Protoberberine derivatives for use in the treatment of advanced cancer
A compound targeting nucleic acid structures in cancer cells effectively treats advanced and resistant cancers by silencing oncogenes, addressing toxicity and resistance issues in current treatments, and enhancing treatment efficacy.
Patent Information
- Application Number
- PCT/EP2025/083731
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-21
- Filing Date
- 2025-11-20
- Publication Date
- 2026-05-28
AI Technical Summary
Current cancer treatments, particularly for advanced, refractory, or resistant cancers, face challenges such as toxicity to normal cells, drug resistance, and a narrow therapeutic window, limiting their long-term efficacy and necessitating the development of new strategies.
A compound of general formula (I) or its pharmaceutically acceptable salt, which modulates the expression of target genes by binding to nucleic acid complex secondary structures like G-quadruplexes and hairpin loops, effectively silencing oncogenes, is administered intravenously to treat cancers, including solid tumors.
The compound achieves effective treatment of advanced and resistant cancers by rapidly reaching targets, reducing tumor size, inhibiting progression, and improving patient survival with minimal side effects, even when used in combination with standard therapies.
Smart Images

Figure EP2025083731_28052026_PF_FP_ABST
Abstract
Description
[0001] PROTOBERBERINE DERIVATIVES FOR USE IN THE TREATMENT OF CANCER
[0002] DESCRIPTION
[0003] Field of the invention
[0004] The invention relates to medical uses of a compound of general formula (I) or a pharmaceutically acceptable salt thereof, and of pharmaceutical compositions comprising said compound of general formula (I) or said pharmaceutically acceptable salt thereof.
[0005] State of the art
[0006] The primary indicators of success in advanced cancer treatment are overall survival and quality of life. Over the last three decades, improvements in these outcomes have been observed, with acceleration in treatment advancements over the years. However, despite significant progress in cancer therapy, numerous patients with advanced refractory, or resistant cancers still cannot be cured using currently available treatments. According to recent Global Cancer Observatory data, in 2022, cancer remains a leading cause of death, with nearly 2 million deaths from lung cancer, 1 million from colorectal cancer, and hundreds of thousands from other cancers like breast, stomach, and prostate cancers. In addition to these frequently occurring tumours, several less common tumours, such as mesothelioma which accounts for over 25,000 deaths, and often with fewer therapeutic options, require further consideration. This highlights the ongoing need for the development of new, more effective therapies, especially for patients with advanced, refractory, or resistant cancers.
[0007] Recent advancements in molecular biology have revealed complex regulatory networks that govern cancer progression. A key finding is the importance of complex secondary nucleic acid structures found in both DNA and RNA, which regulate the expression of genes involved in tumour progression and drug resistance. This opens the door to new therapeutic approaches targeting these structures.
[0008] One of the crucial pathways for cancer cell proliferation and survival is nucleotide metabolism. Compared to normal, non-proliferating cells, cancer cells are highly dependent on the de novo synthesis of nucleotides to produce sufficient DNA and RNA precursors necessary for growth. Thymidylate Synthase (TS) is a key rate-limiting enzyme involved in the de novo synthesis of thymidine monophosphate, an essential nucleotide required for DNA replication and repair. Recent studies also suggest that TS may serve as a regulator of cancer sternness, indicating its involvement in cancer cell de-differentiation in cancer diseases. The absence or inhibition of thymidylate synthesis not only hinders cell proliferation but also induces cell death, underscoring the therapeutic importance of this target. Overexpression of TS correlates with aggressive solid tumours, which are characterized by a highly invasive phenotype, chemoresistance, and poor prognosis in patients. This is the case, for example, in various solid tumour types, including non-small-cell lung cancer (NSCLC), breast cancer, ovarian cancer, prostate cancer, pancreatic cancer, colorectal cancer, gastric cancer, oesophageal squamous cell carcinoma (ESCC), and hepatocellular carcinoma (HCC), among others. Considering this, chemotherapeutic agents targeting thymidylate biosynthesis and directly inhibiting the TS enzyme are currently employed in clinical settings for treating solid and haematological tumours, either as standalone treatments or in combination regimens. Classical TS inhibitors fall into two major categories: antimetabolites (such as 5-fluorouracil and capecitabine) and antifolates (such as methotrexate and pemetrexed). These agents compete with the natural substrate or the cofactor for binding to the dimeric form of the enzyme, thereby blocking its activity and inducing a state of thymidylate deficiency, which prevents cancer cells from proliferating. When used alone, these agents can effectively target rapidly dividing cells. However, their efficacy often increases when combined with other chemotherapeutic agents or targeted therapies. Combination therapies can help overcome resistance, enhance cancer cell death, and minimize the likelihood of relapse, offering a more comprehensive cancer treatment strategy.
