Engineered virus-like particles comprising a base editor for the treatment of glaucoma, and applications thereof
Engineered virus-like particles with a base editor and guide RNA target the MYOC gene in TM cells to address the TM pathology in glaucoma, offering a precise and safe treatment by disrupting MYOC expression and reducing intraocular pressure.
Patent Information
- Application Number
- PCT/US2025/054455
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-06
- Filing Date
- 2025-11-06
- Publication Date
- 2026-05-15
AI Technical Summary
Current glaucoma treatments targeting aqueous humor production are ineffective in addressing the underlying trabecular meshwork (TM) pathology, leading to progressive vision loss, and existing gene editing methods like CRISPR-Cas9 suffer from off-target effects and inefficient tissue-specific delivery.
Engineered virus-like particles (eVLPs) comprising a ribonucleoprotein complex of a base editor and guide RNA are used to selectively target and edit genes associated with glaucoma, particularly the MYOC gene, using adenine base editors to disrupt its expression, thereby reducing intraocular pressure and preventing vision loss.
The eVLPs demonstrate high efficiency and specificity in targeting TM cells, minimizing off-target effects and toxicities, providing a safe and effective treatment for MYOC-associated glaucoma by precisely editing the MYOC gene.
Smart Images

Figure US2025054455_15052026_PF_FP_ABST
Abstract
Description
ENGINEERED VIRUS-LIKE PARTICLES COMPRISING A BASE EDITOR FOR THE TREATMENT OF GLAUCOMA, AND APPLICATIONS THEREOFCROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C. §119 from Provisional Application Serial No. 63 / 717,263, filed November 6, 2024, the disclosure of which is incorporated herein by reference.TECHNICAL FIELD
[0002] Provided are engineered virus-like particles comprising a ribonucleoprotein complex of a base editor and guide RNA that targets gene(s) associated with glaucoma, and applications thereof.INCORPORATION BY REFERENCE OF SEQUENCE LISTING
[0003] Accompanying this filing is a Sequence Listing entitled, ‘'00058-091 WO 1. xml” created on November 6, 2025, and having 15,353 bytes of data, machine formatted on IBM- PC, MS-Windows operating system. The sequence listing is hereby incorporated byreference in its entirety for all purposes.BACKGROUND
[0004] Glaucoma is the leading cause of irreversible blindness, and it is often associated with elevated intraocular pressure (IOP) due to damage to trabecular meshwork (TM) cells. Elevated IOP leads to axonal loss and blindness. The trabecular meshwork (TM) maintains normal IOP by regulating aqueous humor (AH) outflow resistance. In glaucoma, there is increased resistance to aqueous humor outflow through TM, thus elevating IOP. About 70% outflow is regulated by TM, however most of the current drug treatments approved for the glaucoma target AH production via ciliary body. Despite TM being major site of glaucomatous pathology, drugs acting directly on TM pathology have not yet been developed and vision loss continues to progress in some glaucoma patients, thus highlighting a critical need to develop an effective treatment that targets TM outflow to prevent vision loss in glaucoma patients.SUMMARY
[0005] Provided herein are engineered virus-like particles (eVLPs) comprising a ribonucleoprotein (RNP) complex of a base editor and guide RNA that targets gene(s) associated with glaucoma. As shown in FIG. 1, intracameral injection of eVLPs areselectively taken up by the TM cells and an RNP complex of an adenine base editor and gRNA are released in the cytoplasm of TM cells, which then enters the nucleus and binds to the MYOC region, ablating the initiation codon (ATG to GTG) to disrupt the MYOC gene. In the studies presented herein is the design and generation of eVLPs containing Cre or mCherry or an ABE RNP protein complex. The eVLPs were shown to have TM-specific tropism. Further, eVLP -mediated deliver}’ was also found to be highly efficient in precision genome editing of MYOC. The gene editing therapy disclosed herein directly addresses the molecular cause of MYOC-associated primary open-angle glaucoma (POAG) and juvenile open-angle glaucoma (JOAG), enabling treatment for previously unbeatable diseases.
[0006] In a particular embodiment, the disclosure provides a gene editing therapy for the treatment of glaucoma, comprising therapeutically effective amounts of engineered virus-like particles (eVLPs) comprising a ribonucleoprotein complex of a base editor and a guide RNA that targets gene(s) associated with glaucoma. In another embodiment, the eVLPs comprise a scaffold of a retroviral GAG protein, a POL protein, and a viral ENV protein. In yet another embodiment, the retroviral GAG and POL proteins are from a gammaretrovirus. In a further embodiment, the gammaretrovirus is selected from murine leukemia virus (MLV), Moloney murine leukemia virus (MMLV), Feline leukemia Virus or Gibbon ape leukemia virus (GALV). In yet a further embodiment, the viral ENV protein is from a rhabdovirus. In a certain embodiment, the rhabdovirus is a Vesicular stomatitis (VS) virus. In another embodiment, the base editor comprises a dCas9, dCas!2, or Cas9n nuclease linked to a TadA or APOBEC nucleoside deaminase. In yet another embodiment, the base editor is a cytosine base editor. In a further embodiment, the base editor is an adenine base editor. In yet a further embodiment, the base editor is NG-ABE8e and has the sequence of (SEQ ID NO: 1). In yet a further embodiment, the glaucoma is selected from primary Open- Angle Glaucoma (POAG), Primary angle closure glaucoma (PACG), Exfoliation glaucoma (XFG), and Juvenile openangle glaucoma (JOAG). In another embodiment, the guide RNA targets a gene associated with glaucoma selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1. ANGPTL7, GALC, PITX2, PITX3, FOXCI, FOXE3, PAX6. LMX1B. MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1 and CNTNAP2. In yet another embodiment, the guide RNA targets a gene associated with glaucoma selected from PITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, ANGPTL7, and COL11 AL In a further embodiment, the guide RNA targets a geneassociated with glaucoma selected from LOXL1 and CNTNAP2. In yet a further embodiment, the guide RNA targets a gene associated with glaucoma selected from MYOC. OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1, and GALC. In another embodiment, the base editor edits the initiation codon to disrupt the expression of the gene associated with glaucoma selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMC01, SIX1 / SIX6. LRP12 / ZFP, TBK1, ANGPTL7, GALC, PITX2. PITX3, FOXCI. FOXE3, PAX6, LMX1B, MAF PLEKHA7. PCMTD1 / ST18. COL11 Al, LOXL1 and CNTNAP. In yet another embodiment, the guide RNA targets MYOC. In a further embodiment, the base editor edits the MYOC initiation codon to disrupt the expression of the MYOC gene. In a certain embodiment, the guide RNA targets human MYOC and has the sequence of CTGCAATGAGGTTCTTCTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 11) (human MY OC gRNA). In another embodiment, the guide RNA targets mouse MY OC and has the sequence of GCTAGCATGAGGTTCTTCTGGTTTTAGAGCTAGAAATAGCAAGTTAAA ATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 13) (MY0C-A7 gRNA).
[0007] In a further embodiment, the disclosure also provides a pharmaceutical composition comprising a gene editing therapy disclosed herein and a pharmaceutically acceptable carrier, diluent, and / or excipient. In another embodiment, the pharmaceutical composition is formulated for intravitreal injection, intracameral injection, subretinal injection, or for topical administration to the eye(s). In yet another embodiment, the pharmaceutical composition is formulated for intracameral injection administration. In a further embodiment, the pharmaceutical composition further comprises one or more small molecule therapeutics or drugs that lower elevated intraocular pressure (IOP). In another embodiment, the one or more small molecule therapeutics or drugs are sodium 4- phenylbuty tale (PBA) and tauroursodeoxy cholic acid (TUDCA). In yet another embodiment, the one or more small molecule therapeutics or drugs is 5-amino-3-(l-hy droxy-2, 2,6,6- tetramethylpiperidin-4-yl)-1.2,3-oxadiazol-3-ium chloride (SA-2). In a further embodiment, the one or more small molecule therapeutics or drugs is selected from a prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, an alpha-adrenergic agonist, and a miotic. In yet a further embodiment, the one or more small molecule therapeutics or drugs isselected from bimatoprost, tafluprost, latanoprost, travoprost, betaxolol, timolol, brinzolamide, dorzolamide, brimonidine, and netarsudil. In a certain embodiment, the pharmaceutical composition further comprises an siRNA or an antisense oligo that lowers the expression of gene product(s) that causes elevated intraocular pressure (IOP). In another embodiment, the antisense oligo is selected from miRNA, RNAi, shRNA, siRNA, and aptamers. In yet another embodiment, the siRNA is selected from SYL040012. SYL1801 and QPI-1007. In a further embodiment, the siRNA or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMC01, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, ANGPTL7, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1 and CNTNAP2. In yet a further embodiment, the pharmaceutically acceptable diluent comprises buffered saline or purified water. In another embodiment, the pharmaceutically acceptable carrier, diluent, and / or excipient includes sodium citrate, hydroxyethyl cellulose, sodium hydroxide (to adjust pH), hydrochloric acid (to adjust pH), mannitol, sodium phosphate, dibasic sodium phosphate, carbomer 974P, tyloxapol, edetate disodium, hydroxypropyl methylcellulose, polysorbate 80, sodium chloride, edetate disodium and / or purified water.
