion are protective for AMD.

[0092] Increased circulating CFHR1 and CFHR5 proteins are associated with AMD. Additionally, elevated systemic CFHR4 levels were observed in AMD and there is evidence this elevation contributes to complement dysregulation in AMD (Cipriani, et al., 2020, Nature. 11: 778), Immunohistochemistry of human retinas shows localization of CFHR2 and CFHR5 in the choriocapillaris and in drusen.

[0093] Accordingly, the CFHR family represents a target for treating AMD with the dsRNA agents provided herein.

[0094] The iRNAs of the invention targeting a CFHR (e.g., CFRH1 and / or a CFRH5) may include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18- 27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21- 28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of a CFHR gene.

[0095] In some embodiments, one or both of the strands of the double stranded RNAi agents of the invention is up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA transcript of a CFHR gene. In some embodiments, such iRNA agents having longer length antisense strands may include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.

[0096] The use of the iRNA agents described herein enables the targeted degradation of mRNAs of a CFHR gene in mammals.

[0097] Methods and compositions including iRNAs are useful for treating a subject who would benefit from inhibiting or reducing the expression of a CFHR gene, e.g., a subject suffering or prone to suffering from a CFHR-associated disease disorder, or condition, such as a subject suffering or prone to suffering from AMD, aHUS, C3g, orlgAN.

[0098] The following detailed description discloses how to make and use compositions containing iRNAs to inhibit the expression of a CFHR gene (e.g., CFRH1 and / or a CFRH5), as well as compositions and methods for treating subjects having diseases and disorders that would benefit from inhibition and / or reduction of the expression of these genes.

[0099] I. Definitions

[0100] In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.

[0101] The articles “a” and “an” are used herein to refer to one or to more than one ( / . e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.

[0102] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to".

[0103] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise.

[0104] The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.

[0105] The term “CFHR,” also known as “complement factor H-related”, refers to the well-known genes encoding a CFHR1, CFHR2, CFHR3, CFHR4, or CFHR5 protein from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise. The term “CFHR1” is also known as “complement factor H-related 1” or “FHR1”. The term “CFHR5" is also known as “complement factor H-related 5” or “FHR5”.

[0106] The terms also refer to fragments and variants of native CFHR (e.g., CFHR1 and CFHR5) that maintain at least one in vivo or in vitro activity of a native CFHR (e.g., CFHR1 and CFHR5).

[0107] Exemplary nucleotide and amino acid sequences of CFHR1 can be found, for example, at GenBank Accession No. NM 002113.3 (SEQ ID NO: 1; reverse complement SEQ ID NO: 2) for Homo sapiens.

[0108] Exemplary nucleotide and amino acid sequences of CFHR2 can be found, for example, at GenBank Accession No. NM 005666.4 (SEQ ID NO: 3; reverse complement SEQ ID NO: 4) for Homo sapiens.

[0109] Exemplary nucleotide and amino acid sequences of CFHR2 can be found, for example, at GenBank Accession No. XM 005540300.3 (SEQ ID NO: 11; reverse complement SEQ ID NO: 12) for Macaca fascicularis.

[0110] Exemplary nucleotide and amino acid sequences of CFHR3 can be found, for example, at GenBank Accession No. NM 021023.6 (SEQ ID NO: 5; reverse complement SEQ ID NO: 6) for Homo sapiens.

[0111] Exemplary nucleotide and amino acid sequences of CFHR4 can be found, for example, at GenBank Accession No. NM_001201550.3 (SEQ ID NO: 7; reverse complement SEQ ID NO: 8) for Homo sapiens. Exemplary nucleotide and amino acid sequences of CFHR4 can be found, for example, at GenBank Accession No. XM 045394371.1 (SEQ ID NO: 13; reverse complement SEQ ID NO: 14) for Macaca fascicularis.

[0112] Exemplary nucleotide and amino acid sequences of CFHR5 can be found, for example, at GenBank Accession No. NM 030787.4 (SEQ ID NO: 9; reverse complement SEQ ID NO: 10) for Homo sapiens. Exemplary nucleotide and amino acid sequences of CFHR5 can be found, for example, at GenBank Accession No. XM 005540303.2 (SEQ ID NO: 15; reverse complement SEQ ID NO: 16) for Macaca fascicularis.

[0113] Exemplary nucleotide and amino acid sequences of CFH can be found, for example, at GenBank Accession No. NM 000186.4 (SEQ ID NO: 17; reverse complement SEQ ID NO: 18) for Homo sapiens.

[0114] Additional examples of CFHR family mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, and OMIM.

[0115] Further information on CFHR1 is provided, for example in the NCBI Gene database at http: / / www.ncbi.nlm.nih.gov / gene / 3078. Further information on CFHR2 is provided, for example in the NCBI Gene database at http: / / www.ncbi.nlm.nih.gov / gene / 3080. Further information on CFHR3 is provided, for example in the NCBI Gene database at http: / / www.ncbi.nlm.nih.gov / gene / 10878. Further information on CFHR4 is provided, for example in the NCBI Gene database at http: / / www.ncbi.nlm.nih.gov / gene / 10877. Further information on CFHR5 is provided, for example in the NCBI Gene database at http: / / www.ncbi.nlm.nih.gov / gene / 81494. Further information on CFH is provided, for example in the NCBI Gene database at http: / / www.ncbi.nlm.nih.gov / gene / 3075.

[0116] The CFHR family is a result of a recent gene duplication and is not well conserved in lower species. There are no direct homologs in rodents and cynomolgus monkeys only have versions of CFHR2, CFHR4, and CFHR5. There is a high degree of homology between CFHR family members. Homology between CFHR1 and CFHR5 is sufficient to allow the design of dsRNA agents which can target both genes, and possibly also target CFHR2.

[0117] In some embodiments, the dsRNA agents that are substantially complementary to a region of a human CFHR (CFHR2, CFHR4, or CFHR5) mRNA cross-react with monkey (e.g., Macaca fascicularis) CFHR2, CFHR4, or CFHR5 mRNA and represent potential candidates for human and monkey targeting.

[0118] In some embodiments, the dsRNA agents that are substantially complementary to a region of a human CFHR1 mRNA cross-react with human CFHR2. In some embodiments, the dsRNA agents that are substantially complementary to a region of a human CFHR1 mRNA cross-react with human CFHR5. In some embodiments, the dsRNA agents that are substantially complementary to a region of a human CFHR2 mRNA cross-react with human CFHR1. In some embodiments, the dsRNA agents that are substantially complementary to a region of a human CFHR2 mRNA cross-react with human CFHR5. In some embodiments, the dsRNA agents that are substantially complementary to a region of a human CFHR5 mRNA cross-react with human CFHR1. In some embodiments, the dsRNA agents that are substantially complementary to a region of a human CFHR5 mRNA cross-react with human CFHR2. In some embodiments, the dsRNA agents that are substantially complementary to a region of a human CFHR1 mRNA cross-react with human CFHR2 and human CFHR5. In some embodiments, the dsRNA agents that are substantially complementary to a region of a human CFHR2 mRNA cross-react with human CFHR1 and human CFHR5. In some embodiments, the dsRNA agents that are substantially complementary to a region of a human CFHR5 mRNA cross-react with human CFHR1 and human CFHR2.

[0119] In some embodiments, a dsRNA agent provided herein “selectively inhibits” a particular CFHR gene (e.g., CFHR1, CFHR2, CFHR3, CFHR4, or CFHR5). By “selectively inhibits” is meant that the dsRNA agent inhibits expression of its intended target by about 2-fold greater when compared to its inhibition of expression for a non-intended target. Preferably the inhibition by the dsRNA agent will be at least about 2-fold, preferably 5-fold or more, or more preferably 10-fold or more, greater for an intended target than its inhibition of a non-intended target. The inhibition of expression of the intended target and the non-intended target can be in vitro or in vivo. In one embodiment, the dsRNA agent selectively inhibits CFHR1. In another embodiment, the dsRNA agent selectively inhibits CFHR5. An “intended target” is based upon substantial complementarity of the dsRNA agent sequence and the target; given the sequence similarity among CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5, some dsRNA agents will selectively inhibit two or more of CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5. The term “CFHR” including “CFHR1”, “CFHR2”, “CFHR3”, “CFHR4”, and “CFHR5”, as used herein also refers to a particular polypeptide expressed in a cell by naturally occurring DNA sequence variations of the “CFHR1”, “CFHR2”, “CFHR3”, “CFHR4”, and “CFHR5” genes, such as a single nucleotide polymorphism in the “CFHR1”, “CFHR2”, “CFHR3”, “CFHR4”, and “CFHR5” genes. Numerous Single Nucleotide Polymorphisms (SNPs) within the “CFHRI”, “CFHR2”, “CFHR3”, “CFHR4”, and “CFHR5” genes have been identified and may be found at, for example, NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov / snp).

[0120] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a CFHR gene, including mRNA that is a product of RNA processing of a primary transcription product. In one embodiment, the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a CFHR gene.

[0121] The target sequence of a CFHR gene may be from about 9-36 nucleotides in length, e.g., about 15-30 nucleotides in length. For example, the target sequence can be from about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18- 26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21- 27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0122] As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

[0123] “G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 2). The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.

[0124] The terms “iRNA”, “RNAi agent,” “iRNA agent,”, “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the expression of a CFHR gene in a cell, e.g., a cell within a subject, such as a mammalian subject.

[0125] In one embodiment, an RNAi agent of the invention includes a single stranded RNA that interacts with a target RNA sequence, e.g., a CFHR target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory it is believed that long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease -Ill-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, etal., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect the invention relates to a single stranded RNA (ssiRNA) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., a CFHR gene. Accordingly, the term “siRNA” is also used herein to refer to an RNAi as described above.

[0126] In another embodiment, the RNAi agent may be a single-stranded RNAi agent that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents (ssRNAi) bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA. The single -stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded RNAi agents are described in U. S. Patent No. 8,101,348 and in Lima et al., (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single -stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894.

[0127] In another embodiment, an “iRNA” for use in the compositions and methods of the invention is a double -stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double-stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA”, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene. In some embodiments of the invention, a double-stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.

[0128] In general, the majority of nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and / or a modified nucleotide. In addition, as used in this specification, an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides. As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified intemucleotide linkage, and / or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to intemucleotide linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the invention include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this specification and claims.

[0129] The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 9 to 36 base pairs in length, e.g., about 15-30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18- 22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21- 23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0130] The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.

[0131] Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3 ’-end of one strand and the 5 ’-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker”. The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs.

[0132] In one embodiment, an RNAi agent of the invention is a dsRNA, each strand of which comprises less than 30 nucleotides, e.g., 17-27, 19-27, 17-25, 19-25, or 19-23, that interacts with a target RNA sequence, e.g., a CFHR target mRNA sequence, to direct the cleavage of the target RNA. In another embodiment, an RNAi agent of the invention is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., a CFHR target mRNA sequence, to direct the cleavage of the target RNA. In one embodiment, the sense strand is 21 nucleotides in length. In another embodiment, the antisense strand is 23 nucleotides in length.

[0133] As used herein, the term “nucleotide overhang"’ refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA.

[0134] In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end and / or the 5’-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end and / or the 5 ’-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

[0135] In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include extended lengths longer than 10 nucleotides, e.g., 10-30 nucleotides, 10-25 nucleotides, 10-20 nucleotides or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3 ’end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5 ’end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3 ’end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5 ’end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside thiophosphate.

[0136] The terms “blunt” or “blunt ended” as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a “blunt ended” dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double-stranded over its entire length. The term “antisense strand” or "guide strand" refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a CFHR mRNA.

[0137] As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., a CFHR nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5’- and / or 3’-terminus of the iRNA.

[0138] The term “sense strand” or "passenger strand" as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.

[0139] As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.

[0140] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

[0141] Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.

[0142] “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G: U Wobble or Hoogstein base pairing.

[0143] The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use.

[0144] As used herein, a polynucleotide that is “substantially complementary to at least part of’ a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e g., an mRNA encoding a CFHR (e g., CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5)). For example, a polynucleotide is complementary to at least a part of a CFHR mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5).

[0145] Accordingly, in some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target CFHR sequence. In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the target CFHR sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1, 5, 7, or 9 or a fragment of SEQ ID NO: 1, 5, 7, or 9, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

[0146] In one embodiment, an RNAi agent of the invention includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target CFHR sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NOs: 2, 6, 8, or 10, or a fragment of any one of SEQ ID NOs: 2, 6, 8, or 10, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. In some embodiments, an iRNA of the invention includes an antisense strand that is substantially complementary to the target CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) sequence and comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of the sense strands in Tables 3-19 or a fragment of any one of the sense strands in Tables 3-19, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary.

[0147] The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition.

[0148] The phrase “inhibiting expression of a CFHR gene,” as used herein, includes inhibition of expression of any CFHR gene (such as, e.g., a mouse CFHR gene, a rat CFHR gene, a monkey CFHR gene, or a human CFHR gene) as well as variants or mutants of a CFHR gene that encode a CFHR protein.

[0149] “Inhibiting expression of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5) gene” includes any level of inhibition of a CFHR gene, e.g., at least partial suppression of the expression of a CFHR gene, such as an inhibition by at least about 20%. In certain embodiments, inhibition is by at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0150] The terms “CFHR expression” and “CFHR gene expression” are used interchangeably herein to refer to inhibiting endogenous RNA directly by a dsRNA agent, which can be measured as a decrease in mRNA levels and / or protein levels.

[0151] The expression of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5) gene may be assessed based on the level of any variable associated with CFHR gene expression, e.g., CFHR mRNA level or CFHR protein level, e.g., a decrease in CFHR mRNA levels in hepatocytes or a decrease in CFHR protein levels in hepatocytes, plasma, and / or eye. The expression of a CFHR gene may also be assessed indirectly based on, for example, a decrease in a CFHR protein activity, e.g., measuring a decrease in biological activity of a CFHR, e.g., a decrease in complement activation. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

[0152] In one embodiment, at least partial suppression of the expression of a CFHR gene, is assessed by a reduction of the amount of CFHR mRNA which can be isolated from, or detected, in a first cell or group of cells in which a CFHR gene is transcribed and which has or have been treated such that the expression of a CFHR gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells).

[0153] The degree of inhibition may be expressed in terms of:

[0154] (mRNA in control cells) - (mRNA in treated cells) *

[0155]

[0156] (mRNA in control cells)

[0157] The phrase “contacting a cell with an RNAi agent,'’ such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the iRNA or contacting a cell in vivo with the iRNA. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.

[0158] Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain and / or be coupled to a ligand, e.g., GalNAc3, that directs the RNAi agent to a site of interest, e.g., the liver (e.g., a liver-targeting ligand for delivery of the dsRNA to the site of CFHR expression / production). Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.

[0159] In one embodiment, contacting a cell with an iRNA includes “introducing” or “delivering the iRNA into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices.

[0160] Introducing an iRNA into a cell may be in vitro and / or in vivo. For example, for in vivo introduction, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be done by a betaglucan delivery system. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and / or are known in the art.

[0161] The term “lipid nanoparticle” or “LNP” is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which an iRNA is transcribed.

[0162] As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or a bird (e.g., a duck or a goose).

[0163] In an embodiment, the subject is a human, such as a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression; a human at risk for a disease, disorder or condition that would benefit from reduction in CFHR (e.g, CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression; a human having a disease, disorder or condition that would benefit from reduction in CFHR (e.g, CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression; and / or human being treated for a disease, disorder or condition that would benefit from reduction in CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression as described herein.

[0164] As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms associated with CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene expression and / or CFHR (e.g, CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) protein production, e.g, a CFHR-associated disease, such as AMD, aHUS, C3g, or IgAN. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment.

[0165] The term “lower” in the context of a CFHR-associated disease refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more. In certain embodiments, a decrease is at least 20%. “Lower” in the context of the level of CFHR (e.g, CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) in a subject is preferably down to a level accepted as within the range of normal for an individual without such disorder.

[0166] As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, that would benefit from a reduction in expression of a CFHR gene, refers to a reduction in the likelihood that a subject will develop a symptom associated with such disease, disorder, or condition, e.g, a symptom of CFHR gene expression, such as symptoms associated with AMD, e.g, blurred or distorted vision, difficulty seeing in low light, and vision loss. The failure to develop a disease, disorder or condition, or the reduction in the development of a symptom associated with such a disease, disorder or condition (e.g, by at least about 10% on a clinically accepted scale forthat disease or disorder), or the exhibition of delayed symptoms (e.g, symptoms associated with AMD, e.g., blurred or distorted vision, difficulty seeing in low light, and vision loss) delayed (e.g, by days, weeks, months or years) is considered effective prevention.

[0167] As used herein, the term "CFHR-associated disease,” is a disease or disorder that is caused by, or associated with, CFHR (e.g, CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene expression or CFHR (e.g, CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) protein production. The term "CFHR-associated disease” includes a disease, disorder or condition that would benefit from a decrease in CFHR (e.g, CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene expression or protein activity. The term “CFHR-associated disease” includes a disease associated with any of CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5, or a combination of thereof. Non-limiting examples of CFHR-associated diseases, disorders or conditions include age-related macular degeneration (AMD), atypical hemolytic uremic syndrome (aHUS), C3 glomerulopathy (C3g) including Cypriot C3g, immunoglobulin A nephropathy (IgAN), IgA-associated vasculitis with nephritis (IgAVN), anti-neutrophil cytoplasmic antibody mediated vasculitis (ANCA), immune complex membranoproliferative glomerulonephritis (IC-MPGN), ischemic reperfusion injury, Lupus nephritis, systemic lupus erythematosus (SLE), membranous nephropathy (MN), chronic transplant mediated glomerulopathy, diabetic nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis (AAV), thrombotic microangiopathy (TMA), and focal segmental glomerulosclerosis (FSGS).

[0168] In one embodiment, a "CFHR-associated disease” is age-related macular degeneration (AMD). As used herein, the term “age-related macular degeneration” (“AMD”) or “macular degeneration” refers to a progressive degeneration of the macular, the central part of the retina, in people over 55 years of age. AMD accounts for 8.7% of all blindness worldwide. AMD is characterized by large drusen deposits (deposits containing lipids and proteins) under the retina. When AMD damages the macula, the center part of a person’s vision may become blurred or wavy, and a blind spot may develop. AMD can cause vision loss quickly or slowly, and can make it very hard to do things that require sharp vision, such as reading, sewing, cooking or driving; it can also make it difficult to see in dim light. There are two types of AMD, referred to as wet AMD and dry AMD.

[0169] Macular degeneration is initiated and perpetuated by the accumulation of toxic vitamin A derivatives in the retinal pigment epithelium (RPE). Pharmacological inhibition of vitamin A delivery or metabolism in the RPE can significantly slow and reduce vision loss in animal models of macular degeneration. Inhibitory peptides that block interaction between RBP4 and its receptor, STRA6, were shown to reduce vitamin A delivery to RPE, and could serve as the basis for the development of a therapeutic to treat macular degeneration (Farjo, etal., 2013, AR O Annual Meeting, 54(15), 1702).

[0170] “Wet AMD,” also called “neovascular AMD” or “wet macular degeneration” is characterized by pathological blood vessel growth from the choroid into the retina (choroidal neovascularization), driven largely by excessive vascular endothelial growth factor (VEGF) production by the retinal pigment epithelium (RPE).

[0171] “Dry AMD,” also called “geographic atrophy” or “dry macular degeneration” is caused by RPE cell death and photoreceptor degeneration, leading to vision loss.

[0172] In another embodiment, a "CFHR-associated disease” is atypical hemolytic uremic syndrome (aHUS). aHUS is a rare disease that can be associated with genetic abnormalities in the complement factor H (CFH) and complement factor H related (CFHR) genes resulting in the loss of complement regulation. Symptoms of aHUS include, for example, microangiopathic hemolytic anemia, thrombocytopenia, and acute renal failure. Current therapy for aHUS includes plasmapheresis, immunosuppressive therapy, blood transfusions, blood pressure control, and complement inhibitors such as Eculizumab (Soliris) and Ravulizumab-Cwcz (Ultomiris). In another embodiment, a "CFHR-associated disease” is C3 glomerulopathy (C3g). C3g is a rare kidney disease resulting from complement dysregulation resulting in complement C3 deposition in the glomeruli causing inflammation and kidney damage. Symptoms of C3g include, for example, proteinuria, hematuria, swelling, glomerulonephritis, acute kidney injury, and chronic kidney disease. There are not optimal treatments for C3g. Current treatment measures include measures angiotensin-converting enzyme inhibitors or angiotensin-receptor blockers as first-line therapy for proteinuria and blood pressure control, and / or lipid-lowering agents.

[0173] In another embodiment, a "CFHR-associated disease” is Cypriot C3 glomerulopathy (C3g).