[0009] Despite the utility of antimetabolites and antifolates, their use is not without limitations. Primary challenges include toxicity to normal, rapidly dividing cells, leading to side effects such as myelosuppression, mucositis, and gastrointestinal toxicity. Moreover, cancer cells can develop resistance to these drugs over time through various mechanisms, including increased drug efflux, modifications to drug targets, or enhanced DNA repair capabilities. This resistance limits their long-term efficacy and necessitates the development of new strategies to improve effectiveness. Furthermore, there exists a narrow therapeutic window between efficacy and toxicity, necessitating careful dosing and monitoring to avoid severe adverse effects.
[0010] Therefore, there is the need to provide alternative treatments for cancer, preferably treatments for advanced and / or refractory and / or resistant tumours, that allow to overcome the above-mentioned problems.
[0011] Summary of the invention
[0012] It is purpose of the invention to provide an effective treatment of cancer in a human subject. This purpose is achieved by a compound of general formula (I) or a pharmaceutically acceptable salt thereof, preferably a pharmaceutically acceptable salt of general formula (I’) wherein R1 and R2, which can be the same group or a different group, are independently a hydroxy group or a methoxy group or, taken together, a methylenedioxy group,
[0013] R3 and R4, which can be the same group or a different group, are independently a hydroxy group or a methoxy group,
[0014] R5 is a phenyl group, wherein said phenyl group optionally comprises 1 to 4 substituents independently selected among the group consisting of halogen, cyano, nitro, hydroxy, amino, (di)alkyl(C1-C6)amino, alkyl(C1-C6)carbonylamino, alkoxy(C1-C6), alkyl(C1-C6)carbonyloxy, alkoxy(C1-C6)carbonyl, alkyl(C1-C6); and wherein any of said substituents alk*(C1-C6), each independently, contains optionally 1 to 4 halogen atoms independently selected among the group consisting of F, Cl, Br e I, and
[0015] R6 is a phenyl group, wherein said phenyl group optionally comprises 1 to 4 substituents independently selected among the group consisting of halogen, cyano, nitro, hydroxy, amino, (di)alkyl(C1-C6)amino, alkyl(C1-C6)carbonylamino, alkoxy(C1-C6), alkyl(C1-C6)carbonyloxy, alkoxy(C1-C6)carbonyl, alkyl(C1-C6); and wherein any of said substituents alk*(C1-C6), each independently, contains optionally 1 to 4 halogen atoms independently selected among the group consisting of F, Cl, Br e I, and wherein
[0016] X represents an inorganic acid ion, an organic acid ion or a halide, preferably X represents a Cl atom, and wherein n is 2; for use in the treatment of cancer in a human subject, wherein said compound of general formula (I) is administered in a therapeutically effective dose to said human subject.
[0017] It is another object of the invention to provide a pharmaceutical composition for use in the treatment of cancer in a human subject, wherein said pharmaceutical composition comprises a compound of general formula (I) or a pharmaceutically acceptable salt thereof, preferably a pharmaceutically acceptable salt of general formula (I’) according to the invention, and wherein said pharmaceutical composition is administered to said human subject such that a therapeutically effective dose of said compound of general formula (I) or of said pharmaceutically acceptable salt thereof is administered to said human subject.