[0008] In a particular embodiment, the disclosure further provides a method of treating glaucoma in a subject in need thereof, comprising administering a therapeutically effective amount of a gene editing therapy disclosed herein, or a pharmaceutical composition of the disclosure to the subject. In another embodiment, the subject has a glaucoma selected from POAG, PACG, XFG, and JO AG. In yet another embodiment, the subject has POAG or JOAG. In a further embodiment, the gene editing therapy or pharmaceutical composition is administered to the eye(s) of the subject. In yet a further embodiment, the gene editing therapy or pharmaceutical composition is administered to the eye(s) of the subject by intravitreal injection, by intracameral injection, by subretinal injection, or by topical application to the eye(s). In a certain embodiment, the gene editing therapy or pharmaceutical composition is administered to the eye(s) of the subject by intracameral injection. In another embodiment, the method further comprises administering one or more additional medications that lower intraocular pressure (IOP) to the subject. In yet another embodiment, the gene editing therapy is administered separately from one or more additional medications. In a further embodiment, the gene editing therapy is administered concurrently or sequentially with the one or more additional medications. In another embodiment, the the one or moreadditional medications that lower IOP are sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA). In yet another embodiment, the one or more small molecule therapeutics or drugs is 5-amino-3-(l-hydroxy-2,2,6,6-tetramethylpiperidin-4-yl)- l,2,3-oxadiazol-3-ium chloride (SA-2). In a further embodiment, the one or more additional medications that lower IOP is selected from prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, an alpha-adrenergic agonist, and a miotic. In a certain embodiment, the prostaglandin analogue is selected from latanoprost. travoprost, and bimatoprost. In a further embodiment, the beta blocker is selected from timolol and betaxolol. In yet a further embodiment, the carbonic anhydrase inhibitor is selected from dorzolamide and brinzolamide. In another embodiment, the alpha-adrenergic agonist is brimonidine. In yet another embodiment, the miotic is pilocarpine. In a certain embodiment, the combination therapy is administered to the subject in need thereof in combination with an siRNA or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP. In another embodiment, the gene editing therapy is administered separately from the siRNA or the antisense oligo. In yet another embodiment, the gene editing therapy is administered concurrently or sequentially with the siRNA or the antisense oligo. In a further embodiment, the antisense oligo is selected from siRNA, miRNA, RNAi, shRNA, and aptamers. In yet a further embodiment, the siRNA is selected from SYL040012, SYL1801 and QPI-1007. In a certain embodiment, the siRNA or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMC01, SIX1 / SIX6. LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, ANGPTL7, LOXL1 and CNTNAP2.
[0009] In a certain embodiment, the disclosure provides for a composition and / or a method as substantially described in the disclosure and figures presented herein.DESCRIPTION OF DRAWINGS
[0010] The accompanying drawings, which are incorporated into and constitute a part of this specification, illustrate one or more embodiments of the disclosure and, together with the detailed description, explain the invention's principles and implementations.
[0011] FIG. 1 provides a schematic representation of eVLP containing ABE and gRNA and its delivery approach to the trabecular meshwork (TM).
[0012] FIG. 2 demonstrates that eVLPs exhibit highly specific and robust tropism to TM in vivo eVLPs containing mCheriy protein were injected intracamerally in C57 mice, andmCherry expression was determined in whole mount anterior segment. N=4. Arrows show TM tissue.
[0013] FIG. 3A-B demonstrates that eVLP-Cre induces the functional activity of Cre in vivo: (A) Schematic representation of mTmG fluorescence reporter mice. These mice express tdTomato in all tissue, and expression of Cre induces conversion of tdTomato to GFP. (B) eVLPs containing Cre protein were injected intracamerally. and tdTomato to GFP conversion was examined via confocal microscopy 1-week post-injection. Treated animals are in the top row, and untreated controls are in the bottom row. N=8
[0014] FIG. 4 demonstrates the functional activity of Cre in vivo: eVLPs containing Cre protein induced robust GFP expression in TM cells. CB = ciliary body. N=4.
[0015] FIG. 5A-E demonstrates VLP-mediated base editing rescues ocular hypertension and preserves RGC function in Tg-CreMYOCY437Hmice. (A) Intracameral (IC) injection of VLP-Cre at week 0 to induce mutant MYOC expression and IOP elevation, followed by IC administration of VLP-ABE at week 6. Longitudinal IOP measurements demonstrating significant elevation by 3 weeks post-VLP-Cre and normalization of IOP by 8-10 weeks after VLP-ABE treatment (mean ± SEM, p < 0.05). (B-C) Representative pattern electroretinogram (PERG) amplitudes (B) and latencies (C) recorded at 10 weeks showing restored RGC function in VLP-ABE-treated eyes compared with elevated-IOP controls.(D) Whole-mount retinal immunostaining for RBPMS showing higher RGC density in VLP- ABE-treated eyes versus untreated glaucomatous eyes, as quantitated in (E). Scale bar = 50 pm.
[0016] FIG. 6 provides the polypeptide sequence for the base editor NG-ABE8e (SEQ ID NO:1).DETAILED DESCRIPTION
[0017] As used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an ocular condition" includes a plurality of such ocular conditions and reference to "the therapeutic" includes reference to one or more therapeutics and equivalents thereof known to those skilled in the art, and so forth.
[0018] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which thisdisclosure belongs. Although many methods and reagents are similar or equivalent to those described herein, the exemplary methods and materials are disclosed herein.
[0019] All publications mentioned herein are incorporated by reference in full for the purpose of describing and disclosing methodologies that might be used in connection with the description herein. The publications are provided solely for their disclosure prior to the fding date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure. Moreover, with respect to any term that is presented in one or more publications that is similar to, or identical with, a term that has been expressly defined in this disclosure, the definition of the term as expressly provided in this disclosure will control in all respects.
[0020] As used herein, the terms "‘guide polynucleotide,’7"guide sequence,” or "guide RNA” as can refer to any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequencespecific binding of a CRISPR complex to the target sequence. The degree of complementarity between a guide polynucleotide and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences known in the art.
[0021] The human eye is a very sensitive and complex organ. The human eye is composed of anterior and posterior chambers. The anterior segment is composed of tear film, cornea, pupil, lens, and ciliary body. The posterior segment is composed of conjunctiva, sclera, choroid, retina, vitreous humor, and optic nene. The structure and quantity of tears are controlled by orbital glands and epithelial secretions. Cornea is the front portion of the eye that conveys and focuses light into the eye. It is divided into epithelium, stroma, and endothelium. The epithelium is made of five to seven layers of firmly connected cells. Stroma is a water-based compact layer. The endothelium preserves the transparency of the cornea. Iris is the colored portion of the eye which controls the quantity of light penetrating the eye. The dark center opening in the middle of the iris is called pupil. The pupil changes its size according to the available light. The lens is the transparent portion that focuses the light into the retina. The ciliary body comprises pigmented and non-pigmented ciliary epithelia, a stroma, and ciliary muscles. Capillaries of the ci 1 iary body allow communication between anterior and posterior segments. Vitreous humor is a gel-like, clear, avascular connectivetissue that exists between the eye lens and the retina. It comprises 99.9% water, hyaluronic acid, ions, and collagen. The conjunctiva is a delicate transparent membrane lining the eyelids and shelters the frontal surface of the sclera. It is a mucous membrane that is composed of three layers: an outer epithelium, a substantia propria enclosing nerves, lymphatic and blood vessels, and a submucosa layer linked to the sclera. The sclera is a continuous of cornea. It is made of collagen and mucopolysaccharides. The choroid is the vascular layer that is located between the retina and the sclera. The retina is a thin film of tissue composed of neural and glial cells covering the back of the eye. It produces electrical impulses that are delivered through the optic nerve to the brain.