[0174] Heterozygous mutations in the CFHR5 gene were identified in Cypriot C3g. Cypriot C3g is one of the C3 glomerulopathies and can present with microscopic hematuria, isolated glomerular deposition of C3 complement in the absence of immune complexes, membranoproliferative glomerulonephritis. A duplication of exons 2-3 of the CFHR5 gene has been identified in patients of Greek-Cypriot descent. The disease can progress to chronic kidney disease or end stage kidney disease. (Deltas, et al. 2013. Adv Exp Med Biol.

[0175] 735:189-96).

[0176] In another embodiment, a "CFHR-associated disease” is immunoglobulin A nephropathy (IgAN). I AN is also known as Berger’s disease and occurs when IgA builds up in the kidneys and causes damage to glomeruli. Symptoms include hematuria, edema in the hands and feet, foamy urine, puffiness around the eyes, and high blood pressure. IgAN can be caused by a genetic or environmental factors or a combination of genetic and environmental factors. Deletion of CFHR1 and CFHR3 have been found to be protective against IgAN. There is no cure for IgAN, but treatments can help alleviate symptoms, slow progression, and / or prevent / delay kidney failure. Current treatments include angiotensin-converting enzyme (ACE) inhibitors, angiotensin receptor blockers (ARBs), corticosteroids, statins, Budesonide (Tarpeyo), Sparsentan (Filspari), and / or Nefecon.

[0177] "Therapeutically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having a CFHR-associated disease, disorder, or condition, is sufficient to effective treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.

[0178] “Prophylactically effective amount,” as used herein, is intended to include the amount of an iRNA that, when administered to a subject having a CFHR-associated disease, disorder, or condition, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The "prophylactically effective amount" may vary depending on the iRNA, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history', genetic makeup, the ty pes of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0179] A "therapeutically-effective amount" or “prophylactically effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. iRNA employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment.

[0180] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0181] The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) algimc acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations.

[0182] The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In some embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject.

[0183] II. iRNAs of the Invention

[0184] Described herein are iRNAs which inhibit the expression of a target gene. In one embodiment, the iRNAs inhibit the expression of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene. In one embodiment, the iRNA agent includes double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene in a cell, such as a liver cell within a subject, e.g., a mammal, such as a human having AMD, aHUS, C3g, or IgAN.

[0185] In one embodiment, the dsRNA agents provided herein inhibit the expression of a CFHR1 gene. In one embodiment, the dsRNA agents provided herein inhibit the expression of a CFHR5 gene. In certain embodiments, the dsRNA agents provided herein inhibit both CFHR1 and CFHR5 genes. In certain embodiments, the dsRNA agents provided herein inhibit CFHR1, CFHR2, and CFHR5 genes.

[0186] In one embodiment, the dsRNA agents provided herein inhibit the expression of a CFHR3 gene. In another embodiment, the dsRNA agents provided herein inhibit the expression of a CFHR4 gene. In certain embodiments, the dsRNA agents provided herein inhibit both CFHR3 and CFHR4 genes.

[0187] The dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of a CFHR gene. The region of complementarity is about 30 nucleotides or less in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less in length). Upon contact with a cell expressing the target gene, the iRNA inhibits the expression of the target gene (e.g, a human, a primate, a non-primate, or a rodent target gene) by at least about 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, Western Blotting or flowcytometric techniques.

[0188] A dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of a CFHR gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.

[0189] Generally, the duplex structure is between 15 and 30 base pairs in length, e.g., between, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18- 26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21- 27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0190] Similarly, the region of complementarity to the target sequence is between 15 and 30 nucleotides in length, e.g., between 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15- 17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20- 22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0191] In some embodiments, the sense and antisense strands of the dsRNA are each independently about 15 to about 30 nucleotides in length, or about 25 to about 30 nucleotides in length, e.g., each strand is independently between 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. In some embodiments, the dsRNA is between about 15 and about 23 nucleotides in length, or between about 25 and about 30 nucleotides in length. In general, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21-23 nucleotides can serve as substrates for Dicer. As the ordinarily skilled person will also recognize, the region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway).

[0192] One of skill in the art will also recognize that the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of about 9 to 36 base pairs, e.g., about 10-36, 11-36, 12-36, 13-36, 14-36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35, 14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33, 10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11-32, 12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32, 14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15- 18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20- 23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex, of e.g., 15-30 base pairs, that targets a desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, a MicroRNA (miRNA) is a dsRNA. In another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful to target CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression is not generated in the target cell by cleavage of a larger dsRNA.

[0193] A dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4 nucleotides. dsRNAs having at least one nucleotide overhang can have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA.

[0194] A dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.

[0195] iRNA compounds of the invention may be prepared using a two-step procedure. First, the individual strands of the double-stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Single-stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both.

[0196] In one aspect, a dsRNA of the invention includes at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand sequence is selected from the group of sequences provided in Tables 3-19, and the corresponding nucleotide sequence of the antisense strand of the sense strand is selected from the group of sequences of Tables 3-19. In this aspect, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of a CFHR gene. As such, in this aspect, a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in Tables 3-19, and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in Tables 3-19. In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.

[0197] It will be understood that, although the sequences in Tables 3-19 are described as modified, unmodified, unconjugated. And / or conjugated sequences, the RNA of the iRNA of the invention e.g., a dsRNA of the invention, may comprise any one of the sequences set forth Tables 3-19 that is un-modified, unconjugated, and / or modified and / or conjugated differently than described therein. The skilled person is well aware that dsRNAs having a duplex structure of between about 20 and 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226), In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided herein, dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes minus only a few nucleotides on one or both ends can be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences provided herein, and differing in their ability to inhibit the expression of a CFHR gene by not more than about 5, 10, 15, 20, 25, or 30 % inhibition from a dsRNA comprising the full sequence, are contemplated to be within the scope of the present invention.

[0198] In addition, the RNAs described in Tables 3-19 identify a site(s) in a CFHR transcript that is susceptible to RISC-mediated cleavage. As such, the present invention further features iRNAs that target within this site(s). As used herein, an iRNA is said to target within a particular site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that particular site. Such an iRNA will generally include at least about 15 contiguous nucleotides from one of the sequences provided herein coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in the gene.

[0199] While a target sequence is generally about 15-30 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing cleavage of any given target RNA. Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a “window” or “mask” of a given size (as anon-limiting example, 21 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that can serve as target sequences. By moving the sequence “window” progressively one nucleotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an iRNA agent, mediate the best inhibition of target gene expression. Thus, while the sequences identified herein represent effective target sequences, it is contemplated that further optimization of inhibition efficiency can be achieved by progressively “walking the window” one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.

[0200] Further, it is contemplated that for any sequence identified herein, further optimization could be achieved by systematically either adding or removing nucleotides to generate longer or shorter sequences and testing those sequences generated by walking a window of the longer or shorter size up or down the target RNA from that point. Again, coupling this approach to generating new candidate targets with testing for effectiveness of iRNAs based on those target sequences in an inhibition assay as known in the art and / or as described herein can lead to further improvements in the efficiency of inhibition. Further still, such optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in overhang, or other modifications as known in the art and / or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.

[0201] An iRNA agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, an iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains mismatches to a target sequence, it is preferable that the area of mismatch is not located in the center of the region of complementarity. If the antisense strand of the iRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5 ’ -or 3 ’-end of the region of complementarity. For example, for a 23 nucleotide iRNA agent the strand which is complementary to a region of a CFHR gene, generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an iRNA containing a mismatch to a target sequence is effective in inhibiting the expression of a CFHR gene. Consideration of the efficacy of iRNAs with mismatches in inhibiting expression of a CFHR gene is important, especially if the particular region of complementarity in a CFHR gene is known to have polymorphic sequence variation within the population.

[0202] An RNA target may have regions, or spans of the target RNA’s nucleotide sequence, which are relatively more susceptible or amenable than other regions of the RNA target to mediating cleavage of the RNA target via RNA interference induced by the binding of an RNAi agent to that region. The increased susceptibility to RNA interference within such “hotspot regions” (or simply “hotspots”) means that iRNA agents targeting the region will likely have higher efficacy in inducing iRNA interference than iRNA agents which target other regions of the target RNA. For example, without being bound by theory, the accessibility of a target region of a target RNA may influence the efficacy of iRNA agents which target that region, with some hotspot regions having increased accessibility. Secondary structures, for instance, that form in the RNA target (e.g., within or proximate to hotspot regions) may affect the ability of the iRNA agent to bind the target region and induce RNA interference.

[0203] According to certain aspects of the invention, an iRNA agent may be designed to target a hotspot region of any of the target RNAs described herein, including any identified portions of a target RNA (e.g., a particular exon). As used herein, a hotspot region may refer to an approximately 19-200, 19-150, 19-100, 19-75, 19-50, 21-200, 21-150, 21-100, 21-75, 21-50, 50-200, 50-150, 50-100, 50-75, 75-200, 75-150, 75-100, 100-200, or 100-150 nucleotide region of atarget RNA sequence for which targeting using RNAi agents provides an observably higher probability of efficacious silencing relative to targeting other regions of the same target RNA. According to certain aspects of the invention, a hotspot region may comprise a limited region of the target RNA, and in some cases, a substantially limited region of the target, including for example, less than half of the length of the target RNA, such as about 5%, 10%, 15%, 20%, 25%, or 30% of the length of the target RNA. Conversely, the other regions against which a hotspot is compared may cumulatively comprise at least a majority of the length of the target RNA. For example, the other regions may cumulatively comprise at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95% of the length of the target RNA.

[0204] Compared regions of the target RNA may be empirically evaluated for identification of hotspots using efficacy data obtained from in vitro or in vivo screening assays. For example, RNAi agents targeting various regions that span a target RNA may be compared for frequency of efficacious iRNA agents (e.g., the amount by which target gene expression is inhibited, such as measured by mRNA expression or protein expression) that bind each region. In general, a hotspot can be recognized by observing clustering of multiple efficacious RNAi agents that bind to a limited region of the RNA target. A hotspot may be sufficiently characterized as such by observing efficacy of iRNA agents which cumulatively span at least about 60% of the target region identified as a hotspot, such as about 70%, about 80%, about 90%, or about 95% or more of the length of the region, including both ends of the region (i.e. at least about 60%, 70%, 80%, 90%, or 95% or more of the nucleotides within the region, including the nucleotides at each end of the region, were targeted by an iRNA agent). According to some aspects of the invention, an iRNA agent which demonstrates at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% inhibition over the region (e.g., no more than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% mRNA remaining) may be identified as efficacious.

[0205] Amenability to targeting of RNA regions may also be assessed using quantitative comparison of inhibition measurements across different regions of a defined size (e.g, 25, 30, 40, 50, 60, 70, 80, 90, or 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nts). For example, an average level of inhibition may be determined for each region and the averages of each region may be compared. The average level of inhibition within a hotspot region may be substantially higher than the average of averages for all evaluated regions. According to some aspects, the average level of inhibition in a hotspot region may be at least about 10%, 20%, 30%, 40%, or 50% higher than the average of averages. According to some aspects, the average level of inhibition in a hotspot region may be at least about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5 1.6, 1.7, 1.8. 1.9, or 2.0 standard deviations above the average of averages. The average level of inhibition may be higher by a statistically significant (e.g., p < 0.05) amount. According to some aspects, each inhibition measurement within a hotspot region may be above a threshold amount (e.g., at or below a threshold amount of mRNA remaining).

[0206] According to some aspects, each inhibition measurement within the region may be substantially higher than an average of all inhibition measurements across all the measured regions. For example, each inhibition measurement in a hotspot region may be at least about 10%, 20%, 30%, 40%, or 50% higher than the average of all inhibition measurements. According to some aspects, each inhibition measurement may be at least about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5 1.6, 1.7, 1.8. 1.9, or 2.0 standard deviations above the average of all inhibition measurements. Each inhibition measurement may be higher by a statistically significant (e.g., p < 0.05) amount than the average of all inhibition measurements. A standard for evaluating a hotspot may comprise various combinations of the above standards where compatible (e.g., an average level of inhibition of at least about a first amount and having no inhibition measurements below a threshold level of a second amount, lesser than the first amount).

[0207] It is therefore expressly contemplated that any iRNA agent, including the specific exemplary iRNA agents described herein, which targets a hotspot region of a target RNA, may be preferably selected for inducing RNA interference of the target mRNA as targeting such a hotspot region is likely to exhibit a robust inhibitory response relative to targeting a region which is not a hotspot region. RNAi agents targeting target sequences that substantially overlap (e.g., by at least about 70%, 75%, 80%, 85%, 90%, 95% of the target sequence length) or, preferably, that reside fully within the hotspot region may be considered to target the hotspot region. Hotspot regions of the RNA target) s) of the instant invention may include any region for which the data disclosed herein demonstrates higher frequency of targeting by efficacious RNAi agents, including by any of the standards described elsewhere herein, whether or not the range(s) of such hotspot region(s) are explicitly specified.

[0208] In various embodiments, a dsRNA agent of the present invention targets a hotspot region of an mRNA encoding CFHR (e g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5).

[0209] In certain embodiments, the dsRNA agents of the present invention are AD-2288789, AD-2443565, AD-2443574, AD-2787983, AD-3002629, AD-3002631, AD-3002632, AD-3002633, AD-3002634, AD-3002635, AD-3002636, AD-3002637, AD-3002638, AD-3002639, AD-2905718, AD-2905719, AD-2905723, and AD-2905726.

[0210] III. Modified iRNAs of the Invention

[0211] In one embodiment, the RNA of the iRNA of the invention e.g., a dsRNA, is un-modified, and does not comprise, e.g., chemical modifications and / or conjugations known in the art and described herein. In another embodiment, the RNA of an iRNA of the invention, e.g., a dsRNA, is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the invention, substantially all of the nucleotides of an iRNA of the invention are modified. In other embodiments of the invention, all of the nucleotides of an iRNA of the invention are modified. iRNAs of the invention in which “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides. In some aspects of the invention, substantially all of the nucleotides of an iRNA of the invention are modified and the iRNA agents comprise no more than 10 nucleotides comprising 2’ -fluoro modifications (e.g., no more than 92'-fluoro modifications, no more than 82'-fluoro modifications, no more than 72'-fluoro modifications, no more than 62'-fluoro modifications, no more than 5 2'-fluoro modifications, no more than 4 2'-fluoro modifications, no more than 5 2'-fluoro modifications, no more than 42'-fluoro modifications, no more than 3 2'-fluoro modifications, or no more than 22'-fluoro modifications). For example, in some embodiments, the sense strand comprises no more than 4 nucleotides comprising 2'-fluoro modifications (e.g., no more than 3 2'-fluoro modifications, or no more than 22'-fluoro modifications). In other embodiments, the antisense strand comprises no more than 6 nucleotides comprising 2'-fluoro modifications (e.g., no more than 5 2'-fluoro modifications, no more than 42'-fluoro modifications, no more than 42'-fluoro modifications, or no more than 22'-fluoro modifications).

[0212] In other aspects of the invention, all of the nucleotides of an iRNA of the invention are modified and the iRNA agents comprise no more than 10 nucleotides comprising 2 ’-fluoro modifications (e.g., no more than 92'-fluoro modifications, no more than 82'-fluoro modifications, no more than 72'-fluoro modifications, no more than 62'-fluoro modifications, no more than 5 2'-fluoro modifications, no more than 42'-fluoro modifications, no more than 5 2'-fluoro modifications, no more than 42'-fluoro modifications, no more than 32'-fluoro modifications, or no more than 22'-fluoro modifications).

[0213] In one embodiment, the double stranded RNAi agent of the invention further comprises a 5’-phosphate or a 5 ’-phosphate mimic at the 5’ nucleotide of the antisense strand. In another embodiment, the double stranded RNAi agent further comprises a 5 ’-phosphate mimic at the 5’ nucleotide of the antisense strand. In a specific embodiment, the 5’-phosphate mimic is a 5’-vinyl phosphonate (5’-VP). In one embodiment, the phosphate mimic is a 5 ’-cyclopropyl phosphonate. In some embodiments, the 5 ’-end of the antisense strand of the double-stranded iRNA agent does not contain a 5 ’-vinyl phosphonate (VP).

[0214] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a deoxy -nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a glycol modified nucleotide (GNA), e.g., Ggn, Cgn, Tgn, or Agn, a nucleotide with a 2’ phosphate, e.g., G2p, C2p, A2p or U2p, and, a vinyl-phosphonate nucleotide; and combinations thereof. In other embodiments, each of the duplexes of Tables 4, 6, 8, 10, 12, 14, 15, 17 or 19 may be particularly modified to provide another double-stranded iRNA agent of the present disclosure. In one example, the 3 ’-terminus of each sense duplex may be modified by removing the 3 ’-terminal L96 ligand and exchanging the two phosphodiester intemucleotide linkages between the three 3 ’-terminal nucleotides with phosphorothioate intemucleotide linkages. That is, the three 3’-terminal nucleotides (N) of a sense sequence of the formula:

[0215] 5’-Ni-... -Nn.2Nn.iNnL963’ may be replaced with

[0216]

[0217] while the antisense sequence remains unchanged to provide another double-stranded iRNA agent of the present disclosure.

[0218] The nucleic acids featured in the invention can be synthesized and / or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S. L. et al. (Edrs ), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g.. 5 ’-end modifications (phosphorylation, conjugation, inverted linkages) or 3 ’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2’-position or 4’-position) or replacement of the sugar; and / or backbone modifications, including modification or replacement of the phosphodiester linkages.

[0219] Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to RNAs containing modified backbones or no natural intemucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their intemucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified iRNA will have a phosphorus atom in its intemucleoside backbone.

[0220] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5 '-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. In some embodiments of the invention, the dsRNA agents of the invention are in a free acid form. In other embodiments of the invention, the dsRNA agents of the invention are in a salt form. In one embodiment, the dsRNA agents of the invention are in a sodium salt form. In certain embodiments, when the dsRNA agents of the invention are in the sodium salt form, sodium ions are present in the agent as counterions for substantially all of the phosphodiester and / or phosphorothiotate groups present in the agent. Agents in which substantially all of the phosphodiester and / or phosphorothioate linkages have a sodium counterion include not more than 5, 4, 3, 2, or 1 phosphodiester and / or phosphorothioate linkages without a sodium counterion. In some embodiments, when the dsRNA agents of the invention are in the sodium salt form, sodium ions are present in the agent as counterions for all of the phosphodiester and / or phosphorothiotate groups present in the agent.

[0221] Representative U. S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U. S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195;

[0222] 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;

[0223] 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799;

[0224] 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6, 239,265; 6,277,603;

[0225] 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294;

[0226] 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and US Pat RE39464, the entire contents of each of which are hereby incorporated herein by reference.

[0227] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages.

[0228] These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.

[0229] Representative U. S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U. S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086;

[0230] 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

[0231] In other embodiments, suitable RNA mimetics are contemplated for use in iRNAs, in which both the sugar and the intemucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound.

[0232] One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U. S. patents that teach the preparation of PNA compounds include, but are not limited to, U. S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the iRNAs of the invention are described in, for example, in Nielsen etal., Science, 1991, 254, 1497-1500. Some embodiments featured in the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2-[known as a methylene (methylimino) orMMI backbone], -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2-CH2-[wherein the native phosphodiester backbone is represented as --O--P-O-CH2-] of the above-referenced U. S. Patent No. 5,489,677, and the amide backbones of the abovereferenced U. S. Patent No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced U. S. Patent No. 5,034,506.

[0233] Modified RNAs can also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted Ci to Cio alkyl or C2to Cio alkenyl and alkynyl. Exemplary suitable modifications include O[(CH2)nO]mCH3, O(CH2).nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: Ci to Cio lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O— CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy -alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Further exemplary modifications include: 5’-Me-2’-F nucleotides, 5’-Me-2’-Ome nucleotides, 5’-Me-2’-deoxynucleotides, (both Rand S isomers in these three families); 2 ’-alkoxyalkyl; and 2’-NMA (N-methylacetamide).

[0234] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of an iRNA, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5' terminal nucleotide. iRNAs can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U. S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U. S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878;

[0235] 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;

[0236] 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0237] An iRNA of the invention can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

[0238] Modified nucleobases include other synthetic and natural nucleobases such as 5 -methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymme, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5 -trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3 -deazaguanine and 3 -deazaadenine. Further nucleobases include those disclosed in U. S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5 -methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0239] Representative U. S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U. S. Patent Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941;

[0240] 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062;

[0241] 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

[0242] An iRNA of the invention can also be modified to include one or more locked nucleic acids (LN A). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33 ( 1 ):439-447; Mook, OR. etal., (2007) Mol Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).