[0018] It is a further object of the invention to provide a compound of general formula (I) or a pharmaceutically acceptable salt thereof, preferably a pharmaceutically acceptable salt of formula (I’)
[0019] wherein
[0020] R1 and R2, which can be the same group or a different group, are independently a hydroxy group or a methoxy group or, taken together, a methylenedioxy group,
[0021] R3 and R4, which can be the same group or a different group, are independently a hydroxy group or a methoxy group,
[0022] R5 is a phenyl group, wherein said phenyl group optionally comprises 1 to 4 substituents independently selected among the group consisting of halogen, cyano, nitro, hydroxy, amino, (di)alkyl(C1-C6)amino, alkyl(C1-C6)carbonylamino, alkoxy(C1-C6), alkyl(C1-C6)carbonyloxy, alkoxy(C1-C6)carbonyl, alkyl(C1-C6); and wherein any of said substituents alk*(C1-C6), each independently, contains optionally 1 to 4 halogen atoms independently selected among the group consisting of F, Cl, Br e I, and
[0023] R6 is a phenyl group, wherein said phenyl group optionally comprises 1 to 4 substituents independently selected among the group consisting of halogen, cyano, nitro, hydroxy, amino, (di)alkyl(C1-C6)amino, alkyl(C1-C6)carbonylamino, alkoxy(C1-C6), alkyl(C1-C6)carbonyloxy, alkoxy(C1-C6)carbonyl, alkyl(C1-C6); and wherein any of said substituents alk*(C1-C6), each independently, contains optionally 1 to 4 halogen atoms independently selected among the group consisting of F, Cl, Br e I, and wherein
[0024] X represents an inorganic acid ion, an organic acid ion or a halide, preferably X represents a Cl atom, and wherein n is 2; for the manufacture of a medicament for treating cancer in a human subject by administering said compound of general formula (I) in a therapeutically effective dose to said human subject.
[0025] The invention further includes a number of preferred features that are object of the dependent claims and the utility of which will be highlighted hereinafter in the detailed description of an embodiment of the invention.
[0026] In the context of the invention, the term "treatment" is used to refer to the administration of a compound of formula I, or of a medicament or pharmaceutical composition comprising it, to control the progression of the disease before or after the clinical signs have appeared. Control of the progression of the disease is understood as the beneficial or desired clinical results which include but are not limited to reduction of the symptoms, reduction of the duration of the disease, stabilization of pathological conditions (specifically avoiding additional impairment), delaying the progression of the disease, improving the pathological condition and remission (both partial and complete). The control of the progression of the disease also involves a prolongation of survival in comparison to the expected survival if the treatment was not applied.
[0027] In the context of the invention, the expression “a therapeutically effective dose” means a dose sufficiently to cause an effective treatment of a pathology or condition, preferably, an effective treatment of a cancer. In the context of the invention, “an effective treatment of a cancer” means is a treatment that results in a clinically relevant sign of improvement of the pathology or condition such as the ones described above. In the case of a cancer disease, clinically relevant signs of improvement can be for example, but are not limited to, (i) reduction in tumour size, (ii) inhibition of tumour progression and metastatic spread, (iii) prolongation of patient survival, or (iv) improvement in overall response rate as determined by, preferably, the Response Evaluation Criteria in Solid Tumours (RECIST) guidelines. For example, the RECIST guidelines (version 1.1) available at DOI : 10.1016 / j.ejca.2008.10.026.
[0028] Preferably, said compound of general formula (I) or said pharmaceutically acceptable salt thereof modulates expression of a target gene by directly binding to nucleic-acid complex secondary structures in DNA or RNA, for example G-quadruplexes and hairpin loops, wherein said target gene is pathologically overexpressed in the cancer such that reduction of its protein expression is therapeutically beneficial.
[0029] Preferably, said compound of general formula (I) or said pharmaceutically acceptable salt thereof effectively treats said cancer by directly binding to nucleic acid complex secondary structures of a target gene, for example hairpin loops or G-quadruplexes, silencing the expression of said target gene in said tumour.
[0030] Preferably, said target gene is an oncogene. In the context of the invention, an oncogene, is a gene that can cause cancer. Oncogenes can be mutated copies of certain normal cellular genes also called proto-oncogenes. Intact proto-oncogenes play important functions, regulating normal cellular growth, division, and apoptosis, which is the name for programmed or controlled cell death. Oncogenes or mutated copies of the protooncogenes may lead to uncontrolled cell growth and the escape from cell death, which may result in cancer development.
[0031] Preferably, said nucleic acid is an mRNA.
[0032] Preferably said complex secondary structures are located at the 5’-UTR, at the ORF (Open Reading Frame, coding region), and / or at the 3’-UTR of said mRNA. In a further preferred embodiment, said compound of general formula (I) or said pharmaceutically acceptable salt thereof effectively treats said cancer by directly binding to complex secondary structures present in the 5' untranslated region (5' UTR) and / or at the 3’-UTR of the Thymidylate Synthase mRNA, for example hairpin loops or G- quadruplexes, effectively silencing the expression of Thymidylate Synthase in a tumour.
[0033] Preferably, said compound or said pharmaceutically acceptable salt thereof is administered intravenously, more preferably said compound or said pharmaceutically acceptable salt thereof is administered intravenously at least once a week.