[0022] Glaucoma is a quite common optic neuropathy disease. Symptoms start with blurred vision that progresses into irreversible blindness in the late stage. It leads to blindness due to slow deterioration of the optic nerve axon and fatality of retinal ganglion cells. It is commonly connected with elevation in intraocular pressure (IOP) because of irregular formation or obstruction of the aqueous humor. Risk factors include age, race, diabetes, genetics, nearsightedness, migraine, and retinal vascular caliber. Glaucoma is more common in the women population as they represent 55% of open-angle glaucoma, 70% of angle closure glaucoma, and 59% of all forms of glaucoma in 2010. Worldwide incidence is estimated at 76 million in 2020 and is expected to elevate to 112 million by 2040. There are two types of glaucoma: open angle and closed angle. Open-angle glaucoma has no symptoms and is characterized by enlarging optic disc cupping and visual field that results in elevated prevention of drainage of aqueous humor through the trabecular meshwork. However, closedangle glaucoma is characterized by the elevated pressure resulting from the blockage of outflow pathways. About 76 million people suffer from glaucoma, and the number is expected to reach 112 million by 2040. Generally, anti-glaucoma drugs help to adjust either aqueous humor formation or drainage.
[0023] Glaucoma is often associated with elevated IOP due to damage to trabecular meshwork (TM) cells. Elevated OP due to damage to the trabecular mesh work (TM) is associated with primary open-angle glaucoma (POAG). However, current treatments that lower IOP do not address the underlying pathology of glaucomatous TM damage. Elevated IOP can lead to loss of RGC and irreversible blindness. Genetic defects contribute to the pathogenesis of POAG, and the identification of glaucoma-causing genes allowed the study of molecular pathways of glaucomatous TM damage and the development of novel targetedtherapies. Myocilin (MYOC) was the first glaucoma gene identified and is responsible for approximately 4% of POAG and most cases of juvenile-onset glaucoma (JOAG). MYOC- associated JOAG affects children and progresses rapidly to vision loss, and it is often less responsive to current medication since current treatments do not target the main pathology. Although the normal role of wild-type myocilin is unknown, mutations in MYOC cause a deleterious gain-of-function. leading to a lack of extracellular secretion and protein stress within TM cells. Previous studies have shown that wild type myocilin is not required for IOP regulation. Mutations in myocilin cause a gain-of-function phenotype in which mutant myocilin accumulates in the endoplasmic reticulum (ER), leading to ER stress and TM cell death. Therefore, knocking out myocilin at the genome level makes an ideal strategy to cure the disease permanently.
[0024] Recent advances in genome editing technologies allow investigators to directly alter the genes associated with disease pathology at the genomic level. CRISPR-Cas9 is the leading genome editing tool that allows knockout or genetic modification of specific genes. Previous studies have shown that targeting MYOC by a CRISPR-Cas9 system reduced mutant myocilin in TM and prevented glaucoma in transgenic mice. However, traditional CRISPR-Cas9 systems present two major challenges: (1) off-target effects: traditional CRISPR / Cas9-based gene knockouts introduce DNA double-strand breaks (DSBs), which pose serious concerns such as large deletions, translocations, and chromosomal abnormalities, and (2) lack of effective tissues-specific delivery methods: Current approaches utilize viral vectors, which produce Cas9 for longer duration of time resulting into higher and non-specific off-target effects as well as possible oncogenesis due to viral DNA integration. Consistent with this, significant off-target effects were observed in recent studies that utilized viral vectors to deliver Cas9.
[0025] Previous studies to target the glaucoma gene MY OC, which causes POAG, have utilized adenovirus (Ad) 5 to deliver Cas9 and guide RNA. Although Ad5 demonstrated successful editing of MYOC, Ad5 exhibits ocular inflammation, making it unsuitable for clinical use. Lentiviral particles expressing Cas9 and guide RNA targeting MYOC successfully rescued a mouse model of myocilin glaucoma. It was observed, however, that Cas9 induced significant off-target effects. To solve two major issues of off-target effects and inefficient viral delivery methods, engineered viral-like particles (eVLPs), which are DNA- free and cause no ocular toxicity were utilized herein.
[0026] The disclosure provides a solution to foregoing issues noted above, by using base editors to directly alter genes associated with ocular pathologies at the genomic level. Instead of using double-stranded DNA breaks, base editors use nucleobase modification chemistry to efficiently and precisely incorporate single nucleotide variants (SNVs) into the genome of living cells. Two classes of base editors currently exist: deoxy cytidine deamination-derived editors (CBEs, which facilitate OG to T»A mutations) and deoxyadenosine deamination- derived base editors (ABEs, which facilitate A»T to G»C mutations). More recently, the development of mitochondrial base editors also allowed the introduction of OG to T»A mutations into mitochondrial DNA. Base editors show great potential as therapeutic agents and research tools, and extensive studies have been carried out to improve upon the original base editor constructs to aid researchers in various disciplines.
[0027] DNA base editors are generally protein fusion constructs comprising a catalytically impaired Cas nuclease (dCas9, dCasl2, or Cas9n) linked to a single-stranded DNA (ssDNA)-specific nucleobase modifying enzyme. Upon localization of the Cas protein to its target DNA sequence, hybridization of the gRNA to its complementary DNA sequence displaces and exposes a small stretch of ssDNA at the PAM-distal region of the non- complementary strand. This exposure allows the ssDNA modifying enzyme to gain access to and chemically modify its target base within this ssDNA window.
[0028] Adenine base editors (ABEs) catalyze the transition mutation of A*T base pairs to G»C base pairs via deamination deoxyadenosine to form deoxyinosine as the mutagenic intermediate. Because both deoxyuridine and deoxyinosine are noncanonical DNA nucleotides, they are recognized as DNA lesions by the cell and repaired by cellular DNA repair mechanisms distinct from those utilized in DSB-reliant methods. To improve base editing efficiencies, the catalytically dead dCas9 protein can be changed to the nickase version, Cas9n, to introduce a nick on the non-modified DNA strand. This nick serves to bias the cellular repair mechanisms to replace this strand preferentially and use the mutagenic intermediate as a template for repair. The original ABE has been greatly improved. The new' ABE, called ABE8e, can convert A»T base pairs to G*C far faster than the original editor. The polypeptide sequence (SEQ ID NO: 1) for this base editor is provided in FIG. 6. ABE8e edits therapeutic targets in human cells with up to six-fold increased efficiency. It also shows a much w ider range of compatibility w ith different CRISPR proteins, w hich are needed to access targets throughout the genome.
[0029] Cytosine base editors (CBEs) enable programmable genomic C G-to-T A transition mutations and typically comprise a modified CRISPR-Cas enzyme, a naturally occurring cytidine deaminase, and an inhibitor of uracil repair. This chemical conversion is achieved through enzyme-mediated hydrolytic cytosine deamination to uracil, interpreted as thymine by DNA polymerases. To date, CBEs are ty pically composed of four distinct components: a naturally occurring cytidine deaminase (such as APOBEC, AID or CD A), an impaired form of Cas9 capable of nicking the non-base-edited strand of DNA, one or more units of uracil glycosylase inhibitor (UGI) peptide and a nuclear localization sequence (NLS). These components are ty pically covalently fused but may also be noncovalently assembled. CBEs have been widely exploited for gene reversion and cellular engineering and have the potential to provide therapeutic benefits to patients living with debilitating genetic diseases or malignancies. CBEs have been recently developed that use engineered variants of TadA (CBE-T), which enable high on-target C G to T A across a sequence-diverse set of genomic loci. CBE-T demonstrated robust activity in primary cells and caused no detectable elevation in genome-wide mutations.
[0030] Engineered virus-like particles (eVLPs), assemblies of viral proteins that can infect cells but lack viral genetic material, have emerged as potentially promising vehicles for delivering gene editing agents such as ribonucleoprotein (RNP) complexes. eVLPs retain the internal cavity of wild-type virus particles, which can be used to deliver cargo molecules. eVLPs are structurally variable, contributing to their range of functions, and can be categorized as enveloped types containing host cell membranes, non-enveloped forms made of capsid proteins alone, and engineered chimeric versions carrying additional antigens. eVLPs that deliver RNP complexes exploit the efficiency and tissue targeting advantages of viral delivery but avoid the risks associated with viral genome integration and prolonged expression of the editing agent. eVLPs can be pseudotyped with different glycoproteins, enabling specific targeting of cell types of interest with envelope protein engineering efforts. eVLPs are formed by spontaneous assembly and budding of retroviral polyproteins that encapsulate cargo molecules, such as RNP complexes, from producer cells. eVLPs lack a packaged genome but retain the ability to transduce mammalian cells and release cargo molecules. eVLPs are commercially available from a variety of vendors, some of which are pre-loaded with a base-editor RNP cargo (e.g, see addgene, product Id numbers: 181754, 181753, and 181751).