[0243] An iRNA of the invention can also be modified to include one or more bicyclic sugar moieties. A “bicyclic sugar” is a furanosyl ring modified by the bridging of two atoms. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring. Thus, in some embodiments an agent of the invention may include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al., (200T)Mol Cane Ther 6(3): 833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the invention include one or more bicyclic nucleosides comprising a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to 4'-(CH2) — O-2' (LNA); 4'-(CH2) — S-2'; 4'-(CH2)2 — O-2' (ENA); 4'-CH(CH3) — O-2' (also referred to as “constrained ethyl” or “cEf ’) and 4'-CH(CH2OCH3) — O-2' (and analogs thereof; see, e.g., U. S. Pat. No. 7,399,845); 4'-C(CH3)(CH3) — O-2' (and analogs thereof; see e.g., US Patent No. 8,278,283); 4'-CH2 — N(OCH3)-2' (and analogs thereof; see e.g., US Patent No.

[0244] 8,278,425); 4'-CH2— O— N(CH3)-2' (see, e.g., U. S. Patent Publication No. 2004 / 0171570); 4'-CH2— N(R)— O-2', wherein R is H, C1-C12 alkyl, or a protecting group (see, e.g., U. S. Pat. No. 7,427,672); 4'-CH2 — C(H)(CH3)-2' (see, e.g., Chattopadhyaya e / al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2 — C(=CH2)-2' (and analogs thereof; see, e.g., US Patent No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0245] Additional representative U. S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U. S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133;7,084, 125; 7,399,845; 7,427,672;

[0246] 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008 / 0039618; and US 2009 / 0012281, the entire contents of each of which are hereby incorporated herein by reference.

[0247] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and -D-ribofuranose (see WO 99 / 14226). An iRNA of the invention can also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-0-2' bridge. In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.”

[0248] An iRNA of the invention may also include one or more “conformationally restricted nucleotides” (“CRN”). CRN are nucleotide analogs with a linker connecting the C2’and C4’ carbons of ribose or the C3 and -C5' carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

[0249] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US Patent Publication No. 2013 / 0190383; and PCT publication WO 2013 / 036868, the entire contents of each of which are hereby incorporated herein by reference.

[0250] In some embodiments, an iRNA of the invention comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomer with bonds between Cl'-C4' have been removed (i.e. the covalent carbon-oxygen-carbon bond between the Cl1and C41carbons). In another example, the C2'-C3' bond (i.e. the covalent carbon-carbon bond between the C21and C31carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

[0251] Representative U. S. publications that teach the preparation of UNA include, but are not limited to, US Patent No. 8,314,227; and US Patent Publication Nos. 2013 / 0096289; 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are hereby incorporated herein by reference.

[0252] An RNAi agent of the disclosure may also include one or more “cyclohexene nucleic acids” or (“CeNA”). CeNA are nucleotide analogs with a replacement of the furanose moiety of DNA by a cyclohexene ring. Incorporation of cylcohexenyl nucleosides in a DNA chain increases the stability of a DNA / RNA hybrid. CeNA is stable against degradation in serum and a CeNA / RNA hybrid is able to activate E. Coli RNase H, resulting in cleavage of the RNA strand. (See Wang et al., Am. Chem. Soc. 2000, 122, 36, 8595-8602, hereby incorporated by reference).

[0253] Potentially stabilizing modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"- phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011 / 005861.

[0254] Other modifications of an iRNA of the invention include a 5’ phosphate or 5’ phosphate mimic, e.g., a 5 ’-terminal phosphate or phosphate mimic on the antisense strand of an RNAi agent. Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012 / 0157511, the entire contents of which are incorporated herein by reference.

[0255] In certain specific embodiments, an RNAi agent of the present invention is an agent that inhibits the expression of a CFHR gene which is selected from the group of agents listed in Tables 3-19. Any of these agents may further comprise a ligand.

[0256] Modified iRNAs Comprising Motifs of the Invention

[0257] In certain aspects of the invention, the double stranded RNAi agents of the invention include agents with chemical modifications as disclosed, for example, in WO 2013 / 075035, filed on November 16, 2012, the entire contents of which are incorporated herein by reference.

[0258] Accordingly, the invention provides double stranded RNAi agents capable of inhibiting the expression of a target gene ( / . e., a CFHR gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may range from 12-30 nucleotides in length. For example, each strand may be between 14-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length. In one embodiment, the sense strand is 21 nucleotides in length. In one embodiment, the antisense strand is 23 nucleotides in length.

[0259] The sense strand and antisense strand typically form a duplex double stranded RNA (“dsRNA”), also referred to herein as an “RNAi agent.” The duplex region of an RNAi agent may be 12-30 nucleotide pairs in length. For example, the duplex region can be between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17 - 23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

[0260] In one embodiment, the RNAi agent may contain one or more overhang regions and / or capping groups at the 3’-end, 5’-end, or both ends of one or both strands. The overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers. In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2 ’-sugar modified, such as, 2-F, 2’-Omethyl, thymidine (T), 2' -O-methoxyethyl-5 -methyluridine (Teo), 2' -O-methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5 -methylcytidine (m5Ceo), and any combinations thereof. For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.

[0261] The 5’- or 3’- overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3 ’ -end of the sense strand, antisense strand, or both strands. In one embodiment, this 3’-overhang is present in the antisense strand. In one embodiment, this 3’-overhang is present in the sense strand.

[0262] The RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability. For example, the single -stranded overhang may be located at the 3'-terminal end of the sense strand or, alternatively, at the 3'-terminal end of the antisense strand. The RNAi may also have a blunt end, located at the 5 ’ -end of the antisense strand (or the 3 ’ -end of the sense strand) or vice versa. Generally, the antisense strand of the RNAi has a nucleotide overhang at the 3 ’-end, and the 5 ’-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5 ’-end of the antisense strand and 3 ’-end overhang of the antisense strand favor the guide strand loading into RISC process.

[0263] In one embodiment, the RNAi agent is a double ended bluntmer of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 7, 8, 9 from the 5 ’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end.

[0264] In another embodiment, the RNAi agent is a double ended bluntmer of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 8, 9, 10 from the 5’end. The antisense strand contains at least one motif of three 2 -0-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end.

[0265] In yet another embodiment, the RNAi agent is a double ended bluntmer of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end.

[0266] In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5’end; the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang.

[0267] Preferably, the 2 nucleotide overhang is at the 3 ’-end of the antisense strand.

[0268] When the 2 nucleotide overhang is at the 3 ’-end of the antisense strand, there may be two phosphorothioate intemucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. In one embodiment, the RNAi agent additionally has two phosphorothioate intemucleotide linkages between the terminal three nucleotides at both the 5 ’-end of the sense strand and at the 5 ’-end of the antisense strand. In one embodiment, every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides. In one embodiment each residue is independently modified with a 2’-0-methyl or 3’-fluoro, e.g, in an alternating motif. Optionally, the RNAi agent further comprises a ligand (preferably GalNAci).

[0269] In one embodiment, the RNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1-6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5' overhang; wherein at least the sense strand 5' terminal and 3' terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when the double stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides, where at least one of the motifs occurs at or near the cleavage site. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.

[0270] In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at position 11, 12, 13 from the 5’ end; wherein the 3’ end of the first strand and the 5’ end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3’ end than the first strand, wherein the duplex region which is at least 25 nucleotides in length, and the second strand is sufficiently complementary to a target mRNA along at least 1 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent preferentially results in an siRNA comprising the 3’ end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand.

[0271] In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.

[0272] In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand.

[0273] For an RNAi agent having a duplex region of 17-23 nucleotide in length, the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5’-end. Thus the motifs of three identical modifications may occur at the 9, 10, 11 positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions; or 13, 14, 15 positions of the antisense strand, the count starting from the 1stnucleotide from the 5 ’-end of the antisense strand, or, the count starting from the 1stpaired nucleotide within the duplex region from the 5’- end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the ’-end.

[0274] The sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

[0275] In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification. The term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adjacent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different. Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.

[0276] Like the sense strand, the antisense strand of the RNAi agent may contain more than one motifs of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand. This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.

[0277] In one embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3’-end, 5’-end or both ends of the strand.

[0278] In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3 ’-end, 5 ’-end or both ends of the strand.

[0279] When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.

[0280] When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucleotides in the duplex region.

[0281] In one embodiment, every nucleotide in the sense strand and antisense strand of the RNAi agent, including the nucleotides that are part of the motifs, may be modified. Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens and / or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2' hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.

[0282] As nucleic acids are polymers of subunits, many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking 0 of a phosphate moiety. In some cases, the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3’ or 5 ’ terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of a RNA or may only occur in a single strand region of a RNA. For example, a phosphorothioate modification at a non-linking 0 position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The 5’ end or ends can be phosphorylated.

[0283] It may be possible, e.g., to enhance stability, to include particular bases in overhangs, or to include modified nucleotides or nucleotide surrogates, in single strand overhangs, e.g., in a 5’ or 3’ overhang, or in both. For example, it can be desirable to include purine nucleotides in overhangs. In some embodiments all or some of the bases in a 3’ or 5’ overhang may be modified, e.g., with a modification described herein. Modifications can include, e.g., the use of modifications at the 2’ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2’-deoxy-2’ -fluoro (2’-F) or 2’-O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.

[0284] In one embodiment, each residue of the sense strand and antisense strand is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2 ’-methoxy ethyl, 2’- O-methyl, 2’-O-allyl, 2’-C- allyl, 2’-deoxy, 2 ’-hydroxyl, or 2 ’-fluoro. The strands can contain more than one modification. In one embodiment, each residue of the sense strand and antisense strand is independently modified with 2’- O-methyl or 2’-fluoro. The term “HNA” refers to hexitol or hexose nucleic acid.

[0285] At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2’- O-methyl or 2’-fluoro modifications, or others.

[0286] In one embodiment, the RNAi agent comprises the pattern of the alternating motif of 2'-O-methyl modification and 2’-F modification on the sense strand initially has a shift relative to the pattern of the alternating motif of 2'-O-methyl modification and 2’-F modification on the antisense strand initially, i.e., the 2'-O-methyl modified nucleotide on the sense strand base pairs with a 2'-F modified nucleotide on the antisense strand and vice versa. The 1 position of the sense strand may start with the 2'-F modification, and the 1 position of the antisense strand may start with the 2'- O-methyl modification.

[0287] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense strand and / or antisense strand interrupts the initial modification pattern present in the sense strand and / or antisense strand. This interruption of the modification pattern of the sense and / or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense and / or antisense strand surprisingly enhances the gene silencing activity to the target gene.

[0288] The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate intemucleotide linkage. The phosphorothioate or methylphosphonate intemucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both strands in any position of the strand. For instance, the intemucleotide linkage modification may occur on every nucleotide on the sense strand and / or antisense strand; each intemucleotide linkage modification may occur in an alternating pattern on the sense strand and / or antisense strand; or the sense strand or antisense strand may contain both intemucleotide linkage modifications in an alternating pattern. The alternating pattern of the intemucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the intemucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the intemucleotide linkage modification on the antisense strand. In one embodiment, a double -stranded RNAi agent comprises 6-8 phosphorothioate intemucleotide linkages. In one embodiment, the antisense strand comprises two phosphorothioate intemucleotide linkages at the 5 ’-terminus and two phosphorothioate intemucleotide linkages at the 3 ’-terminus, and the sense strand comprises at least two phosphorothioate intemucleotide linkages at either the 5’-terminus or the 3’-terminus.

[0289] In one embodiment, the RNAi comprises a phosphorothioate or methylphosphonate intemucleotide linkage modification in the overhang region. For example, the overhang region may contain two nucleotides having a phosphorothioate or methylphosphonate intemucleotide linkage between the two nucleotides.

[0290] Intemucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within the duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate intemucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate intemucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate intemucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. These terminal three nucleotides may be at the 3’-end of the antisense strand, the 3’-end of the sense strand, the 5 ’-end of the antisense strand, and / or the 5 ’end of the antisense strand.

[0291] In one embodiment, the 2 nucleotide overhang is at the 3 ’-end of the antisense strand, and there are two phosphorothioate intemucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. Optionally, the RNAi agent may additionally have two phosphorothioate intemucleotide linkages between the terminal three nucleotides at both the 5 ’-end of the sense strand and at the 5 ’-end of the antisense strand.

[0292] In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch may occur in the overhang region or the duplex region. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A: U is preferred over G: C; G: U is preferred over G: C; and I: C is preferred over G: C (Uinosinc). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A: T, A: U, G: C) pairings; and pairings which include a universal base are preferred over canonical pairings.

[0293] In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’- end of the antisense strand independently selected from the group of: A: U, G: U, I: C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5 ’-end of the duplex.

[0294] In one embodiment, the nucleotide at the 1 position within the duplex region from the 5 ’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair.

[0295] In another embodiment, the nucleotide at the 3 ’-end of the sense strand is deoxy -thymine (dT). In another embodiment, the nucleotide at the 3 ’-end of the antisense strand is deoxy-thymine (dT). In one embodiment, there is a short sequence of deoxy-thymine nucleotides, for example, two dT nucleotides on the 3 ’-end of the sense and / or antisense strand.

[0296] In certain embodiments, an RNAi agent of the invention may contain a low number of nucleotides containing a 2 ’-fluoro modification, e.g., 10 or fewer nucleotides with 2 ’-fluoro modification. For example, the RNAi agent may contain 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 0 nucleotides with a 2’-fluoro modification. In a specific embodiment, the RNAi agent of the invention contains 10 nucleotides with a 2 ’-fluoro modification, e.g., 4 nucleotides with a 2’-fluoro modification in the sense strand and 6 nucleotides with a 2’-fluoro modification in the antisense strand. In another specific embodiment, the RNAi agent of the invention contains 6 nucleotides with a 2’-fhioro modification, e.g., 4 nucleotides with a 2’-fluoro modification in the sense strand and 2 nucleotides with a 2 ’-fluoro modification in the antisense strand.

[0297] In other embodiments, an RNAi agent of the invention may contain an ultra-low number of nucleotides containing a 2’-fluoro modification, e.g., 2 or fewer nucleotides containing a 2’-fluoro modification. For example, the RNAi agent may contain 2, 1 of 0 nucleotides with a 2’-fluoro modification. In a specific embodiment, the RNAi agent may contain 2 nucleotides with a 2’-fluoro modification, e.g., 0 nucleotides with a 2-fluoro modification in the sense strand and 2 nucleotides with a 2’-fluoro modification in the antisense strand.

[0298] In certain embodiments, the compositions and methods of the disclosure include a vinyl phosphonate (VP) modification of an RNAi agent as described herein. In exemplary embodiments, a vinyl phosphonate of the disclosure has the following structure:

[0299]

[0300] For example, when the phosphate mimic is a 5’-vinyl phosphonate (VP), the 5’-terminal nucleotide can have the following structure,

[0301]

[0302] wherein * indicates the location of the bond to 5 ’-position of the adjacent nucleotide;

[0303] R is hydrogen, hydroxy, methoxy, fluoro (e.g., hydroxy or methoxy), or another modification described herein; and

[0304] B is a nucleobase or a modified nucleobase, optionally where B is adenine, guanine, cytosine, thymine or uracil.

[0305] A vinyl phosphonate of the instant disclosure may be attached to either the antisense or the sense strand of a dsRNA of the disclosure. In certain embodiments, a vinyl phosphonate of the instant disclosure is attached to the antisense strand of a dsRNA, optionally at the 5 ’ end of the antisense strand of the dsRNA. The dsRNA agent can comprise a phosphorus-containing group at the 5 ’-end of the sense strand or antisense strand. The 5 ’-end phosphorus-containing group can be 5 ’-end phosphate (5’-P), o’end phosphorothioate (5 ’-PS), 5 ’-end phosphorodithioate (5 ’-PS2), 5 ’-end vinylphosphonate (5 ’-VP), 5’-end methylphosphonate (MePhos), or 5’-deoxy-5’-C-malonyl. When the 5 ’-end phosphorus-containing group is 5’-end vinylphosphonate (5’-VP), the 5’-VP can be either 5’-E-VP isomer (i.e., trans-

[0306]

[0307] Vinyl phosphate modifications are also contemplated for the compositions and methods of the instant disclosure. An exemplary vinyl phosphate structure is:

[0308]

[0309] For example, when the phosphate mimic is a 5 ’-vinyl phosphate, the 5 ’-terminal nucleotide can have the immediately structure, where the phosphonate group is replaced by a phosphate.

[0310] As described in more detail below, the RNAi agent that contains conjugations of one or more carbohydrate moieties to a RNAi agent can optimize one or more properties of the RNAi agent. In manycases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.

[0311] The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one “backbone atachment point,” preferably two “backbone atachment points” and (ii) at least one “tethering atachment point.” A “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.

[0312] The RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.

[0313] The RNAi agent can comprise a phosphorus-containing group at the 5 ’-end of the sense strand or antisense strand. The 5’-end phosphorus-containing group can be 5’-end phosphate (5 ’-P), 5’-end phosphorothioate (5’-PS), 5’-end phosphorodithioate (5’-PS2), 5’-end vinylphosphonate (5’-VP), 5’-end

[0314] methylphosphonate (MePhos), or 5’-deoxy-5’-C-malonyl (

[0315]

[0316] When the 5 ’-end phosphorus-containing group is 5 ’-end vinylphosphonate (5 ’-VP), the 5 ’-VP can be either 5’-E-VP

[0317] isomer (i.e., trans- vinylphosphonate,

[0318]

[0319] isomer (i.e., cis-vinylphosphonate,

[0320]

[0321] or mixtures thereof.

[0322] In certain embodiments, the RNAi agent comprises a phosphorus-containing group at the 5 ’-end of the sense strand. In certain embodiments, the RNAi agent comprises a phosphorus-containing group at the 5 ’-end of the antisense strand.

[0323] In certain embodiments, the RNAi agent comprises a 5’-P. In certain embodiments, the RNAi agent comprises a 5’-P in the antisense strand.

[0324] In certain embodiments, the RNAi agent comprises a 5’-PS. In certain embodiments, the RNAi agent comprises a 5 ’-PS in the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-VP. In certain embodiments, the RNAi agent comprises a 5 ’-VP in the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-E-VP in the antisense strand. In certain embodiments, the RNAi agent comprises a 5’-Z-VP in the antisense strand.

[0325] In certain embodiments, the RNAi agent comprises a 5’-PS2. In certain embodiments, the RNAi agent comprises a 5’-PS2 in the antisense strand.

[0326] In certain embodiments, the RNAi agent comprises a 5’-PS2. In certain embodiments, the RNAi agent comprises a 5’-deoxy-5’-C-malonyl in the antisense strand.

[0327] IV. iRNAs Conjugated to Ligands

[0328] Another modification of an iRNA of the invention involves chemically linking to the RNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the iRNA. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., (1989) Proc. Natl. Acid Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem. Let, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan etal., ( 1992) Ann. N. Y. Acad. Sci., 660:306-309; Manoharan etal., (1993) Biorg. Med. Chem. Let., 3:2765-2770), a thiocholesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBSLett., 259:327-330;

[0329] Svinarchuk etal., (1993) Biochimie, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac -glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3 -phosphonate (Manoharan etal., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl. Acids Res., 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan etal., (1995) Tetrahedron Lett., 36:3651-3654), apalmityl moiety (Mishra etal., (1995) Biochim. Biophys. Acta, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 22T.923-93T).

[0330] In one embodiment, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated. In preferred embodiments a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Preferred ligands will not take part in duplex pairing in a duplexed nucleic acid.

[0331] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g, a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L- glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

[0332] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

[0333] Ligands can be proteins, e.g. glycoproteins, or peptides, e.g, molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-KB.

[0334] In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, faty acids, cholic acid, lithochohc acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g, oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

[0335] Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the atachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially -available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety atached thereto. The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

[0336] In the ligand-conjugated oligonucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.

[0337] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

[0338] Carbohydrate Conjugates

[0339] In some embodiments of the compositions and methods of the invention, an iRNA oligonucleotide further comprises a carbohydrate. The carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di-and trisaccharides include sugars having two or three monosaccharide units (e.g, C5, C6, C7, or C8).

[0340] In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:

[0341]

[0342]

[0343] .

[0344]

[0345]

[0346] Formua XV,

[0347]

[0348] ormua,

[0349]

[0350] 5

[0351] 5

[0352]

[0353]

[0354]

[0355] Formula XXIX;

[0356]

[0357] ormua III.

[0358]

[0359] Formula XXXIV.

[0360] In another embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. In one embodiment, the monosaccharide is an N-acetylgalactosamine, such as

[0361]

[0362] Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,

[0363]

[0364] when one of X or Y is an oligonucleotide, the other is a hydrogen.

[0365] In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker.

[0366] In one embodiment, the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent, e.g, the 3’ or 5 ’end of the sense strand of a dsRNA agent as described herein. In another embodiment, the double stranded RNAi agents of the invention comprise a plurality e.g., 2, 3, 4, 5, or 6) of GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.

[0367] In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5 ’-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.

[0368] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and / or a cell permeation peptide.

