A novel vector and method of its production thereof

The NIC-TK1 vector targets FeSl, FeS2, and CdTl genes in rice using CRISPR/Cas9 to enhance iron and zinc content and reduce cadmium, addressing nutritional deficiencies and health issues in rice grains.

WO2026105161A1PCT designated stage Publication Date: 2026-05-21INT CENT FOR GENETIC ENG & BIOTECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
INT CENT FOR GENETIC ENG & BIOTECH
Filing Date
2025-11-17
Publication Date
2026-05-21

AI Technical Summary

Technical Problem

Existing rice varieties have low micronutrient content, particularly iron and zinc, and high cadmium levels, leading to nutritional deficiencies and health issues, especially in developing countries, and existing methods do not effectively enhance these nutrients in the edible portions of grains without altering food habits.

Method used

A vector, specifically the NIC-TK1 vector, is used to knockout genes FeSl, FeS2, and CdTl in rice plants through CRISPR/Cas9 technology, enhancing iron and zinc accumulation and reducing cadmium translocation in the endosperm, using a codon-optimized Cas9 cassette and specific sgRNA sequences for targeted gene editing.

Benefits of technology

The method results in rice plants with significantly increased iron and zinc levels in the edible endosperm and reduced cadmium, improving nutritional quality and nutrient-use efficiency, while avoiding environmental and health concerns from marker genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000011_0001_TABLE
    Figure IMGF000011_0001_TABLE
  • Figure 00000025_0000
    Figure 00000025_0000
  • Figure 00000026_0000
    Figure 00000026_0000
Patent Text Reader

Abstract

The present invention provides a vector for knocking out one or more genes for increasing iron (Fe), zinc (Zn) amount and decreasing the amount of cadmium (Cd). The present invention also discloses a method for preparation of the said vector and introducing the vector for developing improved plant with enhanced or improved Fe and Zn accumulation and decreased Cd translocation into rice grain endosperms and high nutrient use efficiency (NUE). The present invention also discloses a plant with increased amount of iron (Fe), zinc (Zn) and decreased amount of cadmium (Cd).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] FIELD OF THE INVENTION

[0002] The present invention pertains to the field of plant biotechnology. In particular, the present invention provides a vector for knocking out one or more genes, a method for its preparation and its utility thereof.

[0003] BACKGROUND OF THE INVENTION

[0004] A commonly cultivated food crop is Rice (Oryza sativa L.) which is one of the important cereals and constitute the staple diet all over the world. The common micronutrients deficient in human diets are iron (Fe) and Zinc (Zn). Iron plays an important role as a micronutrient for humans and is primarily stored as haemoglobin in RBCs for oxygen transport throughout the body and is also essential for the proper functioning of several other proteins involved in various bodily processes. Due to poor grain micronutrient content (iron, zinc and pro-vitamin A) in cereals, prevalent nutritional deficiency related disorders caused amongst population having cereal-based diets, especially those dwelling in developing countries.

[0005] Recent research has identified key regulators of Fe and Zn uptake in rice, including Haemerythrin motif-containing Really Interesting New Gene (RING) and Zinc-finger proteins OsHRZl, OsHRZ2, and their Arabidopsis homologs, which negatively regulate Fe and Zn acquisition. The expression of iron deficiency-inducible genes involved in iron utilization is enhanced in OsHRZ -knockdown lines via RNAi, mainly during iron sufficient conditions (Kobayashi et al., 2013). OsLCTl is characterized as low-affinity cation plasma membrane-localized Cd exporter when knocked-down via RNAi led to decrease in grain Cd levels but in turn increased the Fe content (Uraguchi et al., 2011)

[0006] According to document US20150299722A1 discloses a method for breeding a plant with improved iron deficiency tolerance, and enhanced iron and zinc accumulation in an edible part of the plant by improving the quality by increasing the uptake of iron and zinc from the soil.

[0007] CN118562861 A discloses an application of OsCSG gene in improving rice seedling cadmium stress tolerance, wherein CDS sequence of rice OsCSG gene by knocking OsCSG genes out in rice by using a CRISPR-Cas9 technology, modifying a specific genetic locus of a target organism for high grain Fe / Zn contents, has earlier been identified as a promising food-based approach to overcome micronutrient malnutrition without altering existing food habits. Interest and effort in research and development of crops with output traits including enhancement of food nutrition is on the rise. The invention of CRISPR / Cas9 technology facilitates targeted modification of plant genome for elucidating and manipulating gene functions in plant research and biotechnology possible. The clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein (Cas) technology is a powerful genome-editing method with high efficiency and simplicity (Li etal. 2013).

[0008] Usually, the micronutrient accumulate outer layer of the grain which is sloughed off during milling and polishing. Therefore, there is requirement to generate plants with higher accumulation of Zn and Fe and lower concentrations of Cd in the edible portions (endosperm) of the grains, especially the endosperm region in white rice grains.

[0009] OBJECT OF THE INVENTION

[0010] An object of the invention is to disclose a vector for knocking out one or more genes, a method for vector formation, a method for introducing the vector into plant and its utility.

[0011] BRIEF DESCRIPTION OF FIGURES

[0012] Figure 1 depicts the Multiplex CRISPR / Cas9 (TaU3-777?Z7 / Os-U3-777?Z2 / Ta-U3-ZCT7) in pCRISPR / Cas9TKl-NIC vector construction. The gene names HRZ1 is also represented as FeSl HRZ2 is also represented as FeS2 and LCT1 is also represented as CdTl.

[0013] Figure 2 The structures of marker-free NIC-pCRISPR / Cas9 -TK1 binary vectors was ideally based upon the pCAMBIA1300 backbone. NLS, (nuclear localization sequence), essential sequences and restriction sites required for the cloning and analysis of sgRNA expression cassettes are given. Schematic representation of Cas9 cassette of binary vector NIC-pCRISPR / Cas9 TK-1 used for rice biolistic transformation. The maize pUbi promoter drives the transcription of the plant codon optimized SpCas9 gene that contains two SV40 NLS at the N and C termini NOS acts as a gene terminator. Bsal flanking site present at both 5’ and 3’ of gRNA scaffold, LB: Left border, RB: Right border.

[0014] Figure 3 depicts biolistic mediated rice transformation: The steps involved in tissue culture for the generation of edited rice lines.

[0015] Figure 4A depicts To positive Cas9 rice lines through multiplex CRISPR / Cas9 knockout the Fe & Zn-sensing genes and iron-binding haemerythrin RING ubiquitin ligases FeSl and FeS2.jsimultaneously knockout the cadmium transporter gene [(CdTl)l-46, 47 is WT: Cas9 positive rice lines, WT: Wild type rice BPT5204. Figure 4B depicts Ti positive Cas9 rice lines through multiplex CRISPR / Cas9 knockout the Fe & Zn-sensing genes and iron-binding haemerythrin RING ubiquitin ligases (FeSl), simultaneously knockout the cadmium transporter gene (CdTl). 1-18: Cas9 positive rice lines, WT: Wild type rice BPT5204.

[0016] Figure 4C depicts T2 positive Cas9 rice lines through multiplex CRISPR CAS9 / knockout the Fe & Zn-sensing genes and iron-binding haemerythrin RING ubiquitin ligases (FeSl and FeS2), simultaneously knockout the cadmium transporter gene CdTl) 1-18: Cas9 positive rice lines, WT: Wild type rice BPT5204.