[0031] In a particular embodiment, the disclosure provides for engineered virus-like particles comprising ribonucleoprotein complexes of a base editor and guide RNA that targets gene(s) associated with glaucoma. Primary Open- Angle Glaucoma (POAG) is the most common form of glaucoma, affecting about three million Americans. It happens when the eye’s drainage canals become clogged over time. The inner eye pressure (also called intraocular pressure or IOP) rises because the correct amount of fluid cannot drain out of the eye. With open-angle glaucoma, the entrances to the drainage canals are clear and should be working correctly. Genes associated with POAG include, but are not limited to, MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, ANGPTL7, TBK1, and GALC. Primary angle closure glaucoma (PACG) is a chronic optic neuropathy associated with a loss of retinal ganglion cells and their axons. Pupil block is the most common cause. Patients with angle closure disease are typically asymptomatic until the condition becomes more advanced. Genes associated with PACG include, but are not limited to, ITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, MAF, PLEKHA7, PCMTD1 / ST18. and COL11A1. Exfoliation glaucoma (XFG) is the most common identifiable secondary form of open-angle glaucoma in the world. Also known as pseudoexfoliation, this form of glaucoma is caused by the abnormal accumulation of protein in the drainage system and other structures of the eye. As a group, patients with exfoliative glaucoma show higher pressures and faster disease progression than patients with classic primary open-angle glaucoma. The underlying cause is likely due to the abnormal protein and associated pigment blocking the outflow structures in the eye. Genes associated with XFG include, but are not limited to, LOXL1 and CNTNAP2. Juvenile open-angle glaucoma (JOAG) is a rare form of glaucoma that affects people between the ages of 3 and 35. It affects about 1 in 50,000 people. JOAG is characterized by rapid progressive disease and is often less responsive to medications than other types of glaucoma. The gene most associated with JOAG is MYOC. In a particular embodiment, the disclosure provides for engineered virus-like particles comprising ribonucleoprotein complex of a base editor and guide RNA that targets gene(s) associated with glaucoma that is selected from MYOC. OPTN, CYP1B1 AV1 / CAV2. CDKN2B, TMCO1. SIX1 / SIX6, LRP12 / ZFP, TBK1. ANGPTL7, GALC, P1TX2. P1TX3. FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1 and CNTNAP2. In a further embodiment, the gene associated with glaucoma is selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, ANGPTL7, CDKN2B, TMCO1, SIX1 / SIX6,LRP12 / ZFP, TBK1, and GALC. In another embodiment, the gene associated with glaucoma is selected from ITX2, PITX3. FOXCI, FOXE3, PAX6, LMX1B, and MAF PLEKHA7. PCMTD1 / ST18, and COL11A1. In yet another embodiment, the gene associated with glaucoma is selected from LOXL1 and CNTNAP2. In a certain embodiment, the gene associated with glaucoma is MYOC. MYOC encodes the myocilin protein, which is expressed throughout the body, but primarily in TM tissue in the eyes. TM is principally involved in regulating IOP, and elevated 1OP is the main risk factor associated with glaucoma. Several mRNAs extending in size from 1.8-2.3 kb are transcribed from the MY OC gene. The variation in transcript length arises due to the discrepancy in the use of three polyadenylation sites present at the 3' end of the gene. The MYOC gene yields a secreted glycoprotein build of 504 amino acids. More than 100 disease-causing alterations in MYOC have been identified. These alterations in MYOC can cause it to exhibit distinct phenotypes, such as having a varying age of disease onset, being prevalent among individuals of a particular race, or being influenced by environmental or epigenetic factors. Diseasecausing myocilin variants are prone to aggregate and accumulate inside the ER. When both WT and mutant myocilin are present in a heterozygous state inside TM cells, proteolytic processing and the secretion of WT myocilin molecules are also impeded. This occurs due to interactions resulting in the formation of hetero oligomers between the WT and mutant protein molecules. The ER stress response and associated cell toxicity, as a consequence of misfolded myocilin, constitute the broadly accepted mechanism for the pathogenesis of myocilin-associated glaucoma. In a particular embodiment, the disclosure provides for use of an eVLP containing an ABE ribonucleoprotein complex that targets the MYOC initiation codon (ATG to GTG) to disrupt expression from the MYOC gene.
[0032] The current standard of therapy for glaucoma revolves around lowering IOP. However, MYOC-associated POAG does not respond well to these treatments. By contrast, the gene editing therapy of the disclosure can provide an effective treatment for MYOC- associated POAG, and further has several advantages over traditional viral vector-mediated delivery of Cas9. including:(1) eVLPs selectively target TM at high efficiency, with no other tissues targeted by eVLPs when delivered via intracameral injection.(2) eVLPS are non-toxic and DNA free, and safer than traditional viral vectors, which express the editors over a prolonged period of time;(3) Since eVLPs deliver a RNP protein complex, which is degraded within a week, it reduces off-target effects significantly; and(4) base editing in the TM is likely to be much safer and more efficient and does not result in the formation of double-stranded breaks.
[0033] Any of a variety of art-known methods can be used to administer a gene editing therapy disclosed herein, either alone or in combination with one or more additional agents that lower 1OP. For example, gene editing therapy can be administered by topical application to the eye(s), by intravitreal injection, by intracameral injection, by subretinal injection, etc.
[0034] Preparations for ocular administration of a composition comprising a gene editing therapy disclosed include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil), and injectable organic esters such as ethyl oleate. Examples of aqueous carriers include purified water, saline, and buffered media, alcoholic / aqueous solutions, and emulsions or suspensions. Examples of parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, and fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives such as, other antimicrobial, antioxidants, cheating agents, inert gases and the like also can be included.
[0035] A pharmaceutical composition comprising a gene editing therapy of the disclosure can be in a form suitable for administration to a subject using carriers, excipients, and additives or auxiliaries. Frequently used carriers or auxiliaries include magnesium carbonate, titanium dioxide, lactose, mannitol and other sugars, talc, milk protein, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycols and solvents, such as sterile water, buffered saline, alcohols, glycerol, and polyhydric alcohols. Intravenous vehicles include fluid and nutrient replenishers. Preservatives include antimicrobial, chelating agents, and inert gases. Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like, as described, for instance, in Remington's Pharmaceutical Sciences, 15th ed., Easton: Mack Publishing Co., 1405-1412, 1461-1487 (1975), and The National Formulary XIV., 14th ed., Washington: American Pharmaceutical Association (1975), the contents of which are hereby incorporated by reference. The pH and exact concentration of the various componentsof the pharmaceutical composition are adjusted according to routine skills in the art. See Goodman and Gilman's, The Pharmacological Basis for Therapeutics (7th ed.).
[0036] The disclosure further provides for a pharmaceutical composition comprising a gene editing therapy disclosed herein that is administered by topical application to the eye(s), by intravitreal injection, by intracameral injection, or by subretinal injection. In a particular embodiment, the disclosure provides a pharmaceutical composition that comprises a gene editing therapy that is used to treat or prevent glaucoma.
[0037] Topical administration to the eyes typically takes the form of drops, suspensions, emulsions, gels, or ointment. Eye drops represent more than 95% of the marketed ocular products. They are used for delivering the medication into the anterior part of the eye but with short residence time. Their advantages include easy administration and accepted stability. Ocular suspensions and emulsions have the ability to deliver hydrophobic drugs but may lead to blurred vision. Ocular gels and ointments (semi-solid) could significantly enhance residence time. Solid dosage forms could be used to deliver water-sensitive drugs (powder), provide zero order release model (insert), or sustain residence time (therapeutic contact lens).
[0038] Intracameral injection directly delivers the drug into the anterior chamber of the eye. This targeted drug delivery technique overcomes the ocular barriers and offers a high therapeutic concentration of medication at the desired site and consequently better clinical outcomes. Intracameral drug delivery is a safe and effective modality with many advantages over topical delivery. These include excellent bioavailability, reduced systemic risk, and minimal ocular toxicity. Agents delivered via Intracameral injection have shown promising results against infection, inflammation, ocular hypertension, and neovascularization.
[0039] Intravitreal (IVT) injection is a widely used technique to deliver therapeutic agents, like vascular endothelial growth factor inhibitors, antibiotics and glucocorticoids. IVT injections are one of the most commonly performed ocular surgery procedure in the developed world, second only to cataract surgery7. The procedure is generally performed under local anesthesia with e.g., lidocaine 2%. During the procedure, the eyelids and eyelashes are treated with disinfectant such as a povidone-iodine solution. Subsequently, a 30-gauge needle is inserted through the sclera at the pars plana region, 3.5-4 mm posterior to the limbus between vertical and horizontal muscles. The therapeutic agent is directly injected into the vitreous cavity with limited reflux. IVT injections bypass the blood retinal barrier soas to provide clinically effective doses of therapeutic agents to the target tissue. Therapeutic intraocular concentrations of the gene editing therapy disclosed herein can be achieved immediately and effectively without the danger of systemic absorption and toxicity.
