Compositions and methods for the treatment and prevention of preeclampsia and pregnancy associated hypertension

Abstract

Provided herein compositions and methods for the treatment and prevention of preeclampsia or hypertensive disorders of pregnancy. In particular, provided herein are regulators of the Hippo pathway (e.g., TEAD inhibitors; VGLL2 regulators; verteporfin) that find use in the treatment and prevention of preeclampsia or hypertensive disorder of pregnancy.

Description

[0001] UM-43058.601

[0002] COMPOSITIONS AND METHODS FOR THE TREATMENT AND PREVENTION OF

[0003] PREECLAMPSIA AND PREGNANCY ASSOCIATED HYPERTENSION

[0004] The present application claims priority to United States Provisional Patent Application Serial Number 63 / 716,374, filed November 5, 2024, the disclosure of which is herein incorporated by reference in its entirety.

[0005] SEQUENCE LISTING

[0006] The text of the computer readable sequence listing filed herewith, titled “43058- 601_SEQUENCE_LISTING”, created November 5, 2025, having a file size of 4,636 bytes, is hereby incorporated by reference in its entirety.

[0007] FIELD

[0008] Provided herein compositions and methods for the treatment and prevention of preeclampsia and pregnancy associated hypertension. In particular, provided herein are regulators of the Hippo pathway (e g., TEAD inhibitors; VGLL3 regulators; verteporfin) that find use in the treatment and prevention of preeclampsia and pregnancy associated hypertension.

[0009] BACKGROUND

[0010] Preeclampsia (PE) is a multisystem disorder specific to pregnancy that is characterized by the new onset of high blood pressure. Severe cases may involve red blood cell breakdown, low blood platelet count, impaired liver function, kidney dysfunction, swelling, shortness of breath due to fluid in the lungs, and / or visual disturbances, with sometimes lethal outcomes for both the mother and the fetus.

[0011] PE affects 2-8% of pregnancies worldwide. Hypertensive disorders of pregnancy, which include PE, are one of the most common causes of death due to pregnancy. They resulted in tens of thousands of deaths per year.

[0012] PE can have immediate and life-long consequences for mothers and babies. There are limited treatment options outside of delivering the placenta. The severity of disease and the maturity of the baby are primary considerations, with often challenging and complicated decisions required that can seriously impact the health of the mother, the fetus, or both. UM-43058.601

[0013] Treatments for PE are limited and include hypertension medications and hospitalization for monitoring. Additional treatments for PE and other hypertensive disorders of pregnancy (HDP) are needed.

[0014] SUMMARY

[0015] Provided herein compositions and methods for the treatment and prevention of hypertensive disorders of pregnancy (HDP), including, but not limited to, PE, chronic hypertension, gestational hypertension, and other conditions characterized by high blood pressure during pregnancy. In particular, provided herein are regulators of the Hippo pathway (e.g., TEAD inhibitors; VGLL3 regulators; verteporfin) that find use in the treatment and prevention of PE and HDP.

[0016] Experiments described herein implicated Hippo pathway members in PE. Experiments identified an interaction between PE associated protein VGLL3 and TEAD. It was demonstrated that VGLL3, a transcription co-regulator in the Hippo pathway, is upregulated in preeclamptic placentas. VGLL3 promotes immune activation, impairs trophoblast differentiation, and induces endothelial dysfunction, all of which contribute to pregnancy-related hypertension, fetal growth restriction, and offspring mortality. The results reveal that VGLL3 acts upstream of preeclampsia-associated processes, including the production of sFLTl, a key biomarker of the disease. Notably, targeting VGLL3, for example, by genetic deletion (e g., in placentas) or through therapeutic inhibition (e.g., in human placentas), protects against PE and alleviates disease pathology. Thus, in some embodiments, the present disclosure provides compositions and methods for treating and preventing PE and eclampsia and other related diseases and conditions (e.g., HDP) by targeting Hippo pathway components such as, for example, TEAD.

[0017] For example, in some embodiments, provided herein is a method comprising: treating a subject having or at increased risk of PE or other HDP with a Hippo pathway effector under conditions that reduce or prevent PE or other HDP.

[0018] In some embodiments, the Hippo pathway effector is a TEAD inhibitor. The present disclosure is not limited to particular TEAD inhibitors. Examples include but are not limited to verteporfin, (R)-PFI 2 hydrochloride, TAT-PDHPS1, TM2 TEAD inhibitor, K-975, IK-930, IAG933, GNE-7883, YTP-17, VT3989, BPI-460372, GH658, BGI-9004, SPR1-0117, VT-107, VT103, TED-347, MYF-01-37, YAP-TEAD-IN-1 TFA, YAP-TE AD-IN-2, YAP-TEAD-IN-3, UM-43058.601

[0019] YAP / TAZ inhibitor-1 (WO2017058716), VT104, YAP / TZ inhibitor-2, MSC-4106, TT-10, Super-TDU, TEAD-IN-3, Super-TDU (1-31) (TFA), SWTX-143, MY-1076, TEAD-IN-6, and ISM6331. In certain embodiments, the TEAD inhibitor is verteporfin.

[0020] In some embodiments, the Hippo pathway effector is a VGLL3 regulator (e.g., an agent that blocks an interaction between VGLL3 and TEAD).

[0021] In some embodiments, the method further comprises the step of assessing efficacy of the Hippo pathway effector in reducing or preventing PE or eclampsia or HDP. In some embodiments, the method further comprises the step of assessing a subject to determine risk of PE or eclampsia or HDP. In some embodiments, the assessing comprises evaluating a sign or symptom of PE or eclampsia or HDP (e.g., including but not limited to, blood pressure, level of protein in the urine, swelling in the hands, feet, ankles, or face, headaches, sudden weight gain, nausea or vomiting, abdominal pain, or vision changes or a combination thereof). In some embodiments, the assessing is repeated one or more times (e g., after said subject has delivered a baby).

[0022] In some embodiments, the method further comprises the step of conducting one or more screening or diagnostic tests for PE or eclampsia or HDP prior to administration of a treatment.

[0023] In some embodiments, the subject is or is not at increased risk of PE or eclampsia or HDP.

[0024] The present disclosure is not limited to a particular method of administering the Hippo pathway effector. Examples include but are not limited to systemic delivery (e.g., injection (e.g., intravenous, subcutaneous, or intraperitoneal administration), oral, or transdermal delivery).

[0025] Certain embodiments of the disclosure comprise co-administering an additional treatment for PE or HDP (e.g., including but not limited to, high blood pressure medication, magnesium sulfate, or anti-seizure medication or a combination thereof).

[0026] Also provided is the use of a Hippo pathway effector to treat or prevent PE or eclampsia in a subject.

[0027] Additional embodiments are described herein.

[0028] DEFINITIONS

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention UM-43058.601 belongs. However, in case of conflict, the present specification, including definitions, will control. Accordingly, in the context of the embodiments described herein, the following definitions apply.

[0030] As used herein and in the appended claims, the singular forms “a”, “an” and “the” include plural reference unless the context clearly dictates otherwise.

[0031] As used herein, the term “comprise” and linguistic variations thereof denote the presence of recited feature(s), element(s), method step(s), etc. without the exclusion of the presence of additional feature(s), element(s), method step(s), etc. Conversely, the term “consisting of’ and linguistic variations thereof, denotes the presence of recited feature(s), element(s), method step(s), etc. and excludes any unrecited feature(s), element(s), method step(s), etc., except for ordinarily-associated impurities. The phrase “consisting essentially of’ denotes the recited feature(s), element(s), method step(s), etc. and any additional feature(s), element(s), method step(s), etc. that do not materially affect the basic nature of the composition, system, or method. Many embodiments herein are described using open “comprising” language. Such embodiments encompass multiple closed “consisting of’ and / or “consisting essentially of’ embodiments, which may alternatively be claimed or described using such language.

[0032] As used herein, the term “subject” broadly refers to any animal, including but not limited to, human and non-human animals (e.g., non-human primates (e.g., gorilla), dogs, animal models of disease (e.g., mice, rats), etc.). As used herein, the term “patient” typically refers to a human subject that is being treated for, or to prevent, a disease or condition.

[0033] As used herein, the term “effective amount” refers to the amount sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route.

[0034] As used herein, the terms “administration” and “administering” refer to the act of giving a drug, prodrug, or other agent, or therapeutic treatment to a subject. Exemplary routes of administration to the human body can be by injection (e.g., intravenously, subcutaneously, intraperitoneally, intramuscular, etc.), mouth (oral), skin (topical or transdermal), and the like.

[0035] As used herein, the terms “co-administration” and “co-administering” refer to the administration of at least two agent(s) or therapies to a subject. In some embodiments, the coadministration of two or more agents or therapies is concurrent. In other embodiments, a first UM-43058.601 agent / therapy is administered prior to a second agent / therapy. Those of skill in the art understand that the formulations and / or routes of administration of the various agents or therapies used may vary. The appropriate dosage for co-administration can be readily determined by one skilled in the art. In some embodiments, when agents or therapies are co-administered, the respective agents or therapies are administered at lower dosages than appropriate for their administration alone. Thus, co-administration is especially desirable in embodiments where the coadministration of the agents or therapies lowers the requisite dosage of a potentially harmful (e.g., toxic) agent(s), and / or when co-administration of two or more agents results in sensitization of a subject to beneficial effects of one of the agents via co-administration of the other agent.

[0036] As used herein, the term “treatment” means an approach to obtaining a beneficial or intended clinical result. The beneficial or intended clinical result may include alleviation of symptoms, a reduction in the severity of the disease or condition, inhibiting an underlying cause of a disease or condition, steadying diseases in a non-advanced state, delaying the progress of a disease or condition, and / or improvement or alleviation of disease or condition conditions.

[0037] As used herein, the term “pharmaceutical composition” refers to the combination of an active agent with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo.

[0038] The terms “pharmaceutically acceptable” or “pharmacologically acceptable,” as used herein, refer to compositions that do not substantially produce adverse reactions, e.g., toxic, allergic, or immunological reactions, when administered to a subject.

[0039] As used herein, the term “pharmaceutically acceptable carrier” refers to any of the standard pharmaceutical carriers including, but not limited to, phosphate buffered saline solution, water, emulsions (e.g., such as an oil / water or water / oil emulsions), and various types of wetting agents, any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintegrants (e.g., potato starch or sodium starch glycolate), and the like. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see, e.g., Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, Pa. (1975), incorporated herein by reference in its entirety.