[0017] Figure 4D depicts Cas9-free edited rice lines through multiplex CRISPR cas9 / knockout the Fe & Zn-sensing genes and iron-binding haemerythrin RING ubiquitin ligases (FeSl and FeS2), simultaneously knockout the cadmium transporter gene CdTl) 1-8: Cas9 free rice lines, WT: Wild type rice BPT5204; a. Cas9-free eight edited rice lines in dough stage; b. Cas9-free eight edited T2 &T3 rice lines in mature stage.

[0018] Figure 5 depicts PCR amplification of genomic DNA of edited rice lines using forward and reverse specific primers pairs of Cas9, FeSl, FeS2 and CdTl genes. M-100 bp DNA Ladder, -ve - Negative (water) control, P- positive control (plasmid), WT-wild-type (Negative control).

[0019] Figure 6 depicts mutations identified within the target sited of FeSl generated through CRISPR / Cas9 mediated genome editing.

[0020] Figure 7 depicts mutations identified within the target sited of FeS2 generated through CRISPR / Cas9 mediated genome editing.

[0021] Figure 8 depicts mutations identified within the target sited of CdTl generated through CRISPR / Cas9 mediated genome editing

[0022] Figure 9 depicts mutations identified with in the target sites of FeSl, FeS2 and CdTl generated through CRISPR / Cas9 mediated genome editing in Cas9-free edited rice lines generation. Figure 10 depicts electrophoretic gel images of genomic cleavage detection assay for FeSl gene samples for a) edited rice lines 1-9 b) edited rice lines 10-13 c) edited rice lines 14-18. Electrophoretic gel images of genomic cleavage detection assay for FeS2 gene samples for a) edited rice lines 1-13 b) edited rice lines 14-18.

[0023] Figure 11 depicts real-time expression analysis of T2 edited knockout lines through multiplex CRISPR / Cas9 knockout the Fe & Zn-sensing genes and iron-binding haemerythrin RING ubiquitin ligases (FeSl and FeS2 simultaneously knockout the cadmium transporter gene (CdTl) through fold change (log2) and 2AAAct method.

[0024] Figure 12 depicts real-Time expression analysis of edited knockout Cas9-free rice lines through multiplex CRISPR / Cas9 a) Fold change of FeSl, FeS2 and CdTl in edited rice lines in a) roots b) Flag leaf c) stem d) node e) flower.

[0025] Figure 13 depicts stereo-micrographs and intensity of staining represent the relative density of Fe, Zn and Cd in the edited Ti & T2 rice grain endosperms. A. Histochemical Detection for Elemental Distribution Tl: Localization of Fe, Zn, and Cd Densities Visualized by Staining Intensity. B. Stereomicrographs of T2 revealed high Fe, Zn and Low Cd in endosperms of KO-Mutants and KO Mutants Performed Better than WT. This figure 13B also provides the phenotyping: comparative morpho-agronomic trait performance analysis.

[0026] Figure 14 depicts stereo - micrographs of longitudinally cut in the edited Cas9- free rice grains surface by PPB (Peris' Prussian blue), DTZ (Dithizone) and QAI (2-(8-quinolylazo)-4,5-diphenylimidazole). SDN-1 biofortified samba mahsuri rice Cas9-Free events with enhanced Iron+Zinc & Low Cd in endosperms employing CRISPR. Edited rice events showed enhanced growth performance and yield. Histochemical detection showed that grain, endosperms (Central Edible Part) harboured high Iron-Zinc & low Cd. 1-8: Cas9-free rice lines, WT: Wild type rice BPT5204 a. Dough stage b. Mature stage.

[0027] Figure 15 depicts elemental analysis by inductively coupled plasma-mass spectrometry (ICP-MS): Determination of Iron (Fe), Zinc (Zn) and Cadmium (Cd) content in white rice grain endosperms of T2 edited rice lines.

[0028] Figure 16 depicts comparative panicles analysis of wild-type and edited rice lines: a) Panicles of Ti edited rice lines and wild type, b) Panicles of T2 edited rice lines and wild type, c) Panicles of Cas9-free edited rice lines Scale bars, 1 cm.

[0029] Figure 17 depicts photographs of spikelets and panicles of wild-type and edited rice lines: a) Grains of Ti edited rice lines and wild type b) Grains of T2 edited rice lines and wild type c) Grains of Cas9-free edited rice lines. Scale bars, 1 cm.

[0030] Figure 18 depicts estimation of enzyme activities related to amylose biosynthesis in genome edited Ti, T2 generation and Cas9-free plants: Granule-Bound Starch Synthase (GBSSI), Soluble Starch Synthase (SSSI), and Starch Branching Enzyme (SBE). Figure 19 depicts bioavailability studies in mice, elemental analysis for blood serum iron and zinc content using (ICP-MS) in different experimental groups (A, B, C, D and E) in mice. Figure 20A depicts protocol for histochemical detection and localization of iron, zinc and cadmium in rice seeds. Figure 20B depicts measurement area of the grains to estimate intensity of staining with different stains for iron, zinc and cadmium through the RGB colour (Red, Green and Blue). A represents starting point, and B represents ending point - in different seed regions (Embryo, Aleurone and Endosperm).

[0031] Figure 21 depicts histochemical analysis by stereo-micrograph showing the intensity of Peris’ Prussian blue staining in wild type and edited T2 rice seeds.

[0032] Figure 22. depicts elemental analysis by inductively coupled plasma-mass spectrometry (ICP-MS) for T2 lines.

[0033] Figure 23 (a-e) depicts ICP-MS analysis of batches 1 to 5 providing comparative morpho-agronomic traits performances analysis of WT and CRISPR-Cas9 reagent (Cas9 gene) harbouring Ti , T2 and T3 edited rice lines. Analyses of WT and 3 Gene_KO_T2 Edited Rice Lines, the multiplexed Edited Rice Lines exhibited enhanced morpho-agronomic traits & growth performance and higher yield than the WT Lines. Data represents the mean ± SE of three independent experiments (n = 3).

[0034] Figure 24 depicts comparative morpho-agronomic traits performances for Ti (24A & B), T2 (24C&D) and Cas9-free rice lines (24E &F).

[0035] Figure 25 (A) depict pollen grain viability analysis using I2 / KI solution. (B) pollen grain fertility analysis using acetocarmine solution in which I, II and III represents different microscopic fields red triangle represents viable pollen grain, yellow triangle represents non-viable pollen grain, blue triangle represents fertile pollen grain; green triangle represents sterile pollen grain. This figure depicts rice pollen grain viability test for the edited rice lines and wild type grown under normal growth conditions. (C) depicts rice pollen grain viability test for T2.

[0036] (D) depicts rice pollen grain viability test for wild-type and Cas9-free edited rice lines grown under normal growth conditions.

[0037] Figure 26 depicts viability test percentage, fertility test percentage, rice pollen grain tube lengths (pm) for edited rice lines and Wild-Type grown under normal growth condition. Figure 27 depicts anther in mature spikelets of Samba mahsuri Wild-Type, and Ti, T2 edited rice lines. Figure 28 depicts ICP-MS analysis of iron (Fe), zinc (Zn), cadmium (Cd) and Co concentrations in Grain Endosperms of genome-edited Ts generation FERRIZE Genome Edited SDNl rice lines. ICP-MS analysis of iron (Fe), zinc (Zn), and cadmium (Cd) contents in genome edited T3 generation rice lines. The genome edited lines exhibited increased Fe (25 ppm to 120 ppm) and Zn (30 ppm to 145 ppm) levels and showing a reduction in Cd content in rice grains (0.012-0.001 ppm), ppm is microgram per gram.