[0040] Unlike IVT, subretinal (SR) injections constitute ‘‘proper” ophthalmic surgery performed by vitreoretinal surgeons. SR injections are routinely used in severe cases of submacular hemorrhage or other complex vitreoretinal disease involving the subretinal space. In clinical research, subretinal surgery has been performed in macular translocation surgeries, electronic, or stem-cell implants and gene therapy trials, with the aim to prevent or reverse blindness. The SR injection can be performed under retro- / parabular anesthesia or under general anesthesia in an operating theater. After disinfection, a three-port pars plana vitrectomy is performed, mostly using standard 23 or 25G trocar systems. After successful detachment of the posterior hyaloid membrane and removal of the vitreous, e.g., a doublebarreled 23G needle with 41 G tip is inserted through the trocar. The tip is guided to the subretinal area, and a small infusion of balanced salt solution (BSS) is performed into the potential subretinal space to form a bleb. Once the subretinal space has formed and location of the bleb is within the targeted region, the same retinotomy (injection channel through neuroretina) is used to guide a second instrument with the same tip built into the subretinal space for the injection of the therapeutic agent using a controlled flow rate.
[0041] The disclosure further provides for a pharmaceutical composition comprising a gene editing therapy disclosed herein that is administered by injection (subcutaneous, intravenous, etc ), oral administration, inhalation, transdermal application, or rectal administration. Depending on the route of administration, the pharmaceutical composition can be coated with a material to protect the pharmaceutical composition from the action of enzymes, acids, and other natural conditions that may inactivate the pharmaceutical composition. The pharmaceutical composition can also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.
[0042] Pharmaceutical compositions suitable for injectable use include stenle aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the composition should be sterile and should be fluid to the extent that easy syringability exists. The carrier can be asolvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size, in the case of dispersion, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens. chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be typical to include isotonic agents, for example, sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
[0043] Sterile injectable solutions can be prepared by incorporating the pharmaceutical composition in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the pharmaceutical composition into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
[0044] The pharmaceutical composition can be orally administered, for example, with an inert diluent or an assimilable edible carrier. The pharmaceutical composition and other ingredients can also be enclosed in a hard or soft-shell gelatin capsule, compressed into tablets, or incorporated directly into the individual's diet. For oral therapeutic administration, the pharmaceutical composition can be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 1% by weight of active compound. The percentage of the compositions and preparations can, of course, be varied and can conveniently be between about 5% to about 80% of the weight of the unit.
[0045] The tablets, troches, pills, capsules, and the like can also contain the following: a binder, such as gum tragacanth, acacia, com starch, or gelatin; excipients such as dicalcium phosphate; a disintegrating agent, such as com starch, potato starch, alginic acid, and the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin, or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage unit form is a capsule, it can contain, in addition to materials of the abovetype, a liquid carrier. Various other materials can be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules can be coated with shellac, sugar, or both. A syrup or elixir can contain the agent, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye, and flavoring, such as cherry or orange flavor. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic / biocompatible in the amounts employed. In addition, the pharmaceutical composition can be incorporated into sustained- release preparations and formulations.
[0046] Thus, a “pharmaceutically acceptable carrier’' is intended to include solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the pharmaceutical composition, use thereof in the therapeutic compositions and methods of treatment is contemplated. Supplementary active compounds can also be incorporated into the compositions.
[0047] It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. “Dosage unit form” as used herein, refers to physically discrete units suited as unitary' dosages for the individual to be treated; each unit containing a predetermined quantity of pharmaceutical composition is calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specifics for the dosage unit forms of the disclosure are related to the characteristics of the pharmaceutical composition and the particular therapeutic effect to be achieve.
[0048] The principal pharmaceutical composition is compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable carrier in an acceptable dosage unit. In the case of compositions containing supplementary' active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the said ingredients.
[0049] Additionally, the disclosure provides for pharmaceutical compositions that comprise therapeutically effective amounts of a gene editing therapy disclosed herein in combination of one or more small molecule therapeutics or drugs that lower elevated intraocular pressure (IOP). In a particular embodiment, the one or more small molecule therapeutics or drugs are sodium 4-phenylbutytate (PBA) and tauroursodeoxycholic acid(TUDCA). In another embodiment, the one or more small molecule therapeutics or drugs is 5-amino-3-(l-hydroxy-2,2,6,6-tetramethylpiperidin-4-yl)-l,2.3-oxadiazol-3-ium chloride (SA-2). In yet another embodiment, the one or more small molecule therapeutics or drugs is selected from a prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, an alpha-adrenergic agonist, and a miotic. In a further embodiment, the one or more small molecule therapeutics or drugs is selected from bimatoprost, tafluprost. latanoprost, travoprost, betaxolol, timolol, brinzolamide, dorzolamide, brimonidine. and netarsudil. In other embodiments, the pharmaceutical composition further comprises an siRNA or an antisense oligo that lowers the expression of gene product(s) that causes elevated intraocular pressure (IOP). In a further embodiment, the antisense oligo is selected from miRNA, RNAi, shRNA, siRNA, and aptamers. In yet a further embodiment, the siRNA is selected from SYL040012, SYL1801 and QPI-1007. In a certain embodiment, the siRNA or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMC01, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, ANGPTL7, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1 and CNTNAP2.
[0050] The disclosure provides methods for treating glaucoma in a subject in need thereof, comprising: administering therapeutically effective amounts of a gene editing therapy disclosed herein to the subject, wherein the gene editing therapy is administered concurrently or sequentially, either alone or in combination with other therapeutic agents to a subject who has, or is at risk of having, glaucoma. The disclosure further provides that a gene editing therapy of the disclosure can administered to the subject in combination with compounds that lower IOP. Examples of compounds that lower IOP include prostaglandin analogues (e.g., latanoprost, travoprost, and bimatoprost). beta-blockers (e.g., timolol and betaxolol), carbonic anhydrase inhibitors (e.g, dorzolamide, and brinzolamide), alpha- adrenergic agonists (e.g, brimonidine), and miotics (cholinergic agonists) (e.g., pilocarpine). Other examples of compounds that lower IOP include, but are not limited to. PBA and TUDCA, and SA-2.
[0051] For use in the therapeutic applications described herein, kits and articles of manufacture are also described herein. Such kits can comprise a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a methoddescribed herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials such as glass or plastic.
[0052] For example, the container(s) can comprise a gene editing therapy disclosed herein, optionally in a composition or in combination with another agent as disclosed herein. The container(s) optionally have a sterile access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). Such kits optionally comprise an identifying description or label or instructions relating to its use in the methods described herein.
[0053] A kit will typically comprise one or more additional containers, each with one or more of various materials (such as reagents, optionally in concentrated form, and / or devices) desirable from a commercial and user standpoint for use of compounds described herein. Non-limiting examples of such materials include, but are not limited to, buffers, diluents, filters, needles, syringes; carrier, package, container, vial and / or tube labels listing contents and / or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.
[0054] A label can be on or associated with the container. A label can be on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself, a label can be associated with a container when it is present within a receptacle or carrier that also holds the container, e.g, as a package insert. A label can be used to indicate that the contents are to be used for a specific therapeutic application. The label can also indicate directions for use of the contents, such as in the methods described herein. These other therapeutic agents may be used, for example, in the amounts indicated in the Physicians' Desk Reference (PDR) or as otherwise determined by one of ordinary skill in the art.