[0369] Additional carbohydrate conjugates (and linkers) suitable for use in the present invention include those described in PCT Publication Nos. WO 2014 / 179620 and WO 2014 / 179627, the entire contents of each of which are incorporated herein by reference.

[0370] Linkers

[0371] In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.

[0372] The term "linker" or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO2, SO2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl. heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylheteroaryl, which one or more methylenes can be interrupted or terminated by 0, S, S(0), SO2, N(R8), C(0), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms.

[0373] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

[0374] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

[0375] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

[0376] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a livertargeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis. Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

[0377] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0378] Peptide-based cleaving groups

[0379] In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells.

[0380] Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (-C(O)NH-). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond ( / .e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula - NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above. In one embodiment, an iRNA of the invention is conjugated to a carbohydrate through a linker. Nonlimiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,

[0381]

[0382] (Formula XXXIX),

[0383]

[0384] (Formula XLII), and

[0385]

[0386] (Formula XLIII), when one of X or Y is an oligonucleotide, the other is a hydrogen.

[0387] In certain embodiments of the compositions and methods of the invention, a ligand is one or more GalNAc (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker. It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.

[0388] “Chimeric” iRNA compounds or “chimeras,” in the context of this invention, are iRNA compounds, preferably dsRNAs, which contain two or more chemically distinct regions, each made up of at least one monomer unit, z.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity for the target nucleic acid. An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA: DNA or RNA: RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA: DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0389] In certain instances, the RNA of an iRNA can be modified by a non-ligand group. A number of nonligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. etal., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger eta / ., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan etal., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan etal., Ann. N. Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan etal., Tetrahedron Lett., 1995, 36:3651; Shea etal., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan etal., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim.

[0390] Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.

[0391] V. Delivery of an iRNA of the Invention

[0392] The delivery of an iRNA of the invention to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having AMD, aHUS, C3g, or IgAN) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an iRNA of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an iRNA, e.g., a dsRNA, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below.

[0393] In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an iRNA of the invention (see e.g., Akhtar S. and Julian RL., (1992) Trends Cell. Biol. 2(5): 139-144 and WO94 / 02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an iRNA can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the iRNA molecule to be administered. Several studies have shown successful knockdown of gene products when an iRNA is administered locally. For example, intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, MJ. etal., (2004) Retina 24:132-138) and subretinal injections in mice (Reich, SJ. et al. (2003) Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J. et al. (2005) Mol. Ther. 11:267-274) and can prolong survival of tumor-bearing mice (Kim, WJ. et al., (2006) Mol. Ther. 14:343-350; Li, S. et al., (2007) Mol. Ther. 15:515-523). For administering an iRNA systemically for the treatment of a disease, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo. Modification of the RNA or the pharmaceutical earner can also permit targeting of the iRNA composition to the target tissue and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J. et al., (2004) Nature 432:173-178). Conjugation of an iRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, JO. etal., (2006) Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim SH. etal., (2008) Journal of Controlled Release 129(2): 107-116) that encases an iRNA. The formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically. Methods for making and administering cationic-iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, DR., etal. (2003) J. Mol. Biol 327:761-766: Verma, UN. etal., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, AS etal., (2007) J. Hypertens. 25: 197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, DR., et al (2003), supra; Verma, UN. etal., (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, TS. et al., (2006) Nature 441:111-114), cardiolipin (Chien, PY. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet ME. et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, DA. etal., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. etal., (1999) Pharm. Res. 16:1799-1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U. S. Patent No.

[0394] 7, 427, 605, which is herein incorporated by reference in its entirety.

[0395] Vector encoded iRNAs of the Invention

[0396] iRNA targeting a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, etal., TIG.

[0397] (1996), 12:5-10; Skillern, A., etal., International PCT Publication No. WO 00 / 22113, Conrad, International PCT Publication No. WO 00 / 22114, and Conrad, U. S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, etal., (1995) Proc. Natl. Acad. Sci. USA 92:1292).

[0398] The individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell. Alternatively, each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.

[0399] iRNA expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.

[0400] Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.,- (c) adeno- associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picomavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells’ genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors. Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are known in the art.

[0401] VI. Pharmaceutical Compositions of the Invention

[0402] The present invention also includes pharmaceutical compositions and formulations which include the iRNAs of the invention. Accordingly, in one embodiment, provided herein are pharmaceutical compositions comprising a double stranded ribonucleic acid (dsRNA) agent that inhibits expression of complement factor H-related (CFHR) (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) in a cell, such as a liver cell, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of SEQ ID NO: 1, 5, 7, or 9, and said antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of SEQ ID NO: 2, 6, 8, or 10; and a pharmaceutically acceptable carrier. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 1, 5, 7, or 9, and said antisense strand comprises at least 15 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 2, 6, 8, or 10.

[0403] In another embodiment, provided herein are pharmaceutical compositions comprising a dsRNA agent that inhibits expression of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) in a cell, such as a liver cell, wherein the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from any one of the antisense sequences listed in Tables 3-19; and a pharmaceutically acceptable carrier. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides from any one of the antisense sequences listed in Tables 3-19.

[0404] The pharmaceutical compositions containing the iRNA of the invention are useful for treating a disease or disorder associated with the expression or activity of a CFHR gene, e.g., AMD, aHUS, C3g, or IgAN.

[0405] Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV), intramuscular (IM) or for subcutaneous delivery. Another example is compositions that are formulated for direct delivery into the liver, e.g., by infusion into the liver, such as by continuous pump infusion. The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a CFHR gene.

[0406] The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual iRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.

[0407] Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as a CHFR-associated disease, disorder, or condition that would benefit from reduction in the expression of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5). Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose. Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose. Suitable mouse models are known in the art and include, for example, Cfti- / - knockout mice, transgenic CFH Y402H mice, and transgenic mice overexpressing complement factor C3, C3a and C5a receptor. Rodents do not have direct homologs of the CFHR genes (Pennesi, et al., 2012, Mol Aspects Med. 33(4)L487-509, which is incorporated herein by reference). Nonhuman primates have versions of CFHR2, CFHR4, and CFHR5 and have a retinal structure that more closely resembles that of humans. As such, nonhuman primates, such as cynomolgus macaque (Macaca fascicularis) and rhesus macaque monkeys (Macaca mulatto) are suitable models to study a CHFR-associated disease, disorder, or condition, e.g, AMD, aHUS, C3g, or IgAN.

[0408] The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral.

[0409] Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by mtraparenchymal, intrathecal or intraventricular, administration.

[0410] The iRNA can be delivered in a manner to target a particular cell or tissue, such as the liver (e.g., the hepatocytes of the liver).

[0411] In some embodiments, the pharmaceutical compositions of the invention are suitable for intramuscular administration to a subject. In other embodiments, the pharmaceutical compositions of the invention are suitable for intravenous administration to a subject. In some embodiments of the invention, the pharmaceutical compositions of the invention are suitable for subcutaneous administration to a subject, e.g., using a 29g or 30g needle.

[0412] The pharmaceutical compositions of the invention may include an RNAi agent of the invention in an unbuffered solution, such as saline or water, or in a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.

[0413] The pharmaceutical compositions of the invention may comprise a dsRNA agent of the invention in a free acid form. In other embodiments of the invention, the pharmaceutical compositions of the invention may comprise a dsRNA agent of the invention in a salt form, such as a sodium salt form. In certain embodiments, when the dsRNA agents of the invention are in the sodium salt form, sodium ions are present in the agent as counterions for substantially all of the phosphodiester and / or phosphorothiotate groups present in the agent. Agents in which substantially all of the phosphodiester and / or phosphorothioate linkages have a sodium counterion include not more than 5, 4, 3, 2, or 1 phosphodiester and / or phosphorothioate linkages without a sodium counterion. In some embodiments, when the dsRNA agents of the invention are in the sodium salt form, sodium ions are present in the agent as counterions for all of the phosphodiester and / or phosphorothiotate groups present in the agent.

[0414] Additional Formulations

[0415] i. Emulsions

[0416] The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1pm in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1, p. 199: Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be of either the water-in-oil (w / o) or the oil-in-water (o / w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w / o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o / w) emulsion. Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o / w / o) and water-in-oil-in-water (w / o / w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o / w emulsion enclose small water droplets constitute a w / o / w emulsion. Likewise, a sy stem of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o / w / o emulsion.

[0417] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1, p. 199).

[0418] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug De liven Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N. Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile / lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1, p. 285).

[0419] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w / o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswellmg clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.

[0420] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1, p. 199).

[0421] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.

[0422] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

[0423] ii. Microemulsions

[0424] In one embodiment of the present invention, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed ), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1, p. 245).

[0425] Typically, microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w / o) or an oil-in-water (o / w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

[0426] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1 -propanol, and 1 -butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions can, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase can include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil. Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o / w and w / o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U. S. Patent Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U. S. Patent Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions can form spontaneously when their components are brought together at ambient temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides or iRNAs. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of iRNAs and nucleic acids.

[0427] Microemulsions of the present invention can also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the iRNAs and nucleic acids of the present invention.

[0428] Penetration enhancers used in the microemulsions of the present invention can be classified as belonging to one of five broad categories-surfactants, fatty acids, bile salts, chelating agents, and non-chelating nonsurfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

[0429] Hi. Microparticles

[0430] An RNAi agent of the invention may be incorporated into a particle, e.g., a microparticle.

[0431] Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.

[0432] iv. Penetration Enhancers

[0433] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee etal., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each ofthe above mentioned classes of penetration enhancers are described below in greater detail.

[0434] Surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of iRNAs through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et l., J. Pharm.

[0435] Pharmacol., 1988, 40, 252).

[0436] Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1 -monocaprate, l-dodecylazacycloheptan-2-one, acylcamitines, acylcholines, C1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., Touitou, E., etal. Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee etal., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri etal., J. Pharm. Pharmacol., 1992, 44, 651-654).

[0437] The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fatsoluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery', Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxy cholate), ursodeoxycholic acid (UDCA), sodium tauro-24, 25 -dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee etal., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto etal., J. Pharm. Exp. Then, 1992, 263, 25; Yamashita

[0438]

[0439] J. Pharm. Sci., 1990, 79, 579-583).

[0440] Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of iRNAs through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J.

[0441] Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5 -methoxy salicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-ammo acyl derivatives of beta-diketones (enamines)(see e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, MA, 2006; Lee etal., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur etal., J. Control Rel, 1990, 14, 43-51).

[0442] As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of iRNAs through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1 -alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee etal., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita etal., J. Pharm. Pharmacol., 1987, 39, 621-626).

[0443] Agents that enhance uptake of iRNAs at the cellular level can also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U. S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97 / 30731), are also known to enhance the cellular uptake of dsRNAs. Examples of commercially available transfection reagents include, for example Lipofectamine™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000™ (Invitrogen; Carlsbad, CA), 293fectin™ (Invitrogen; Carlsbad, CA), Cellfectin™ (Invitrogen; Carlsbad, CA), DMRIE-C™ (Invitrogen; Carlsbad, CA), FreeStyle™ MAX (Invitrogen;

[0444] Carlsbad, CA), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, CA), Lipofectamine™ (Invitrogen;

[0445] Carlsbad, CA), RNAiMAX (Invitrogen; Carlsbad, CA), Oligofectamine™ (Invitrogen; Carlsbad, CA), Optifect™ (Invitrogen; Carlsbad, CA), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam® Reagent (Promega; Madison, WI), TransFast™ Transfection Reagent (Promega; Madison, WI), Tfx™-20 Reagent (Promega; Madison, WI), Tfx™-50 Reagent (Promega; Madison, WI), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPassaDI Transfection Reagent (New England Biolabs; Ipswich, MA, USA), LyoVec™ / LipoGen™ (Invitrogen; San Diego, CA, USA), PerFectin Transfection Reagent (Genlantis; San Diego, CA, USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), GenePORTER Transfection reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, CA, USA), Cytofectin Transfection Reagent (Genlantis; San Diego, CA, USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), TroganPORTER™ transfection Reagent (Genlantis; San Diego, CA, USA), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline; Taunton, MA, USA), UniFECTOR (B-Bridge International; Mountain View, CA, USA), SureFECTOR (B-Bridge International; Mountain View, CA, USA), or HiFect™ (B-Bridge International, Mountain View, CA, USA), among others.

[0446] Other agents can be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.

[0447] v. Carriers

[0448] Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, “carrier compound” or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadmimstration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et l., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.

[0449] vi. Excipients

[0450] In contrast to a carrier compound, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.) fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, com starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).

[0451] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0452] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives.

[0453] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.

[0454] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0455] v / z. Other Components

[0456] The compositions of the present invention can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and / or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

[0457] Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension can also contain stabilizers. In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more iRNA compounds and (b) one or more agents which function by a non-RNAi mechanism and which are useful in treating an a CFHR-associated disease, disorder, or condition. Examples of such agents include, but are not limited to vitamin C, vitamin E, lutein, zeaxanthin, zinc, copper, and / or vascular endothelial growth factor (VEGF) inhibitors including antibodies targeting VEGF; or a combination of any of the foregoing.

[0458] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. Compounds that exhibit high therapeutic indices are preferred.

[0459] The data obtained from cell culture assay s and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the invention lies generally within a range of circulating concentrations that include the ED50with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50 ( / .e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

[0460] In addition to their administration, as discussed above, the iRNAs featured in the invention can be administered in combination with other known agents effective in treatment of pathological processes mediated by CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression. In any event, the administering physician can adjust the amount and timing of iRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein.

[0461] VII. Methods of the Invention

[0462] The present invention also provides methods of using an iRNA of the invention and / or a composition of the invention to reduce and / or inhibit CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression in a cell, such as a cell in a subject, e.g., a hepatocyte. The methods include contacting the cell with an RNAi agent or pharmaceutical composition comprising an iRNA agent of the invention. In some embodiments, the cell is maintained for a time sufficient to obtain degradation of the mRNA transcript of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene. Reduction in gene expression can be assessed by any methods known in the art. For example, a reduction in the expression of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) may be assessed by determining the mRNA expression level of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) using methods routine to one of ordinary skill in the art, e.g., Northern blotting, qRT-PCR; by determining the protein level of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) using methods routine to one of ordinary skill in the art, such as Western blotting, immunological techniques. A reduction in the expression of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) may also be assessed indirectly by measuring a decrease in biological activity of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5), e.g., a decrease in complement activation.

[0463] In the methods of the invention the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject.

[0464] A cell suitable for treatment using the methods of the invention may be any cell that expresses a CFHR gene. A cell suitable for use in the methods of the invention may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g, a monkey cell or a chimpanzee cell), a nonprimate cell (such as a cow cell, a pig cell, a camel cell, a llama cell, a horse cell, a goat cell, a rabbit cell, a sheep cell, a hamster, a guinea pig cell, a cat cell, a dog cell, a rat cell, a mouse cell, a lion cell, a tiger cell, a bear cell, or a buffalo cell), a bird cell (e.g., a duck cell or a goose cell), or a whale cell. In one embodiment, the cell is a human cell, e.g., a human liver cell.

[0465] CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression is inhibited in the cell by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or about 100%. In preferred embodiments, CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression is inhibited by at least 20%.

[0466] In one embodiment, the in vivo methods of the invention may include administering to a subject a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary' to at least a part of an RNA transcript of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5)gene of the mammal to be treated.

[0467] In another embodiment, the in vivo methods of the invention may include administering to a subject a composition containing a first iRNA agent and a second iRNA agent, where the first iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene of the mammal to be treated and the second iRNA includes a nucleotide sequence that is complementary to at least a part of an second RNA transcript of a gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection.

[0468] In some embodiments, the administration is via a depot injection. A depot injection may release the iRNA in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of CFHR, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection.

[0469] In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the iRNA to the liver.

[0470] An iRNA of the invention may be present in a pharmaceutical composition, such as in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the iRNA can be adjusted such that it is suitable for administering to a subject.

[0471] Alternatively, an iRNA of the invention may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.

[0472] The mode of administration may be chosen based upon whether local or sy stemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.

[0473] In one aspect, the present invention also provides methods for inhibiting the expression of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene in a mammal. The methods include administering to the mammal a composition comprising a dsRNA that targets a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene in a cell of the mammal, thereby inhibiting expression of the CFHR (e.g, CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene in the cell.

[0474] In some embodiments, the methods include administering to the mammal a composition comprising a dsRNA that targets a CFHR (e.g, CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene in a cell of the mammal, thereby inhibiting expression of the CFHR gene in the cell. In another embodiment, the methods include administering to the mammal a pharmaceutical composition comprising a dsRNA agent that targets a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene in a cell of the mammal.

[0475] In another aspect, the present invention provides use of an iRNA agent or a pharmaceutical composition of the invention for inhibiting the expression of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene in a mammal.

[0476] In yet another aspect, the present invention provides use of an iRNA agent of the invention targeting a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene or a pharmaceutical composition comprising such an agent in the manufacture of a medicament for inhibiting expression of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene in a mammal.

[0477] Reduction in gene expression can be assessed by any methods known it the art and by methods, e.g. qRT-PCR, described herein. Reduction in protein production can be assessed by any methods known it the art and by methods, e.g. ELISA, mass spectrometry, complement activity, described herein.

[0478] The present invention also provides therapeutic and prophylactic methods which include administering to a subject having, or prone to developing AMD, aHUS, C3g, or IgAN, the iRNA agents, pharmaceutical compositions comprising an iRNA agent, or vectors comprising an iRNA of the invention.

[0479] In one aspect, the present invention provides methods of treating a subject having a disorder that would benefit from reduction in CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression, e.g., a CFHR-associated disease, e.g., AMD, aHUS, C3g, or IgAN.

[0480] The treatment methods (and uses) of the invention include administering to the subject, e.g., a human, a therapeutically effective amount of a dsRNA agent that inhibits expression of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) or a pharmaceutical composition comprising a dsRNA that inhibits expression of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5), thereby treating the subject.

[0481] In one aspect, the invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression, e.g., AMD, aHUS, C3g, or IgAN. The methods include administering to the subject a prophylactically effective amount of dsRNA agent or a pharmaceutical composition comprising a dsRNA, thereby preventing at least one symptom in the subject.

[0482] In one embodiment, a CFHR-associated disease, disorder, or condition is AMD, aHUS, C3g, or IgAN. The present invention also provides use of a therapeutically effective amount of an iRNA agent of the invention or a pharmaceutical composition comprising a dsRNA that inhibits expression of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) for treating a subject, e.g., a subject that would benefit from a reduction and / or inhibition of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression, e.g., a CFHR-associated disease, e.g., AMD, aHUS, C3g, or IgAN. In another aspect, the present invention provides use of an iRNA agent, e.g., a dsRNA, of the invention targeting a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene or a pharmaceutical composition comprising an iRNA agent targeting a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and / or inhibition of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression, e.g., a CFHR-associated disease.

[0483] The present invention also provides use of a prophylactically effective amount of an iRNA agent of the invention or a pharmaceutical composition comprising a dsRNA that inhibits expression of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) for preventing at least one symptom in a subject having a disorder that would benefit from reduction in CFHR expression, e.g., AMD, aHUS, C3g, or IgAN.

[0484] In another aspect, the present invention provides use of an iRNA agent, e.g., a dsRNA, of the invention targeting a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene or a pharmaceutical composition comprising an iRNA agent targeting a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene in the manufacture of a medicament for preventing at least one symptom in a subject having a disorder that would benefit from reduction in CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression, e.g., AMD, aHUS, C3g, or IgAN.

[0485] Accordingly, in one aspect, the present invention provides methods of treating a subject having a disorder that would benefit from reduction in CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression, e.g., a CFHR-associated disease, such as AMD, aHUS, C3g, or IgAN. In one embodiment, the CFHR-associated disease is age-related macular degeneration (AMD). “Age-related macular degeneration” (“AMD”) or “macular degeneration” refers to a progressive degeneration of the macular, the central part of the retina, in people over 55 years of age.

[0486] As used herein, “age-related macular degeneration,” used interchangeably with the term “AMD,” refers to a progressive degeneration of the macular, the central part of the retina, in people over 55 years of age. AMD accounts for 8.7% of all blindness worldwide. AMD is characterized by large drusen deposits (deposits containing lipids and proteins) under the retina. When AMD damages the macula, the center part of a person’s vision may become blurred or wavy, and a blind spot may develop. AMD can cause vision loss quickly or slowly, and can make it difficult to do things that require sharp vision, such as reading, sewing, cooking or driving; it can also make it difficult to see in dim light. There are two types of AMD, referred to as wet AMD and dry AMD.

[0487] Macular degeneration is initiated and perpetuated by the accumulation of toxic vitamin A derivatives in the retinal pigment epithelium (RPE). Pharmacological inhibition of vitamin A delivery or metabolism in the RPE can significantly slow and reduce vision loss in animal models of macular degeneration. Inhibitory peptides that block interaction between RBP4 and its receptor, STRA6, were shown to reduce vitamin A delivery to RPE, and could serve as the basis for the development of a therapeutic to treat macular degeneration (Faijo, et al., 2013, ARVO Annual Meeting, 54(15), 1702).