[0040] As used herein, a “Hippo pathway effector” refers to an agent or agents (e.g., small molecule, RNAi molecule, peptide, protein, gene editing system, etc.) that activate or inhibit a UM-43058.601 component of the Hippo signal transduction pathway resulting in an “off’ mode of the Hippo pathway that promotes cell growth via activation of TEAD (transcriptional enhanced associated domain) protein(s) (e.g., TEAD1, TEAD2, TEAD3, and / or TEAD4) via YAP (yes-associated protein) translocation to the nucleus and YAP binding and activation of TEAD; or an “on” mode of the Hippo pathway that prevents YAP from translocating to the nucleus and / or binding to and / or activating TEAD resulting in a “stop growing” mode. Hippo pathway effectors include, for example, TEAD inhibitors. TEAD inhibitors include agents that function as protein-protein interaction disruptors (PPIDs) that disrupt the ability of YAP to functionally bind to TEAD, as well as agents that prevent YAP from translocating to the nucleus to activate TEAD. TEAD inhibitors may be pan-TEAD inhibitors or may have specificity for one or a sub-set of TEADs (e.g., TEAD 1 -specific, TEAD2-specific, TEAD3 -specific, TEAD4-specific, TEADl / 2-specific, etc ). TEAD PPIDs may interact with TEAD in a central pocket and / or at one or more surface interfaces (Interface 1, Interface 2, Interface 3). TEAD inhibitors include, but are not limited to, Verteporfin (e.g., without light activation), (R)-PFI 2 hydrochloride, TAT-PDHPS1, TM2 TEAD inhibitor, K-975, IK-930, IAG933, GNE-7883, YTP-17, VT3989, BPI-460372, GH658, BGI- 9004, SPR1-0117, VT-107, VT103, TED-347, MYF-01-37, YAP-TEAD-IN-1 TFA, YAP- TEAD-1N-2, YAP-TEAD-1N-3, YAP / TAZ inhibitor-1 (WO2017058716), VT104, YAP / TZ inhibitor-2, MSC-4106, TT-10, Super-TDU, TEAD-IN-3, Super-TDU (1-31) (TFA), SWTX- 143, MY-1076, TEAD-IN-6, and ISM6331. In some embodiments, the Hippo pathway effector regulates MST1 / 2, LATS1 / 2, 14-3-3, SAV1, and / or M0B1. In some embodiments, the Hippo pathway effector regulates an association between VGLL3 and TEAD.

[0041] DESCRIPTION OF FIGURES

[0042] FIG. 1 shows VGLL3 -associated genes including molecules and processes implicated in PE.

[0043] FIG. 2 shows that inhibition of VGLL3 by Verteporfin mimics the effects of VGLL3 siRNA and targets PE-associated molecular signaling.

[0044] FIG. 3 shows that Vgll3-null placentas are distinct from WT placentas in PE-associated pathways.

[0045] FIG. 4 shows that placental overexpression of Vgll3 induces PE-like phenotype in mice. FIG. 5 shows upregulation of VGLL3 in human PE placentas. UM-43058.601

[0046] FIG. 6 shows that human PE gene signature is reflected in Vgll3-OE placentas.

[0047] FIG. 7 shows that Co-IP confirms VGLL3-TEAD1 binding in HTR8 cells.

[0048] FIG. 8 shows that targeting VGLL3 in PE placentas limits cell-cell interactions and reduces the disease signature in immune cells.

[0049] DETAILED DESCRIPTION

[0050] Provided herein compositions and methods for the treatment and prevention of PE and HDP. In particular, provided herein are regulators of the Hippo pathway (e.g., TEAD inhibitors; VGLL3 regulator; verteporfin) that find use in the treatment and prevention of PE and HDP.

[0051] Risk factors for PE include obesity, prior hypertension, older age, and diabetes mellitus.

[0052] It is also more frequent in a woman's first pregnancy and if she is carrying twins. The underlying mechanisms are complex and involve abnormal formation of blood vessels in the placenta amongst other factors. Most cases are diagnosed before delivery, and may be categorized depending on the gestational week at delivery. Commonly, PE continues into the period after delivery, then known as postpartum preeclampsia. Rarely, PE may begin in the period after delivery. While historically both high blood pressure and protein in the urine were required to make the diagnosis, some definitions also include those with hypertension and any associated organ dysfunction. PE is routinely screened during prenatal care.

[0053] Primates can also experience PE. In 2024, a female western lowland gorilla was diagnosed with PE and had a successful caesarean section.

[0054] If untreated, PE can progress to eclampsia, characterized by seizures or coma, which can be fatal.

[0055] For HDP and the associated high blood pressure, there is an increase in the resistance of blood vessels. This may hinder blood flow in many different organ systems in the expectant mother including the liver, kidneys, brain, uterus, and placenta. There are other problems that may develop as a result of severe gestational hypertension (blood pressure readings that are higher than 160 / 110 mm Hg). Placental abruption (premature detachment of the placenta from the uterus) may occur in some pregnancies. Gestational hypertension can also lead to fetal problems including intrauterine growth restriction (poor fetal growth) and stillbirth. If untreated, severe gestational hypertension may cause dangerous seizures (eclampsia) and even death in the UM-43058.601 mother and fetus. Because of these risks, it may be necessary for the baby to be delivered early, before 37 weeks gestation.

[0056] Accordingly, provided herein is a method comprising: treating a subject having or at increased risk of PE, eclampsia, or HDP with a Hippo pathway effector under conditions that reduce or prevent PE, eclampsia, or HDP. The present disclosure is not limited to a particular subject population. In some embodiments, the subject is pregnant or post-partum. In some embodiments, subject is not at increased risk of PE or eclampsia or HDP. In some embodiments, the subject has been identified as being at increased risk of PE or eclampsia or HDP based on one or more risk factors of developing PE or one or more signs or symptoms of PE or HDP (e.g., including but not limited to, blood pressure, level of protein in the urine, swelling in the hands, feet, ankles, or face, headaches, sudden weight gain, nausea or vomiting, abdominal pain, or vision changes or a combination thereof).

[0057] In some embodiments, one or more tests are conducted prior to, during, or after treatment to assess the status and / or progression of disease or related signs, symptoms, and / or complications. In some embodiments, the assessing comprises evaluating a sign or symptom of PE or eclampsia or HDP. In some embodiments, the assessing is repeated one or more times (e.g., after said subject has delivered a baby).

[0058] Testing finds use for research (drug screening), identifying therapeutic agents, selecting therapeutic agents, monitoring efficacy of therapeutic approaches, and modifying therapeutic approaches (e.g., changing drugs, changing doses, stopping therapy, adding additional drugs or other interventions, etc.). In some embodiments, a patient is tested, treated, and then tested again to monitor the response to therapy. In some embodiments, cycles of testing and treatment may occur without limitation to the pattern of testing and treating (e.g., test / treat, test / treat / test, test / treat / test / treat, test / treat / test / treat / test, test / treat / treat / test / treat / treat, etc.), the periodicity, or the duration of the interval between each testing and treatment phase.

[0059] In some embodiments, the Hippo pathway effector is a TEAD inhibitor. The present disclosure is not limited to particular TEAD inhibitors. Examples include but are not limited to verteporfin, (R)-PFI 2 hydrochloride, TAT-PDHPS1, TM2 TEAD inhibitor, K-975, IK-930, IAG933, GNE-7883, YTP-17, VT3989, BPI-460372, GH658, BGI-9004, SPR1-0117, VT-107, VT103, TED-347, MYF-01-37, YAP-TEAD-IN-1 TFA, YAP-TEAD-IN-2, YAP-TEAD-IN-3, YAP / TAZ inhibitor- 1 (WO2017058716), VT104, YAP / TZ inhibitor-2, MSC-4106, TT-10, UM-43058.601

[0060] Super-TDU, TEAD-IN-3, Super-TDU (1-31) (TFA), SWTX-143, MY- 1076, TE AD-IN-6, and ISM6331. In certain embodiments, the TEAD inhibitor is verteporfin.

[0061] In some embodiments, the Hippo pathway effector is a nucleic acid. Exemplary nucleic acids suitable for inhibiting TEAD, VGLL3, or other Hippo pathway components (e.g., by preventing expression of TEAD) include, but are not limited to, antisense nucleic acids and RNAi nucleic acids. In some embodiments, nucleic acid therapies are complementary to and hybridize to at least a portion (e.g., at least 5, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides) of TEAD.

[0062] In some embodiments, compositions comprise oligomeric antisense compounds, particularly oligonucleotides used to modulate the function of nucleic acid molecules encoding TEAD or VGLL3, ultimately modulating the amount of TEAD or VGLL3. This is accomplished by providing antisense compounds that specifically hybridize with one or more nucleic acids encoding TEAD or VGLL3 or other Hippo pathway members. The specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This modulation of function of a target nucleic acid by compounds that specifically hybridize to it is generally referred to as “antisense.” The functions of DNA to be interfered with include replication and transcription. The functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity that may be engaged in or facilitated by the RNA. The overall effect of such interference with target nucleic acid function is decreasing the amount of TEAD or VGLL3 protein in the cell.

[0063] In some embodiments, nucleic acids are RNAi nucleic acids. “RNA interference (RNAi)” is the process of sequence-specific, post-transcriptional gene silencing initiated by a small interfering RNA (siRNA), shRNA, or microRNA (miRNA). During RNAi, the RNA induces degradation of target mRNA with consequent sequence-specific inhibition of gene expression.

[0064] In “RNA interference,” or “RNAi,” a “small interfering RNA” or “short interfering RNA” or “siRNA” or “short hairpin RNA” or “shRNA” molecule, or “miRNA” an RNAi (e.g., single strand, duplex, or hairpin) of nucleotides is targeted to a nucleic acid sequence of interest, for example, TEAD and / or VGLL3. UM-43058.601

[0065] An “RNA duplex” refers to the structure formed by the complementary pairing between two regions of an RNA molecule. The RNA using in RNAi is “targeted” to a gene in that the nucleotide sequence of the duplex portion of the RNAi is complementary to a nucleotide sequence of the targeted gene. In certain embodiments, the RNAi is targeted to the sequence encoding TEAD and / or VGLL3. In some embodiments, the length of the RNAi is less than 30 base pairs. In some embodiments, the RNA can be 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 base pairs in length. In some embodiments, the length of the RNAi is 19 to 32 base pairs in length. In certain embodiment, the length of the RNAi is 19 or 21 base pairs in length.

[0066] In some embodiments, RNAi comprises a hairpin structure (e.g., shRNA). In addition to the duplex portion, the hairpin structure may contain a loop portion positioned between the two sequences that form the duplex. The loop can vary in length. In some embodiments the loop is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nucleotides in length. In certain embodiments, the loop is 18 nucleotides in length. The hairpin structure can also contain 3' and / or 5' overhang portions. In some embodiments, the overhang is a 3' and / or a 5' overhang 0, 1, 2, 3, 4 or 5 nucleotides in length.

[0067] "miRNA" or "miR" means a non-coding RNA between 18 and 25 nucleobases in length which hybridizes to and regulates the expression of a coding RNA. In certain embodiments, a miRNA is the product of cleavage of a pre-miRNA by the enzyme Dicer. Examples of miRNAs are found in the miRNA database known as miRBase.

[0068] As used herein, Dicer- substrate RNAs (DsiRNAs) are chemically synthesized asymmetric 25-mer / 27-mer duplex RNAs that have increased potency in RNA interference compared to traditional RNAi. Traditional 21-mer RNAi molecules are designed to mimic Dicer products and therefore bypass interaction with the enzyme Dicer. Dicer has been recently shown to be a component of RISC and involved with entry of the RNAi into RISC. Dicer- substrate RNAi molecules are designed to be optimally processed by Dicer and show increased potency by engaging this natural processing pathway. Using this approach, sustained knockdown has been regularly achieved using sub-nanomolar concentrations. (U.S. Pat. No. 8,084,599; Kim et al., Nature Biotechnology 23:222 2005; Rose et al., Nucleic Acids Res., 33:41402005).

[0069] The transcriptional unit of a “shRNA” is comprised of sense and antisense sequences connected by a loop of unpaired nucleotides. shRNAs are exported from the nucleus by UM-43058.601

[0070] Exportin-5, and once in the cytoplasm, are processed by Dicer to generate functional RNAi molecules. “miRNAs” stem-loops are comprised of sense and antisense sequences connected by a loop of unpaired nucleotides typically expressed as part of larger primary transcripts (pri- miRNAs), which are excised by the Drosha-DGCR8 complex generating intermediates known as pre-miRNAs, which are subsequently exported from the nucleus by Exportin-5, and once in the cytoplasm, are processed by Dicer to generate functional miRNAs or siRNAs.