[0055] The disclosure further provides that the compositions, systems and methods described herein can be further defined by the following aspects (aspects 1 to 56):1. A gene editing therapy for the treatment of glaucoma, comprising: therapeutically effective amounts of engineered virus-like particles (eVLPs) comprising a ribonucleoprotein complex of a base editor and a guide RNA that targets gene(s) associated with a glaucoma.2. The gene editing therapy of aspect 1, wherein the eVLPs comprise a scaffold of a retroviral GAG protein, a POL protein, and a viral ENV protein.3. The gene editing therapy of aspect 2, wherein the retroviral GAG and POL proteins are from a gammaretro virus.4. The gene editing therapy of aspect 3. wherein the gammaretrovirus is selected from murine leukemia virus (MLV), Moloney murine leukemia virus (MMLV), Feline leukemia Virus or Gibbon ape leukemia virus (GALV).5. The gene editing therapy of aspect 2, wherein the viral ENV protein is from a rhabdo virus.6. The gene editing therapy of aspect 5, wherein the rhabdovirus is a Vesicular stomatitis (VS) virus.7. The gene editing therapy f any one of aspects 1 to 6, wherein the base editor comprises a dCas9, dCasl2, or Cas9n nuclease linked to a TadA or APOBEC nucleoside deaminase.8. The gene editing therapy of any one of aspects 1 to 7, wherein the base editor is a cytosine base editor.9. The gene editing therapy of any one of aspects 1 to 7. wherein the base editor is an adenine base editor.10. The gene editing therapy of aspect 9, wherein the adenine base editor is NG- ABE8e and has the sequence of (SEQ ID NO:1).11. The gene editing therapy of any one of aspects 1 to 10, wherein the glaucoma is selected from primary Open- Angle Glaucoma (POAG). Primary angle closure glaucoma (PACG), Exfoliation glaucoma (XFG), and Juvenile open-angle glaucoma (JOAG).12. The gene editing therapy of any one of aspects 1 to 11, wherein the guide RNA targets a gene associated with glaucoma selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP. TBK1. ANGPTL7, GALC, PITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1 and CNTNAP2.13. The gene editing therapy of any one of aspects 1 to 12, wherein the guide RNA targets a gene associated with glaucoma selected from PITX2, PITX3, FOXCI, FOXE3, PAX6. LMX1B. MAF PLEKHA7, PCMTD1 / ST18, ANGPTL7, and COL11A1.14. The gene editing therapy of any one of aspects 1 to 12, wherein the guide RNA targets a gene associated with glaucoma selected from LOXL1 and CNTNAP2.15. The gene editing therapy of any one of aspects 1 to 12, wherein the guide RNA targets a gene associated with glaucoma selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMC01, SIX1 / SIX6, LRP12 / ZFP, TBK1, and GALC.16. The gene editing therapy of any one of aspects 1 to 15, wherein the base editor edits the initiation codon to disrupt the expression of the gene associated with glaucoma selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMC01, SIX1 / SIX6, LRP12 / ZFP, TBK1, ANGPTL7. GALC, P1TX2, P1TX3, FOXCI, FOXE3. PAX6. LMX1B. MAF PLEKHA7, PCMTD1 / ST18, COL1 1A1, LOXL1 and CNTNAP.17. The gene editing therapy of any one of aspects 1 to 12, 15 and 16 wherein the guide RNA targets MYOC.18. The gene editing therapy of aspect 17, wherein the base editor edits the MYOC initiation codon to disrupt the expression of the MYOC gene.19. The gene editing therapy of any one of aspects 1 to 18, wherein the guide RNA targets human MYOC and comprises the sequence of any one of SEQ ID NOs:10-12, particularly wherein the guide RNA targets human MYOC and has the sequence of SEQ ID NO: 11 (CTGCAATGAGGTTCTTCTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATA AGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC).20. The gene editing therapy of any one of aspects 1 to 18, wherein the guide RNA targets human MYOC and comprises the sequence of any one of SEQ ID NOs:5-8 and 13-14, particularly wherein the guide RNA targets mouse MYOC and has the sequence of SEQ ID NO: 13 (GCTAGCATGAGGTTCTTCTGGTTTTAGAGCTAGAAATAGCAAGTTAA AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC).21. A pharmaceutical composition comprising the gene editing therapy of any one of aspects 1 to 20, and a pharmaceutically acceptable carrier, diluent, and / or excipient.22. The pharmaceutical composition of aspect 21, where the pharmaceutical composition is formulated for intravitreal injection, intracameral injection, subretinal injection, or for topical administration to the eye(s).23. The pharmaceutical composition of aspect 21 or aspect 22, wherein the pharmaceutical composition is formulated for intracameral injection administration.24. The pharmaceutical composition of any one of aspects 21 to 23, wherein the pharmaceutical composition further comprises one or more small molecule therapeutics or drugs that lower elevated intraocular pressure (IOP).25. The pharmaceutical composition of aspect 24, wherein the one or more small molecule therapeutics or drugs are sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA).26. The pharmaceutical composition of aspect 24, wherein the one or more small molecule therapeutics or drugs is 5-amino-3-(l -hydroxy-2, 2,6, 6-tetramethylpiperidin-4-yl)- l,2,3-oxadiazol-3-ium chloride (SA-2).27. The pharmaceutical composition of aspect 24, wherein the one or more small molecule therapeutics or drugs is selected from a prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, an alpha-adrenergic agonist, and a miotic.28. The pharmaceutical composition of aspect 24 or aspect 25, wherein the one or more small molecule therapeutics or drugs is selected from bimatoprost, tafluprost. latanoprost, travoprost, betaxolol, timolol, brinzolamide, dorzolamide, brimonidine, and netarsudil.29. The pharmaceutical composition of any one of aspects 21 to 28, wherein the pharmaceutical composition further comprises a siRNA or an antisense oligo that lowers the expression of gene product(s) that causes elevated intraocular pressure (IOP).30. The pharmaceutical composition of aspect 29, wherein the antisense oligo is selected from miRNA, RNAi, shRNA, siRNA, and aptamers.31. The pharmaceutical composition of aspect 29 or aspect 30, wherein the siRNA is selected from SYL040012, SYL1801 and QPI-1007.32. The pharmaceutical composition of aspect 29 or aspect 30, wherein the siRNA or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, ANGPTL7, PAX6, LMX1B, MAF PLEKHA7. PCMTD1 / ST18. COL11A1, LOXL1 and CNTNAP2.33. The pharmaceutical composition of any one of aspects 21 to 32, wherein the pharmaceutically acceptable diluent comprises buffered saline or purified water.34. The pharmaceutical composition of any one of aspects 21 to 33, wherein the pharmaceutically acceptable earner, diluent, and / or excipient includes sodium citrate, hydroxy ethyl cellulose, sodium hydroxide (to adjust pH), hydrochloric acid (to adjust pH), mannitol, sodium phosphate, dibasic sodium phosphate, carbomer 974P, tyloxapol, edetatedisodium, hydroxypropyl methylcellulose, polysorbate 80, sodium chloride, edetate disodium and / or purified water.35. A method of treating glaucoma in a subject in need thereof, comprising: administering a therapeutically effective amount of the gene editing therapy of any one of aspects 1 to 20, or the pharmaceutical composition of any one of aspects 21 to 34, to the subject.36. The method of aspect 35, wherein the subject has a glaucoma selected from primary Open-Angle Glaucoma (POAG), Primary angle closure glaucoma (PACG), Exfoliation glaucoma (XFG), and Juvenile open-angle glaucoma (JOAG).37. The method of aspect 36, wherein the subject has POAG or JOAG.38. The method of aspect 35 or aspect 36. wherein the gene editing therapy or pharmaceutical composition is administered to the eye(s) of the subject.39. The method of aspect 38, wherein the gene editing therapy or pharmaceutical composition is administered to the eye(s) of the subject by intravitreal injection, by intracameral injection, by subretinal injection, or by topical application to the eye(s).40. The method of aspect 38 or aspect 39, wherein the gene editing therapy or pharmaceutical composition is administered to the eye(s) of the subject by intracameral injection.41. The method of any one of aspect 35 to 40, wherein the method further comprises administering one or more additional medications that lower intraocular pressure (IOP) to the subject.42. The method of aspect 41, wherein the gene editing therapy is administered separately from one or more additional medications.43. The method of aspect 41 or aspect 42. wherein the gene editing therapy is administered concurrently or sequentially with the one or more additional medications.44. The method of any one of aspects 41 to 43, w herein the the one or more additional medications that lower IOP are sodium 4-phenylbuty tate (PBA) and tauroursodeoxy cholic acid (TUDCA).45. The method of any one of aspects 41 to 43, wherein the one or more small molecule therapeutics or drugs is 5-amino-3-(l -hydroxy-2, 2,6, 6-tetramethylpiperidin-4-yl)- l,2,3-oxadiazol-3-ium chloride (SA-2).46. The method of of any one of aspects 41 to 43. wherein the one or more additional medications that lower IOP is selected from a prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, an alpha-adrenergic agonist, and a miotic.47. The method of claim 46, wherein the prostaglandin analogue is selected from latanoprost, travoprost, and bimatoprost.48. The method of claim 46, wherein the beta blocker is selected from timolol and betaxolol.49. The method of claim 46, wherein the carbonic anhydrase inhibitor is selected from dorzolamide and brinzolamide.50. The method of claim 46, wherein the alpha-adrenergic agonist is brimonidine.51. The method of claim 46, wherein the miotic is pilocarpine.52. The method of any one of aspects 35 to 51, wherein the combination therapy is administered to the subject in need thereof in combination with an siRNA or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP.53. The method of aspect 52, wherein the gene editing therapy is administered separately from the siRNA or the antisense oligo.54. The method of aspect 52 or aspect 53, wherein the gene editing therapy is administered concurrently or sequentially with the siRNA or the antisense oligo.55. The method of any one of aspects 52 to 54, wherein the antisense oligo is selected from siRNA, miRNA, RNAi. shRNA, and aptamers.56. The method of any one of aspects 52 to 55, wherein the siRNA is selected from SYL040012, SYL1801 and QPI-1007.57. The method of any one of aspects 52 to 56, wherein the siRNA or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, ANGPTL7, LOXL1 and CNTNAP2.