[0034] Intravenous administration presents challenges both from a formulation point of view of the compound, as well as from an in vivo efficacy and a safety perspective, e.g. due to the risk of reduced efficacy due problems during preparation of the injectable formulation and / or to the risk and severity of side effects derived from the compound being delivered directly into the blood stream. To the best knowledge of the inventors, efficacious intravenous administration to treat cancer, preferably to treat solid tumours, has not yet been proved for a compound according to the invention. As shown in the examples below the compound according to the invention can safely achieve its therapeutical effect against a variety of cancers via this administration route, thus allow treatments that have the advantages of such administration route such as the compound rapidly reaching its target and the therapeutic effect often being achieved quickly.
[0035] In the context of the invention, the expression “administered intravenously”, means that an “intravenous administration” (“i.v. administration”) route, that is an administration via a vein of said human subject, is used. Preferably, said intravenous administration is by injection of said compound of general formula (I) or said pharmaceutically acceptable salt thereof according to the invention, or by injection of a medicament or a pharmaceutical composition comprising said compound of general formula (I) or said pharmaceutically acceptable salt thereof according to the invention.
[0036] Preferably, said therapeutically effective dose is a dose sufficiently to cause an effective treatment of cancer. More preferably, said therapeutically effective dose is a dose comprised between a Minimal Starting Dose (MSD) and the Maximum Tolerated Dose (MTD).
[0037] In the context of the invention, doses of the compound, including the Minimal Starting Dose (MSD) and the Maximal Tolerated Dose (MTD), can be expressed in “mg / kg of body weight of the subject to be treated” or “mg / m2body surface area of the subject to be treated”. The correspondence between doses expressed in “mg / kg of body weight of the subject to be treated” and doses expressed in “mg / m2body surface area of the subject to be treated” is known by the skilled person in the art based on, for example, the relevant guidelines, for example “USFDA. Guidance for Industry: Estimating the Maximum Safe Starting Dose in Adult Healthy Volunteer. Rockville, MD: US Food and Drug Administration; 2005”.
[0038] In the context of the invention, the minimal starting dose (MSD) can be the recommended starting dose. The recommended starting dose can be determined according to the ICH S9 guideline. For example, the recommended starting dose can be derived from one- tenth of the most severely toxic dose in 10% of the animals (STD10) in rodents, provided this does not cause severe irreversible toxicity in a non-rodent species, or is derived from one-sixth of the highest non-severely toxic dose (HNSTD) in non-rodents, adjusted for interspecies scaling. Adjustment for interspecies scaling can be done using the relevant guidelines, for example “USFDA. Guidance for Industry: Estimating the Maximum Safe Starting Dose in Adult Healthy Volunteer. Rockville, MD: US Food and Drug Administration; 2005”. For example, the Minimal Starting Dose (MSD) can be 9 mg / m2of body surface area of a human subject as determined based on the one-tenth of the STD10 dose in rats.
[0039] Preferably, minimal starting dose (MSD) is the recommended starting dose according to the relevant guidelines, for example according to the “ICH guideline S9 on non-clinical evaluation for anticancer pharmaceuticals, first published on the 11 / 02 / 2013 and last updated on the 11 / 02 / 2013”. More preferably, the Minimal Starting Dose (MSD) is derived from one-tenth of the most severely toxic dose in 10% of the animals (STD10) in rodents, provided this does not cause severe irreversible toxicity in a non-rodent species, or alternatively, if one-tenth of the STD10 causes severe toxicity in non-rodents, the Minimal Starting Dose (MSD) is derived from one-sixth of the non-rodent highest non- severely toxic dose (HNSTD), adjusted for interspecies scaling. In a further preferred embodiment, the Minimal Starting Dose (MSD) is 9 mg / m2 of body surface area of a human subject.
[0040] In the context of the invention, the Maximal Tolerated Dose is the highest dose at which no more than one in six patients experience a Dose Limiting Toxicity (DLT) related to the compound. For example, the Maximal Tolerated Dose (MTD) can be determined in a Phase 1 clinical trial starting from said minimal starting dose (MSD) by carrying out a dose escalation trial, for example, with two or more expansion cohorts to investigate the safety, tolerability, pharmacokinetics, pharmacodynamics, and antitumor activity of the compound in patients with cancer.