[0071] “Artificial miRNA” or an “artificial miRNA shuttle vector”, as used herein interchangeably, refers to a primary miRNA transcript that has had a region of the duplex stem loop (at least about 9-20 nucleotides) which is excised via Drosha and Dicer processing replaced with the siRNA sequences for the target gene while retaining the structural elements within the stem loop necessary for effective Drosha processing. The term “artificial” arises from the fact the flanking sequences (e.g., about 35 nucleotides upstream and about 40 nucleotides downstream) arise from restriction enzyme sites within the multiple cloning site of the RNAi. As used herein the term “miRNA” encompasses both the naturally occurring miRNA sequences as well as artificially generated miRNA shuttle vectors.

[0072] The RNAi can be encoded by a nucleic acid sequence, and the nucleic acid sequence can also include a promoter. The nucleic acid sequence can also include a polyadenylation signal. In some embodiments, the polyadenylation signal is a synthetic minimal polyadenylation signal or a sequence of six Ts.

[0073] The present disclosure contemplates the use of any genetic manipulation for use in modulating the expression of TEAD and / or VGLL3. Examples of genetic manipulation include, but are not limited to, gene knockout (e.g., removing the TEAD, VGLL3, or another Hippo pathway gene from the chromosome using, for example, recombination), expression of antisense constructs with or without inducible promoters, and the like. Delivery of nucleic acid construct to cells in vitro or in vivo may be conducted using any suitable method. A suitable method is one that introduces the nucleic acid construct into the cell such that the desired event occurs (e.g., expression of an antisense construct).

[0074] Introduction of molecules carrying genetic information into cells is achieved by any of various methods including, but not limited to, directed injection of naked DNA constructs, bombardment with gold particles loaded with said constructs, and macromolecule mediated gene transfer using, for example, liposomes, biopolymers, and the like. Exemplary methods use gene UM-43058.601 delivery vehicles derived from viruses, including, but not limited to, adenoviruses, retroviruses, lentiviral vectors, vaccinia viruses, and adeno-associated viruses. Because of the higher efficiency as compared to retroviruses, vectors derived from adenoviruses are the preferred gene delivery vehicles for transferring nucleic acid molecules into host cells in vivo. Adenoviral vectors have been shown to provide very efficient in vivo gene transfer into a variety of solid tumors in animal models and into human solid tumor xenografts in immune-deficient mice. Examples of adenoviral vectors and methods for gene transfer are described in PCT publications WO 00 / 12738 and WO 00 / 09675 and U.S. Pat. Appl. Nos. 6,033,908, 6,019,978, 6,001,557, 5,994,132, 5,994,128, 5,994,106, 5,981,225, 5,885,808, 5,872,154, 5,830,730, and 5,824,544, each of which is herein incorporated by reference in its entirety.

[0075] In some embodiments, vectors are lentiviral vectors. Lentiviruses are a subclass of retroviruses. They are sometimes used as vectors for gene therapy thanks to their ability to integrate into the genome of non-dividing cells, which is the unique feature of lentiviruses as other Retroviruses can infect only dividing cells. The viral genome in the form of RNA is reverse-transcribed when the virus enters the cell to produce DNA, which is then inserted into the genome at a random position by the viral integrase enzyme.

[0076] For safety reasons lentiviral vectors do not carry the genes required for their replication. To produce a lentivirus, several plasmids are transfected into a so-called packaging cell line, commonly HEK 293. One or more plasmids, generally referred to as packaging plasmids, encode the virion proteins, such as the capsid and the reverse transcriptase. Another plasmid contains the genetic material to be delivered by the vector. It is transcribed to produce the single-stranded RNA viral genome and is marked by the presence of the \| / (psi) sequence. This sequence is used to package the genome into the virion.

[0077] Vectors may be administered to subject in a variety of ways. For example, in some embodiments of the present disclosure, vectors are administered into tissue using direct injection. In other embodiments, administration is via the blood or lymphatic circulation (See e.g., PCT publication 1999 / 02685 herein incorporated by reference in its entirety). Exemplary dose levels of adenoviral vector are preferably 108to 1011vector particles added to the perfusate.

[0078] In some embodiments, nucleic acids (e.g., nucleic acids that inhibit the expression of TEAD and / or VGLL3) are introduced into the genome using the RNA-guided microbial endonuclease CRISPR (clustered regularly interspaced short palindromic repeat) / Cas9 (CRISPR UM-43058.601 associated protein 9) system. The CRTSPR / Cas9 system allows precise genome editing. It is widely used for studying the functionality of genetic elements, creating genetically modified organisms, and is promising in clinical therapeutic applications. Cas9 is an RNA-guided nuclease that catalyzes site-specific cleavage of double stranded DNA. A guide RNA comprising a 20-nt seed region complementary to its target activates Cas9 nuclease and creates a DNA double strand break (DSB).

[0079] The CRISP / CAS9 system can be used for sequence-specific gene editing and transcriptional regulation (Cho et al., 2013 Nat. Biotechnol. 31, 230-232; Cong et al., 2013 Science 339, 819-823; Fu et al., 2014 Nat. Biotechnol. 32, 279-284; Jinek et al. Science 337, 816-821, 2012; Mali et al., 2013b Science 339, 823-826; Qi et al., 2013 Cell 152, 1173-1183; Ran et al., 2015 Nature 520, 186-191; Yu et al., 2015 Cell Stem Cell 16, 142-147).

[0080] In some embodiments, the present disclosure provides antibodies that inhibit TEAD, VGLL3, or modulate the activity of Hippo pathway members. Any suitable antibody (e.g, monoclonal, polyclonal, or synthetic (e.g., nanobody, fragment, etc.)) may be utilized in the therapeutic methods disclosed herein. In some embodiments, the antibodies are humanized antibodies. Methods for humanizing antibodies are well known in the art (See e.g., U.S. Patents 6,180,370, 5,585,089, 6,054,297, and 5,565,332; each of which is herein incorporated by reference).

[0081] In some embodiments, candidate Hippo pathway effectors are screened for activity (e g., using the methods described herein or another suitable assay).

[0082] In some embodiments, provided herein pharmaceutical compositions including a Hippo pathway effector (e.g., TEAD inhibitor, VGLL3 regulator) alone or in combination with one or more additional therapeutic agents in admixture with a pharmaceutically acceptable excipient. One of skill in the art will recognize that the pharmaceutical compositions may include a pharmaceutically acceptable salts of the compounds described herein.

[0083] Depending on the specific conditions being treated, such agents may be formulated into liquid or solid dosage forms and administered systemically or locally. The agents may be delivered, for example, in a timed- or sustained-slow-release form as is known to those skilled in the art. Techniques for formulation and administration may be found in Remington: The Science and Practice of Pharmacy (20th ed.) Lippincott, Williams & Wilkins (2000). Suitable routes may include oral, buccal, by inhalation spray, sublingual, rectal, transdermal, vaginal, transmucosal, UM-43058.601 nasal or intestinal administration; parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intra- articullar, intra-sternal, intra-synovial, intra-hepatic, intralesional, intracranial, intraperitoneal, intranasal, or intraocular injections or other modes of delivery.

[0084] Pharmaceutical compositions suitable for use in the present disclosure include compositions wherein the active ingredients are contained in an effective amount to achieve their intended purpose. Determination of the effective amounts is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. Generally, the compounds according to the disclosure are effective over a wide dosage range. For example, in the treatment of adult humans, dosages from 0.01 to 1000 mg, from 0.5 to 100 mg, from 1 to 50 mg per day, and from 5 to 40 mg per day are examples of dosages that may be used. A nonlimiting dosage is 10 to 30 mg per day. The exact dosage will depend upon the route of administration, the form in which the compound is administered, the subject to be treated, the body weight of the subject to be treated, the bioavailability of the compound(s), the adsorption, distribution, metabolism, and excretion (ADME) toxicity of the compound(s), and the preference and experience of the attending physician.

[0085] In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically.

[0086] EXAMPLES

[0087] MATERIALS AND METHODS

[0088] Human Placentas

[0089] Immediately following delivery, whole-thickness placental samples and chorioamniotic membranes were digested with Miltenyi Biotec umbilical cord dissociation kit to obtain singlecell suspension as per the manufacturer’s protocol. Briefly, tissues were washed, cut into small (2-3mm) pieces with sterile scissors or blade, incubated with a digestive enzyme cocktail for 2 hours at 37°C, and dissociated with gentleMACS dissociator run on spleen_01 program. For ex vivo treatments, PreE placental explants were incubated with inhibitors or DMSO as a negative UM-43058.601 control at 4°C overnight prior to digestion with the enzyme cocktail. Samples were then run through 100-um strainers, incubated with red blood cell lysis buffer (Biolegend), washed, and resuspended in IMDM media supplemented with 10% FBS for delivery to the UM Advanced Genomics Core for scRNA-seq. Cell viability was confirmed to be above 80% for all samples. Libraries were constructed on the 10X Chromium system with chemistry v3 and sequenced on the Illumina NovaSeq 6000 sequencer to generate 150 bp paired-end reads. scRNA-seq analyses

[0090] Data was pre-processed in Seurat

[0054] by removing genes expressed in fewer than 2 cells and excluding cells that were outliers for number of RNA molecules, or more than 10% mitochondrial genes. DoubletFinder

[0055] was used to identify and remove probable doublet cells (PC 1 : 15, PN default 0.25, nExp determined with estimated doublet based on loading density for 10X platform) and DecontX

[0056] was used to remove probable RNA contamination from individual cells. The individual samples were merged into one object, and pre-processed with the standard Seurat analysis including normalization, variable feature identification, data scaling, and principal component analysis (PCA). The samples were integrated using the RunHarmony

[0010] command in Seurat to mitigate batch effects. Uniform Manifold Approximation and Projection (UMAP) dimensional reduction was done using the RunUMAP function in Seurat. Unsupervised clustering was performed by identifying the nearest neighbors using the first twenty dimensions and identifying clusters (resolutions used: human untreated: 0.1, human inhibitor treated: 0.5, mouse Vgll3 OE: 0.3, mouse LPS treated: 0.3). The top cluster-defining genes were found using the FindAllMarkers function (absolute log2 fold change threshold of 0.5), and these cluster-defining genes were used to annotate the cell types based on canonical gene signatures and previously published data

[0057] , PE specific genes were identified by using FindMarkers to identify differentially expressed genes between HD and PE on total placenta with a minimum Log2 fold change threshold of +0.1. Putative upstream regulators of this gene signature were identified using Ingenuity Pathway Analysis and plotted on a volcano plot showing the activation z-score and FDR. The proportion of VGLL3 expressing cells was calculated by taking the number of VGLL3+ cells in each individual cluster divided by the total number of cells within the dataset. To perform higher resolution analysis of endothelial and trophoblast clusters, EVT, EVT2, VSM, ImmEC, LymphEC, and CapEC were subsetted into a UM-43058.601

[0091] Seurat object and re-processed including normalization, variable feature identification, data scaling, and PCA identification. Clustering was performed with a resolution of 0.2.

[0092] Gene signature definition and scoring

[0093] PE specific gene signatures were identified with the FindMarker command on individual clusters with a minimum Log2 fold change threshold of +0.1 and p-value < 0.05. The AddModule Score function was used to score individual cells for these signatures (ctrl = 10). To score PE gene signatures on mouse data, mouse orthologs of signatures were identified and scored. Vgll3-OE specific genes were identified with the FindMarker command on individual clusters with a minimum Log2 fold change threshold of +0.1, minimum percentage expressed of 10%, and a p-value < 0.05. Human orthologs of these signatures were scored on the human dataset with the AddModule Score function.