[0056] The following examples are intended to illustrate but not limit the disclosure. While they are typical of those that might be used, other procedures known to those skilled in the art may alternatively be used.EXAMPLES
[0057] The invention is illustrated in the following examples, which are provided by way of illustration and are not intended to be limiting.
[0058] Process to make eVLPs. BE-eVLPs were produced by transient transfection of Gesicle Producer 293T cells (Takara; 632617). Gesicle cells were seeded in T-75 flasks (Coming) at a density of 5 * 106cells per flask. After 20-24 h, the cells were transfected using the jetPRIME transfection reagent (Polyplus) according to the manufacturer’s protocols. For producing v4 BE-eVLPs, a mixture of plasmids expressing VSV-G (400 ng), MMLVgag-pro-pol (3,375 ng), MMLVgag-3xNES-NG-ABE8e (1,125 ng), and an sgRNA (4,400 ng) were co-transfected per T-75 flask.
[0059] 40-48 h post-transfection, producer cell supernatant was harvested and centrifuged for 5 min at 500 to remove cell debris. The clarified eVLP-containing supernatant was filtered through a 0.45-pm PVDF filter. For BE-eVLPs that were injected into mice, the filtered supernatant was concentrated 1000-fold by ultracentrifugation using a cushion of 20% (w / v) sucrose in PBS. Ultracentrifugation was performed at 23,000 rpm for 2 h (4 °C) using a SureSpin 632 rotor (Thermo, 75003032) in an Optima XE-90 Ultracentrifuge (Beckman Coulter). Following ultracentrifugation, BE-eVLP pellets were resuspended in cold PBS with 10% sucrose (pH 7.4) and centrifuged at 1,000 g for 5 min to remove debris. BE-eVLPs were frozen at a rate of -1 °C / min and stored at -80 °C. BE-VLPs were thawed on ice immediately prior to use.
[0060] Production and testing eVLP RNP constructs. The sgRNA constructs were production by KLD mutagenesis (NEB, M0554S) from previously described pU6 sgRNA plasmids in Huang et al., Nature Protocols 16: 1089-1128 (2021) To test BE-eVLPs, cells were plated for transduction in 48-well plates (Coming) at a density of 30,000-40,000 cells per well. After 20-24 h, BE-eVLPs were added directly to the culture media in each well. 48-72 h post-transduction, cellular genomic DNA was isolated as reported by Doman et al., Nature Biotechnology 38:620-628 (2020). Briefly, cells were washed once with PBS and lysed in 150 pL of lysis buffer (10 mM Tris-HCl pH 8.0, 0.05% SDS, 25 pg mL’1proteinase K (Thermo Fisher Scientific)) at 37 °C for 1 h followed by heat inactivation at 80 °C for 30 min.
[0061] eVLP exhibit highly specific and robust tropism to TM in vivo’. First was examined whether eVLPs containing mCherry protein exhibit mCherry expression in TMcells. eVLP-mCherry was intracamerally injected into C57 mice. 24 h after injections, mCherry was evaluated in fixed eyes using confocal imaging. As shown in FIG. 2. robust mCherry expression was observed selectively in TM tissue indicating that eVLPs have specific and robust tropism to TM tissue.
[0062] eVLP expressing Cre protein exhibits strong Cre activity in TM cells in vivo.It was further examined whether eVLPs can induce Cre activity in TM cells in vivo using florescence reporter reporter mTmG mice. Prior to Cre recombination, cell membrane- localized tdTomato (mT) fluorescence expression is present in every cell / tissue. Cre recombinase expressing cells have cell membrane localized EGFP (mG) fluorescence expression replacing the red fluorescence (see FIG. 3A). An intracameral injection of eVLPs expressing Cre protein was performed. GFP / tdTomato expression was examined in whole mount anterior segment tissues (see FIG. 3B). Compared to control mice, which only expressed tdTomato, Cre injected mice exhibited GFP expression selectively in TM cells, and efficiency of conversion neared 100%.
[0063] Also was examined tdTomato to eGFP conversion in cryosections of anterior segment as shown in FIG. 4. eVLPs-Cre injection induced robust eGFP expression selectively in TM cells (see FIG. 4). Excitingly, almost the entire TM is transduced by eVLPs, indicating that eVLPs are highly efficient in transducing the TM, and that high editing efficiencies with ABE are expected. eGFP in the neural retina was not observed.
[0064] Design of gRNA targeting MYOC: Guide RN As targeting MYOC were designed to target the following region of:Human MY OC : 5 -AGCCTCACCAAGCCTCTGCAATGAGGTTCTTCTGTGCACG-3’ (SEQ ID NO:2)Mouse MYOC:5 -GCTGCAGCTGTGGTCCCAAGATGCCAGCTCTCCATCTGCT-3' (SEQ ID N0:3)Transgene mouse MYOC:5 - CTGCTGCAGCCCAAGCTAGCATGAGGTTCTTCTGTGCACG-3' (SEQ ID NO:4)The following gRNA sequences were utilized:A7 MYOC gRNA: 5’-GCTAGCATGAGGTTCTTCTG-3’(SEQ ID NO: 5)A9 MYOC gRNA: 5’- GAAGCTAGCATGAGGTTCTTC-3' (SEQ ID NO:7)Human MYOC gRNA: 5’- CTGCAATGAGGTTCTTCTG-3’ (SEQ ID NOV)
[0065] The MYOC initiation codon was targeted (ATG to GTG) resulting in disrupting MYOC expression. Various gRNAs were created, including Human MYOC gRNA and MYOC-A7 sgRNA provided below, to target the MYOC initiation codon in order to disrupt MYOC expression in human eyes and in a mouse model of MYOC-associated glaucoma. gRNA sequence along with protospacer underlined targeting human MYOC:CTGCAATGAGGTTCTTCTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 11)MYOC-A7 sgRNA sequence with protospacer underlined targeting mouse MYOC:GCTAGCATGAGGTTCTTCTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 13)
[0066] VLP-Mediated Base Editing Reverses MYOC-Induced Ocular Hypertension and Restores RGC Function in vivo. Intracameral (IC) injection of VLP-Cre into Tg- CreMYOC437Hmice successfully induced expression of the pathogenic mutant MYOC transgene within the trabecular meshwork (TM), leading to progressive ocular hypertension. IOP began to rise significantly by 3 weeks post-VLP-Cre injection and remained elevated through 6 weeks, confirming robust disease induction (see FIG. 5A). At this point, a single intracameral administration of VLP-ABE (adenine base editor targeting the MYOC) was performed. Remarkably, IOP measurements showed a progressive decline beginning by 8 weeks post-VLP-ABE treatment, reaching near-baseline levels by 10 weeks, demonstrating efficient functional rescue of TM outflow physiology. Pattern electroretinography (PERG) recordings performed at 10 weeks revealed preservation of retinal ganglion cell (RGC) function as evident from improved PERG amplitude and reduced latencies in VLP-ABE- treated eyes compared with untreated glaucomatous controls (see FIG. 5B-C). Whole-mount immunostaining for RBPMS, a selective RGC marker, further confirmed structural protection (see FIG. 5D), showing markedly higher RGC survival in the VLP-ABE group relative to the elevated-IOP group (see FIG. 5E). Together, these data demonstrate that targeted base editing of MY OC in TM cells via VLP delivery reverses ocular hypertension and prevents RGC degeneration in vivo.
[0067] A number of embodiments have been described herein. Nevertheless, it will be understood that various modifications may be made without departing from the spirit andscope of this disclosure. Accordingly, other embodiments are within the scope of the following claims.
Claims
WHAT IS CLAIMED IS:1 . A gene editing therapy for the treatment of glaucoma, comprising: therapeutically effective amounts of engineered virus-like particles (eVLPs) comprising a ribonucleoprotein complex of a base editor and a guide RNA that targets gene(s) associated with a glaucoma.