[0041] In the context of the invention, a “dose escalation trial” means, for example, a trial wherein patients are enrolled sequentially into escalating dose cohorts and will continue receiving the compound at the tested dose until disease progression, unacceptable toxicity, withdrawal of consent or otherwise as specified in the investigational medicinal product (IMP) discontinuation criteria associated with said trial. For example, patients in said dose cohort can receive said compound or a composition comprising said compound, preferably by intravenous (IV) administrations, at the same dose in a dosing interval of at least once a week, preferable twice a week, for several weeks in cycles, preferably for four weeks per cycle consecutively without interruption, except when necessary to manage adverse events (AEs). Dose escalation may continue beyond, until the Maximal Tolerated Dose (MTD) can be defined, for example, based on safety, preliminary efficacy, PK and PD data, based on the recommendations of the Safety Review Committee (SRC) overseeing the trial. For example, in determining the Maximal Tolerated Dose (MTD), a Dose Limiting Toxicity (DLT) can be determined during the escalation trial based on the National Cancer institute - Common Terminology Criteria for Adverse Events (NCI-CTCAE) version 5.0 published on the 27 November 2017. Preferably, the Maximal Tolerated Dose is defined as the highest dose at which no more than one in six patients experience a Dose Limiting Toxicity related to the compound. More preferably, a Dose Limiting Toxicity (DLT) is determined during the escalation trial based on the National Cancer institute - Common Terminology Criteria for Adverse Events (NCI-CTCAE) version 5.0 published on the 27 November 2017. Even more preferably, the Maximum Tolerated Dose (MTL) is determined in a Phase 1 clinical trial starting from said Minimal Starting Dose (MSD) by carrying out a dose escalation trial and is defined based on safety, preliminary efficacy, PK and PD data, based on the recommendations of the Safety Review Committee (SRC) overseeing the trial.
[0042] Preferably, said cancer comprises or consists of a solid tumour.
[0043] In the context of the invention, the expression “a solid tumour” means a tumour that forms a mass, typically an aberrant or abnormal mass, in a tissue. Solid tumours initially develop in a tissue at a specific location and can potentially lead to tumoral cells circulating in the blood stream that, if they establish themselves in another location, can lead to the formation of other tumours. The original tumour is known as primary tumour whereas the newly formed tumours from said tumoral cells circulating, are known as secondary tumours.
[0044] Preferably, said cancer comprising or consisting of a solid tumour is mesothelioma, preferably pleural mesothelioma or peritoneal mesothelioma, and more preferably pleural mesothelioma.
[0045] Preferably, said cancer comprising or consisting of a solid tumour is a lung cancer, preferably wherein said lung cancer is small cell lung cancer or non-small-cell lung cancer, more preferably wherein said lung cancer is a non-small cell lung cancer subtype, and even more preferably wherein said lung cancer is a non-small cell lung cancer subtype selected from the group consisting of adenocarcinoma or a squamous cell carcinoma. In the context of the invention, the term “non-small-cell lung cancer” or abbreviated “NSCLC” refers to a group of heterogenous cancer diseases that share their prognosis and management. Although tumour classification has evolved rapidly in the last years, the term “non-small-cell lung cancer” includes cancer comprising or consisting of at least a tumour selected from the group consisting of adenocarcinomas, squamous cell carcinomas (SCC), and large cell carcinomas (LCC).
[0046] The skilled person in the art knows how to classify tumours, particularly lung tumours following established criteria such as the World Health Organization (WHO) Classification of Tumours, 5th Edition, 2021. For example, classification particularly for lung tumours can be found in the WHO Classification of Tumours, 5th Edition, 2021 (ISBN-13 978-92-832-4506-3), Volume 5 related to Thoracic Tumours.
[0047] Preferably, said cancer comprising or consisting of a solid tumour is colorectal cancer.
[0048] Preferably, said cancer comprising or consisting of a solid tumour is ovarian cancer.
[0049] Preferably, said cancer comprises or consists of an advanced tumour.
[0050] In the context of the invention, an “advanced tumour” is a tumour that is at a stage where it has either grown significantly in size, and / or it has spread to nearby tissues, and / or it has metastasized to distant parts of the body. Typically, advanced tumours are not susceptible to be treated by surgery, due to their size, level of spread, or level of metastasis found throughout the body of the patient.
[0051] Preferably, an advanced tumour is a tumour that is at a stage where it has grown significantly in size, more preferably where it has grown to a size which makes it not susceptible to be treated by surgery, and / or a tumour that has spread to nearby tissues, and / or a tumour that has metastasized to distant parts of the body.