[0094] Pseudotime trajectory construction

[0095] Trophoblast clusters (CTB, transitional trophoblasts, STB, and EVT) were subsetted into a Seurat object and separated by disease state. These objects were imported into Monocle3 by generating a cell data set from the decontaminated counts slot. Normalization and PCA were done with the preprocess cds command from Monocle3 with the first 100 dimensions using log normalization, and batch correction was performed using the align cds command with continuous effects, which uses the Batchelor tool

[0058] , UMAP dimensional reduction was performed using the reduce_dimension command. Cells were clustered with the cluster_cells command with default parameters. The trajectory graph was learned on the Monocle-derived clusters with leam graph. Cells on the UMAP plot are colored by Seurat-derived clusters. Pseudotime was determined using CTB as the starting point. Genes that increase with pseudotime in either the STB or EVT lineage were identified using the find gene modules function and selecting the modules that increased expression in either lineage. These gene lists were then filtered for those genes with higher expression in PE than HD cells. Ingenuity Pathway Analysis was then used to identify putative upstream regulators of these signatures. UM-43058.601

[0096] Ligand-receptor interaction analyses

[0097] CellphoneDB (v4.1.0) was used to identify putative ligand-receptor interactions from scRNA-seq datasets

[0059] , To identify interactions between VGLL3+ EVT cells and other cell types in PreE placenta, a new cell-identity was created to denote cells that were positive or negative for VGLL3 expression. Interactions with p < 0.05 were retained, and the number of interactions was plotted with ktplots on a heatmap and on a barchart. Select interactions were plotted on dotplots showing the strength of the interaction. Mouse Vgll3-OE and LPS-treated control vs Vgll3 KO analyses were performed on each genotype separately, and then select interactions were shown on dot plots. Inhibitor-treated human samples were run separately, and significant interactions retained. A summation of all interactions was generated and plotted as a heatmap for each condition. Ligand-receptor interactions that were mutually expressed within the same cell types between the conditions were removed and the resulting non-overlapping interactions were also plotted as a heatmap. Ligands and receptors that were associated with a cytokine, complement, or Hippo pathway were plotted as Circos plots, also removing mutual interactions between conditions.

[0098] Spatial sequencing

[0099] FFPE placentas from a PreE patient and HD were re-imbedded into a single block, sectioned unto a slide, and subjected to Xenium in situ transcriptomics preparation and sequencing at UM Advanced Genomics Core. For data analyses, we initially employed Symphony

[0060] to annotate our spatial Xenium dataset by mapping it onto a well-curated, annotated single-cell RNA-seq reference obtained from our current work. This approach enabled robust and accurate cell type identification. Subsequently, we utilized the R package Giotto

[0061] to generate in situ plots that visually represent both the cell type annotations and the spatial expression patterns of targeted genes. Finally, differential gene expression analysis was performed using scran

[0062] as implemented within the Giotto framework, facilitating the robust identification of gene expression differences across distinct cellular populations.

[0100] Double-axis scatterplots

[0101] DEGs significantly changed (p<0.05) between treatment and control groups for each cell type of interest were inputted into EnrichR to assess pathway enrichment. The compiled pathway UM-43058.601 data was presented to Al to automate identification of the pathways shared among all cell types, with at least top 3 pathways for each cell type chosen for representation. The double-axis scatterplots were created in Tableau with “Cell Types” as columns and “Pathways” as rows and the intersection of these two variables as the negative log p-values with larger (more significant) values corresponding to heavier dots in the scatterplot.

[0102] Bulk RNA-seq

[0103] Five 20-um sections per sample were obtained from FFPE biopsies. RNA isolation was performed using the Qiagen RNeasy FFPE Kit (73504). In brief, sections were transferred to a microcentrifuge tube treated with Qiagen deparaffinization solution and briefly incubated at 56°C. Following a subsequent incubation in a proteinase K lysis buffer at 56°C, tissue sections were shifted to a higher temperature (80°C) to partially reverse formalin crosslinking of the released nucleic acids. This was followed by DNase treatment optimized to eliminate all genomic DNA. The obtained lysates were mixed with Buffer RBC and ethanol and subjected to an RNeasy MinElute spin column. The obtained RNA was eluted with 30 pl of RNase-free water. Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep kit and sequenced on the Illumina NovaSeq 6000 SP Flow Cells. For RNA-Seq analyses, adapter trimming and quality control were conducted on the raw sequence reads. The paired-end reads were mapped using STAR

[0063] to Genome Reference Consortium Human Build 37 (GRCh37). Only uniquely mapped reads were used for subsequent analysis. Gene expression levels were quantified with GENCODE v24 used as a reference and normalized by HTSeq

[0064] and DESeq2

[0065] ,

[0104] IHC / PLA

[0105] Formalin-fixed, paraffin-embedded human and mouse tissue sections were heated at 60°C for 30 minutes, deparaffmized, and rehydrated. Slides were placed in either pH9 or pH6 antigen retrieval buffer dependent on the antibody specification. Slides were cooled in ice, treated with 3% H2O2 for 5 minutes, and blocked with 10% serum for 30 minutes. Primary antibodies included the following: NE (Abeam, ab310335), CD3 (Abeam, ab215212), CD19 (Thermofisher, pa5-27442), VGLL3 (Sigma, HPA054983), FLT1 (Abeam, ab2350), TEAD1 (Santa Cruz, sc-393976), TEAD2 (LS Bio, LS-C342577), TEAD3 (Creative Biolabs, CBMAB- UM-43058.601

[0106] 0234-LY), TEAD4 (Santa Cruz, sc-390578). After an overnight incubation at 4°C, sections were washed and incubated with secondary antibody for 1 hour at room temperature. Following counterstaining with hematoxylin and bluing reagent, slides were imaged under a Zeiss Axioskop 2 microscope. For PLA, five-micron sections were prepared from formalin-fixed, paraffin-embedded human placenta samples and stained using Duolink® Proximity Ligation Assay kit according to the manufacturer’s instructions (Sigma Aldrich).

[0107] Cell Culture, transfections, IP, and protein analyses

[0108] HTR8 cells were cultured in Gibco RPMI 1640 (Invitrogen) with 10% fetal bovine serum. HTR8 cells were grown to over 70% confluence and then transfected using Lipofectamine 3000 (ThermoFisher) according to the manufacturer’s protocol. For IP, 500ug- Img total protein was incubated overnight with anti-FLAG antibody (Origene, TA50011) on a shaker at 4°C. Protein A agarose was used to pull down immune complexes, which were then analyzed by immunoblotting and mass spectrometry. For immunoblotting, proteins were denatured in sample buffer containing P-mercaptoethanol and boiled at 100 °C for 3 min. Samples were separated on gradient 4-20% SDS-PAGE gels (ThermoFisher) and electroblotted to nitrocellulose. Primary antibodies included the following: TEAD1 (Origene, RG215492), GFP (Origene, TA150041), FLAG (Origene, TA50011), VGLL3 (Sigma, HPA054983). Bands were detected on the iB right system using ECL substrate. LC-tandem mass spectrometry was performed at UM Proteomics Resource Facility.

[0109] Design and validation of Cre-inducible Vgll3 mice

[0110] The Rosa26 locus on chromosome 6, a “safe harbor” genomic site, was used for the integration of mouse Vgll3 downstream of a floxed EGFP with STOP sequence to achieve conditional gene expression in mice. Mouse Vgll3 with IRES DNA (1560 bp) was PCR- amplified from K5-Vgll3-IRES-mCherry, the construct used for generating our previous K5 promoter-driven Vgll3 transgenic mouse model

[0020] , The PCR fragment was then cloned into a previously generated CAG-loxP-EGFP-STOP-loxP-rtTA3-P2A-mCherry-SV40-polyA cassette, where it replaced rtTA3-P2A. This cassette was built by replacing the sequence from CAG up to the Rosa26 right arm in the backbone of pR26 CAG AsiSI / MluI plasmid

[0066] (Addgene, 74286). We designed cloning protocols that were carried out by GenScript. The 15.5-kb plasmid was knocked into the mouse Rosa26 locus of fertilized oocytes using the CRISPR-Cas9 system by UM-43058.601 the UM Transgenic Animal Model Core. Three transgenic mouse lines were validated by analyzing high molecular weight genomic DNAs extracted from Fl pups with long range PCR (NEB# M0323S LongAmp Tag DNA polymerase), to confirm proper 5’ and 3’ integration into the Rosa26 locus. 2058 bp of 5’ flanking sequences were PCR amplified using primer pair of 5’CTAGGTAGGGGATCGGGACTCTG (SEQ ID NO: 1) and 5’AGTAGGAAAGTCCCATAAGGTC (SEQ ID NO:2) (targeting CMV promoter). 5493 bp of 3’ flanking sequences were PCR amplified using primer pair of 5’CACCATCGTGGAACAGTACGAAC (SEQ ID NO:3) (targeting mCherry) and 5’ CAGTGGCTCAACAACACTTGGTC (SEQ ID NO:4).

[0111] Mouse breeding and phenotyping

[0112] Cypl9-Cre males were time-mated with R26-LSL-Vgll3 females to induce Vgll3 overexpression specifically in the placenta. Detection of a vaginal plug in the morning following coitus was designated as embryonic day (E) 0.5. Blood pressure monitoring was performed at El 6.5 using a tail-cuff method on CODA Noninvasive Blood Pressure Monitoring System (Kent Scientific) at UM Physiology Phenotyping Core. Genotyping was carried out by Transnetyx automated service using custom designed probes. Placental histological examinations were conducted by a pathologist on 10 hematoxylin and eosin-stained sections of murine placentas at the Unit for Laboratory Animal Medicine (ULAM) Pathology Core, where complete blood count (CBC) and serum chemistries were also performed. P1GF in maternal circulation was measured by ELISA as per the manufacturer’s protocol (LS Bio, LS-F5507-1). Ejection fraction was measured at E15.5 during ultrasound scanning with Echo at UM Physiology Phenotypic Core. For LPS administration (Sigma-Aldrich, L2630), intraperitoneal injections were performed daily for 10 days starting at E7.5 as described previously

[0067] , and placentas were harvested at E18.5. Vgll3 KO mice (strain ID EM: 11403, C57BL / 6NTac-Vgll3 / H) were obtained from MRC Harwell Institute. They were generated by CRISPR-induced deletion of 890nt from Vgll3 gene, including a critical exon 2 ENSMUSE00000876808, to induce a premature stop codon and a null allele. UM-43058.601

[0113] Animal body composition analysis

[0114] Body fat, lean mass, free water, and total water were quantified using an NMR-based EchoMRI™ 4inl-500 analyzer. Conscious mice were placed individually in a clear plastic holder and inserted into the analyzer without anesthesia or sedation, allowing for non-invasive, rapid measurements within two minutes. The EchoMRI system differentiates tissue composition by exploiting differences in relaxation times of hydrogen proton spins, generating high-contrast signals through specialized radio pulse sequences. Calibration was performed daily using a canola oil reference sample as per manufacturer recommendations.

[0115] In silico experiments

[0116] Analyses were performed using the UCSC GRCh38 / hg38 genome version and are based upon the longest annotated VGLL3 transcript (NM_016206) with transcription start site (TSS) on the (-) strand of chromosome 3 at coordinate 86991149. Analyses were based upon TSS- proximal regions 1-10 kb upstream from the TSS (hg38 coordinates: 86990149-87001149). VGLL3 -correlated genes were identified by evaluating gene expression across 80 trophoblast microarray samples. The 80 samples had been generated using the same commercial microarray platform (Affymetrix Human Genome Plus 2.0 array) and were compiled from 9 Gene Expression Omnibus series submissions (GSE19810, GSE27909, GSE28504, GSE30127, GSE40182, GSE41459, GSE43685, GSE66840, GSE86171). The microarray samples were generated using RNA from various cell types, including primary placenta-derived villous trophoblasts, cultured trophoblast cell monolayers, and trophectoderm. 13753 genes were identified with detectable expression (P < 0.05, Signed rank test) in at least 5% (> 4 / 80) of the 80 microarray samples. Of these 13753 genes, the expression pattern of 6634 was positively correlated with VGLL3 (rs > 0).