[0488] “Wet AMD,” also called “neovascular AMD” or “wet macular degeneration” is characterized by pathological blood vessel growth from the choroid into the retina (choroidal neovascularization), driven largely by excessive vascular endothelial growth factor (VEGF) production by the retinal pigment epithelium (RPE).

[0489] “Dry AMD,” also called “geographic atrophy” or “dry macular degeneration” is caused by RPE cell death and photoreceptor degeneration, leading to vision loss.

[0490] Components of the complement cascade were discovered in drusen from the eyes of patients with AMD. Polymorphisms in the gene for complement factor H (CFH) are associated with an increased risk of AMD. The CFH Y402H polymorphism increases the risk of AMD five to sevenfold, and this polymorphism is associated with at least 50% of AMD cases. Genetic analysis have shown that CFHR5 loss of function and deletion of CFHR1 / 3 are protective for AMD. Increased circulating CRHR1 and CFHR5 proteins are also associated with AMD. The iRNA can be administered by intravenous infusion over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis.

[0491] Administration of the iRNA can reduce CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more. In a preferred embodiment, administration of the iRNA can reduce CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 20%.

[0492] Before administration of a full dose of the iRNA, patients can be administered a smaller dose, such as a 5% infusion reaction, and monitored for adverse effects, such as an allergic reaction. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels.

[0493] Alternatively, the iRNA can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired daily dose of iRNA to a subject. The injections may be repeated over a period of time. The administration may be repeated on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every other day or to once a year. In certain embodiments, the iRNA is administered about once per week, once every 7-10 days, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once per month, once every 2 months, once every 3 months, once per quarter), once every 4 months, once every 5 months, or once every 6 months.

[0494] In one embodiment, the method includes administering a composition featured herein such that expression of the target CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours. In one embodiment, expression of the target CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene is decreased for an extended duration, e.g., at least about two, three, four days or more, e.g, about one week, two weeks, three weeks, or four weeks or longer.

[0495] Preferably, the iRNAs useful for the methods and compositions featured herein specifically target RNAs (primary or processed) of the target CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) gene.

[0496] Compositions and methods for inhibiting the expression of these genes using iRNAs can be prepared and performed as described herein.

[0497] Administration of the dsRNA according to the methods of the invention may result in a reduction of the severity, signs, symptoms, and / or markers of such diseases or disorders in a patient with AMD, aHUS, C3g, or IgAN. By “reduction” in this context is meant a statistically significant decrease in such level. The reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.

[0498] Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom seventy, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropnate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. For example, efficacy of treatment of AMD may be assessed, for example, by periodic monitoring of one or more of blurred or distorted vision, difficulty seeing in low light, and vision loss.

[0499] Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of an iRNA or pharmaceutical composition thereof, “effective against” AMD indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as an improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating AMD and the related causes. A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment.

[0500] Efficacy for a given iRNA drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art.

[0501] The invention further provides methods for the use of a iRNA agent or a pharmaceutical composition of the invention, e.g., for treating a subject that would benefit from reduction and / or inhibition of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) expression, e.g., a subject having an CFHR-associated disease disorder, or condition, in combination with other pharmaceuticals and / or other therapeutic methods, e.g., with known pharmaceuticals and / or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. For example, in certain embodiments, an iRNA agent or pharmaceutical composition of the invention is administered in combination with, e.g., vitamin C, vitamin E, lutein, zeaxanthin, zinc, copper, and / or vascular endothelial growth factor (VEGF) inhibitors including antibodies targeting VEGF; or a combination of any of the foregoing.

[0502] The iRNA agent and an additional therapeutic agent and / or treatment may be administered at the same time and / or in the same combination, e.g., subcutaneously, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and / or by another method known in the art or described herein.

[0503] VIII. Kits

[0504] The present invention also provides kits for performing any of the methods of the invention. Such kits include one or more RNAi agent(s) and instructions for use, e.g, instructions for inhibiting expression of a CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) in a cell by contacting the cell with an RNAi agent or pharmaceutical composition of the invention in an amount effective to inhibit expression of the CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5). The kits may optionally further comprise means for contacting the cell with the RNAi agent (e.g., an injection device), or means for measuring the inhibition of CFHR (e.g., means for measuring the inhibition of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) mRNA and / or CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) protein). Such means for measuring the inhibition of CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5) may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample. The kits of the invention may optionally further comprise means for administering the RNAi agent(s) to a subject or means for determining the therapeutically effective or prophylactically effective amount.

[0505] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary' skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0506] EXAMPLES

[0507] Example 1. Rare predicted loss-of-function and damaging missense variants in CFHR5 associate with lower risk of age-related macular degeneration

[0508] Age-related macular degeneration (AMD) is a leading cause of blindness among older adults worldwide. Current treatments often slow but do not halt vision loss and can be burdensome due to a need for regular intravitreal injections. Hence, there is a need for more effective and easily maintained treatments.

[0509] One of the strongest AMD genome wide association study (GWAS) associations is at the complement factor H (CFH) locus, which includes the CFH gene and five complement factor H-related (CFHR) genes. This association is largely driven by a common missense variant in CFH, Y402H, that strongly increases AMD risk. Due to extensive linkage disequilibrium across the locus, all nearby genes have strong associations with AMD, presenting an obstacle to identifying potential causal roles for the five CFHR genes individually. Analyses of rare (MAF<0.01) coding variants can help to disentangle such associations.

[0510] Using data from over 400,000 UK Biobank participants, associations of rare variant burden were tested for genes at the CFH locus with AMD. Variant sets included rare high-confidence predicted loss-of-function (HC pLOF) variants, on their own or aggregated with predicted damaging missense variants. Burden analyses was performed using Regenie and employed the ACAT feature to aggregate variant set p-values together and yield a single overall burden p-value for each gene. When conditioning on CFH Y402H and a well-known common, AMD-protective CFHR1-3 deletion, only CFH and CFHR5 had AMD associations that were significant (p<0.05 / 6). Results for individual (i.e., not aggregated) variant sets showed that burden of rare HC pLOFs + damaging missense variants in CFH associated with increased AMD risk (OR=5.6, p=4.6e- 15); whereas for CFHR5, such burden associated with reduced AMD risk (OR=0.75, p=7e-4), as did burden of HC pLOFs alone (OR=0.76, 1.7e-3). These associations remained at least nominally significant when adjusting for additional CFH-region variants previously identified as independently associated with AMD.

[0511] Prior studies have shown AMD to associate with reduced photoreceptor thickness, and this study found that CFHR5 HC pLOFs + damaging missense variants associated with increased photoreceptor thickness (+0.50 SD, p=2e-4, n=55,000), and this association remained when excluding AMD cases from the analytic sample. In addition, results were observed indicating that the protective association of CFHR5 HC pLOFs + damaging missense variants on AMD risk may be stronger for CFH Y402H carriers (p=0.04 for interaction term).

[0512] These findings suggest that therapeutic inhibition of CFHR5 may provide protection against AMD, and such protection might be greatest for those with elevated AMD risk due to being CFH Y402H carriers.

[0513] Example 2. CFHR iRNA Design, Synthesis, and Selection

[0514] Nucleic acid sequences provided herein are represented using standard nomenclature. See the abbreviations of Table 2. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5’-3’-phosphodiester bonds. The abbreviations are understood to omit the 3’-phosphate (i.e. they are 3’-OH) when placed at the 3’-terminal position of an oligonucleotide.

[0515] TABLE 2: Abbreviations of nucleotide monomers used in nucleic acid sequence representation.

[0516]

[0517]

[0518]

[0519]

[0520] ’The chemical structure of L96 is as follows:

[0521]

[0522] 2The chemical structure of uL96 is as follows:

[0523]

[0524] Experimental Methods

[0525] This Example describes methods for the design, synthesis, and selection of CFHR iRNA agents. In particular, the design, synthesis, and selection of dsRNA agents targeting CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5, and dsRNA agents that target both CFHR1 and CFHR5. In some cases, the dsRNA agents also cross-react with and target CFHR2. In some cases, the dsRNA agents also cross-react with and target CFHR1, CFHR2, and CFHR5. In some cases, the CFHR3 and CFHR4 dsRNA agents target both CFHR3 and CFHR4 (CFHR3 / 4). In some cases, the dsRNA agents only target CFHR1 and in other cases the dsRNA agents only target CFHR5. In some cases, the human CFHR1 and CFHR5 dsRNA agents also cross-react with CFHRs from cynomolgus monkey.

[0526] Bioinformatics

[0527] Source of reagents

[0528] Where the source of a reagent is not specifically given herein, such reagent can be obtained from any supplier of reagents for molecular biology at a quality / purity standard for application in molecular biology.

[0529] Transcripts

[0530] A set of siRNAs targeting human complement factor H-related 1 (CFHR1; human NCBI refseqID NM_002113.3; NCBI GenelD: 3080), were designed using custom R and Python scripts. The human NM_002113.3 REFSEQ mRNA has a length of 1297 bases. _A set of siRNAs targeting human complement factor H-related 5 (CFHR5; human NCBI refseqID NM_030787.4; NCBI GenelD: 81494), were designed using custom R and Python scripts. The human NM_030787.4 REFSEQ mRNA has a length of 2814 bases.

[0531] A set of siRNAs targeting human complement factor H-related 3 (CFHR3) and CFHR4 (CFHR3 / 4 (human CFHR3 NCBI refseqID NM 021023.6; NCBI GenelD: 10878; CFHR4 NCBI refseqID NM_001201550.3; NCBI GenelD: 10877), were designed using custom R and Python scripts. The human NM_021023.6 REFSEQ mRNA has a length of 2934 bases and the human NM_001201550.3 REFSEQ mRNA has a length of 2063 bases.

[0532] siRNA Synthesis

[0533] siRNAs were synthesized and annealed using routine methods known in the art.

[0534] Briefly, siRNA sequences were synthesized at 1 pmol scale on a Mermade 12 synthesizer (BioAutomation) using the solid support mediated phosphoramidite chemistry. The solid support was controlled pore glass (500 A) loaded with custom GalNAc ligand or universal solid support (AM biochemical). Ancillary synthesis reagents, 2’-F and 2’-O-Methyl RNA and deoxy phosphoramidites were obtained from Thermo-Fisher (Milwaukee, WI) and Hongene (China). 2’F 2’-O-Methyl, GNA (glycol nucleic acids), 5’phosphate and other modifications were introduced using the corresponding phosphoramidites. Synthesis of 3’ GalNAc conjugated single strands was performed on a GalNAc modified CPG support.

[0535] Custom CPG universal solid support was used for the synthesis of antisense single strands. Coupling time for all phosphoramidites (100 mM in acetonitrile) was 5 min employing 5-Ethylthio-1H-tetrazole (ETT) as activator (0.6 M in acetonitrile). Phosphorothioate linkages were generated using a 50 mM solution of 3-((Dimethylamino-methylidene) amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes (Wilmington, MA, USA)) in anhydrous acetomtrile / pyridine (1:1 v / v). Oxidation time was 3 minutes. All sequences were synthesized with final removal of the DMT group (“DMT off’).

[0536] Upon completion of the solid phase synthesis, oligoribonucleotides were cleaved from the solid support and deprotected in sealed 96 deep well plates using 200 pL Aqueous Methylamine reagents at 60°C for 20 minutes. For sequences containing 2’ ribo residues (2’-OH) that are protected with a tert-butyl dimethyl silyl (TBDMS) group, a second step deprotection was performed using TEA.3HF (triethylamine tnhydro fluoride) reagent. To the methylamine deprotection solution, 200uL of dimethyl sulfoxide (DMSO) and OOul TEA.3HF reagent was added and the solution was incubated for additional 20min at 60°C. At the end of cleavage and deprotection step, the synthesis plate was allowed to come to room temperature and was precipitated by addition of ImL of acetontile: ethanol mixture (9: 1). The plates were cooled at -80°C for 2 hrs, supernatant decanted carefully with the aid of a multi-channel pipette. The oligonucleotide pellet was resuspended in 20mM NaOAc buffer and were desalted using a 5 mL HiTrap size exclusion column (GE Healthcare) on an AKTA Purifier System equipped with an A905 autosampler and a Frac 950 fraction collector. Desalted samples were collected in 96-well plates. Samples from each sequence were analyzed by EC-MS to confirm the identity, UV (260 nm) for quantification and a selected set of samples by IEX chromatography to determine purity. Annealing of single strands was performed on a Tecan liquid handling robot. Equimolar mixture of sense and antisense single strands were combined and annealed in 96 well plates. After combining the complementary single strands, the 96-well plate was sealed tightly and heated in an oven at 100°C for 10 minutes and allowed to come slowly to room temperature over a period 2-3 hours. The concentration of each duplex was normalized to lOpM in IX PBS and then submitted for in vitro screening assays.

[0537] In some instances, a duplex (dsRNA) was synthesized more than once. Different batches are labeled with different extensions. For example, AD-2152632.1 and AD-2152632.2 are different batches of the same duplex. Duplexes having the same ID but without an extension, or with different extensions, have the same nucleotide sequences of the sense strand and antisense strand, e.g., AD-2152632, AD-2152632.1, and AD- 2152632.2 have the same nucleotide sequences of the sense strand and antisense strand.

[0538] A detailed list of the unmodified nucleotide sequences of the sense strand and antisense strand sequences for CFHR1 is shown in Tables 3 and 7. A detailed list of the unmodified nucleotide sequences of the sense strand and antisense strand sequences for CFHR5 is shown in Tables 5 and 9. A detailed list of the unmodified nucleotide sequences of the sense strand and antisense strand sequences for CFHR1 and CFHR5 targeting dsRNA agents is shown in Table 11 and Table 13.

[0539] A detailed list of the modified nucleotide sequences of the sense strand and antisense strand sequences for CFHR1 is shown in Tables 4 and 8. A detailed list of the modified nucleotide sequences of the sense strand and antisense strand sequences for CFHR5 is shown in Tables 6 and 10. A detailed list of the modified nucleotide sequences of the sense strand and antisense strand sequences for CFHR1 and CFHR5 targeting dsRNA agents is shown in Table 12 and Table 14. Additional unmodified and modified dsRNA agents targeting CFHR1 and / or CHFR5 are shown in Table 15. These dsRNA agents targeting CFHR1 and / or CFHR5 may also cross-react with and knockdown CFHR2.

[0540] A detailed list of unmodified and modified dsRNA agents targeting CFHR1 and CFHR5 is shown in Tables 16 and 17. A detailed list of unmodified and modified dsRNA agents targeting both CFHR3 and CFHR4 (CFHR3 / 4) is shown in Tables 18 and 19.

[0541] TABLE 3. Unmodified Sense and Antisense Strand Sequences of Human CFHR1 dsRNA Agents

[0542]

[0543]

[0544]

[0545]

[0546]

[0547]

[0548] TABLE 4. Modified Sense and Antisense Strand Sequences of Human CFHR1 dsRNA Agents

[0549]

[0550]

[0551]

[0552]

[0553]

[0554]

[0555] TABLE 5. Unmodified Sense and Antisense Strand Sequences of Human CFHR5 dsRNA Agents

[0556]

[0557]

[0558]

[0559]

[0560]

[0561]

[0562]

[0563]

[0564]

[0565]

[0566]

[0567]

[0568]

[0569]

[0570]

[0571]

[0572]

[0573]

[0574]

[0575]

[0576]

[0577]

[0578]

[0579]

[0580]

[0581]

[0582]

[0583]

[0584]

[0585]

[0586]

[0587]

[0588] TABLE 6. Modified Sense and Antisense Strand Sequences of Human CFHR5 dsRNA Agents

[0589]

[0590]

[0591]

[0592]

[0593]

[0594]

[0595]

[0596]

[0597]

[0598]

[0599]

[0600]

[0601]

[0602]

[0603]

[0604]

[0605]

[0606]

[0607]

[0608]

[0609]

[0610]

[0611]

[0612]

[0613]

[0614]

[0615]

[0616]

[0617]

[0618]

[0619] TABLE 7. Additional Unmodified Sequences of Human CFHR1 dsRNA Agents

[0620]

[0621]

[0622]

[0623]

[0624] TABLE 8. Additional Modified Sequences of Human CFHR1 dsRNA Agents

[0625]

[0626]

[0627]

[0628]

[0629] TABLE 9. Additional Unmodified Sequences of Human CFHR5 dsRNA Agents

[0630]

[0631]

[0632]

[0633]

[0634]

[0635]

[0636]

[0637]

[0638]

[0639]

[0640]

[0641] TABLE 10. Additional Modified Sequences of Human CFHR5 dsRNA Agents

[0642]

[0643]

[0644]

[0645]

[0646]

[0647]

[0648]

[0649]

[0650]

[0651]

[0652]

[0653]

[0654] TABLE 11. Unmodified Sense and Antisense Strand Sequences of dsRNA Agents Targeting Both Human CFHR1 and CFHR5

[0655]

[0656]

[0657]

[0658]

[0659]

[0660]

[0661]

[0662]

[0663]

[0664]

[0665] TABLE 12. Modified Sense and Antisense Strand Sequences of dsRNA Agents Targeting Both Human CFHR1 and CFHR5

[0666]

[0667]

[0668]

[0669]

[0670]

[0671]

[0672]

[0673]

[0674]

[0675]

[0676] TABLE 13. Additional Unmodified Sense and Antisense Strand Sequences of dsRNA Agents Targeting Both Human CFHR1 and CFHR5

[0677]

[0678]

[0679]

[0680] TABLE 14. Additional Modified Sense and Antisense Strand Sequences of dsRNA Agents Targeting Both Human CFHR1 and CFHR5

[0681]

[0682]

[0683]

[0684] Table 15. Additional dsRNA Agents Targeting Human CFHR1 and / or CFHR5

[0685]

[0686] TABLE 16. Unmodified Sense and Antisense Strand Sequences of dsRNA Agents Targeting Both Human CFHR1 and CFHR5

[0687]

[0688]

[0689]

[0690]

[0691]

[0692]

[0693]

[0694] TABLE 17. Modified Sense and Antisense Strand Sequences of dsRNA Agents Targeting Both Human CFHR1 and CFHR5

[0695]

[0696]

[0697]

[0698]

[0699]

[0700]

[0701]

[0702]

[0703] Table 18. Unmodified Sense and Antisense Strand Sequences of Human CFHR3 / 4 dsRNA Agents

[0704]

[0705]

[0706] Table 19. Modified Sense and Antisense Strand Sequences of Human CFHR3 / 4 dsRNA Agents

[0707]

[0708]

[0709] Example 3. In vitro screening of CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5 siRNA Experimental Methods

[0710] Cell culture and transfections:

[0711] Primary human hepatocytes (PHH) or primary cyno hepatocytes (PCH) were transfected by adding 4.9pl of Opti-MEM plus O.lpl of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat # 13778-150) to 5 pl of siRNA duplexes per well into a 384-well plate and incubated at room temperature for 15 minutes. 40pl of media containing 5 xlO3cells was then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Dose response experiments were performed at various final duplex concentrations.

[0712] Cos-7 cells (ATCC) were transfected by adding 5 pl of 1 ng / pl, diluted in Opti-MEM, C9orf72 intron 1 psiCHECK2 vector (Blue Heron Biotechnology), 4.9pl of Opti-MEM plus 0.1 pl of Lipofectamine 2000 per well (Invitrogen, Carlsbad CA. cat #11668-019) to 5 pl of siRNA duplexes per well, with 4 replicates of each siRNA duplex, into a 384-well plate, and incubated at room temperature for 15 minutes. Thirty-five pl of Dulbecco’s Modified Eagle Medium (ThermoFisher) containing ~5 xlO3cells were then added to the siRNA mixture. Cells were incubated for 48 hours followed by Firefly (transfection control) and Renilla (fused to target sequence) luciferase measurements. Dose response experiments were performed at various final duplex concentrations.

[0713] Free uptake:

[0714] Free uptake assays were carried out in primary human hepatocyte (PHH, BioIVT) and primary cyno hepatocyte (PCH, BioIVT). Free uptake assay was performed similarly to the transfection assay without using Lipofectamine RNAimax and cells were incubated for 48 hours prior to the RNA purification. Experiments were performed essentially as described in Agarwal S., Nucleic Acid. Ther. (2021) 31(4): 309-315.

[0715] Experiments were performed at 250nM, lOOnM, lOnM, InM, O.lnM, O. OlnM, 0.00 InM, and O. OOOlnM.