[0038] Figure 29 depicts ICP-MS analysis of Potassium (K), Manganese (Mn), Magnesium (Mg), Phosphorus (P), Calcium (Ca), Copper (Cu) and Cobalt (Co) contents in genome edited T3 generation rice lines. The genome edited lines exhibited increased K, Mn, Mg, P, Ca, Cu and Co levels in rice grains.

[0039] Figure 30 (A) depicts explanation of ICPMS elemental analysis for SDN 1 FERRIZE 3 Gene KO Gene Edited Rice Lines. (B) depicts ICPMS elemental analysis for SDN 1 FERRIZE 3 Gene KO Gene Edited Rice Lines showing enhanced uptake of nitrogen and iron and zinc.

[0040] Figure 31 depicts vector construction and rice transformation.

[0041] Figure 32 depicts flow chart for molecular validation through PCR analysis for transformed plants and sending it for Sanger’s sequencing for primary screening.

[0042] Figure 33 depicts A-B depicts PCR using Cas9 specific primers.

[0043] Figure 34 depicts Wild-type & Cas9-free edited seedlings grown in iron-sufficient / -deficient hydroponic media for 21 days. In contrast to WT, the EL (edited lines) exhibited profuse root growth & shoot growth under Fe sufficiency & deficiency states.

[0044] Figure 35 depicts WT & Edited Cas9-free Rice Plants Grown Hydroponically Under Different Fe & Zn Concentrations. Edited lines tolerate upto 200 pM of iron and 650 pM of zinc in comparison to WT, which stop growing at and 50 pM of Fe and 100 pM of Zn .

[0045] Figure 36 depicts WT & Edited Cas9-free rice plants grown hydroponically under different Cd-concentrations. edited lines tolerate unto 650 pM of cadmium in comparison to WT, which stop growing at 100 pM (scale bars-lcm).

[0046] Figure 37 depicts genome edited high iron-zinc low Cd_ rice plants in green house condition. WT rice plants showed Late maturing panicles & Late flowering. Edited rice plants exhibited accelerated maturity in panicles and early flowering. Fe and Zn-enhanced edited lines exhibited east flowering, 15-20 days earlier than WT plants.

[0047] Figure 38 depicts Fe toxicity- histochemical detection of ROS (H2O2 & O2) content and bronzing in shoots and seeds. NO Fe-Toxicity in the form of “Bronzing” or ROS-related damage in leaves & grains of 3_Gene KO Lines.

[0048] SUMMARY OF THE INVENTION

[0049] The present invention focuses on the development of nutritionally improved and environmentally safe rice varieties. More specifically, the invention provides a vector (NIC-TK1) for producing genome-edited rice plants that exhibit enhanced accumulation of bioavailable iron and zinc, and reduced cadmium translocation in the endosperm by knockingout one or more genes selected from FeSl, FeS2 and CdTl and methods for the same.

[0050] The present invention discloses a vector for knocking out one or more genes for increasing iron (Fe), zinc (Zn) amount and decreasing the amount of cadmium (Cd), wherein the said one or more genes are selected from FeSl, FeS2 and CdTl. The FeSl, FeS2 and CdTl genes were knocked out by NIC-TK1 vector.

[0051] The present invention specifically a discloses a vector or plasmid DNA for 3 genes knock out, where the genes knocked out are FeSl, FeS2 and CdTl genes and the vector is denoted by SEQ. ID No. 1.

[0052] The OsHRZI-OsHRZ2-OsLCTl-NIC-TKl vector has 18044 bp length, designed to carry a codon-optimized Cas9 cassette from Streptococcus pyogenes under a maize ubiquitin promoter with nopaline synthase terminator, and sgRNA sequences for the target genes driven by riceU3 denoted by SEQ ID No.22 and wheat U3 promoter denoted by SEQ ID No. 25.

[0053] Specific sgRNA sequences (SEQ ID Nos. 2, 3 and 4) were designed to target the Haeme-binding domains and Cd transporter regions of the respective genes (FeSl, FeS2 and CdTl genes).

[0054] The present invention discloses a method for producing the OsHRZI-OsHRZ2-OsLCTl-NIC-TK1 vector denoted by SEQ. ID No. 1 for knocking out FeSl, FeS2 and CdTl genes including the following steps: i. selecting a suitable vector backbone,

[0055] ii. designing and assembling the sgRNAs specific to the genes selected from one or more FeSl, FeS2 and CdTl genes, and

[0056] iii. constructing the Cas9 expression cassette.

[0057] The present invention further discloses a method for obtaining an improved rice plant with enhanced or improved Fe and Zn accumulation and decreased Cd translocation into rice grain endosperms and high nutrient-use efficiency comprising steps:

[0058] i. inducing callus formation from Oryza sativa cv. BPT5204 (Samba Mahsuri) seeds, ii. transforming the Calli via biolistic bombardment with gold particles coated with the NIC-TK1 construct,

[0059] iii. regenerating plants through standard tissue culture and hardening processes.

[0060] The present invention further discloses a plant with enhanced iron (Fe) and zinc (Zn) content and reduced cadmium (Cd) accumulation achieved through CRISPR / Cas9-based genome editing that targets and knocks out specific genes, particularly FeSl, FeS2, and CdTl.

[0061] The HRZ1, HRZ2 and LCT1 genes are the same as FeSl, FeS2, and CdTl genes respectively. The knockout of these genes results in plant cell lines with different combinations of gene edits, including two-gene knockouts (FeSl-FeS2, FeSl-CdTl, FeS2-CdTl, CdTl-FeS2) denoted by SEQ. ID Nos. 17, 18, 19 and 20 respectively and a three-gene knockout line denoted by SEQ. ID No. 21, which collectively contribute to increased micronutrient accumulation of Fe and Zn and reduced Cd.

[0062] DETAILED DECRIPTION OF THE INVENTION

[0063] The present invention discloses a vector for knocking out two or more genes for increasing iron (Fe), zinc (Zn) amount and decreasing the amount of cadmium (Cd), wherein the said two or more genes are selected from FeSl, FeS2 and CdTl. The FeSl, FeS2 and CdTl genes were knocked out by NIC-TK1 vector and is denoted by SEQ. ID No. 27. The vector has 18044 bp length and comprises:

[0064] i. codon-optimized Cas9 cassette from Streptococcus pyogenes (spCas9) with nuclear localization signals, a maize ubiquitin promoter denoted by SEQ ID No.

[0065] 23 and a nopaline synthase terminator SEQ ID No. 24; ii. sgRNA sequences for FeSl, FeS2, and CdTl along with riceU3 denoted by SEQ ID No.22 and wheat U3 promoter denoted by SEQ ID No.25 through multiple cloning sites (Swal-Sbfl; Swal-ASiSI; Sbfl-ASiSI; Bsal-BsalBsal).

[0066] The sgRNA sequences of FeSl, FeS2 and CdTl are denoted by SEQ. ID Nos. 2, 3 and 4 respectively, wherein the sgRNA sequence of FeSl is denoted by SEQ. ID No. 2 comprising Haeme binding domain is denoted by SEQ. ID No. 5 (GGAACTCGCATCCTGTACAG) and PAM sequence is denoted by SEQ. ID No. 6 (GGG).