[0117] In vitro experiments

[0118] Human HTR8 trophoblast cells were treated with 1) siRNA to target VGLL3 or a nontargeting RNA control; 2) Hippo pathway inhibitors Verteporfin and Truli or DMSO as a vehicle control; 3) RNAi to target VGLL3 or a non-targeting RNA control. Following treatment, RNA was isolated with Qiagen RNeasy RNA extraction kit and sequenced at UM Advanced Genomics Core. UM-43058.601

[0119] In vivo experiments

[0120] R26-LSL-Vgll3 mice were designed at the Skin Biology and Diseases Resource-Based Center (SBDRC) Animal Modeling Core (AMC). The construct design can be summarized as following: Rosa26-LSL(GFP)-VGLL3-IRES-mCherry. Non-inducible Cypl9-Cre mice (PMID: 17299749) were obtained from the lab of Dr. Gustavo Leone, the Ohio State University. R26- LSL-Vgll3 females were time-mated with Cypl9-Cre mice males to drive the overexpression of Vgll3 exclusively in placental trophoblasts. Coitus was verified by the presence of a vaginal plug, and pregnancy was confirmed by at least 2 g of weight gain by the 12.5 days post coitum. Placentas and maternal blood were harvested at day 15.5-16.5 post coitum. Serum and whole blood were analyzed at the ULAM Pathology Core. Placentas were H&E stained and observed by a pathologist for pathological changes. Additional placentas were subjected to single-cell isolation using the umbilical cord dissociation kit as in the ex vivo experiments followed by single-cell RNA-Seq at UM Advanced Genomics Core.

[0121] Ex vivo experiments

[0122] Whole-thickness placenta proper and chorioamniotic membranes were washed with sterile PBS, cut into 2-3mm pieces, and incubated at 4oC overnight with either DMSO (1 :1000 dilution in PBS) or an equivalent volume of inhibitor (a stock concentration of lOmM in DMSO). Following treatment, samples were washed and digested to obtain single-cell suspension using an umbilical cord dissociation kit (Miltenyi Biotec) as per the manufacturer’s protocol. Briefly, tissue was incubated with a mixture of 4 digestive enzymes at 37oC for 2 hours and further dissociated using a gentleMACS dissociator. After filtration through a 100-um strainer and a 5-minute incubation with a red blood cell lysis buffer (Biolegend), the cells were washed, resuspended in IMDM with 10% FBS, and transported on ice to the UM Advanced Genomics Core. Prior to sequencing, a viability of 75% or more was confirmed at the core. 10,000 cells were sequenced per sample at the resolution of 75,000 reads per cell.

[0123] Statistical analyses. Statistical significance was set at the 95% confidence interval. For the animal studies, experiments were performed with 3 or more biological replicates. For the cell-based studies, at least 3 independent experiments were performed in each experiment. Comparisons with normal distribution were analyzed by Student’s t-test (two-sample, assuming UM-43058.601 unequal variances), while those that do not fall within normal distribution were analyzed by Mann-Whitney test. For RNA-Seq, our in-house analysis pipeline was employed to perform adapter trimming and quality control procedures. The reads were mapped using STAR and gene expression was normalized and quantified by DESeq2 and HTSeq, respectively. Testing correction was performed to identify statistical significance, defined for RNA-Seq as a False Discovery Rate of < 5%.

[0124] Single-cell and spatial RNA seq revealed activation of immune cells, altered signaling in non-immune cells, and Hippo pathway dysregulation in PreE placenta

[0125] To characterize cellular composition and transcriptomic alterations in placentas affected by preeclampsia (PreE), single-cell RNA sequencing (scRNA-seq) was performed on placental tissue from three healthy donors (HD) and eight individuals with PreE (Table 2).

[0126] Table 2. Demographics of donors whose placentas were used for scRNA-seq analyses

[0127] Data are shown as mean (range) and percentage (n / N). Statistics analyzed byaMann-Whitney U- test orbFisher’s exact test.

[0128] After rigorous quality control and filtering, the dataset comprised 45,813 high-quality cells, with an average of 10,664 transcripts and 2,560 genes per cell. Data preprocessing using Seurat and integration with Harmony

[0010] facilitated unsupervised clustering based on differentially expressed genes (DEGs), resulting in identification of 23 distinct cell clusters. UM-43058.601

[0129] Visualization using Uniform Manifold Approximation and Projection (UMAP) and cluster annotation based on cluster- and lineage-defining genes revealed six major placental cell types: trophoblasts, maternal-derived stromal cells, endothelial cells (ECs), lymphocytes, and myeloid lineage cells. While overall composition of immune and non-immune clusters was comparable between HD and PreE placentas, an increased proportion of monocytes, B cells, and extravillous trophoblasts (EVTs), alongside a decreased proportion of a macrophage subpopulation (Mac3) and aP T cells in PreE samples was observed. Pseudobulk analysis across all cell populations confirmed significant upregulation of PreE-associated genes in the PreE cohort. Ingenuity Pathway Analysis (IP A) of predicted upstream regulators driving the PreE transcriptomic signature highlighted several key inflammatory mediators, including TNF, TGF i, IFNy, IL-1B, IL-4, and IL-33, reinforcing the central role of immune dysregulation in PreE pathogenesis.

[0130] Monocytes and macrophages from PreE placentas exhibited elevated expression of inflammatory genes, including interferon-responsive genes as well as CXCL2, ILIA, CCL3, and CCL20, all associated with immune activation, endothelial dysfunction, and previously implicated in PreE pathophysiology [12-15], In addition, T cell subsets in PreE placentas showed increased expression of inflammatory mediators: IL32 and GZMA were enriched in yb T cells, while CD8 T cells upregulated LFNG, GZMH, and GZMA. CD4 T cells in PreE placentas displayed enhanced expression of signaling molecules such as FYN and JUNB, but reduced expression of functional molecules CD40LG and TNF, consistent with reported impairments in regulatory T cell function in PreE

[0016] ,

[0131] Although B cells represented a relatively small fraction of the total placental immune population, they demonstrated notable gene expression changes in PreE. Specifically, B cells from PreE placentas showed reduced expression of SPIB, a transcription factor that limits plasma cell differentiation, along with increased expression of genes involved in immunoglobulin production and plasma cell function, including PRDM1, CD27, MZB1, and XBP1. Pathway analysis of these B cells revealed enrichment of IL-12-mediated signaling cascades that drive a B cell-intrinsic, IFNy-dependent feed-forward loop promoting plasmablast differentiation

[0017] , Additionally, expression of CXCR4, a receptor for stromal-derived factor 1 (SDF-1) that supports B cell survival under hypoxic conditions, was elevated, suggesting a potential adaptation to the altered placental microenvironment in PreE

[0018] , UM-43058.601

[0132] To assess spatial transcriptomic differences between HD and PreE placentas, Xenium spatial profiling was utilized on placental sections encompassing both maternal (decidua) and fetal (chorionic villi) compartments, identified by H&E and HLA-G positivity. By overlaying cell-type markers identified through our scRNA-seq dataset, all 23 identified cell types across the tissue architecture were successfully mapped. Notably, single-nucleus sequencing facilitated improved detection of multinucleated syncytiotrophoblasts (STBs). Spatial transcriptomic analysis confirmed the presence of immune dysregulation in PreE and revealed compartmentspecific expression patterns of key signaling molecules. For example, while both IFNGR1 and IFNGR2, the receptors for interferon-y (IFNy), were upregulated in PreE placentas, their spatial distribution diverged: IFNGR1 was predominantly localized to the fetal villous compartment, whereas IFNGR2 was confined to the maternal decidua. These findings underscore the importance of spatial context in understanding the compartmentalized immune responses associated with PreE.

[0133] Strikingly, trophoblasts, stromal cells, and other non-immune cell types exhibited a robust increase in PreE gene module scores, comparable to those observed in immune cells. Receptor-ligand interaction analysis predicted numerous PreE-specific signaling events between non-immune cell populations. Further analysis of complement and cytokine receptor-ligand expression patterns revealed distinct contributors to the inflammatory microenvironment in PreE, notably identifying decidual cells as a key source of C3 and CCL28. Gene expression changes in PreE non-immune cells implicated multiple dysregulated pathways, including networks centered on HIF-la and AP-1 transcription factors, Syndecan-1- and focal adhesion kinase (FAK)- mediated signaling, and pi integrin cell-surface interactions. In addition, fibrosis module scores were significantly elevated across most non-immune cell types, suggesting broad engagement of fibrotic processes in the PreE placenta.

[0134] Further analysis identified dysregulation of the Hippo signaling pathway — a known driver of fibrosis in various pathological contexts

[0019] — as a prominent feature of PreE. Receptor-ligand interaction analysis of Hippo pathway-associated genes revealed robust intercellular communication involving both immune and non-immune cell populations. The expression of key Hippo pathway effector genes was assessed and significant upregulation of multiple TEAD family transcription factors and VGLL family transcription co-regulators (TEAD1, TEAD3, WWTR1, VGLL1, VGLL3, and VGLL4) was observed, but not YAP1, in UM-43058.601

[0135] PreE placentas (FIG. 9). VGLL proteins lack DNA-binding domains and regulate gene expression by binding TEAD transcription factors. Expression of VGLL-3 across placental cell types was assessed and a markedly increased proportion of VGLL3 -expressing cells among PreE trophoblasts was observed.

[0136] Co-immunoprecipitation and subsequent mass spectrometry confirmed physical interactions between VGLL3 and TEAD1 / TEAD3. Spatial transcriptomic analysis further validated co-expression of VGLL3 with TEAD1 and TEAD3 in STBs and EVTs, with significantly higher co-localization scores and odds ratios in PreE. In healthy placentas, VGLL3Ahi trophoblasts were restricted to discrete regions, predominantly near decidua, whereas in PreE placentas, they expanded across broader placental regions — a distribution pattern paralleled by FLT1 expression. Finally, proximity ligation assay (PLA) confirmed increased physical proximity between VGLL3 and TEAD1 in PreE placentas, supporting their interaction in vivo.

[0137] To validate the findings in a larger and independent cohort, bulk RNA-seq data derived from a substantial number (n=84) of formalin-fixed paraffin-embedded placental samples was analyzed

[0022] , Despite the lower resolution of bulk sequencing compared to single-cell approaches, the results showed strong concordance with our scRNA-seq data. DEGs in PreE placentas included IGFBP1, a gene with polymorphisms previously associated with increased PreE risk

[0023] , and DDX20, a regulator of miRNA biogenesis in trophoblasts

[0024] critical for embryonic development

[0025] , Among the top dysregulated pathways were MHC class II, Smad, and TGF-P signaling, all of which are known to play roles in immune modulation and placental development.