[0716] Total RNA isolation using DYNABEADS mRNA Isolation Kit:

[0717] RNA was isolated using an automated protocol on a BioTek-EL406 platform using DYNABEADs (Invitrogen, cat#61012). Briefly, 70 pl of Lysis / Binding Buffer and 10 pl of lysis buffer containing 3 pl of magnetic beads were added to the plate with cells. Plates were incubated on an electromagnetic shaker for 10 minutes at room temperature and then magnetic beads were captured and the supernatant was removed. Beadbound RNA was then washed 2 times with 150 pl Wash Buffer A and once with Wash Buffer B. Beads were then washed with 150 pl Elution Buffer, re -captured and supernatant removed.

[0718] Synthesis using ABI High capacity cDNA reverse transcription kit (Applied Biosvstems, Foster City, CA, Cat #4368813):

[0719] Ten pl of a master mix containing 1 pl 10X Buffer, 0.4 pl 25X dNTPs, 1 pl lOx Random primers, 0.5 pl Reverse Transcriptase, 0.5 pl Rnase inhibitor and 6.6 pl of H2O per reaction was added to RNA isolated above. Plates were sealed, mixed, and incubated on an electromagnetic shaker for 10 minutes at room temperature, followed by 2 h 37°C.

[0720] Real time PCR:

[0721] Two pl of cDNA and 5 pl Lightcycler 480 probe master mix (Roche Cat # 04887301001) were added to either 0.5 pl of human GAPDH TaqMan Probe and 0.5 pl human CFHR (e.g., CFHR1, CFHR2, CFHR3, CFHR4, or CFHR5) probe per well in a 384 well plates (Roche cat # 04887301001). Real time PCR was done in a LightCycler480 Real Time PCR system (Roche). Each duplex was tested at least two times and data were normalized to cells transfected with a non-targeting control siRNA. To calculate relative fold change, real time data were analyzed using the AACt method and normalized to assays performed with cells transfected with a non-targetmg control siRNA.

[0722] Dual-Glo® Luciferase assay (Dual-Luc):

[0723] Screening of RNAi agents in Cos-7 cells (Dual-Luciferase psiCHECK2 vector) was also performed. The level of expression of CFHR1, CFHR2, and CFHR5 was determined by quantitative Anorogenic RT-PCR (i.e., the TaqMan™ System), by a Dual-Glo® Luciferase assay.

[0724] Results:

[0725] The results of a multi-dose screening assay in PHH cells for CFHR1 are shown in Tables 20 and 22. The results of a multi-dose screening assay in PHH cells for CFHR5 are shown in Tables 21 and 24. The results of a multi-dose free uptake assay in PHH cells are shown in Table 23 for CFHR1 and Table 25 for CFHR5. The results of a multi -dose free uptake assay in PCH cells are shown in Table 26 for CFHR5. The results of a multi-dose free uptake assay in PHH cells are shown in Table 28 for CFHR1, CFHR2, CFHR3, CFHR4, and CFHR5. The results of dual -luciferase (dual-Luc) assays in Cos-7 cells are shown in Tables 27 and 29 for CFHR1, CFHR2, and CFHR5. The results of dual -luciferase (dual-Luc) assays in Cos-7 cells for CHFR1, CFHR5, CFHR2, and CFH are shown in Table 30 and Table 31. The dsRNA duplexes in Table 30 demonstrated knockdown of CFHR1 mRNA, but not knockdown of CFHR5, CFHR2, or CFH. The dsRNA duplexes in Table 31 demonstrated knockdown of CFHR5 mRNA, but not knockdown of CFHR1, CFHR2, or CFH. The results of dual-luciferase (dual-Luc) assays in Cos-7 cells for CHFR3 / 4 targeted dsRNA duplexes are shown in Table 32. Table 33 shows the results for CFHR1 knockdown in a multi-dose free uptake assay in PHH cells. Table 34 shows the results for CFHR5 knockdown in a multi-dose free uptake assay in PHH cells and Table 35 shows the results for CFHR5 knockdown in a multi-dose free uptake assay in PCH cells. The results are presented as the average (avg) percent mRNA remaining and include the standard deviation (SD).

[0726] TABLE 20. Multi-dose In vitro Screening of CFHR dsRNA agents in PHH Cells for CFHR1

[0727]

[0728]

[0729]

[0730]

[0731] TABLE 21. Multi-Dose In vitro Screening of CFHR dsRNA Agents in PHH Cells for CFHR5

[0732]

[0733]

[0734]

[0735]

[0736]

[0737]

[0738]

[0739]

[0740]

[0741]

[0742]

[0743]

[0744]

[0745]

[0746]

[0747]

[0748]

[0749]

[0750]

[0751]

[0752]

[0753]

[0754]

[0755] TABLE 22. Multi-dose In vitro Screening of CFHR dsRNA agents in PHH Cells for CFHR1

[0756]

[0757]

[0758]

[0759] TABLE 23. In vitro Screening Free uptake of CFHR dsRNA agents in PHH Cells for CFHR1

[0760]

[0761]

[0762]

[0763] TABLE 24. Multi-dose In vitro Screening of CFHR dsRNA agents in PHH Cells for CFHR5

[0764]

[0765]

[0766]

[0767]

[0768]

[0769]

[0770]

[0771] TABLE 25. In vitro Screening Free uptake of CFHR dsRNA agents in PHH Cells for CFHR5

[0772]

[0773]

[0774]

[0775]

[0776]

[0777]

[0778]

[0779]

[0780] TABLE 26. In vitro Screening Free uptake of CFHR dsRNA agents in PCH Cells for CFHR5

[0781]

[0782]

[0783]

[0784]

[0785]

[0786]

[0787]

[0788] TABLE 27. In vitro Screening Dual-Luc Assay of CFHR dsRNA agents in Cos-7 Cells for CFHR1 and CFHR5

[0789]

[0790]

[0791]

[0792]

[0793]

[0794]

[0795]

[0796]

[0797] TABLE 28. In vitro Screening Free uptake of CFHR dsRNA agents in PHH Cells for CFHR1-5

[0798]

[0799] TABLE 29. Dual-Luc Screening Assay of CFHR dsRNA agents in PHH Cells for CFHR1, 2 and 5

[0800]

[0801] Table 30. Dual-Luc Screening Assay of Selected CFHR dsRNA agents in COS7 Cells for CFHR1, 2 and 5 and CFH

[0802]

[0803] Table 31. Dual-Luc Screening Assay of Selected CFHR dsRNA agents in COS7 Cells for CFHR1, 2 and 5 and CFH

[0804]

[0805]

[0806] Table 32. Dual-Luc Screening Assay of Selected CFHR dsRNA agents in COS7 Cells for CFHR3 / 4

[0807]

[0808] TABLE 33. Screening Free uptake of CFHR dsRNA agents in PHH Cells for CFHR1 Knockdown

[0809]

[0810]

[0811]

[0812] TABLE 34. Screening Free uptake of CFHR dsRNA agents in PHH Cells for CFHR5 Knockdown

[0813]

[0814]

[0815]

[0816] TABLE 35. Screening Free uptake of CFHR dsRNA agents in PCH Cells for CFHR5 Knockdown

[0817]

[0818]

[0819]

[0820] Example 4. In vivo Studies in PXB mice

[0821] PXB mice having a humanized liver were administered 1 mg / kg (mpk), 3 mpk, or 10 mpk of selected dsRNA duplexes subcutaneously. qPCR was performed on liver samples at day 14 and day 21. FIG. 1A shows the results for the percent CFHR1 mRNA remaining. FIG. 1B shows the results of the percent CFHR5 mRNA remaining. FIG. 1C shows the percent CFHR2 mRNA remaining.

[0822] PXB mice were administered a single dose, 3mg / kg subcutaneous, of exemplary dsRNA duplexes. The level of human CFHR1, CFHR2, CFHR5, and CFH in the PBS treated mice was used as the control. Human CFHR1, CFHR2, CFHR5, and CFH levels were measured in the liver at day 14 after administration. The results in Table 36 and in FIG. 2A, FIG. 2B, and FIG. 2C are presented as percent mRNA remaining relative to the PBS control. The levels of CFH remained unchanged (data not shown). FIG. 2D illustrates the sequences and modifications of the dsRNA agents tested in the study. PXB mice were administered an exemplary siRNA duplex, AD-2288789, at 3 mg / kg subcutaneous in a single dose at day 0. Human CFHR1, CFHR2, CFHR5, and CFH mRNA levels were measured in the liver at day 14 as described above. The sequence and structure of AD-2288789 is shown in FIG. 3A. In vitro qPCR results of a free uptake assay in PHH are shown for CFHR1 and CFHR5 in FIG. 3B. FIG. 3C depicts the qPCR results of the PXB mouse study and shows the levels of CFHR1, CFHR2, CFHR5, and CFH mRNA remaining relative to the PBS control.

[0823] PXB mice were administered exemplary siRNA duplexes AD-2152635.2, AD-2288789.2, AD-2700146.2, AD-2700147.2, or AD-2738841.2 at 1 mg / kg, 3 mg / kg, or 10 mg / kg subcutaneous in a single dose at day 0. CFHR1 and CFHR5 mRNA levels were measured in the liver at day 14 as described above. The percent liver mRNA remaining was determined. The results are presented in FIG. 4A for CFHR1 and in FIG. 4B for CFHR5.

[0824] PXB mice were administered an exemplary siRNA duplex, AD-2152719, which targets only CFHR1, at 10 mg / kg subcutaneous in a single dose at day 0. CFHR1 mRNA levels were measured in the liver at day 21. The percent liver mRNA remaining was determined. The results are presented in FIG. 5. The CFHR1 only duplex showed about a 50% knockdown of CFHR1.

[0825] PXB mice were administered an exemplary siRNA duplex, AD-2152745, which targets only CFHR5, at 10 mg / kg subcutaneous in a single dose at day 0. CFHR1 mRNA levels were measured in the liver at day 21. The percent liver mRNA remaining was determined. The results are presented in FIG. 6. The CFHR5 only duplex showed about a 50% knockdown of CFHR5.

[0826] PXB mice were administered an exemplary siRNA duplex, AD-2152779, which targets CFHR3 and CFHR4 (CFHR3 / 4), at 10 mg / kg subcutaneous in a single dose at day 0. CFHR3 mRNA levels were measured in the liver at day 21. The percent liver mRNA remaining was determined. The results are presented in FIG. 7. The CFHR3 / 4 duplex showed about a 93% knockdown of CFHR3.

[0827] PXB mice were administered exemplary siRNA duplexes AD-2787983, AD-2288789.2, AD-3002629, AD-3002631, AD-3002632, AD-3002633, AD-3002634, AD-3002635, AD-3002636, AD-3002637, AD-3002638, AD-3002639, AD-2905718 (CFHRl-only), AD-2905719 (CFHRl-only), AD-2905723 (CFHR5-only), AD-2905726 (CFHR5-only) at 2 mg / kg subcutaneous in a single dose at day 0. CFHR1 and CFHR5 mRNA levels were measured in the liver at day 14 as described above. The percent liver mRNA remaining was determined. The results are presented in FIG. 8A for CFHR1 and in FIG. 8B for CFHR5. The serum protein levels of CFHR2 and CFHR5 were measured by ELISA at day 14. FIG.

[0828] 8C depicts the knockdown of CFHR2 protein and FIG. 8D illustrates the knockdown of CFHR5 protein. TABLE 36. PXB Mouse Study of CFHR dsRNA agents qPCR Results for CFHR1, 2, 5, and CFH

[0829]

[0830] Example 5. In vivo Knockdown of CFHR2 and CFHR5 in Non-Human Primates (NHP)

[0831] In vivo knockdown effects of dsRNA agents AD-2288789. AD-2443565, and AD-244574 were assessed. The study schematic is shown in FIG. 9. Cynomolgus monkeys were subcutaneously administered a single dose of dsRNA agent and mRNA and protein levels of CFHR2 and CFHR5 were monitored overtime. Two different doses of AD-2288789 were evaluated, 3 mg / kg and 20 mg / kg. A single dose of 3 mg / kg of AD-2443565 and AD-244574 was evaluated. FIG. 10A shows the percent CFHR2 mRNA remaining and FIG. 10B shows the percent CFHR5 mRNA remaining in the liver out to day 100 post-administration. FIG. 11A depicts the percent CFHR2 protein remaining and FIG. 11B depicts the percent CFHR5 protein remaining in serum over time as measured by mass spectrometry. FIG.

[0832] 12 shows the protein level of CFH in the serum remained unchanged.

[0833] The results show that the three duplexes tested all significantly reduced mRNA and protein levels of CFHR2 and CFHR5 and the knockdown of CFHR2 and CFHR5 protein is indistinguishable at 3 mg / kg.

[0834] Example 6. In vivo Knockdown of Ocular CFHR2 and CFHR5 in Non-Human Primates (NHP) Male monkeys (3 / group) were administered phosphate-buffered saline (PBS) or AD-2288789 at 15 mg / kg via multiple SC injections on Days 1 and 30. The study schematic is shown in FIG. 13. Serum samples were collected from all animals at the following time points: Days -14, -7, 8, 15, 22, 29, 30 (predose), 36, 43, 50, 57, and 62. Blood was collected, transferred into 2 mL serum separator tubes, and centrifuged within 60 minutes of collection. Serum was collected and stored at nominally -80°C until analyzed for CFH, CFHR2, and CFHR5 protein. The posterior eye cup, including choroid, basement membrane, and retinal pigment epithelium, was dissected from all animals on Day 63 and placed into separate containers. The samples were snap-frozen in liquid nitrogen and stored nominally at -80°C. Posterior eye cup was analyzed for CFH, CFHR2, and CFHR5 protein.

[0835] Quantitation of Serum and Posterior Eye Cup CFHR Protein Concentration by LC / MS

[0836] An 11-point standard curve [2.5-5000 ng / mL] of synthesized proteotypic peptides was prepared in a surrogate matrix of mouse serum and used for peptide quantification. QC samples with peptide standards spiked in at concentrations of 10, 50 and 250 ng / mL were prepared in surrogate matrix.

[0837] Posterior eye cup samples were lysed 1:10 (mg tissue: pL lysis buffer) with 7M urea, 2M thiourea, 4% CHAPS in 100 mM ammonium bicarbonate. Samples were lysed with three cycles of shaking at 30 1 / s for 5 minutes in Qiagen TissueLyser II followed by 5-minute sonication in ice-cold water bath.

[0838] Lysates were centrifuged at 4°C, 14000xg for 5 minutes and protein concentration was measured with Pierce 660 nm kit. Volume of lysate containing 500 pg of protein was transferred to a new tube and tube was filled to 100 pL with lysis buffer. Proteins were precipitated in -80°C overnight with 8 volumes of 7:1 LC-MS grade acetone: methanol. Precipitated proteins were centrifuged at 4°C, 14000xg for 5 minutes and supernatant was discarded. Protein pellet was washed with 250 pL of ice-cold methanol, vortexed for 1 min and centrifuged 4°C, 14000xg for 2 minutes, three times. Protein pellet was resuspended in 20 pL of 7M urea for protein denaturation.

[0839] 7M urea was added to 20 pL serum or surrogate matrix for protein denaturation.

[0840] All samples were spiked with 100 ng / mL of stable isotope-labeled standard peptides for all three proteins. Denatured proteins from serum and posterior eye cup were reduced with DTT, alkylated with IAA and digested into peptides with try psin. Solid phase mixed cation exchange extraction was applied to all samples. Peptides were dried under nitrogen and reconstituted in 40 pL mobile phase A (0.1% formic acid in water).

[0841] The CFH peptide targeted was WSSPPQCEGLPCK (SEQ ID NO: 8203); the CFHR2 peptide targeted was TGDIVEFDCK (SEQ ID NO: 8204); the CFHR5 peptide targeted was ENYLLPEAK (SEQ ID NO: 8205). Endogenous and standard / QC peptide peak areas were quantified relative to the internal standard peak. 10 pL of reconstituted peptides were eluted at 36°C over a 20-minute gradient consisting of an increase from 5% mobile phase B (0.1% formic acid in acetonitrile) to 36% mobile phase over 12 minutes, followed by a 3 -minute column wash at 90% mobile phase B and 5-minute column equilibration at 5% mobile phase B. The column used was XSelect Premier Peptide CSH C18 column (130, 2.5mm, 2.1 x 100 mm) [Waters, cat no. 186009905], Peptide were analyzed on a Sciex QQQ 7500 mass spectrometer. Targeted peptide transitions are listed in Table. The “Cam” in SEQ ID NOs: 8206 and 8207 is a carbamidomethylated cysteine represented by the following cysteine modification:

[0842]

[0843] Table 37: Peptide Characteristics

[0844]

[0845] Abbreviations: CE=collision energy; CXP=collision cell exit potential; EP=entrance potential;

[0846] ID=identification.

[0847] Administration of two doses of AD-2288789 to NHPs, on day 1 and day 30, resulted in potent pharmacologic reduction of CFHR2 and CFHR5 circulating protein, with maximal reductions of up to 90% relative to predose (FIG. 14A and FIG. 14B). Posterior eye cup protein levels of CFHR2 and CFHR5 were also reduced at the end of the study at Day 63, with mean maximal reduction of 54% (46% remaining) and 68% (32% remaining), respectively (FIG. 16). No change was observed in circulating or ocular CFH levels (FIG. 16 and FIG. 15). No inhibition of the complement alternative pathway or complement classical pathway was observed (FIG. 17A and FIG. 17B).

[0848] CFHR Sequences

[0849] SEQ ID NO: 1

[0850] > NM 002113. 3 Homo sapiens complement factor H related 1 ( CFHR1 ), transcript variant 1, mRNA CAGTTAGTACACTGAAATTCAAAGTCATGCTCATAACTGTTAATGAAAGCAGATTCAAAGCAACACCACCACCACTG AAGTATTTTTAGTTATATAAGATTGGAACTACCAAGCATGTGGCTCCTGGTCAGTGTAATTCTAATCTCACGGATAT CCTCTGTTGGGGGAGAAGCAACATTTTGTGATTTTCCAAAAATAAACCATGGAATTCTATATGATGAAGAAAAATAT AAGCCATTTTCCCAGGTTCCTACAGGGGAAGTTTTCTATTACTCCTGTGAATATAATTTTGTGTCTCCTTCAAAATC ATTTTGGACTCGCATAACATGCACAGAAGAAGGATGGTCACCAACACCAAAGTGTCTCAGACTGTGTTTCTTTCCTT TTGTGGAAAATGGTCATTCTGAATCTTCAGGACAAACACATCTGGAAGGTGATACTGTGCAAATTATTTGCAACACA GGATACAGACTTCAAAACAATGAGAACAACATTTCATGTGTAGAACGGGGCTGGTCCACCCCTCCCAAATGCAGGTC CACTGACACTTCCTGTGTGAATCCGCCCACAGTACAAAATGCTCATATACTGTCGAGACAGATGAGTAAATATCCAT CTGGTGAGAGAGTACGTTATGAATGTAGGAGCCCTTATGAAATGTTTGGGGATGAAGAAGTGATGTGTTTAAATGGA AACTGGACAGAACCACCTCAATGCAAAGATTCTACGGGAAAATGTGGGCCCCCTCCACCTATTGACAATGGGGACAT TACTTCATTCCCGTTGTCAGTATATGCTCCAGCTTCATCAGTTGAGTACCAATGCCAGAACTTGTATCAACTTGAGG GTAACAAGCGAATAACATGTAGAAATGGACAATGGTCAGAACCACCAAAATGCTTACATCCGTGTGTAATATCCCGA GAAATTATGGAAAATTATAACATAGCATTAAGGTGGACAGCCAAACAGAAGCTTTATTTGAGAACAGGTGAATCAGC TGAATTTGTGTGTAAACGGGGATATCGTCTTTCATCACGTTCTCACACATTGCGAACAACATGTTGGGATGGGAAAC TGGAGTATCCAACTTGTGCAAAAAGATAGAATCAATCATAAAATGCACACCTTTATTCAGAACTTTAGTATTAAATC AGTTCTTAATTTCATTTTTAAGTATTGTTTTACTCCTTTTTATTCATACGTAAAATTTTGGATTAATTTGTGAAAAT GTAATTATAAGCTGAGACCGGTGGCTCTCTTCTTAAAAGCACCATATTAAAACTTGGAAAACTAA SEQ ID NO: 2 Reverse complement of SEQ ID NO: 1 TTAGTTTTCCAAGTTTTAATATGGTGCTTTTAAGAAGAGAGCCACCGGTCTCAGCTTATAATTACATTTTCACAAAT T AAT C C AAAAT TTTACGTAT GAAT AAAAAG GAGT AAAC AAT AC T T AAAAAT GAAAT T AAGAAC T GAT T T AAT AC TA AAGTTCTGAATAAAGGTGTGCATTTTATGATTGATTCTATCTTTTTGCACAAGTTGGATACTCCAGTTTCCCATCCC AACATGTTGTTCGCAATGTGTGAGAACGTGATGAAAGACGATATCCCCGTTTACACACAAATTCAGCTGATTCACCT GTTCTCAAATAAAGCTTCTGTTTGGCTGTCCACCTTAATGCTATGTTATAATTTTCCATAATTTCTCGGGATATTAC ACACGGATGTAAGCATTTTGGTGGTTCTGACCATTGTCCATTTCTACATGTTATTCGCTTGTTACCCTCAAGTTGAT ACAAGTTCTGGCATTGGTACTCAACTGATGAAGCTGGAGCATATACTGACAACGGGAATGAAGTAATGTCCCCATTG TCAATAGGTGGAGGGGGCCCACATTTTCCCGTAGAATCTTTGCATTGAGGTGGTTCTGTCCAGTTTCCATTTAAACA CATCACTTCTTCATCCCCAAACATTTCATAAGGGCTCCTACATTCATAACGTACTCTCTCACCAGATGGATATTTAC TCATCTGTCTCGACAGTATATGAGCATTTTGTACTGTGGGCGGATTCACACAGGAAGTGTCAGTGGACCTGCATTTG GGAGGGGTGGACCAGCCCCGTTCTACACATGAAATGTTGTTCTCATTGTTTTGAAGTCTGTATCCTGTGTTGCAAAT AAT TT GCACAGT AT CAC CT T C CAGAT GTGTTTGTCCT GAAGAT T CAGAAT GAC CAT T TT C CACAAAAGGAAAGAAAC ACAGTCTGAGACACTTTGGTGTTGGTGACCATCCTTCTTCTGTGCATGTTATGCGAGTCCAAAATGATTTTGAAGGA GACACAAAATTATATTCACAGGAGTAATAGAAAACTTCCCCTGTAGGAACCTGGGAAAATGGCTTATATTTTTCTTC ATCATATAGAATTCCATGGTTTATTTTTGGAAAATCACAAAATGTTGCTTCTCCCCCAACAGAGGATATCCGTGAGA TTAGAATTACACTGACCAGGAGCCACATGCTTGGTAGTTCCAATCTTATATAACTAAAAATACTTCAGTGGTGGTGG TGTTGCTTTGAATCTGCTTTCATTAACAGTTATGAGCATGACTTTGAATTTCAGTGTACTAACTG SEQ ID NO: 3