[0067] The sgRNA sequence of FeS2 is denoted by SEQ. ID No. 3 comprising Haeme binding domain is denoted by SEQ. ID No. 7 (CTTCAAAAATGAGGAAACAA) and PAM sequence is denoted by SEQ. ID No. 8 (AGG) and the sgRNA sequence of CdTl is denoted by SEQ. ID No. 4 comprising Cd exporter gene is denoted by SEQ. ID No. 9 (AGCAAAGGTCGGAGTGGAGG) and PAM sequence is denoted by SEQ. ID No. 10 (CGG).

[0068] The present invention also discloses a method for producing a NIC-TK1 vector (DNA plasmid) for knocking out genes FeSl, FeS2, and CdTl respectively comprises the following steps: i. selecting pCAMBIA1300-based binary vector for multiplexed editing of FeSl, FeS2, and CdTl genes;

[0069] ii. designing and constructing sgRNAs targeting Haeme binding domain of the genes FeSl, FeS2 and a low-affinity cation plasma membrane-localized Cd exporter CdTl gene respectively;

[0070] iii. assembling the sgRNA sequences for FeSl, FeS2, and CdTl and using riceU3 denoted by SEQ ID No. 22 and wheat U3 promoter denoted by SEQ ID No. 25 through multiple cloning sites (Swal-Sbfl; Swal-ASiSI; Sbfl-ASiSI; Bsal-Bsal, Bsal, Swal, Sbfl)

[0071] iv. generating a Cas9 cassette comprising rice codon-optimized Cas9 from Streptococcus pyogenes (spCas9) with nuclear localization signals, maize ubiquitin promoter and nopaline synthase terminator.

[0072] The FeSl, FeS2, and CdTl genes have amino acid sequence denoted by SEQ. ID Nos. 14, 15 and 16 respectively and the nucleotide sequences denoted by SEQ. ID Nos. 11, 12 and 13 respectively In an embodiment the present invention discloses a method for obtaining an improved plant with enhanced or improved Fe and Zn accumulation and decreased Cd translocation into rice grain endosperms and high nutrient use efficiency comprising steps:

[0073] i. inducing the production of calli in Oryza sativa L. ssp. indica cv BPT5204 (Samba Mahsuri) seeds as the explant source;

[0074] ii. subjecting the Calli obtained in step a) to biolistic transformation with gold particles coated with plasmid DNA (containing the CRISPR / Cas9-NIC-TKl construct for genes)

[0075] iii. following transformation, transferring the calli obtained in step b) in shoot regeneration and rooting media;

[0076] iv. transferring the shoots to half-strength MS medium for rooting;

[0077] v. hardening of the regenerated plants in a greenhouse.

[0078] The present invention further discloses a plant resulting in increased iron and zinc content decreased amount of Cd by the process of utilising the CRISPR / Cas9 system for vector construct capable of knocking out two or more genes selected from FeSl, FeS2 and CdTl. The modified plant consists of increased amount of iron (Fe) ranges from 15 ppm to 120 ppm zinc ranges from 30 ppm to 150 ppm respectively and decreased amount of cadmium (Cd) ranges from 0.012-0.001 ppm.

[0079] The further consists of increased amount of potassium (K) concentrations ranging from approximately 85 to 91 pg / g, manganese (Mn) ranging from 5.0 to 6.7 pg / g, magnesium (Mg) ranging from 22 to 27 pg / g, phosphorus (P) ranging from 40 to 55 pg / g, calcium (Ca) ranging from 8.0 to 10.5 pg / g, copper (Cu) ranging from 0.8 to 1.3 pg / g, and cobalt (Co) ranging from 0.025 to 0.040 pg / g.

[0080] The knockout of FeSl, FeS2, and CdTl genes results in plant cell lines with different combinations of gene edits, including two-gene knockouts (FeSl-FeS2, FeSl- -CdTl, FeS2 CdTl, CdTl-FeS2) denoted by SEQ. ID Nos. 17, 18, 19 and 20 respectively and a three-gene knockout (FeSl-FeS2- CdTl) line denoted by SEQ. ID No. 21, which collectively contribute to increased micronutrient accumulation of Fe and Zn and reduced Cd uptake in the rice endosperm and in any plant that has these genes. The edited grains and edited whole plant consist of no vector backbone or Cas9 gene remains as shown via PCR analyses. All edited plants are free of vector backbone including Cas9 gene construct and sgRNA construct.

[0081] Vector-based NICTK1 generation of three-gene knockout SDN1 GE plant lines has enabled the development of plants with high iron and zinc concentrations specifically in the grain endosperm, achieving effective biofortification. In addition to enhanced micronutrient content, these genome-edited lines accumulated cadmium, cobalt, and chromium primarily in the roots rather than in the shoots or grains including the polished endosperm, thus providing a bioremediation benefit by restricting heavy -metal translocation to edible tissues. Furthermore, the edited plants showed improved nutrient-use efficiencies, exhibiting increased levels of essential nutrients such as nitrogen, phosphorus, calcium, magnesium, and potassium in both shoot tissues and grains.

[0082] Endosperm is the edible portion or central region (minus the aleurone layer-harbours Fe-Zn & embryo-that forms the plant) of white rice grain after milling and polishing, which has only starch and provides nutrition to embryo for plant growth therefore it is important for the micronutrients such as Fe and Zn to translocate and accumulate inside the endosperm.

[0083] The HRZ1, HRZ2 and LCT1 genes are the same as FeSl, FeS2, and CdTl genes respectively and also shown in Table A.

[0084]

[0085] Table A

[0086] The plant consisting of increased amount of iron (Fe), zinc (Zn) respectively and decreased amount of cadmium (Cd) can be selected from monocot or dicot and is specifically selected from rice.

[0087] EXAMPLES

[0088] Example 1: Prediction of Multiple sgRNA Target Regions in FeSl, FeS2, and CdTl genes with High Score and Zero Off-Target Effects The gene sequences of FeSl, FeS2, and CdTl were retrieved from the NCBI database and the Rice Genome Annotation Project. The FeSl gene, the CDS for FeSl gene is 3711 nucleotides long, encodes a 1236 amino acid protein, which functions as an iron -binding haemerythrin RING ubiquitin ligase involved in iron uptake and regulation. FeS2 gene is 2 nucleotides long, encoding an 811 amino acid protein with similar iron-binding functions. CdTl gene contains three exons with a transcript length of 1536 bp and a protein translation length of 511 residues. Using tools such as CRISPR V 2.0, E-CRISP, Cas-designer, and Cas Offinder, multiple sgRNA target regions were identified within these genes, ensuring no off-target effects. Specific sgRNAs were designed for each gene's Heme binding domain. For FeSl, the gRNA sequence GGAACTCGCATCCTGTACAG with a PAM sequence of GGG was selected. For FeS2, CTTCAAAAATGAGGAAACAA with a PAM sequence of AGG was chosen. The gRNA sequence AGCAAAGGTCGGAGTGGAGG with a PAM sequence of CGG was selected for CdTl.