[0138] IPA further identified VGLL3 as a predicted upstream regulator of the bulk RNA seq PreE gene expression signature. As a transcriptional co-regulator, VGLL3 is poised to influence multiple signaling cascades simultaneously by modulating the expression of diverse target genes. Thus, VGLL3 dysregulation in PreE likely contributes to multiple pathogenic processes in parallel. To further dissect the cellular and molecular consequences of VGLL3 activation in PreE, we next integrated our single-cell and spatial transcriptomics datasets to characterize VGLL3-driven shifts in placental biology. UM-43058.601

[0139] VGLL3 upregulation in PreE trophoblasts promotes inflammatory responses and apoptosis in STBs and abnormal interaction of EVTs with immunomodulatory ECs

[0140] The Hippo signaling pathway has been implicated in regulating the sternness and differentiation of placental trophoblasts

[0026] , To assess how TEAD1 and VGLL3 expression changes during trophoblast differentiation, we applied Monocle3 to our scRNA-seq data to infer developmental trajectories in trophoblast cells from both HD and PreE placentas

[0027] , While the overall pseudotime trajectories were comparable between conditions, TEAD1 and VGLL3 expression steadily increased across pseudotime in PreE extravillous trophoblast (EVT) cells, in contrast to a rise-and-fall pattern observed in HD samples.

[0141] To identify potential regulators of the PreE-specific gene expression changes during trophoblast differentiation, we first defined gene signatures comprising transcripts that were both upregulated across pseudotime in PreE EVTs or STBs and preferentially expressed in PreE over HD cells. We then used IPA to infer their upstream regulators of these signatures. For each predicted regulator, we calculated a module score based on its downstream target genes and assessed its correlation with pseudotime. This analysis revealed several inflammatory drivers — including lipopolysaccharide (LPS), type I interferons, IL-2, and TNF — as candidate regulators of the PreE-associated transcriptional shift. Together, these findings suggest that the trajectory of VGLL3 and TEAD1 expression is dysregulated during trophoblast differentiation in PreE and is accompanied by a progressive, pro-inflammatory transcriptional program in both STBs and EVTs.

[0142] To further characterize functional differences between VGLL3+and VGLL3 STBs, we interrogated our spatial transcriptomics data. VGLL3+STBs showed differential expression of several genes previously implicated in PreE, including TIMP2, TWIST1, and FLT1. Pathway enrichment analysis revealed that VGLL3+STBs were associated with activation of key signaling pathways including apoptosis, PI3K / AKT / mT0R, TGF-0, and IL-6 / JAK / STAT3. These findings are particularly relevant given that STBs in PreE are known to exhibit increased apoptosis, altered nutrient transport, and enhanced shedding of proinflammatory mediators — processes that contribute to the formation of syncytial knots and systemic maternal inflammation. Transcriptional profile of VGLL3+STBs suggests that VGLL3 may act upstream of these dysregulated processes in PreE, serving as a potential driver of STB dysfunction. UM-43058.601

[0143] Successful pregnancy depends on the ability of EVTs to invade the maternal decidua and remodel spiral arteries, a process that involves the replacement of vascular smooth muscle (VSM) cells and ECs. Impaired spiral artery remodeling is a hallmark of PreE. To better understand EVT interactions with ECs and VSMs, we performed high-resolution re-clustering of these populations and annotated subtypes using canonical markers. This included identification of endovascular EVTs (EVT2), lymphatic ECs (LymphEC), immunomodulatory ECs (ImmEC), and capillary ECs (CapEC). Across all EVT subtypes, PreE samples showed a significantly higher proportion of VGLL3+cells compared to HD. To assess whether VGLL3 expression influenced cell-cell communication, we conducted CellPhoneDB analysis (32) and observed that VGLL3+EVTs engaged in more ligand-receptor interactions than VGLL3 EVTs. Notably, these enhanced interactions were concentrated between VGLL3+EVTs and remodeling VSMs, mature VSMs, and ImmECs. Many of the VGLL3+-specific interactions were enriched for collagen- related ligands, fibrotic signaling molecules, and components of the WNT signaling pathway, supporting a role for VGLL3 in promoting fibrosis and vascular dysfunction in PreE.

[0144] To define the gene network centered around VGLL3 in trophoblasts, we analyzed VGLL3 -correlated gene expression across 80 trophoblast microarray samples. To stratify 6,634 genes with positive correlation to VGLL3 (Spearman’s p > 0), we applied a graphical method identifying a critical inflection point in the correlation decay curve, which yielded a refined set of 737 genes with strong VGLL3 correlation (p > 0.67) that constituted a localized transcriptional sub-network. Among the top VGLL3 -correlated genes were PSG2, PSG3, TGFBR2, and CSF2RB (p > 0.88). Functional enrichment analysis revealed that this VGLL3 -associated network was highly enriched for “granulocyte activation,” “cell activation involved in immune response,” “neutrophil degranulation,” and “myeloid leukocyte-mediated immunity”. To directly assess the transcriptional impact of VGLL3, we performed bulk RNA-seq following VGLL3 overexpression or knockdown in vitro. Differential expression analysis identified several key PreE-associated genes, C3, AXL, CTGF, and CYR61, among the top VGLL3 -regulated targets, underscoring VGLL3’s role as an upstream regulator of pathogenic gene expression in PreE.

[0145] Placental overexpression of Vgll3 is sufficient to trigger PreE-like phenotype

[0146] To assess whether placental overexpression of Vgll3 is sufficient to induce PreE-like symptoms, we generated a Cre / Lox-based mouse model in which Vgll3 overexpression was UM-43058.601 restricted to placental trophoblasts

[0028] , Placentas from Vgll 3 -overexpressing (OE) mice exhibited elevated Fltl, mirroring the molecular phenotype observed in human PreE placentas. Pregnant dams carrying Vgll3-OE placentas developed gestational hypertension, accompanied by reduced cardiac ejection fraction. Histological examination revealed fibrinoid necrosis and microthrombi formation around placental capillaries, along with immune cell infiltration. Maternal blood profiling showed elevated levels of mean platelet volume, hematocrit, total protein, blood urea nitrogen, triglycerides, and red blood cell distribution width, while placental growth factor (P1GF) was significantly reduced — a hallmark feature of human PreE. Offspring from Vgll3-OE placentas exhibited a 40% postnatal mortality rate, reduced body weight at one week of age, and lower adiposity by three weeks. These findings demonstrate that trophoblastspecific Vgll3 overexpression is sufficient to induce PreE-like pathology and impair fetal growth.

[0147] To evaluate the impact of Vgll3 overexpression on the placental transcriptome, we performed scRNA-seq on control and Vgll3-OE mouse placentas. Cell clusters were annotated using both mouse-specific marker genes and human signature scores. While mouse placenta does not have the same type of cells as human placenta, the trophoblast compartment included trophoblast giant cells (TBGCs) and spongiotrophoblasts (SpongTBs). In Vgll3-OE placentas, trophoblasts showed elevated expression of Fltl, Igf2, and Hl 9, mirroring human PreE trophoblasts, along with increased activation of the mTOR signaling pathway. Immune cells — B cells, myeloid cells, and T cells — also exhibited transcriptional changes consistent with human PreE.

[0148] To assess PreE signature enrichment, we identified PreE-specific genes (log2FC > 0.1, p < 0.05) from human EVT, STB, and cytotrophoblast (CTB) clusters and scored their mouse orthologs across mouse cell types. Trophoblasts and monocytes from Vgll3-OE placentas displayed significant upregulation of these PreE signatures. A reciprocal analysis using a Vgll3- OE mouse signature further confirmed elevated scores in human PreE CTB, EVT, and monocyte clusters compared to HD samples. These findings indicate that Vgll3 drives conserved PreE- associated transcriptional programs in both trophoblasts and monocytes across species. Pathway analysis in Vgll3-OE placentas identified PDGFR-0, ErbBl, and mTOR signaling as top dysregulated pathways in these cell types. UM-43058.601

[0149] Lastly, we analyzed ligand-receptor interactions in the mouse dataset and found that trophoblast-capEC interactions involving receptors critical for vascular integrity and angiogenesis were significantly enriched in dams with Vgll3-OE placentas compared to controls. These same interactions were also elevated in human VGLL3+EVTs relative to VGLL3 EVTs. Together, these findings demonstrate that Vgll3 overexpression in placentas induces PreE-like phenotypes and provides a viable in vivo model to study cellular and molecular mechanisms underlying PreE.

[0150] Deletion of Vgll3 suppresses placental inflammation in mice but does not disrupt pregnancy progression

[0151] To assess whether VGLL3 is essential for normal pregnancy, we monitored whole-body Vgll3 knockout (KO) mice throughout gestation. Vgll3 KO dams exhibited no overt abnormalities, and their pregnancies and offspring were comparable to wild-type (WT) controls. Transcriptomic profiling of KO placentas revealed distinct gene expression clustering. Among the most upregulated genes in Vgll3-null placentas was Pcsk6, a gene previously implicated in blood pressure regulation in PreE, with Pcsk6 deficiency linked to salt-sensitive hypertension

[0029] . Enrichment analysis of upregulated genes pointed to pathways involved in “positive regulation of cell migration” and “regulation of angiogenesis,” whereas downregulated genes were associated with “signaling events mediated by VEGFR1 and VEGFR2”.

[0152] Our analyses identified lipopolysaccharide (LPS) as a potential upstream regulator of the PreE-specific transcriptomic shift in human placentas, consistent with previous studies in which LPS was used to induce PreE-like inflammation in animal models

[0030] , To assess whether Vgll3 deletion mitigates LPS-induced inflammation, we administered daily LPS injections (Sigma- Aldrich L2630, 20 pg / kg) to pregnant WT and Vgll3 KO dams from embryonic day 7.5 to 17.5 and performed scRNA-seq on placentas collected at day 18.5. Deletion of Vgll3 did not substantially alter the composition of major placental cell clusters. However, scoring with a human PreE-specific gene signature revealed that TBGC1 cells from Vgll3 KO mice exhibited reduced expression of both STB and EVT PreE gene signatures. Moreover, Vgll3 KO trophoblasts showed decreased expression of an LPS-induced gene signature. In contrast, trophoblasts from Vgll3-OE placentas (in the absence of LPS) displayed increased expression of this same LPS signature compared to controls. These transcriptional changes were accompanied UM-43058.601 by a modest, though not statistically significant, reduction in blood pressure in LPS-treated Vgll3 KO dams compared to LPS-treated WT controls.

[0153] Further supporting the role of Vgll3 in regulating Fltl and cell adhesion molecule expression in trophoblasts, we observed reduced expression of these genes in trophoblasts from LPS-injected Vgll3 KO dams compared to LPS-injected WT controls, and conversely, increased expression in Vgll3 -overexpressing (OE) placentas compared to WT controls. Ligand-receptor interaction analysis revealed that PreE-specific trophoblast-EC interactions identified in the Vgll3-OE mouse model were significantly enriched in LPS-treated WT mice but diminished in LPS-treated Vgll3 KO mice. Among the top differentially regulated pathways in LPS-treated Vgll3 KO placentas were HIF-la and AP-1 signaling, particularly within EVTs, ECs, and monocytes. These findings underscore the importance of Vgll3 in driving inflammatory and adhesive signaling in trophoblasts and its broader impact on placental cell-cell communication. Given the effectiveness of Vgll3 deletion in attenuating placental inflammation in mice, we next sought to target VGLL3 / Hippo signaling in human PreE placentas.

[0154] Targeting Hippo pathway suppresses disease signaling in PreE placentas ex vivo

[0155] Verteporfin is a known inhibitor of Hippo pathway at the transcriptional level

[0031] , To evaluate whether verteporfin mimics the effects of VGLL3 inhibition, we treated HTR8 trophoblasts with either verteporfin or VGLL3 -targeting siRNA and performed bulk RNA-seq. Both treatments impacted overlapping pathways, including integrin-mediated cell surface interactions, angiogenesis, p53 effector signaling, and Syndecan-1 signaling.