2. The gene editing therapy of claim 1, wherein the eVLPs comprise a scaffold of a retroviral GAG protein, a POL protein, and a viral ENV protein.
3. The gene editing therapy of claim 2. wherein the retroviral GAG and POL proteins are from a gammaretrovirus.
4. The gene editing therapy of claim 3, wherein the gammaretrovirus is selected from murine leukemia virus (MLV), Moloney murine leukemia virus (MMLV), Feline leukemia Virus or Gibbon ape leukemia virus (GALV).
5. The gene editing therapy of claim 2, wherein the viral ENV protein is from a rhabdovirus.
6. The gene editing therapy of claim 5, wherein the rhabdovirus is a Vesicular stomatitis (VS) virus.
7. The gene editing therapy of claim 1. wherein the base editor comprises a dCas9, dCasl2, or Cas9n nuclease linked to a TadA or APOBEC nucleoside deaminase.
8. The gene editing therapy of claim 1, wherein the base editor is a cytosine base editor.
9. The gene editing therapy of claim 1, wherein the base editor is an adenine base editor.
10. The gene editing therapy of claim 1, wherein the base editor is NG-ABE8e and has the sequence of (SEQ ID NO: 1).
11. The gene editing therapy of claim 1 , wherein the glaucoma is selected from primary Open- Angle Glaucoma (POAG), Primary angle closure glaucoma (PACG), Exfoliation glaucoma (XFG), and Juvenile open-angle glaucoma (JOAG).
12. The gene editing therapy of claim 1, wherein the guide RNA targets a gene associated with glaucoma selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1. ANGPTL7, GALC, P1TX2. P1TX3. FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1 and CNTNAP2.
13. The gene editing therapy of claim 12, wherein the guide RNA targets a gene associated with glaucoma selected from PITX2, PITX3, FOXCI, FOXE3. PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, ANGPTL7, and COL11A1.
14. The gene editing therapy of claim 12, wherein the guide RNA targets a gene associated with glaucoma selected from LOXL1 and CNTNAP2.
15. The gene editing therapy of claim 12, wherein the guide RNA targets a gene associated with glaucoma selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMC01, SIX1 / SIX6, LRP12 / ZFP, TBK1. and GALC.
16. The gene editing therapy of claim 12, wherein the base editor edits the initiation codon to disrupt the expression of the gene associated w ith glaucoma selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMC01, SIX1 / SIX6, LRP12 / ZFP, TBK1, ANGPTL7, GALC. PITX2, PITX3, FOXCI. FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1 and CNTNAP.
17. The gene editing therapy of claim 1, wherein the guide RNA targets MYOC.
18. The gene editing therapy of claim 17, wherein the base editor edits the MYOC initiation codon to disrupt the expression of the MYOC gene.
19. The gene editing therapy of claim 18, wherein the guide RNA targets human MYOC and has the sequence of SEQ ID NO: 11.
20. A pharmaceutical composition comprising the gene editing therapy of claim 1 and a pharmaceutically acceptable carrier, diluent, and / or excipient.
21. The pharmaceutical composition of claim 20, where the pharmaceutical composition is formulated for intravitreal injection, intracameral injection, subretinal injection, or for topical administration to the eye(s).
22. The pharmaceutical composition of claim 21, wherein the pharmaceutical composition is formulated for intracameral injection administration.
23. The pharmaceutical composition of claim 20, wherein the pharmaceutical composition further comprises one or more small molecule therapeutics or drugs that lower elevated intraocular pressure (IOP).
24. The pharmaceutical composition of claim 23, wherein the one or more small molecule therapeutics or drugs are sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA).
25. The pharmaceutical composition of claim 23, wherein the one or more small molecule therapeutics or drugs is 5-amino-3-(l-hydroxy-2,2,6,6-tetramethylpiperidin-4-yl)-l,2,3- oxadiazol-3-ium chloride (SA- 2).
26. The pharmaceutical composition of claim 23, wherein the one or more small molecule therapeutics or drugs is selected from a prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, an alpha-adrenergic agonist, and a miotic.
27. The pharmaceutical composition of claim 23, wherein the one or more small molecule therapeutics or drugs is selected from bimatoprost, tafluprost, latanoprost, travoprost, betaxolol, timolol, brinzolamide, dorzolamide, brimonidine, and netarsudil.
28. The pharmaceutical composition of claim 20, wherein the pharmaceutical composition further comprises an siRNA or an antisense oligo that lowers the expression of gene product(s) that causes elevated intraocular pressure (IOP).
29. The pharmaceutical composition of claim 28, wherein the antisense oligo is selected from miRNA, RNAi, shRNA, siRNA, and aptamers.
30. The pharmaceutical composition of claim 28, wherein the siRNA is selected from SYL040012, SYL1801 and QPI-1007.
31. The pharmaceutical composition of claim 28, wherein the siRNA or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, ANGPTL7, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1 and CNTNAP2.
32. The pharmaceutical composition of claim 20, wherein the pharmaceutically acceptable diluent comprises buffered saline or purified water.
33. The pharmaceutical composition of claim 20, wherein the pharmaceutically acceptable carrier, diluent, and / or excipient includes sodium citrate, hydroxyethyl cellulose, sodium hydroxide (to adjust pH), hydrochloric acid (to adjust pH), mannitol, sodium phosphate, dibasic sodium phosphate, carbomer 974P, tyloxapol, edetate disodium, hydroxypropyl methylcellulose, polysorbate 80. sodium chloride, edetate disodium and / or purified water.
34. A method of treating glaucoma in a subject in need thereof, comprising: administering a therapeutically effective amount of the gene editing therapy of any one of claims 1 to 19, or the pharmaceutical composition of any one of claims 20 to 33, to the subject.
35. The method of claim 34, wherein the subject has a glaucoma selected from primary Open- Angle Glaucoma (POAG), Primary angle closure glaucoma (PACG), Exfoliation glaucoma (XFG), and Juvenile open-angle glaucoma (JOAG).
36. The method of claim 34. wherein the subject has POAG or JOAG.
37. The method of claim 34, wherein the gene editing therapy or pharmaceutical composition is administered to the eye(s) of the subject.
38. The method of claim 37, wherein the gene editing therapy or pharmaceutical composition is administered to the eye(s) of the subject by intravitreal injection, by intracameral injection, by subretinal injection, or by topical application to the eye(s).
39. The method of claim 38. wherein the gene editing therapy or pharmaceutical composition is administered to the eye(s) of the subject by intracameral injection.
40. The method of claim 34, wherein the method further comprises administering one or more additional medications that lower intraocular pressure (IOP) to the subject.
41. The method of claim 40, wherein the gene editing therapy is administered separately from one or more additional medications.
42. The method of claim 41. wherein the gene editing therapy is administered concurrently or sequentially with the one or more additional medications.
43. The method of claim 40, wherein the the one or more additional medications are sodium 4-phenylbutytate (PBA) and tauroursodeoxycholic acid (TUDCA).
44. The method of claim 40, wherein the one or more additional medications is 5-amino-3- (l-hydroxy-2,2,6,6-tetramethylpiperidin-4-yl)-l,2,3-oxadiazol-3-ium chloride (SA-2).
45. The method of claim 40, wherein the the one or more additional medications are selected from a prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, an alpha-adrenergic agonist, and a miotic.
46. The method of claim 45, wherein the prostaglandin analogue is selected from latanoprost, travoprost, and bimatoprost.
47. The method of claim 45, wherein the beta blocker is selected from timolol and betaxolol.
48. The method of claim 45, wherein the carbonic anhydrase inhibitor is selected from dorzolamide and brinzolamide.
49. The method of claim 45, wherein the alpha-adrenergic agonist is brimonidine.
50. The method of claim 45, wherein the miotic is pilocarpine.
51. The method of claim 34, wherein the combination therapy is administered to the subject in need thereof in combination with an siRNA or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP.
52. The method of claim 51, wherein the gene editing therapy is administered separately from the siRNA or the antisense oligo.
53. The method of claim 52, wherein the gene editing therapy is administered concurrently or sequentially with the siRNA or the antisense oligo.
54. The method of claim 51. wherein the antisense oligo is selected from siRNA, miRNA, RNAi, shRNA, and aptamers.
55. The method of claim 51, wherein the siRNA is selected from SYL040012, SYL1801 and QPI-1007.
56. The method of claim 51, wherein the siRNA or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, PAX6,LMX1B, MAF PLEKHA7, PCMTD1 / ST18, C0L11A1, ANGPTL7, LOXL1 andCNTNAP2.