[0089] Example 2: Multiplex CRISPR / Cas9 (TaU3-FeSl / Os-U3-FeS2 / Ta-U3-CdTl) in pCRISPR / Cas9TKl-NIC Vector Construction

[0090] A robust marker-free pCAMBIA1300-based plant expression vector NICTK-l_pCRISPR-Cas9 (16.0 kb), was designed indigenously for the multiplexed editing of FeSl, FeS2, and CdTl genes in rice employing biolistic transformation. This vector harbours a 6.6 kb of Cas9 cassette of rice plant codon optimized SpCas9 gene (4.1 kb) with attached nuclear localization signals (NLSs) at both ends including high GC content at the 5' end. T-DNA (Cas9) region was driven by Zea mays ubiquitin (pUbi) promoter (1.9 kb) and nopaline synthase (NOS) terminator (253 bp), which can be flanked by Srfl-Srfl restriction sites. Additionally, 4 MCS (Swal-Sbfl; Swal-ASiSI; Sbfl-ASiSI; Bsal-Bsal), were added, which can be utilized for the assembly of multiple sgRNAs. Plant codon-optimized Cas9 gene sequence was fused with the modified pCAMBIAl 00-based vector backbone and synthesized by GeneArt (ThermoScientifc, USA).

[0091] Further, three sgRNAs target sequences were selected within the target FeSl, FeS2, and CdTl genes employing CRISPR v2.0 software. Selected two sgRNAs target sequences were driven by rice U3 and wheat U3 promoters Developed sgRNAs expression cassette was ligated into the intermediate pMA-RQ entry vector with Bsal restriction sites. Finally, the generated sgRNAs expression cassette was cloned into one recipient NICTK-l_pCRISPR-Cas9 vector (refer figures 1, 2, and 31). This study employed a modified, marker-free vector to avoid environmental and health concerns, ensuring edited rice lines could be commercialized without marker genes. High editing efficiencies were achieved with multiplexed gRNAs targeting the hemerythrin domains of FeSl, FeS2, and the low-affinity cation transporter CdTl, with the goal of improving micronutrient quality in rice-specifically, increasing iron (Fe) and zinc (Zn) levels and reducing cadmium (Cd) content in grains.

[0092] Example 3: Rice Embryogenic Callus Induction, Biolistic-Mediated Transformation, and Regeneration

[0093] In this study, Oryza sativaL. ssp. indica cv BPT5204 (Samba Mahsuri) seeds were used as the explant source for callus induction. Embryogenic calli were produced using Chu’s N6 medium containing basal salts, sucrose, casein hydrolysate, proline, 2,4-dichlorophenoxyacetic acid (2.4-D), glutamine, dicamba, and phytagel. The medium resulted in high callus induction with a regeneration efficiency of 95%. The compact creamish -white calli were subjected to biolistic transformation using a helium -powered particle delivery system (PDS 1000 / He, BioRad). Gold particles coated with plasmid DNA (containing the NIC-CRISPR / Cas9TKl construct for FeSl, FeS2, and CdTl genes) were bombarded into the calli. Following transformation, the calli were transferred to shoot regeneration and rooting media, showing a high regeneration efficiency of 95%. Shoots were transferred to half-strength MS medium for rooting, achieving 98% root proliferation. Regenerated plants were hardened in a greenhouse and successfully transplanted into pots under controlled conditions. The biolistic approach demonstrated efficient recovery of edited Indica rice plants, with high transformation efficiency (refer figure 3).

[0094] Example 4: PCR Screening and Validation of Cas9 Transgenic Rice Lines

[0095] The study focused on screening and validating To, Ti, and ^transgenic rice lines developed via biolistic transformation using CRISPR / Cas9 targeting FeSl, FeS2, and CdTl genes. Genomic DNA was isolated from putative transgenic plants, and PCR amplification using Cas9-specific primers confirmed the presence of a 531 bp Cas9 fragment in 69% of the transformed lines. PCR products from knockout (KO) rice lines were sequenced to validate the presence of indels in the target genes.

[0096] Approximately 3000 embryogenic calli were bombarded, leading to the generation of hundreds of transgenic rice plants. Cas9 presence was assessed in To and Ti lines through PCR and Sanger sequencing, confirming successful mutations in 18 plants. The Cas9 gene segregation was observed in Ti lines, with 20 out of 32 plants showing Cas9 (-ve) negative results. Southern blot analysis using a DIG-based system verified the integration of the Cas9 gene in transgenic lines, revealing independent transgenic events with no signals detected in wild-type plants. Sanger sequencing confirmed indels at target sites within FeSl, FeS2, and CdTl genes. The mutations, including insertions, deletions, and transitions, were analysed using bioinformatics tools (DS Decode M, CRISPR-GE, Gene Studio, etc.). Frameshift mutations were identified, which altered the protein structure and function, as predicted in wild-type and edited rice lines. PCR and sequencing of Cas9-free lines were performed to confirm indels, followed by realtime PCR to assess the stability of these lines. Cas9-free edited rice lines were evaluated via phenotyping and genotyping, showing high iron and zinc content with reduced cadmium levels, demonstrating successful gene editing and trait incorporation (refer figures 3, 4A, B, C, D , 5, 32, 33A and B).

[0097] Example 5: Mutation Detection in CRISPR / Cas9 Edited Rice Lines Using T7 Endonuclease Assay

[0098] The research focused on detecting insertion or deletion (indel) mutations in CRISPR / Cas9-edited rice Ti lines targeting FeSl, FeS2, and CdTl genes using the T7 Endonuclease 1 (T7E1) assay. Genomic DNA extracted from 18 edited rice lines was used for mutation detection. PCR was used to amplify loci where gene-specific double-strand breaks occurred. Denaturation and reannealing of the PCR products resulted in heteroduplex formation, which was then cleaved by T7 Endonuclease I. This assay detects mismatches caused by indels and provides semi-quantitative evidence of mutated alleles (refer figures 6, 7, 8 and 9).

[0099] Cleaved DNA fragments were analyzed through gel electrophoresis and quantified using gel analysis software. The assay confirmed the presence of indels, and the cleavage efficiency was calculated for each edited rice line. The cleavage efficiency for FeSl showed a range from 18.18% (line 16) to 71.19% (line 4). For FeS2, the efficiency ranged from 35.04% (line 15) to 80.88% (line 8). For CdTl, the efficiency varied between 14.96% (line 4) and 73.75% (line 17). The T7E1 assay successfully validated indel mutations in the Ti edited rice lines, providing crucial evidence of targeted gene modifications for potential trait improvements in rice (refer Figure 10).

[0100] Example 6: RT PCR: Quantitative real time PCR (qRT-PCR) for expression analysis Example 6A. Quantitative Real-Time PCR (qRT-PCR) Expression Analysis in CRISPR / Cas9 Edited Rice Lines This study involved the quantitative real-time PCR (qRT-PCR) expression analysis of FeSl, FeS2, and CdTl genes in 18 CRISPR / Cas9-edited T2 rice knockout lines. These genes, associated with iron and zinc sensing (FeSl, FeS2) and cadmium transport CdTl), were targeted using multiplex CRISPR / Cas9 technology. Total RNA was extracted from leaf tissue of the edited knockout lines for expression analysis. The experiment used the relative quantification method, where the wild-type (WT) rice served as the reference. Cycle threshold (CT) values were used to calculate AACT, from which fold changes in gene expression were derived using the formula 2A-AACT. The results demonstrated down-regulation of FeSl, FeS2, and CdTl in all 18 edited rice T2 lines compared to the WT, confirming successful knockout of these genes. The high sensitivity and accuracy of qRT-PCR provided robust evidence of gene expression reduction, further supporting the gene editing outcomes previously confirmed through sequencing, T7E1 assay, and genotyping (refer figure 11).