[0851] > NM 005666. 4 Homo sapiens complement factor H related 2 ( CFHR2 ), transcript variant 1, mRNA ACCACAAAGGACTTTACTAAACTAGCTTCCAGTTAGTACACTGAAATTCAAAGTCATGCTCATAACTGTTAATGAAA GCAGATTCAAAGCAACACCACCACCACTGAAGTATTTTTAGTTATATAAGATTGGAACTACCAAGCATGTGGCTCCT GGTCAGTGTAATTCTAATCTCACGGATATCCTCTGTTGGGGGAGAAGCAATGTTCTGTGATTTTCCAAAAATAAACC ATGGAATTCTATATGATGAAGAAAAATATAAGCCATTTTCCCAAGTTCCTACAGGGGAAGTTTTCTATTACTCCTGT GAATATAATTTTGTGTCTCCTTCAAAATCCTTTTGGACTCGCATAACGTGCGCAGAAGAAGGATGGTCACCAACACC AAAGTGTCTCAGACTGTGTTTCTTTCCTTTTGTGGAAAATGGTCATTCTGAATCTTCAGGACAAACACATCTGGAAG GT GAT ACT GT AC AAT T AT TT GCAACACAGGAT ACAGACT T CAAAAC AT GAGAACAACAT T T CAT GT GT AGAAC GG GGCTGGTCCACTCCTCCCAAATGCAGGTCCACTATTTCTGCAGAAAAATGTGGGCCCCCTCCACCTATTGACAATGG AGACATTACTTCATTCCTGTTGTCAGTATATGCTCCAGGTTCATCAGTTGAGTACCAGTGCCAGAACTTGTATCAAC TTGAGGGTAACAATCAAATAACATGTAGAAACGGACAATGGTCAGAACCACCAAAATGCTTAGATCCATGTGTAATA TCACAAGAAATTATGGAAAAATATAACATAAAATTAAAGTGGACAAACCAACAAAAGCTTTATTCAAGAACAGGTGA CATAGTTGAATTTGTTTGTAAATCTGGATATCATCCAACAAAATCTCATTCATTTCGAGCAATGTGTCAGAATGGGA AACTGGTATATCCCAGTTGTGAAGAAAAATAGAATCAATGGCATTACTATTAGTAAAATGCACACCTTTTTCTGAAT TTACTATTATATTTGTTTTCAATTTCATTTTTCAAGTACTGTTTTACTCATTTTTATTCATAAATAAAGTTTTGTGT TGATTTGTGAAAATGCAATTACAATCTGAGATGTGTCACAATGGTGAGGACTATCTTCACCAAATCTAAGTAACAAC CTAGGAATTGTCTTTTTTTTTCTTTTTAAAAAAATTGACAATAACTGTATATATTCATGGAGTACATAGTAATGTTT CCATATATATAATGTATAATGGTCAGTTAGGGTAATTAGTATATCCATTATCTCAAACATTTTTCATTTCTTTGGGT TAGGAGCATTAAATATTCTCCTTCCAGCTATTTGGTACTTCATAGTATATTACTGGTAACTGAAGGAATTATATCTA GACGTTACCCCAGGTATCTTGAAATGTCAATTCCTAACAGTCACAGCCTGGGAGCTCATGTTTGCCTTCTTTCAGAG CT T GT AAC AT GT AT AT C CACATAAAT AAT CAAAA SEQ ID NO: 4 Reverse complement of SEQ ID NO: 3 TTTTGATTATTTATGTGGATATACATAGTTACAAGCTCTGAAAGAAGGCAAACATGAGCTCCCAGGCTGTGACTGTT AGGAATTGACATTTCAAGATACCTGGGGTAACGTCTAGATATAATTCCTTCAGTTACCAGTAATATACTATGAAGTA CCAAATAGCTGGAAGGAGAATATTTAATGCTCCTAACCCAAAGAAATGAAAAATGTTTGAGATAATGGATATACTAA TTACCCTAACTGACCATTATACATTATATATATGGAAACATTACTATGTACTCCATGAATATATACAGTTATTGTCA ATTTTTTTAAAAAGAAAAAAAAAGACAATTCCTAGGTTGTTACTTAGATTTGGTGAAGATAGTCCTCACCATTGTGA CACAT CT CAGAT T GT AAT T GCATT T T CACAAAT CAACACAAAACT T TAT T TAT GAA AAAAAT GAGT AAAACAGT AC T T GAAAAAT GAAAT T GAAAACAAAT AT AAT AGT AAAT T CAGAAAAAGGT GT GCATT T TACT AAT AGT AAT GC CAT T G ATTCTATTTTTCTTCACAACTGGGATATACCAGTTTCCCATTCTGACACATTGCTCGAAATGAATGAGATTTTGTTG GATGATATCCAGATTTACAAACAAATTCAACTATGTCACCTGTTCTTGAATAAAGCTTTTGTTGGTTTGTCCACTTT AATTTTATGTTATATTTTTCCATAATTTCTTGTGATATTACACATGGATCTAAGCATTTTGGTGGTTCTGACCATTG TCCGTTTCTACATGTTATTTGATTGTTACCCTCAAGTTGATACAAGTTCTGGCACTGGTACTCAACTGATGAACCTG GAGCATATACTGACAACAGGAATGAAGTAATGTCTCCATTGTCAATAGGTGGAGGGGGCCCACATTTTTCTGCAGAA ATAGTGGACCTGCATTTGGGAGGAGTGGACCAGCCCCGTTCTACACATGAAATGTTGTTCTCATTGTTTTGAAGTCT GTATCCTGTGTTGCAAATAATTTGTACAGTATCACCTTCCAGATGTGTTTGTCCTGAAGATTCAGAATGACCATTTT CCACAAAAGGAAAGAAACACAGTCTGAGACACTTTGGTGTTGGTGACCATCCTTCTTCTGCGCACGTTATGCGAGTC CAAAAGGATTTTGAAGGAGACACAAAATTATATTCACAGGAGTAATAGAAAACTTCCCCTGTAGGAACTTGGGAAAA TGGCTTATATTTTTCTTCATCATATAGAATTCCATGGTTTATTTTTGGAAAATCACAGAACATTGCTTCTCCCCCAA CAGAGGATATCCGTGAGATTAGAATTACACTGACCAGGAGCCACATGCTTGGTAGTTCCAATCTTATATAACTAAAA ATACTTCAGTGGTGGTGGTGTTGCTTTGAATCTGCTTTCATTAACAGTTATGAGCATGACTTTGAATTTCAGTGTAC TAACTGGAAGCTAGTTTAGTAAAGTCCTTTGTGGT SEQ ID NO: 5

[0852] > NM_021023. 6 Homo sapiens complement factor H related 3 (CFHR3), transcript variant 1, mRNA AGTGCAACTGAAACTTTTGTATTAGCATACTACTGAGAATATCTAACATGTTGTTACTAATCAATGTCATTCTGACC TTGTGGGTTTCCTGTGCTAATGGACAAGTGAAACCTTGTGATTTTCCAGACATTAAACATGGAGGTCTATTTCATGA GAATATGCGTAGACCATACTTTCCAGTAGCTGTAGGAAAATATTACTCCTATTACTGTGATGAACATTTTGAGACTC CTTCAGGAAGTTACTGGGATTACATTCATTGCACACAAAATGGGTGGTCACCAGCAGTACCATGTCTCAGAAAATGT TATTTTCCTTATTTGGAAAATGGATATAATCAAAATTATGGAAGAAAGTTTGTACAGGGTAACTCTACAGAAGTTGC CTGCCATCCTGGCTACGGTCTTCCAAAAGCGCAGACCACAGTTACATGTACGGAGAAAGGCTGGTCTCCTACTCCCA GATGCATCCGTGTCAGAACATGCTCAAAATCAGATATAGAAATTGAAAATGGATTCATTTCCGAATCTTCCTCTATT TATATTTTAAATAAAGAAATACAATATAAATGTAAACCAGGATATGCAACAGCAGATGGAAATTCTTCAGGATCAAT TACATGTTTGCAAAATGGATGGTCAGCACAACCAATTTGCATTAATTCTTCAGAAAAGTGTGGGCCTCCTCCACCTA TTAGCAATGGTGATACCACCTCCTTTCTACTAAAAGTGTATGTGCCACAGTCAAGAGTCGAGTACCAATGCCAGCCC TACTATGAACTTCAGGGTTCTAATTATGTAACATGTAGTAATGGAGAGTGGTCGGAACCACCAAGATGCATACATCC ATGTATAATAACTGAAGAAAACATGAATAAAAATAACATAAAGTTAAAAGGAAGAAGTGACAGAAAATATTATGCAA AAACAGGGGATACCATTGAATTTATGTGTAAATTGGGATATAATGCAAATACATCAATTCTATCATTTCAAGCAGTG TGTCGGGAAGGGATAGTGGAATACCCCAGATGCGAATAAGGCAGCATTGTTACCCTAAATGTATGTCCAACTTCCAC TTTTCCACTTCTCACTCTTATGGTCTCAAAGCTTGCAAAGATAGCTTCTGATATTGTTGTAATTTCTACTTTATTTC AAAGAAAAT T AAT AT AAT AGT T T C AAT T T G C AAC T T AAT AT AT T C T C AAAAAT AT AT T AAAAC AAAC T AAAT T AT T G CTTATGCTTGTACTAAAATAATAAAAACTACTCTTATATTGGACTTCTTATCAATGAATTAGTAAGTATAGAGACAG ACAGCTGAATGGCTTTCTGCATATTGTATAGTATACCTAGACATAGAAACAAAATGACTTTAGATTTTATTTGGGGA AGT AAT AAT AC CAT AAAAT T AGAT AT T AAAAT T GT AAGT GAAGAT AAACACACT AT AGT AT T C C CT TAT T GT AGC CA TGGTCCTCTAGATGCAGTTAACCAAATAGGGTCATTTTTATTAAAAGTAGTGTTTCCTGGCAAACACTGACATTACA TCATTATCATGATTTAAAGGAAATAGTACTAGAGAAGGTGAATTATTATCATTTTCCTGTGAAAAAAGAAAAGAGGT TTTGCTAACCCTTTCAGAGCATTGGGAACACAGCCAGAAGTGCATTAAATGTATATATTAACTTGGGCAATGTTGAC ACTTTAGGATGCTGAAGCCAGGTGCAGTGGCACACGCCTGTAATCCTAGCACTTTGAGAGGCCAAGCTGGCAATCAT CAGAGGTCAAAAGTTCAAGACCAGCCTGTTCAACACGGTGAAACCCTGTCTCTACTAAAAATAGAAAAACTAGCTCG GCATGATGGCGTGCACCTGTAGTCCCAGCTACTCAGGAGGCTGAGGTGGGAGAATCACTTTAACCAGTGGGGCAGAG GTTGAACTGAGCCAAGATAGTGCCACTGCACTCCAGCCTGGGCAATAGAGTGAGACTCTGTCTTAAAAATAAATAAA TAGGATGCTGAAAATTCCTATTTAAGGAAATAATTCTTTTTCTGATTTATTTAAGGCTACATTTGTATTTTCTTAAT ACAAATATTTTGAAAGTTTCTTCATATATGGTTTTTTGCATTTCTTATTAAGTTTTGCTTCAGATTTTTTTTTGTCT TTTCTCCTGTTAATTGCCTTCACTCTCTTTCTGTTCTGTACTTTTCTTTGTATATAAGGATTTTTTGAAAAGATTGT ATATCCCTGTTAACAAATTGAAATCTCTATTCACTTTAATAGATTTTTACCCCCAGTTAGCATATGGTTAGTGAGAA GTTGCAGGGTAAGAAGAAAACAATGTTCCCTTTCCCAACACTTTTCCTGATTATAGAGAAAAAAGCATGAACTTGTA TAATGATCTAGTCCTGTACAGAATGAGAAATATTAATTGCTAGACTGAGAATGTTTTGGTGGCTAAAGCTAGGAATA ACTTTTTAAGACTGAAGAATGATATAAGCTATCAAATCTAACTCAGTTTTCAAATAACAGGTTTGCAGAGACTGGAG AATAAAAAGTAAAAAATTGTTTTATTAATTCCAGTGACTAATTCTACTTCATCAACATACATCATAAATAAAATTTC AAAAATAATTGCTGATATGGTTTGGCTGTGTCCCACCCAATTTTCACCTTGAATTATATAATCACCATGCATCAAAG GTAGGGCCAGGTGGAGATAATGGAATCATGGGAGCAGTTTCCCCATACCCCACTCATGGTAGTAAATACATCTCATG AGATCTAATGGTTTTATAAATGAAAGTTCCCCTGGACAAGTTCTCTTGCCTGCCACCATGTAAGATGTACCTTTGCT ACTCATTCACCTTCTGTCATGATGGTGAGGCCTTCCCAGCAATGTGGAACTGTGAGTCCATTAAACCTCTTTCCTTT ATAAATTA SEQ ID NO: 6 Reverse complement of SEQ ID NO: 5 TAATTTATAAAGGAAAGAGGTTTAATGGACTCACAGTTCCACATTGCTGGGAAGGCCTCACCATCATGACAGAAGGT GAATGAGTAGCAAAGGTACATCTTACATGGTGGCAGGCAAGAGAACTTGTCCAGGGGAACTTTCATTTATAAAACCA TTAGATCTCATGAGATGTATTTACTACCATGAGTGGGGTATGGGGAAACTGCTCCCATGATTCCATTATCTCCACCT GGCCCTACCTTTGATGCATGGTGATTATATAATTCAAGGTGAAAATTGGGTGGGACACAGCCAAACCATATCAGCAA TTATTTTTGAAATTTTATTTATGATGTATGTTGATGAAGTAGAATTAGTCACTGGAATTAATAAAACAATTTTTTAC TTTTTATTCTCCAGTCTCTGCAAACCTGTTATTTGAAAACTGAGTTAGATTTGATAGCTTATATCATTCTTCAGTCT TAAAAAGTTATTCCTAGCTTTAGCCACCAAAACATTCTCAGTCTAGCAATTAATATTTCTCATTCTGTACAGGACTA GATCATTATACAAGTTCATGCTTTTTTCTCTATAATCAGGAAAAGTGTTGGGAAAGGGAACATTGTTTTCTTCTTAC CCTGCAACTTCTCACTAACCATATGCTAACTGGGGGTAAAAATCTATTAAAGTGAATAGAGATTTCAATTTGTTAAC AGGGATATACAATCTTTTCAAAAAATCCTTATATACAAAGAAAAGTACAGAACAGAAAGAGAGTGAAGGCAATTAAC AGGAGAAAAGACAAAAAAAAAT CT GAAGCAAAACTTAATAAGAAAT GCAAAAAACCATATAT GAAGAAACTTT CAAA ATATTTGTATTAAGAAAATACAAATGTAGCCTTAAATAAATCAGAAAAAGAATTATTTCCTTAAATAGGAATTTTCA GCATCCTATTTATTTATTTTTAAGACAGAGTCTCACTCTATTGCCCAGGCTGGAGTGCAGTGGCACTATCTTGGCTC AGTTCAACCTCTGCCCCACTGGTTAAAGTGATTCTCCCACCTCAGCCTCCTGAGTAGCTGGGACTACAGGTGCACGC CATCATGCCGAGCTAGTTTTTCTATTTTTAGTAGAGACAGGGTTTCACCGTGTTGAACAGGCTGGTCTTGAACTTTT GACCTCTGATGATTGCCAGCTTGGCCTCTCAAAGTGCTAGGATTACAGGCGTGTGCCACTGCACCTGGCTTCAGCAT CCTAAAGTGTCAACATTGCCCAAGTTAATATATACATTTAATGCACTTCTGGCTGTGTTCCCAATGCTCTGAAAGGG TTAGCAAAACCTCTTTTCTTTTTTCACAGGAAAATGATAATAATTCACCTTCTCTAGTACTATTTCCTTTAAATCAT GATAATGATGTAATGTCAGTGTTTGCCAGGAAACACTACTTTTAATAAAAATGACCCTATTTGGTTAACTGCATCTA GAGGACCATGGCTACAATAAGGGAATACTATAGTGTGTTTATCTTCACTTACAATTTTAATATCTAATTTTATGGTA TTATTACTTCCCCAAATAAAATCTAAAGTCATTTTGTTTCTATGTCTAGGTATACTATACAATATGCAGAAAGCCAT TCAGCTGTCTGTCTCTATACTTACTAATTCATTGATAAGAAGTCCAATATAAGAGTAGTTTTTATTATTTTAGTACA AGCATAAGCAATAATTTAGTTTGTTTTAATATATTTTTGAGAATATATTAAGTTGCAAATTGAAACTATTATATTAA TTTTCTTTGAAATAAAGTAGAAATTACAACAATATCAGAAGCTATCTTTGCAAGCTTTGAGACCATAAGAGTGAGAA GTGGAAAAGTGGAAGTTGGACATACATTTAGGGTAACAATGCTGCCTTATTCGCATCTGGGGTATTCCACTATCCCT TCCCGACACACTGCTTGAAATGATAGAATTGATGTATTTGCATTATATCCCAATTTACACATAAATTCAATGGTATC CCCTGTTTTTGCATAATATTTTCTGTCACTTCTTCCTTTTAACTTTATGTTATTTTTATTCATGTTTTCTTCAGTTA TTATACATGGATGTATGCATCTTGGTGGTTCCGACCACTCTCCATTACTACATGTTACATAATTAGAACCCTGAAGT TCATAGTAGGGCTGGCATTGGTACTCGACTCTTGACTGTGGCACATACACTTTTAGTAGAAAGGAGGTGGTATCACC ATTGCTAATAGGTGGAGGAGGCCCACACTTTTCTGAAGAATTAATGCAAATTGGTTGTGCTGACCATCCATTTTGCA AACATGTAATTGATCCTGAAGAATTTCCATCTGCTGTTGCATATCCTGGTTTACATTTATATTGTATTTCTTTATTT AAAATATAAATAGAGGAAGATTCGGAAATGAATCCATTTTCAATTTCTATATCTGATTTTGAGCATGTTCTGACACG GATGCATCTGGGAGTAGGAGACCAGCCTTTCTCCGTACATGTAACTGTGGTCTGCGCTTTTGGAAGACCGTAGCCAG GATGGCAGGCAACTTCTGTAGAGTTACCCTGTACAAACTTTCTTCCATAATTTTGATTATATCCATTTTCCAAATAA GGAAAATAACATTTTCTGAGACATGGTACTGCTGGTGACCACCCATTTTGTGTGCAATGAATGTAATCCCAGTAACT TCCTGAAGGAGTCTCAAAATGTTCATCACAGTAATAGGAGTAATATTTTCCTACAGCTACTGGAAAGTATGGTCTAC GCATATTCTCATGAAATAGACCTCCATGTTTAATGTCTGGAAAATCACAAGGTTTCACTTGTCCATTAGCACAGGAA ACCCACAAGGTCAGAATGACATTGATTAGTAACAACATGTTAGATATTCTCAGTAGTATGCTAATACAAAAGTTTCA GTTGCACT SEQ ID NO: 7