[0156] Comparison of DEGs revealed substantial overlap: 1, 191 of the 1,493 DEGs identified in VGLL3 siRNA-treated cells (80%) were also differentially expressed in verteporfm-treated cells. Notably, verteporfin induced broader transcriptomic changes than VGLL3 siRNA, likely reflecting additional VGLL3 -independent effects. We categorized DEGs into those shared between treatments and those unique to each condition and performed pathway enrichment analyses for each group. The overlapping DEGs were enriched in pathways associated with apoptosis, TNF signaling, hypoxia, and mTORC signaling, all previously implicated in human PreE and the Vgll3-OE mouse model.

[0157] PreE placentas were treated ex vivo with the Hippo pathway inhibitor verteporfin, followed by single-cell RNA sequencing (scRNA-seq) analysis. Compared to vehicle (DMSO) UM-43058.601 controls, verteporfin treatment did not induce major shifts in overall cellular composition. Receptor-ligand expression analysis demonstrated that verteporfin broadly suppressed PreE- associated intercellular communication, most notably among decidual cells, stromal cells, ECs, and trophoblasts. Correspondingly, cytokine signaling was reduced across all major cell types following verteporfin treatment. Verteporfin treatment also attenuated PreE gene signature scores, previously derived from comparisons between untreated PreE and EID placentas, in both CTBs and EVTs. To further dissect verteporfm’s transcriptional effects, we compared DEGs from disease-state (PreE vs. HD) and treatment (verteporfin vs. DMSO) in trophoblasts. Multiple genes elevated in PreE were downregulated by verteporfin, including IGFBP7, COL17A1, EFNB1, and SEMA4C. In stromal cells, LTBP4, a regulator of TGF-0 activity and a recently identified VGLL3 target in salmon sexual maturation [32-34], was significantly elevated in PreE compared to HD and downregulated following verteporfin treatment.

[0158] Pathway enrichment of verteporfin-affected genes in immune cells highlighted suppression of ERBB1, IL-12, and BCR signaling, while in non-immune cells, verteporfin perturbed pathways involving integrin-mediated cell -surface interactions, angiogenesis, and FAK signaling. Notably, verteporfm-treated placental explants exhibited a substantial overlap in DEGs and pathways with those affected by WRW4, an FPR2 antagonist.

[0159] Taken together, these findings demonstrate that the dysregulation of the Hippo pathway in PreE leads to an immune imbalance at the maternal-fetal interface, alters trophoblast differentiation, and causes vascular endothelial dysfunction. As these key pathological processes of PreE converge on a VGLL3 -centered gene network, our data position VGLL3 as a pivotal master regulator in the etiology of PreE.

[0160] Further Results Details and Association with Figures

[0161] The in-silico analyses of the publicly available microarray data identified genes whose expression is correlated with VGLL3 in human placenta trophoblast cells. Using a graphical approach to identify a critical point in the decay of correlations among the 6634 genes (Figure 1A), a set of 737 genes with significant VGLL3-correlated expression (rs > 0.67) was defined, representing a local sub-network surrounding VGLL3 within the broader trophoblast gene expression network (Figures IB and 1C). Genes most strongly correlated with VGLL3 expression included pregnancy specific beta- 1 -glycoprotein 2 (PSG2), pregnancy specific beta-1- UM-43058.601 glycoprotein 3 (PSG3), transforming growth factor beta receptor 2 (TGFBR2) and colony stimulating factor 2 receptor beta common subunit (CSF2RB) (rs > 0.88) (Figure ID), all of which has been previously implicated in the pathophysiology of PE. As a group, the 737 VGLL3 -correlated genes were most strongly enriched with respect to the Gene Ontology (GO) biological process (BP) terms granulocyte activation, cell activation with immune response, neutrophil degranulation, and myeloid WBC mediated immunity (Figure IE), which is consistent with the role of VGLL3 in immune regulation and indicates that VGLL3 may contribute to the immune imbalance in PE placentas.

[0162] RNAi experiments in HTR8 trophoblasts confirmed that knocking down VGLL3 dysregulates molecular targets that have been linked to PE in literature, including AXL and ERAP1 (Table 1). Furthermore, either VGLL3 depletion by siRNA or its inhibition by Verteporfin disrupted molecular pathways associated with PE, including “integrins in angiogenesis”, “syndecan-1 mediated signaling events”, and “Notch signaling pathway” (Figure 2). Finally, transcriptomes of murine Vgll3-null placentas clearly separated from WT controls as determined by the principal component (PC) analysis. Analysis of the differentially expressed genes showed dysregulation of pathways in immune signaling, angiogenesis, and placenta growth factor (PGF) (Figure 3). Knocking out Vgll3 in mice did not affect pregnancy progression and had no adverse consequences on maternal or neonatal health, supporting safe targetability of VGLL3 in pregnancy.

[0163] A mouse model with placenta-specific overexpression of Vgll3 in which Rosa26-LSL- Vgll3+ dams were mated to Cypl9-Cre+ sires so that Vgll3 was overexpressed exclusively in the double-transgenic placentas was generated (Figure 4A). Dams with Vgll3 -overexpressing (OE) placentas developed hypertension in pregnancy (Figure 4B) and circulatory markers of inflammation and PE-specific disease processes, including increased total protein and triglycerides in serum (Figure 4D). H&E staining revealed microthrombi and fibrinoid necrosis around the placental capillaries in the Vgll3-OE placentas (arrows in Figure 4C). Furthermore, the pups bom from the Vgll3-OE placentas were smaller in size and had a 40% mortality rate by 3 weeks of age (Figure 4E).

[0164] Comparison of human placentas obtained from PE patients versus those from healthy donors established that trophoblast expression of VGLL3 is significantly increased on the mRNA level, as assessed by sc-RNA-Seq (Fig. 5A), and on the protein level, as confirmed by UM-43058.601 immunofluorescence (IF, Fig. 5B). Proximity Ligation Assay (PLA) also revealed increased colocalization of VGLL3 with TEADl in the placentas from PE patients versus healthy controls (Fig. 5C).

[0165] Furthermore, human PE placentas exhibited changes in trophoblast and leukocytes that were mirrored in the mouse Vgll3-OE placentas, including increased expression of FLT (Figure 6A) and other markers indicative of abnormal trophoblast differentiation and B cell activation and other features of immune dysfunction (Fig 6B).

[0166] PE-specific gene signatures obtained from human scRNA-Seq data were significantly upregulated in the corresponding cell types in mouse scRNA-Seq data and vice versa (Figure 6D-E).

[0167] Co-immunoprecipitation (Co-IP) in HTR8 cells that overexpress VGLL3 and TEADl revealed that VGLL3 pull-down indeed enriched for TEAD1. When VGLL3 was mutated at the predicted TEADl binding site, no TEADl enrichment was longer detected (Figure 7). These findings were confirmed by mass spectrometry. Therefore, VGLL3-TEAD interaction is a mechanism by which VGLL3 drives expression of its target genes in placenta.

[0168] The TEADl interaction in the human PE placentas ex vivo was targeted with Verteporfin along with other Hippo pathway inhibitors. Results indicated that Verteporfin successfully reduced PE-specific signature scores in immune cells, including T cells and monocytes, and limited cell-cell interaction in PE placentas (Figure 8).

[0169] UM-43058.601

[0170] Table 1 : VGLL3 RNAi dysregulate PE-associated targets in HTR8 cells.

[0171] REFERENCES

[0172] 1. Chappell, L.C., et al., Pre-eclampsia. Lancet, 2021. 398(10297): p. 341-354.

[0173] 2. Than, N.G., et al., Classification of preeclampsia according to molecular clusters with the goal of achieving personalized prevention. J Reprod Immunol, 2024. 161: p. 104172. 3. Maynard, S.E., et al., Excess placental soluble fms-like tyrosine kinase 1 (sFltl) may contribute to endothelial dysfunction, hypertension, and proteinuria in preeclampsia. J Clin Invest, 2003. 111(5): p. 649-58.

[0174] 4. Zeisler, H., et al., Predictive Value of the sFIt-EPIGF Ratio in Women with Suspected Preeclampsia. N Engl J Med, 2016. 374(1): p. 13-22. UM-43058.601

[0175] 5. Turan ov, A. A., et al., RNAi modulation of placental sFLTl for the treatment of preeclampsia. Nat Biotechnol, 2018.

[0176] 6. Simard, J.F., et al., Early-onset Preeclampsia in Lupus Pregnancy. Paediatr Perinat Epidemiol, 2017. 31(1): p. 29-36.

[0177] 7. Kamper-Jorgensen, M., H.S. Gammill, and J.L. Nelson, Preeclampsia and scleroderma: a prospective nationwide analysis. Acta Obstet Gynecol Scand, 2018. 97(5): p. 587-590.

[0178] 8. Cheng, X., et al., Early age at menarche is associated with an increased risk of preeclampsia and adverse neonatal outcomes: a 6-year retrospective study. Arch Gynecol Obstet, 2024. 310(2): p. 807-815.

[0179] 9. An, H., et al., Association of age at menarche with gestational hypertension and preeclampsia: A large prospective cohort in China. J Clin Hypertens (Greenwich), 2023. 25(11): p. 993-1000.

[0180] 10. Korsunsky, I., et al., Fast, sensitive and accurate integration of single-cell data with Harmony. Nat Methods, 2019. 16(12): p. 1289-1296.

[0181] 11. Deer, E., et al., The role of immune cells and mediators in preeclampsia. Nat Rev Nephrol, 2023. 19(4): p. 257-270.

[0182] 12. Ullah, A., et al., Pathophysiological impact of CXC and CX3CL1 chemokines in preeclampsia and gestational diabetes mellitus. Front Cell Dev Biol, 2023. 11: p. 1272536.

[0183] 13. Li, J., et al., Genetic variations in ILIA and IL1RN are associated with the risk of preeclampsia in Chinese Han population. Sci Rep, 2014. 4: p. 5250.

[0184] 14. Than, N.G., et al., Proteomic Profiles of Maternal Plasma Extracellular Vesicles for Prediction of Preeclampsia. Am J Reprod Immunol, 2024. 92(4): p. el3928.

[0185] 15. Wang, X., et al., Plasma Olink Proteomics Identifies CCL20 as a Novel Predictive and Diagnostic Inflammatory Marker for Preeclampsia. J Proteome Res, 2022. 21(12): p. 2998-3006.

[0186] 16. Hosking, S.L., et al., Treg cells promote decidual vascular remodeling and modulate uterine NK cells in pregnant mice. JCI Insight, 2024. 10(2).

[0187] 17. Elsner, R.A., S. Smita, and MJ. Shlomchik, IL-12 induces a B cell-intrinsic IL- 12 TFNgamma feed-forward loop promoting extrafollicular B cell responses. Nat Immunol, 2024. 25(7): p. 1283-1295.

[0188] 18. Jang, J.W., et al., CXCR4 promotes B cell viability by the cooperation of nuclear factor (erythroid-derived 2)-like 2 and hypoxia-inducible factor-lalpha under hypoxic conditions. Cell Death Dis, 2021. 12(4): p. 330.

[0189] 19. Dey, A., X. Varelas, and K.L. Guan, Targeting the Hippo pathway in cancer, fibrosis, wound healing and regenerative medicine. Nat Rev Drug Discov, 2020. 19(7): p. 480-494.

[0190] 20. Billi, A.C., et al., The female-biased factor VGLL3 drives cutaneous and systemic autoimmunity. JCI Insight, 2019. 4(8).

[0191] 21. Liang, Y., et al., A gene network regulated by the transcription factor VGLL3 as a promoter of sex-biased autoimmune diseases. Nat Immunol, 2017. 18(2): p. 152-160.