[0101] Example 6B. qRT-PCR Expression Analysis in Cas9-Free Edited Rice Lines

[0102] The expression analysis of FeSl, FeS2, and CdTl genes in eight Cas9-free edited rice lines, assessed across various plant parts, including leaves, roots, stems, nodes, and flowers. Using quantitative real-time PCR (qRT-PCR), the results showed significant down-regulation of these target genes in all tested plant parts when compared to wild-type (WT) plants. The consistent gene down-regulation across different plant tissues confirms the successful knockout of FeSl, FeS2, and CdTl genes in these Cas9-free edited rice lines. This provides strong evidence of the efficiency and stability of the genome editing, enhancing the potential for creating modified rice varieties with improved nutrient regulation and stress response.

[0103] Example 6C. Expression Analysis of Iron and Zinc Homeostasis Genes in Cas9-Free Edited Rice Lines

[0104] This study focuses on the expression analysis of key genes related to iron (Fe) and zinc (Zn) uptake and translocation in Cas9-free edited rice lines. Expression data were collected for 19 genes linked to Fe and Zn homeostasis in rice endosperm, identified through expression databases. Real-time PCR analysis using the comparative cycle threshold method (2AAACt) revealed differential gene expression in edited rice lines compared to wild-type (WT) plants. Key genes studied include ABC transporter superfamily, heavy metal ATPase 2 (0sHMA2), iron deficiency-responsive element-binding factors (OsIDEFl and OsIDEF2), natural resistance-associated macrophage proteins (OsNRAMP 1 , 0sNRAMP5), nicotinamine aminotransferase 1 (OsNAATl), ferritin 1 and 2 (OsFERl and OsFER2), among others. Significant fold changes in gene expression were observed, particularly in rice lines edited for FeSl, FeS2 which regulate Fe and Zn sensing and translocation. For instance, 0sHMA2 and 0sNRAMP5 showed increased fold changes in edited lines, facilitating metal transport to developing tissues, while OsNAATl and OsIRTl were also upregulated. Elemental analysis via ICP-MS confirmed improved Fe and Zn translocation and storage in the rice endosperm (refer Figures 11 & 12).

[0105] Example 7. Histochemical detection and localization of iron, zinc and cadmium in rice seed and spikelet morphology & Phenotyping of husked rice grains

[0106] The elemental analysis was conducted to quantify iron (Fe), zinc (Zn), and cadmium (Cd) concentrations in the grain endosperms of CRISPR-Cas9 edited rice lines, including Cas9-free-edited and wild-type lines. The analysis employed inductively coupled plasma mass spectrometry (ICP-MS) using the Thermo Scientific™ iCAP™ TQ ICP-MS Triple Quadrupole system with Qtegra™ ISDS software. The standardization process used a multi-element standard calibration (30 elements) to ensure accurate measurement. Fe concentration in the edited rice lines ranged from 9 ppm to 64.33 ppm, while Zn ranged from 14 ppm to 69 ppm. In comparison, wild-type rice showed only 2 ppm Fe and 18 ppm Zn in the endosperm. In Cas9-free-edited rice lines, line 7 showed a Zn concentration of 26.13 ppm and Fe concentration of 9.36 ppm, while line 2 exhibited a high Fe concentration of 13.48 ppm and Zn concentration of 22.9 ppm. A notable reduction in Cd concentration was observed in the edited lines, especially compared to the wild-type (WT). The knockout of Fe- and Zn-sensing genes (FeSl, and FeS2) and the Cd transporter gene (CdTl) through multiplex CRISPR-Cas9 contributed to these significant changes in mineral content (refer figure 15).

[0107] Furthermore, results of ICP-MS in white rice grains (in the central edible-region known as endosperm) of edited SDNI Ts-rice lines revealed enhanced Fe content (15-120 ppm) and Zn (30-150 ppm) as well as almost negligible Cadmium (0.012-0.001 ppm), Cobalt and other heavy metals compared with the WT lines and edited rice lines (refer Figures 13A,13B,14, 20A,20B & 21).

[0108] Example 8: Elemental analysis

[0109] The elemental analysis was conducted to quantify iron (Fe), zinc (Zn), and cadmium (Cd) concentrations in the grain endosperms of CRISPR-Cas9 edited rice lines, including Cas9-free- edited and wild-type lines. The analysis employed inductively coupled plasma mass spectrometry (ICP-MS) using the Thermo Scientific™ iCAP™ TQ ICP-MS Triple Quadrupole system with Qtegra™ ISDS software. The standardization process used a multi-element standard calibration (30 elements) to ensure accurate measurement. Fe concentration in the edited rice lines ranged from 9 ppm to 64.33 ppm, while Zn ranged from 14 ppm to 69 ppm. In comparison, wild-type rice showed only 2 ppm Fe and 18 ppm Zn in the endosperm. In Cas9-free-edited rice lines, line 7 showed a Zn concentration of 26.13 ppm and Fe concentration of 9.36 ppm, while line 2 exhibited a high Fe concentration of 13.48 ppm and Zn concentration of 22.9 ppm. A notable reduction in Cd concentration was observed in the edited lines, especially compared to the wild-type. The knockout of Fe- and Zn-sensing genes (FeSl, a \ l''eS2) and the Cd transporter gene (CdTl) through multiplex CRISPR-Cas9 contributed to these significant changes in mineral content (refer Figure 15, 22, 23a-e). ICP-MS analysis of iron (Fe), zinc (Zn) and cadmium (Cd) concentrations in genome-edited Ts generation rice lines. The edited lines exhibited elevated Fe levels ranging from approximately 45 to 120 pg / g and Zn levels between 75 to 145 pg / g, compared to the control, which showed only -7-12 pg / g Fe and -15-18 pg / g Zn. A notable decrease in Cd content (0.002-0.006 pg / g) was also observed in the edited lines relative to the control. ICP-MS analysis of essential mineral elements in genome-edited Ts generation rice lines. The edited lines exhibited potassium (K) concentrations ranging from approximately 85 to 91 pg / g, manganese (Mn) 5.0 to 6.7 pg / g, magnesium (Mg) 22 to 27 pg / g, phosphorus (P) 40 to 55 pg / g, calcium (Ca) 8.0 to 10.5 pg / g, copper (Cu) 0.8 to 1.3 pg / g, and cobalt (Co) 0.025 to 0.040 pg / g, compared to the control plants which showed -83 pg / g K, -4.8 pg / g Mn, -20 pg / g Mg, -38 pg / g P, -10 pg / g Ca, -0.7 pg / g Cu, and -0.018 pg / g Co. The results indicate improved micronutrient accumulation in the edited lines relative to the non-edited control ((refer Figure 28, 29, 30A&B).

[0110] Example 9. Argo-morphological traits evaluation & Spikelet and Pollen Viability Assessment

[0111] Rice yield metrics Various agronomic and yield-related parameters were measured for TO, T1 and T2, where edited rice lines showed phenotypically better performance than WT (Fig. 2), and Cas9 transgenic rice lines did not show any morphological variations in comparison to the WT. Cas9-free edited lines showed good performance compared to wild-type. Edited rice lines showed stable, enhanced agronomic traits under greenhouse conditions. In Ti plants, plant height increased by 5-20 cm, tiller number by 2-6, panicle number and length, 1000-grain weight (by 2-7 g), grain number per panicle, and overall yield all rose significantly compared to the wild type, while spikelet fertility also improved. Edited lines showed the early flowering (10- 15 days) an early maturity compare than control plants T2 lines displayed similar, genetically stable performances across the same traits. Cas9-free edited lines showed no differences from Cas9-containing lines, indicating that the improved traits result from multiplex knockout of OsHRZl, OsHRZ2 and OsLCTl, not from the Cas9 transgene (refer Figure 16,17A,17B & 24A-F). Edited rice lines (Ti, T2 and Cas9-free) showed no significant differences from wild type in spikelet and flower morphology, anther structure, pollen viability, fertility or in-vitro germination. Some edited and Cas9-free lines exhibited slightly higher pollen viability (2-4%) and longer pollen tube lengths than wild type, but these changes had no adverse effect on plant performance (refer Figure 25A-D, 26 & 27).