[0853] > NM 001201550.3 Homo sapiens complement factor H related 4 (CFHR4 ), transcript variant 1, mRNA AAATTCAGAATCACACTTGGTAACTAATAATGAAAGATTTCAAACCCCAAACAGTGCAACTGAAACTTTTGCATTAC TATACTACTGAGAATATCTAACATGTTGTTACTAATCAATGTCATTCTGACCTTGTGGGTTTCCTGTGCTAATGGAC AAGAAGTGAAACCTTGTGATTTTCCAGAAATTCAACATGGAGGTCTATATTATAAGAGTTTGCGTAGACTATACTTT CCAGCAGCTGCAGGACAATCTTATTCCTATTACTGTGATCAAAATTTTGTGACTCCTTCAGGAAGTTACTGGGATTA CATTCATTGCACACAAGATGGTTGGTCACCAACGGTCCCATGCCTCAGAACATGCTCAAAATCAGATGTAGAAATTG AAAATGGATTCATTTCTGAATCTTCCTCTATTTATATTTTAAATGAAGAAACACAATATAATTGTAAACCAGGATAT GCAACAGCAGAGGGAAATTCTTCAGGATCAATTACATGTTTGCAAAATGGATGGTCAACACAACCAATTTGCATTAA ATTTTGTGATATGCCTGTTTTTGAGAATTCCAGAGCCAAGAGTAATGGCATGTGGTTTAAGCTCCATGACACATTGG ACTATGAATGCTATGATGGATATGAAAGCAGTTATGGAAACACCACAGATTCCATAGTGTGTGGTGAAGATGGCTGG TCCCATTTGCCAACATGCTATAATTCTTCAGAAAACTGTGGGCCTCCTCCACCTATTAGCAATGGAGATACCACGTC CTTCCCGCAAAAAGTGTATCTGCCATGGTCAAGAGTCGAGTACCAGTGCCAGTCCTACTATGAACTTCAGGGTTCTA AATATGTAACATGTAGTAATGGAGACTGGTCAGAACCACCAAGATGCATATCAATGAAACCTTGTGAGTTTCCAGAA ATTCAACATGGACATCTATATTATGAGAATACGCGTAGACCATACTTTCCAGTAGCTACAGGACAATCTTACTCCTA TTACTGTGACCAAAATTTTGTGACTCCTTCAGGAAGTTACTGGGATTACATTCACTGCACACAAGATGGGTGGTTGC CAACAGTCCCATGCCTCAGAACATGCTCAAAATCAGATATAGAAATTGAAAATGGATTCATTTCTGAATCTTCCTCT ATTTATATTTTAAATAAAGAAATACAATATAAATGTAAACCAGGATATGCAACAGCAGATGGAAATTCTTCAGGTTC AATTACATGTTTGCAAAATGGATGGTCAGCACAACCAATTTGCATTAAATTTTGTGATATGCCTGTTTTTGAGAATT CCAGAGCCAAGAGTAATGGCATGCGGTTTAAGCTCCATGACACATTGGACTACGAATGCTACGATGGATATGAAATC AGTTATGGAAACACCACAGGTTCCATAGTGTGTGGTGAAGATGGGTGGTCCCATTTCCCAACATGTTATAATTCTTC AGAAAAGTGTGGGCCTCCTCCACCTATTAGCAATGGTGATACCACCTCCTTTCTACTAAAAGTGTATGTGCCACAGT CAAGAGTCGAGTACCAATGCCAGTCCTACTATGAACTTCAGGGTTCTAATTATGTAACATGTAGTAATGGAGAGTGG TCGGAACCACCAAGATGCATACATCCATGTATAATAACTGAAGAAAACATGAATAAAAATAACATACAGTTAAAAGG AAAAAGTGACATAAAATATTATGCAAAAACAGGGGATACCATTGAATTTATGTGTAAATTGGGATATAATGCGAATA CATCAGTTCTATCATTTCAAGCAGTGTGTAGGGAAGGCATAGTGGAATACCCCAGATGCGAATAAGGCAGCATTGTT ACCCTAAATGTATGTCCAACTTCCACTTCTCACTCTTATGGTCTCAAAGCTTGCAAAGATAGCTTCTGATATTGTTG TAATTTCTACTTTATTTCAAAGAAAATTAATATAATAGTTTCAATTTGCAACTTAATATGTTCTCAAAAATATGTTA AAACAAACTAAATTATTGCTTATGCTTGTACTAAAATAATAAAAACTACCCTTATATTGGA SEQ ID NO: 8 Reverse complement of SEQ ID NO: 7 TCCAATATAAGGGTAGTTTTTATTATTTTAGTACAAGCATAAGCAATAATTTAGTTTGTTTTAACATATTTTTGAGA ACATATTAAGTTGCAAATTGAAACTATTATATTAATTTTCTTTGAAATAAAGTAGAAATTACAACAATATCAGAAGC TATCTTTGCAAGCTTTGAGACCATAAGAGTGAGAAGTGGAAGTTGGACATACATTTAGGGTAACAATGCTGCCTTAT TCGCATCTGGGGTATTCCACTATGCCTTCCCTACACACTGCTTGAAATGATAGAACTGATGTATTCGCATTATATCC CAATTTACACATAAATTCAATGGTATCCCCTGTTTTTGCATAATATTTTATGTCACTTTTTCCTTTTAACTGTATGT TATTTTTATTCATGTTTTCTTCAGTTATTATACATGGATGTATGCATCTTGGTGGTTCCGACCACTCTCCATTACTA CATGTTACATAATTAGAACCCTGAAGTTCATAGTAGGACTGGCATTGGTACTCGACTCTTGACTGTGGCACATACAC TTTTAGTAGAAAGGAGGTGGTATCACCATTGCTAATAGGTGGAGGAGGCCCACACTTTTCTGAAGAATTATAACATG TTGGGAAATGGGACCACCCATCTTCACCACACACTATGGAACCTGTGGTGTTTCCATAACTGATTTCATATCCATCG TAGCATTCGTAGTCCAATGTGTCATGGAGCTTAAACCGCATGCCATTACTCTTGGCTCTGGAATTCTCAAAAACAGG CATATCACAAAATTTAATGCAAATTGGTTGTGCTGACCATCCATTTTGCAAACATGTAATTGAACCTGAAGAATTTC CATCTGCTGTTGCATATCCTGGTTTACATTTATATTGTATTTCTTTATTTAAAATATAAATAGAGGAAGATTCAGAA ATGAATCCATTTTCAATTTCTATATCTGATTTTGAGCATGTTCTGAGGCATGGGACTGTTGGCAACCACCCATCTTG TGTGCAGTGAATGTAATCCCAGTAACTTCCTGAAGGAGTCACAAAATTTTGGTCACAGTAATAGGAGTAAGATTGTC CTGTAGCTACTGGAAAGTATGGTCTACGCGTATTCTCATAATATAGATGTCCATGTTGAATTTCTGGAAACTCACAA GGTTTCATTGATATGCATCTTGGTGGTTCTGACCAGTCTCCATTACTACATGTTACATATTTAGAACCCTGAAGTTC ATAGTAGGACTGGCACTGGTACTCGACTCTTGACCATGGCAGATACACTTTTTGCGGGAAGGACGTGGTATCTCCAT TGCTAATAGGTGGAGGAGGCCCACAGTTTTCTGAAGAATTATAGCATGTTGGCAAATGGGACCAGCCATCTTCACCA CACACTATGGAATCTGTGGTGTTTCCATAACTGCTTTCATATCCATCATAGCATTCATAGTCCAATGTGTCATGGAG CTTAAACCACATGCCATTACTCTTGGCTCTGGAATTCTCAAAAACAGGCATATCACAAAATTTAATGCAAATTGGTT GTGTTGACCATCCATTTTGCAAACATGTAATTGATCCTGAAGAATTTCCCTCTGCTGTTGCATATCCTGGTTTACAA TTATATTGTGTTTCTTCATTTAAAATATAAATAGAGGAAGATTCAGAAATGAATCCATTTTCAATTTCTACATCTGA TTTTGAGCATGTTCTGAGGCATGGGACCGTTGGTGACCAACCATCTTGTGTGCAATGAATGTAATCCCAGTAACTTC CTGAAGGAGTCACAAAATTTTGATCACAGTAATAGGAATAAGATTGTCCTGCAGCTGCTGGAAAGTATAGTCTACGC AAACTCTTATAATATAGACCTCCATGTTGAATTTCTGGAAAATCACAAGGTTTCACTTCTTGTCCATTAGCACAGGA AACCCACAAGGTCAGAATGACATTGATTAGTAACAACATGTTAGATATTCTCAGTAGT...

Claims

We Claim:

1. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of a complement factor H-related (CFHR) gene in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding CFHR which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 3-19.

2. Tire dsRNA agent of claim 1, wherein the CFHR is CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5.

3. Tire dsRNA agent of claim 1, wherein the CFHR is CFHR1, CFHR2, and CFHR5.

4. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement factor H-related 1 (CFHR1) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding CFHR1 which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 3-19.

5. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement factor H-related 5 (CFHR5) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding CFHR5 which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 3-19.

6. Tire dsRNA agent of any one of claims 1-5, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the sense sequences listed in any one of Tables 3-19.

7. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement factor H-related 1 and complement factor H-related 5 in a cell, wherein the dsRNA agent comprises:(a) a sense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from tire nucleotide sequence of 5’-UCCUGUGAAUAUAAUUUUGUA-3' (SEQ ID NO: 6065); and(b) ail antisense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’-UACAAAAUUAUAUUCACAGGAGU-3‘ (SEQ ID NO: 6340).

8. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement factor H-related 1 and complement factor H-related 5 in a cell, wherein the dsRNA agent comprises:(a) a sense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5 -UGUGAAUAUAAUUUUGUGUCA-3’ (SEQ ID NO: 8083); and(b) an antisense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’-UGACACAAAAUUAUAUUCACAGG-3’ (SEQ ID NO: 8084).

9. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement factor H-related 1 and complement factor H-related 5 in a cell, wherein the dsRNA agent comprises:(a) a sense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’-ACUCCUGUGAAUAUAAUUUUA-3' (SEQ ID NO: 6066); and(b) an antisense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from tire nucleotide sequence of 5 -UAAAAUTAUAUTCACAGGAGUAA-3’ (SEQ ID NO: 6341).

10. The dsRNA agent of claim any one of claims 1-9, wherein the dsRNA agent comprises at least one modified nucleotide.

11. The dsRNA agent of any one of claims 1-9, wherein substantially all of the nucleotides of the sense strand comprise a modification.

12. Tire dsRNA agent of any one of claims 1-9, wherein substantially all of the nucleotides of the antisense strand comprise a modification.

13. Tire dsRNA agent of any one of claims 1-9, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a modification.

14. The dsRNA agent of any one of claims 1-13, wherein all of the nucleotides of the sense strand comprise a modification.

15. The dsRNA agent of any one of claims 1-13, wherein all of the nucleotides of the antisense strand comprise a modification.

16. The dsRNA agent of any one of claims 1-13, wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification.

17. The dsRNA agent of any one of claims 10-16, wherein the at least one modified nucleotide is selected from the group consisting of a deoxy-nucleotide, a 3’-terminal deoxy-thymine (dT) nucleotide, a 2’-O-methyl modified nucleotide, a 2’-fluoro modified nucleotide, a 2’-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2 ’-O-allyl -modified nucleotide, 2 ’-C-alkyl -modified nucleotide, 2 ’-hydroxyl -modified nucleotide, a 2 ’-methoxy ethyl modified nucleotide, a 2’-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5 ’-phosphate, a nucleotide comprising a 5 '-phosphate mimic, a glycol modified nucleotide, and a 2-O-(N-methylacetamide) modified nucleotide, and combinations thereof.

18. The dsRNA agent of claim 17, wherein the nucleotide modifications are 2’-O-methyl and / or 2 ’-fluoro modifications.

19. The dsRNA agent of any one of claims 1-18, wherein the antisense strand comprises two phosphorothioate intemucleotide linkages at the 5 ’-terminus and two phosphorothioate intemucleotide linkages at the 3 ’-terminus20. Tire dsRNA agent of any one of claims 1-19, wherein the region of complementarity is at least 17 nucleotides in length.

21. Tire dsRNA agent of any one of claims 1-20, wherein the region of complementarity is 19 to 30 nucleotides in length.

22. Tire dsRNA agent of claim 21, wherein the region of complementarity is 19-25 nucleotides in length.

23. The dsRNA agent of claim 22, wherein the region of complementarity is 21 to 23 nucleotides in length.

24. The dsRNA agent of any one of claims 1-23, wherein each of the sense strand and the antisense strand is no more than 30 nucleotides in length.

25. The dsRNA agent of any one of claims 1-24, wherein each of the sense strand and the antisense strand is independently 19-30 nucleotides in length.

26. Tire dsRNA agent of claim 25, wherein each of the sense strand and the antisense strand is independently 19-25 nucleotides in length.

27. Tire dsRNA agent of claim 25, wherein each of the sense strand and the antisense strand is independently 21-23 nucleotides in length.

28. Tire dsRNA agent of any one of claims 1-27, wherein the at least one of the sense strand or the antisense strand comprises a 3’ overhang of at least 1 nucleotide.

29. The dsRNA agent of any one of claims 1-27, wherein the at least one of the sense strand or the antisense strand comprises a 3’ overhang of at least 2 nucleotides.

30. The dsRNA agent of any one of claims 1-29 further comprising a ligand.

31. The dsRNA agent of claim 30, wherein the ligand is conjugated to the 3 ’ end of the sense strand of the dsRNA agent.

32. Tire dsRNA agent of claim 31, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

33. Tire dsRNA agent of claim 32, wherein the sense strand is conjugated to the GalNAc derivative through a monovalent, bivalent or trivalent branched linker at the 3 ’-terminus.

34. Tire dsRNA agent of claim 32 or 33, wherein the ligand is35. The dsRNA agent of claim 34, wherein the dsRNA agent is conjugated to the ligand as shown in the following schematic3'and, wherein X is O or S.

36. The dsRNA agent of claim 35, wherein the X is 0.

37. Tire dsRNA agent of any one of claims 1-36, wherein the dsRNA agent comprises any one of the antisense sequences listed in any one of Tables 3-19.

38. Tire dsRNA agent of any one of claims 1-37, wherein the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of the nucleotide sequences of any one of the agents listed in any one of Tables 3-19.

39. Tire dsRNA agent of any one of claims 1-38, wherein the dsRNA agent is selected from the group consisting of AD-2288789, AD-2443565, AD-2443574, AD-2787983, AD-3002629. AD-3002631, AD-3002632, AD-3002633, AD-3002634, AD-3002635, AD-3002636, AD-3002637. AD-3002638, AD-3002639, AD-2905718, AD-2905719. AD-2905723, and AD-2905726.

40. The dsRNA agent of any one of claims 1-39 wherein the dsRNA agent targets a hotspot region of an mRNA encoding a CFHR.

41. The dsRNA of claim 40, wherein the CFHR is CFHR1 and / or CFHR5.

42. The dsRNA agent of claim 40, wherein the CFHR is CFHR1, CFHR2, and CFHR5.

43. A dsRNA agent that targets a hotspot region of a complement factor H-related (CFHR) mRNA.

44. Tire dsRNA agent of claim 43, wherein the CFHR is CFHR1 and / or CFHR5.

45. Tire dsRNA agent of claim 43, wherein the CFHR is CFHR1, CFHR2, and CFHR5.

46. A cell containing the dsRNA agent of any one of claims 1-45.

47. A vector encoding at least one of the sense strand or the antisense strand of the dsRNA agent of any one of claims 1-45.

48. A pharmaceutical composition for inhibiting expression of a CFHR gene comprising the dsRNA agent of any one of claims 1-45.

49. The pharmaceutical composition of claim 48, wherein the CFHR is CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5.

50. Tire pharmaceutical composition of claim 48, wherein the CFHR is CFHR1, CFHR2, and CFHR5.

51. Tire pharmaceutical composition of any one of claims 48-50, wherein tire dsRNA agent is formulated in an unbuffered solution.

52. Tire pharmacal composition of claim 51, wherein the unbuffered solution is saline or water.

53. The pharmaceutical composition of any one of claims 48-50, wherein the dsRNA agent is formulated with a buffered solution.

54. The pharmaceutical composition of claim 53, wherein the buffered solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.

55. The pharmaceutical composition of claim 54, wherein the buffered solution is phosphate buffered saline (PBS).

56. A method of inhibiting CFHR expression in a cell, the method comprising introducing into the cell the dsRNA agent of any one of claims 1-45, or a pharmaceutical composition of any one of claims 48-55, thereby inhibiting expression of CFHR in the cell.

57. Tire method of claim 56, wherein the CFHR is CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5.

58. Tire method of claim 56, wherein the CFHR is CFHR1, CFHR2, and CFHR5.59 The method of any one of claims 56-58, wherein the cell is within a subject.

60. The method of claim 59, wherein the subject is a human.

61. The method of any one of claims 56-60, wherein the CFHR expression is inhibited by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or to below the level of detection of CFHR1 and / or CFHR5 expression.

62. Tire method of claim 61, wherein the human subject suffers from a CFHR-associated disease, disorder, or condition.

63. Tire method of claim 62, wherein the CFHR-associated disease, disorder, or condition is age-related macular degeneration (AMD).

64. Tire method of claim 62, wherein the CFHR-associated disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), C3 glomerulopathy (C3g), Cypriot C3g, immunoglobulin A nephropathy (IgAN), IgA-associated vasculitis with nephritis (IgAVN), anti-neutrophil cytoplasmic antibody mediated vasculitis (ANCA), immune complex membranoproliferative glomerulonephritis (IC-MPGN).ischemic reperfusion injury, Lupus nephritis, systemic lupus erythematosus (SLE), membranous nephropathy (MN), chronic transplant mediated glomerulopathy, diabetic nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis (AAV), thrombotic microangiopathy (TMA), or focal segmental glomerulosclerosis (FSGS).

65. The method of claim 63 or 64, wherein the subject has a complement factor H (CFH) Y402H polymorphism.

66. A method of inhibiting the expression of CFHR in a subject, the method comprising administering to the subject a therapeutically effective amount of the dsRNA agent of any one of claims 1-45, or a pharmaceutical composition of any one of claims 48-55, thereby inhibiting the expression of CFHR in the subject.

67. A method of treating a subject suffering from a CFHR-associated disease, disorder, or condition, comprising administering to the subject a therapeutically effective amount of the dsRNA agent of any one of claims 1-45, or a pharmaceutical composition of any one of claims 48-55, thereby treating the subject suffering from a CFHR-associated disease, disorder, or condition.

68. A method of preventing at least one symptom in a subject having a disease, disorder or condition that would benefit from reduction in expression of a CFHR gene, comprising administering to the subject a prophylactically effective amount of the dsRNA agent of any one of claims 1-45, or a pharmaceutical composition of any one of claims 48-55. thereby preventing at least one symptom in a subject having a disease, disorder or condition that would benefit from reduction in expression of a CFHR gene.

69. The method of claim 68, wherein the subject is suffering from a CFHR-associated disease, disorder, or condition.

70. Tire method of any one of claims 66-67, or 69, wherein the CFHR-associated disease, disorder, or condition is AMD.

71. Tire method of any one of claims 66-67, or 69, wherein the CFHR-associated disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), C3 glomerulopathy (C3g), Cypriot C3g, immunoglobulin A nephropathy (IgAN), IgA-associated vasculitis with nephritis (IgAVN), anti -neutrophil cytoplasmic antibody mediated vasculitis (ANCA), immune complex membranoproliferative glomerulonephritis (IC-MPGN). ischemic reperfusion injury, Lupus nephritis, systemic lupus erythematosus (SLE), membranous nephropathy (MN), chronic transplant mediated glomerulopathy, diabetic nephropathy,antineutrophil cytoplasmic antibody-associated vasculitis (AAV), thrombotic microangiopathy (TMA), and focal segmental glomerulosclerosis (FSGS).

72. The method of claim 70 or 71, wherein the subject has a complement factor H (CFH) Y402H polymorphism.

73. The method of any one of claims 66-72, wherein the CFHR is CFHR1, CFHR2, CFHR3, CFHR4, and / or CFHR5.

74. Tire method of any one of claims 66-72, wherein the CFHR is CFHR1, CFHR2, and CFHR5.

75. Tire method of any one of claims 59-74, further comprising administering an additional therapeutic to the subject.

76. Tire method of any one of claims 59-75, wherein the dsRNA agent is administered to the subject intravenously, intramuscularly, or subcutaneously.

77. The method of any one of claims 59-76, further comprising determining the level of the CFHR in the subject.

Images