[0192] 22. Hesson, A.M., et al., Placental transcriptome analysis of hypertensive pregnancies identifies distinct gene expression profiles of preeclampsia superimposed on chronic hypertension. BMC Med Genomics, 2023. 16(1): p. 91.

[0193] 23. Peng, X., et al., Associations between IGFBP1 gene polymorphisms and the risk of preeclampsia and fetal growth restriction. Hypertens Res, 2023. 46(9): p. 2070-2084.

[0194] 24. Donker, R.B., et al., The expression of Argonaute2 and related microRNA biogenesis proteins in normal and hypoxic trophoblasts. Mol Hum Reprod, 2007. 13(4): p. 273-9. UM-43058.601

[0195] 25. Mouillet, J.F., et al., DEAD-box protein-103 (DP 103, Ddx20) is essential for early embryonic development and modulates ovarian morphology and function. Endocrinology, 2008. 149(5): p. 2168-75.

[0196] 26. Meinhardt, G., et al., Pivotal role of the transcriptional co-activator YAP in trophoblast sternness of the developing human placenta. Proc Natl Acad Sci U S A, 2020. 117(24): p. 13562-13570.

[0197] 27. Trapnell, C., et al., The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells. Nat Biotechnol, 2014. 32(4): p. 381-386.

[0198] 28. Wenzel, P.L. and G. Leone, Expression of Cre recombinase in early diploid trophoblast cells of the mouse placenta. Genesis, 2007. 45(3): p. 129-34.

[0199] 29. Chen, S., et al., PCSK6-mediated corin activation is essential for normal blood pressure. Nat Med, 2015. 21(9): p. 1048-53.

[0200] 30. Fan, M., et al., LPS Induces Preeclampsia-Like Phenotype in Rats and HTR8 / SVneo Cells Dysfunction Through TLR4 / p38 MAPK Pathway. Front Physiol, 2019. 10: p. 1030.

[0201] 31. Wei, L., et al., Verteporfin reverses progestin resistance through YAP / TAZ-PI3K-Akt pathway in endometrial carcinoma. Cell Death Discov, 2023. 9(1): p. 30.

[0202] 32. Verta, J.P., et al., A complex mechanism translating variation of a simple genetic architecture into alternative life histories. Proc Natl Acad Sci U S A, 2024. 121(48): p. e2402386121.

[0203] 33. Maamela, K.S., et al., Food Quality and Life-History Genotype Influence Maturation and Reproductive Traits in Female Atlantic Salmon. Mol Ecol, 2025. 34(8): p. el7735.

[0204] 34. Ahi, E.P., et al., Hippo-vgll3 signaling may contribute to sex differences in Atlantic salmon maturation age via contrasting adipose dynamics. Biol Sex Differ, 2025. 16(1): p. 23.

[0205] 35. Li, S., et al., Suppression of FPR2 expression inhibits inflammation in preeclampsia by improving the biological functions of trophoblast via NF-kappaB pathway. J Assist Reprod Genet, 2022. 39(1): p. 239-250.

[0206] 36. Natri, H , et al., The Pregnancy Pickle: Evolved Immune Compensation Due to Pregnancy Underlies Sex Differences in Human Diseases. Trends Genet, 2019. 35(7): p. 478-488.

[0207] 37. Mor, G., P. Aldo, and A.B. Alvero, The unique immunological and microbial aspects of pregnancy. Nat Rev Immunol, 2017. 17(8): p. 469-482.

[0208] 38. Fu, M., et al., The Hippo signalling pathway and its implications in human health and diseases. Signal Transduct Target Ther, 2022. 7(1): p. 376.

[0209] 39. Ma, F., et al., Systems-based identification of the Hippo pathway for promoting fibrotic mesenchymal differentiation in systemic sclerosis. Nat Commun, 2024. 15(1): p. 210.

[0210] 40. Ray, S., et al., Hippo signaling cofactor, WWTR1, at the crossroads of human trophoblast progenitor self-renewal and differentiation. Proc Natl Acad Sci U S A, 2022. 119(36): p. e2204069119.

[0211] 41. Hermann, A., et al., The Hippo pathway component Wwc2 is a key regulator of embryonic development and angiogenesis in mice. Cell Death Dis, 2021. 12(1): p. 1 17.

[0212] 42. Gu, B., et al., The TEA domain transcription factors TEAD1 and TEAD3 and WNT signaling determine HLA-G expression in human extravillous trophoblasts. Proc Natl Acad Sci U S A, 2025. 122(12): p. e2425339122.

[0213] 43. Lin, Q., et al., YAP-mediated trophoblast dysfunction: the common pathway underlying pregnancy complications. Cell Commun Signal, 2023. 21(1): p. 353.

[0214] 44. Liu, R., et al., Hippo-YAP 1 signaling pathway and severe preeclampsia (sPE) in the Chinese population. Pregnancy Hypertens, 2020. 19: p. 1-10. UM-43058.601

[0215] 45. Hu, M., et al., miR2l modulates the Hippo signaling pathway via interference with PP2A Bbeta to inhibit trophoblast invasion and cause preeclampsia. Mol Ther Nucleic Acids, 2022. 30: p. 143-161.

[0216] 46. Kjaemer-Semb, E., et al., Vgll3 and the Hippo pathway are regulated in Sertoli cells upon entry and during puberty in Atlantic salmon testis. Sci Rep, 2018. 8(1): p. 1912.

[0217] 47. Barson, N.J., et al., Sex-dependent dominance at a single locus maintains variation in age at maturity in salmon. Nature, 2015. 528(7582): p. 405-8.

[0218] 48. Elks, C.E., et al., Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies. Nat Genet, 2010. 42(12): p. 1077-85.

[0219] 49. Oliver, J.E. and A.J. Silman, Why are women predisposed to autoimmune rheumatic diseases? Arthritis Res Ther, 2009. 11(5): p. 252.

[0220] 50. Hori, N., et al., Vestigial-like family member 3 (VGLL3), a cofactor for TEAD transcription factors, promotes cancer cell proli feration by activating the Hippo pathway. J Biol Chem, 2020. 295(26): p. 8798-8807.

[0221] 51. Y amaguchi, N. , Multiple Roles of Vestigial-Like Family Members in Tumor Development. Front Oncol, 2020. 10: p. 1266.

[0222] 52. Soundararajan, R. and A.J. Rao, Trophoblast p ' seudo-tumorigenesis': significance and contributory factors. Reprod Biol Endocrinol, 2004. 2: p. 15.

[0223] 53. Hypertension in pregnancy. Report of the American College of Obstetricians and Gynecologists' Task Force on Hypertension in Pregnancy. Obstet Gynecol, 2013. 122(5): p. 1122-1131.

[0224] 54. Stuart, T., et al., Comprehensive Integration of Single-Cell Data. Cell, 2019. 177(7): p. 1888-1902 e21.

[0225] 55. McGinnis, C.S., L.M. Murrow, and Z.J. Gartner, DoubletFinder: Doublet Detection in Single-Cell RNA Sequencing Data Using Artificial Nearest Neighbors. Cell Sy st, 2019. 8(4): p. 329-337 e4.

[0226] 56. Yang, S., et al., Decontamination of ambient RNA in single-cell RNA-seq with DecontX. Genome Biol, 2020. 21(1): p. 57.

[0227] 57. Vento-Tonno, R., et al., Single-cell reconstruction of the early maternal-fetal interface in humans. Nature, 2018. 563(7731): p. 347-353.

[0228] 58. Haghverdi, L., et al., Batch effects in single-cell RNA-sequencing data are corrected by matching mutual nearest neighbors. Nat Biotechnol, 2018. 36(5): p. 421-427.

[0229] 59. Efremova, M., et al., CellPhoneDB: inferring cell-cell communication from combined expression of multi -subunit ligand-receptor complexes. Nat Protoc, 2020. 15(4): p. 1484- 1506.

[0230] 60. Kang, J.B., et al., Efficient and precise single-cell reference atlas mappingwith Symphony. Nat Commun, 2021. 12(1): p. 5890.

[0231] 61. Dries, R., et al., Giotto: a toolbox for integrative analysis and visualization of spatial expression data. Genome Biol, 2021. 22(1): p. 78.

[0232] 62. Lun, A T , D. J. McCarthy, and J.C. Marioni, A step-by-step workflow for low-level analysis of single-cell RNA-seq data with Bioconductor. FlOOORes, 2016. 5: p. 2122.

[0233] 63. Dobin, A., et al., STAR: ultrafast universal RNA-seq aligner. Bioinformatics, 2013. 29(1): p. 15-21.

[0234] 64. Anders, S., P.T. Pyl, and W. Huber, HTSeq—a Python framework to work with high- throughput sequencing data. Bioinformatics, 2015. 31(2): p. 166-9. UM-43058.601

[0235] 65. Love, M I , W. Huber, and S. Anders, Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol, 2014. 15(12): p. 550.

[0236] 66. Chu, V.T., et al., Efficient generation of Rosa26 knock-in mice using CRISPR / Cas9 in C57BL 6 zygotes. BMC Biotechnol, 2016. 16: p. 4. 67. Li, G., et al., The intervention effect of aspirin on a lipopolysaccharide-induced preeclampsia-like mouse model by inhibiting the nuclear factor-kappaB pathway. Biol Reprod, 2018. 99(2): p. 422-432.

Claims

UM-43058.601CLAIMSWe claim:

1. A method comprising: treating a subject having or at increased risk of preeclampsia (PE), eclampsia, or hypertensive disorders of pregnancy (HDP) with a Hippo pathway effector under conditions that reduce or prevent PE, eclampsia, or HDP.

2. The method of claim 1, wherein the Hippo pathway effector is a TEAD inhibitor.

3. The method of claim 1, wherein the Hippo pathway effector is a VGLL3 regulator.

4. The method of claim 3, wherein the VGLL3 regulator prevents the association of VGLL3 with TEAD.

5. The method of claim 1, wherein the Hippo pathway effector is Verteporfin.

6. The method of any one of the preceding claims, further comprising the step of assessing said subject determine risk of PE or eclampsia or HDP.

7. The method of claim 6, wherein said assessing comprises evaluating a sign or symptom of PE or eclampsia or HDP.

8. The method of claim 6 or 7, wherein said assessing is repeated one or more times.

9. The method of claim 8, wherein said assessing is repeated after said subject has delivered a baby.

10. The method of claim 9, wherein said sign or symptom of PE or eclampsia or HDP is selected from the group consisting of blood pressure, level of protein in the urine, swelling inUM-43058.601 the hands, feet, ankles, or face, headaches, sudden weight gain, nausea or vomiting, abdominal pain, or vision changes.

11. The method of any one of the preceding claims, wherein said subject is at increased risk of PE or eclampsia or HDP.

12. The method of any one of the preceding claims, wherein said subject is not at increased risk of PE or eclampsia or HDP.

13. The method of any one of the preceding claims, wherein said treating comprises systemic delivery of the Hippo pathway effector to the subject.

14. The method of claim 12, wherein said systemic delivery comprises injection, oral, or transdermal delivery.

15. The method of claim 14, wherein said injection comprises intravenous, subcutaneous, intramuscular, or intraperitoneal administration.

16. The method of any one of the preceding claims, wherein said treating further comprises co-administering an additional treatment for PE or HDP.

17. The method of claim 16, wherein said additional treatment is selected from the group consisting of high blood pressure medication, magnesium sulfate, and anti-seizure medication.

18. The use of a Hippo pathway effector to treat or prevent PE or eclampsia or HDP in a subject.

Images