[0112] Example 10. Estimation of enzyme activities related to amylose biosynthesis

[0113] The enzyme activities involved in amylose biosynthesis in rice, specifically examining Granule-Bound Starch Synthase (GBSSI), Soluble Starch Synthase (SSSI), and Starch Branching Enzyme (SBE). The study evaluated these enzyme activities in rice lines edited with CRISPR / Cas9 (Ti, T2, and Cas9-free lines), including those grown hydroponically under cadmium stress (refer Figure 18).

[0114] Example 11. Granule-Bound Starch Synthase (GBSSI):

[0115] Ti edited rice lines showed varied SSSI activity, with some lines having similar or higher activity compared to wild type. T2 lines displayed similar variations in SSSI activity as T 1 lines. Cas9-free edited lines had SSSI activity comparable to Ti and T2 lines. Under cadmium stress, SSSI activity in certain edited lines was similar to untreated wild type, while the treated wild type had lower SSSI activity compared to normal conditions refer Figure 18).

[0116] Example 12. Soluble Starch Synthase (SSSI):

[0117] Ti edited rice lines showed varied SSSI activity, with some lines having similar or higher activity compared to wild type. T2 lines displayed similar variations in SSSI activity as T 1 lines. Cas9-free edited lines had SSSI activity comparable to Ti and T2 lines. Under cadmium stress, SSSI activity in certain edited lines was similar to untreated wild type, while the treated wild type had lower SSSI activity compared to normal conditions refer Figure 18).

[0118] Example 13. Starch Branching Enzyme (SBE): Ti and T2 edited rice lines, as well as Cas9-free lines, showed SBE activity similar to the wild type. Hydroponically grown lines under cadmium stress maintained SBE activity comparable to untreated wild type, with the treated wild type showing reduced activity compared to normal growth conditions.

[0119] The research indicates that reduced GBSSI activity in edited lines may enhance amylopectin biosynthesis, suggesting potential applications in breeding programs aimed at improving amylopectin content (refer Figure 18).

[0120] Elemental analysis for Blood serum iron and zinc content:

[0121] Animal feed trials were conducted to evaluate the safety and efficacy of CRISPR / Cas9-edited rice lines in mice. The trials adhered to guidelines from the Institutional Animal Ethics Committee (IAEC) at ICGEB, New Delhi, and no adverse reactions or poisoning symptoms were observed in the animals. Elemental analysis of blood serum iron and zinc was performed using inductively coupled plasma mass spectrometry (ICP-MS). Results showed a significant increase in iron levels in the serum of mice fed with the high iron-edited rice, with a concentration of 7.15 pg / ml compared to 4.41 pg / ml in the control group. This indicates that a 30-day feeding period with the high iron rice led to a notable increase of 3 pg / ml in iron levels. Zinc concentrations showed a slight increase across groups, as depicted in the provided figure. The rice was used as a supplementary feed at 150U / Kg, while the overall diet remained unchanged (refer Figure 19).

[0122] Example 14. Fe, Zn and Cd toxicity, bronzing, histochemical detection of H2O2- and 02- content in shoots and seeds:

[0123] General screening for the effect of editing on the translocation of Fe in free Cas9 edited rice lines grown under normal field conditions. To estimate the amount of in vivo ROS formation in response to the Iron-oxidative effect, the leaf strips and seeds of free cas9 edited rice lines were histochemically stained with DAB and NBT. H2O2 in the presence of peroxidases oxidizes DAB which leads to the production of reddish-brown precipitate. Similarly, the O-freeradical reacts with NBT to form a dark blue insoluble formazan compound. The staining intensity of these tissues provides an estimate of in vivo H2O2 and 02.- formation in response to Iron-oxidative effect or any other abiotic stress. The Fe+ showed significantly high ROS production than Fe- but no significant ROS production in all free Cas9 edited rice lines compared to wildtype. In wild type and edited free Cas9 rice lines shoots, H2O2content was quantified and histochemically detected as it is shown. In seeds, H2O2content was quantified and histochemically detected as it is shown. In wildtype and edited free Cas9 rice lines shoots, O-content was quantified and histochemically detected as it is shown. In seeds, O-content was quantified and histochemically detected as it is shown. No bronzing effect was observed on wildtype and Free Cas9 edited rice lines leaves but Bronzing was appeared on wildtype plant shoot with over access of iron Fe+ and iron deficient pale green phenotype on wildtype shoot with Fe deficient condition (refer Figure34, 35, 36 & 37).

[0124] Example 12. Starch Branching Enzyme (SBE):

[0125] Ti and T2 edited rice lines, as well as Cas9-free lines, showed SBE activity similar to the wild type. Hydroponically grown lines under cadmium stress maintained SBE activity comparable to untreated wild type, with the treated wild type showing reduced activity compared to normal growth conditions.

[0126] The research indicates that reduced GBSSI activity in edited lines may enhance amylopectin biosynthesis, suggesting potential applications in breeding programs aimed at improving amylopectin content (refer Figure 18).

[0127] Elemental analysis for Blood serum iron and zinc content:

[0128] Animal feed trials were conducted to evaluate the safety and efficacy of CRISPR / Cas9-edited rice lines in mice. The trials adhered to guidelines from the Institutional Animal Ethics Committee (IAEC) at ICGEB, New Delhi, and no adverse reactions or poisoning symptoms were observed in the animals. Elemental analysis of blood serum iron and zinc was performed using inductively coupled plasma mass spectrometry (ICP-MS). Results showed a significant increase in iron levels in the serum of mice fed with the high iron-edited rice, with a concentration of 7.15 pg / ml compared to 4.41 pg / ml in the control group. This indicates that a 30-day feeding period with the high iron rice led to a notable increase of 3 pg / ml in iron levels. Zinc concentrations showed a slight increase across groups, as depicted in the provided figure. The rice was used as a supplementary feed at 150 U / Kg, while the overall diet remained unchanged (refer Figure 19).

Claims

We claim:

1. A vector or plasmid DNA for knocking out a gene from a plant for increasing iron (Fe), zinc (Zn) amount and decreasing the amount of cadmium (Cd), wherein the gene is selected from the group comprising FeSl, FeS2 and CdTl or a combination thereof.

2. The vector or plasmid DNA as claimed in claim 1, wherein the unmodified vector is NIC-TK1 is denoted by SEQ ID No 27.

3. The vector or plasmid DNA as claimed in claim 1, wherein the nucleotide and coding sequences wherein the nucleotide sequence of the said FeSl, FeS2, and CdTl genes are denoted by SEQ ID Nos. 11, 12, 13 respectively and the coding sequences of FeSl, FeS2, and CdTl genes are denoted by SEQ ID Nos. 28, 29 and 30 respectively.

4. The vector or plasmid DNA as claimed in claim 1, wherein the amino acid sequences of the said FeSl, FeS2, and CdTl genes are denoted by SEQ ID Nos. 14, 15 and 16 respectively.

5. The vector or plasmid DNA as claimed in claim 1 , wherein the two gene FeSl and FeS2 knockout is introduced by introducing SEQ. ID No. 17 into NIC-TK1 vector which is denoted by SEQ ID No 27.

6. The vector or plasmid DNA as claimed in claim 1, wherein the two gene FeSl and CdTl knockout is introduced by introducing SEQ. ID No. 18 into NIC-TK1 vector is denoted by SEQ ID No 27.

7. The vector or plasmid DNA as claimed in claim 2, wherein the two gene FeS2 and CdTl knockout is introduced by introducing SEQ. ID No. 19 into NIC-TK1 vector which is denoted by SEQ ID No 27.

8. The vector or plasmid DNA as claimed in claim 4, wherein the two gene CdTl and FeS2 knockout is introduced by introducing SEQ. ID No. 20 into NIC-TK1 vector which is denoted by SEQ ID No 27.

9. The vector or plasmid DNA as claimed in claim 4, wherein the three gene FeSl, FeS2 and CdTl knockout is introduced by introducing SEQ ID No. 21 into NIC-TK1 vector which is denoted by SEQ ID No 27.

10. The vector or plasmid DNA comprising the three gene knockout as claimed in claim 9, wherein the said vector is OsHRZI-OsHRZ2-OsLCTl-NIC-TKl and is denoted by SEQ. ID No. 1 and represented by figure 1.

11. The vector or plasmid DNA as claimed in claim 10, wherein the OsHRZI-OsHRZ2- OsLCTl-NIC-TKl vector comprises codon-optimized Cas9 cassette from Streptococcus pyogenes (spCas9) with nuclear localization signals, a maize ubiquitin promoter denoted by SEQ ID No. 23 and a nopaline synthase terminator denoted by SEQ ID No.24.

12. The vector or plasmid DNA as claimed in claim 10, wherein the OsHRZI-OsHRZ2- OsLCTl-NIC-TKl vector comprises sgRNA sequences for FeSl, FeS2, and CdTl along with riceU3 denoted by SEQ ID No. 22 and wheat U3 promoter denoted by SEQ ID No. 25 and a rice U3 terminator denoted by SEQ ID No. 26 through multiple cloning sites Swal-Sbfl; Swal-ASiSI; Sbfl-ASiSI; Bsal-BsalBsal.

13. The vector or plasmid DNA as claimed in claim 10, wherein the OsHRZI-OsHRZ2- OsLCTl-NIC-TKl vector has 18044 bp length.

14. The vector or plasmid DNA as claimed in claim 1, wherein the sgRNA sequences of FeSl, FeS2 and CdTl are denoted by SEQ. ID No. 2, 3 and 4 respectively.

15. The vector or plasmid DNA as claimed in claim 1, wherein the sgRNA sequence of FeSl is denoted by SEQ. ID No. 2 comprising Haeme binding domain denoted by SEQ. ID No. 5 (GGAACTCGCATCCTGTACAG) and PAM sequence denoted by SEQ. ID No. 6 (GGG).

16. The vector or plasmid DNA as claimed in claim 1, wherein the sgRNA sequence of FeS2 is denoted by SEQ. ID No. 3 comprising Haeme binding domain is denoted bySEQ. ID No. 7(CTTCAAAAATGAGGAAACAA) and PAM sequence is denoted by SEQ. ID No. 8 (AGG).

17. The vector or plasmid DNA as claimed in claim 1, wherein the sgRNA sequence of CdTl is denoted by SEQ. ID No. 4 comprising Cd exporter gene is denoted by SEQ. ID No. 9 (AGCAAAGGTCGGAGTGGAGG) and PAM sequence is denoted by SEQ. ID No. 10 (CGG).

18. The vector or plasmid DNA as claimed in claim 1, wherein the vector can produce plant endosperm comprising increased amount iron (Fe) in the ranges 25 ppm to 120 ppm, zinc (Zn) in the range of 30 ppm to 145 ppm respectively and decreased amount of cadmium (Cd) in the range of 0.012 to 0.001 ppm.

19. A method for producing a NIC-TK1 vector or DNA plasmid for knocking out genes FeSl, FeS2, and CdTl respectively comprises the following steps:i. selecting binary vector for multiplexed editing of FeSl, FeS2, and CdTl genes; ii . designing and constructing sgRNAs targeting Haeme binding domain of the genes FeSl, FeS2 and a low-affinity cation plasma membrane-localized Cd exporter CdTl gene respectively;iii. assembling the sgRNA sequences for FeSl, FeS2, and CdTl and using riceU3 denoted by SEQ ID No. 22 and wheat U3 promoter denoted by SEQ ID No. 25 through multiple cloning sites (Swal-Sbfl; Swal-ASiSI; Sbfl-ASiSI; Bsal-Bsal, Bsal, Swal, Sbfl);iv. generating a Cas9 cassette comprising rice codon-optimized Cas9 from Streptococcus pyogenes (spCas9) with nuclear localization signals, maize ubiquitin promoter and nopaline synthase terminator.

20. The method for producing a NIC-TK1 vector (DNA plasmid) for knocking out genes FeSl, FeS2, and CdTl as claimed in claim 18, wherein the amino acid sequences of the said FeSl, FeS2, and CdTl genes are denoted by SEQ ID Nos. 14, 15 and 16 respectively.

21. The method for producing a NIC-TK1 vector (DNA plasmid) for knocking out genes FeSl, FeS2, and CdTl as claimed in claim 18, wherein the nucleotide sequences of the said FeSl, FeS2, and CdTl genes are denoted by SEQ ID Nos. 11, 12 and 13 respectively.

22. A method for obtaining a modified plant having increased amount iron (Fe), zinc (Zn) and lower amount of cadmium (Cd) translocated to the endosperm comprising steps: i. inducing the production of Calli in Oryza sativa L. ssp. indica cv BPT5204 (Samba Mahsuri) seeds as the explant source;ii. subjecting the Calli obtained in step a) to biolistic transformation with gold particles coated with plasmid DNA with the vector as claimed in claim 10 (containing the CRISPR / Cas9TKl-NIC construct for genes);iii. following transformation, transferring the Calli obtained in step b) in shoot regeneration and rooting media;iv. transferring the shoots to half-strength MS medium for rooting;v. hardening of the regenerated plants in a greenhouse.

23. A modified plant having increased amount of Fe, Zn and decreased amount of Cd developed using OsHRZI-OsHRZ2-OsLCTl-NIC-TKl vector denoted by SEQ ID No.1 by knocking out FeSl, FeS2 and CdTl, wherein the said plant contains increased amount iron (Fe) in the ranges 15 ppm to 120 ppm, zinc (Zn) in the range of 30 ppm to 150 ppm respectively and decreased amount of cadmium (Cd) in the range of 0.012 to 0.001 ppm.

24. The modified plant as claimed in claim 23, wherein the said plant further consists of increased amount of potassium (K) concentrations ranging from approximately 85 to 91 pg / g, manganese (Mn) ranging from 5.0 to 6.7 pg / g, magnesium (Mg) ranging from 22 to 27 pg / g, phosphorus (P) ranging from 40 to 55 pg / g, calcium (Ca) ranging from 8.0 to 10.5 pg / g, copper (Cu) ranging from 0.8 to 1.3 pg / g, and cobalt (Co) ranging from 0.025 to 0.040 pg / g.

25. The modified plant as claimed in claim 23, wherein the said modified plant can be a monocot or a dicot plant.