[0052] Preferably, said cancer comprises or consists of a poorly responsive tumour. In the context of the invention, the expression “a poorly responsive tumour” refers to a tumour that show a poor response to treatment, preferably to available treatments such as Standard of Care treatments for said tumour. In the context of the invention, “a poor response to treatment” is a response to treatment unable to control the progression of the cancer or tumour.
[0053] Poorly responsive tumours can be classified as refractory tumours, resistant tumours, and relapsed / recurrent tumours. T umours can be at the same time refractory or resistant, and relapsed recurrent tumours.
[0054] Preferably, said poorly responsive tumour is selected from the group consisting of a refractory tumour, a resistant tumour, a relapsed / recurrent tumour, or a combination thereof.
[0055] Preferably, said cancer comprises or consists of a tumour selected from the group consisting of a refractory tumour, a resistant tumour, a relapsed / recurrent tumour, and a combination thereof.
[0056] In the context of the invention, “a refractory tumour” is a tumour nonresponding initially to therapy, preferably to the standard of care treatment. The standard of care treatment for a given tumour is the treatment that is preferred for said tumour as it has shown the most effective results in treating said tumour.
[0057] In the context of the invention, “a resistant tumour” is a tumour that acquires or has acquired a resistance over time to a particular treatment. Certain tumours can acquire resistance to a particular treatment, for example, since they start to develop specific mutations that confer them the ability to be resistant to said particular treatment. Other tumours can acquire resistance, for example, due to changes in the tumour microenvironment, which facilitates the survival of tumoral cells and limits the efficacy of said particular treatment. In the context of the invention, “a relapsed / recurrent tumour” is a tumour that has relapsed, that means that has come back after having been considered in remission. Remission can include partial remission and complete remission.
[0058] Preferably, said cancer comprises or consists of an advanced refractory solid tumour or an advanced resistant solid tumour. More preferably, said cancer is selected from the group consisting of advanced refractory mesothelioma, advanced refractory lung cancer, advanced refractory colorectal cancer, advanced refractory ovarian cancer, advanced resistant mesothelioma, advanced resistant lung cancer, advanced resistant colorectal cancer, and advanced resistant ovarian cancer.
[0059] Preferably, said treatment is administered in combination with an additional cancer therapy. More preferably said additional cancer therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, and a combination thereof. Even more preferably said additional cancer therapy is the cancer therapy considered the standard of care treatment for said cancer. In a further preferred embodiment, said treatment is administered in combination with cisplatin.
[0060] Preferably, said pharmaceutically acceptable salt is a pharmaceutically acceptable salt of general formula (I’) wherein X represents a halogen atom, more preferably wherein X represents a Cl atom.
[0061] Preferably, said compound is a compound of formula (I) wherein R1 and R2 taken together are a methylenedioxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2.
[0062] Preferably, said compound is a compound of formula (I) wherein R1 and R2 taken together are a methylenedioxy group, R3 is a methoxy group, R4 is a hydroxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2. Preferably, said compound is a compound of formula (I) wherein R1 and R2 taken together are a methylenedioxy group, R3 is a hydroxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2. Preferably, said compound is a compound of formula (I) wherein R1 is a methoxy group, R2 is a hydroxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2.
[0063] Preferably, said compound is a compound of formula (I) wherein R1 is a hydroxy group, R2 is a methoxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2.
[0064] In a preferred embodiment, the invention relates to a compound of general formula (I) or a pharmaceutically acceptable salt thereof of general formula (I’) wherein R1 and R2 taken together are a methylenedioxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2, and wherein X is a Cl atom, for use in the treatment of cancer in a human subject, wherein said compound of general formula (I) is administered intravenously in a therapeutically effective dose to said human subject, wherein said cancer comprises or consists of a solid tumour, and wherein said cancer comprises or consists of at least one selected from the group consisting of an advanced tumour, a refractory tumour, a resistant tumour, a relapsed / recurrent tumour, and any combination thereof. More preferably, wherein said cancer is an advanced solid tumour, or a refractory solid tumour, or a resistant solid tumour, or a relapsed / recurrent solid tumour, wherein said cancer is selected from the group consisting of pleural mesothelioma, peritoneal mesothelioma, small cell lung cancer, non-small-cell lung cancer, colorectal cancer, and ovarian cancer.
[0065] In a preferred embodiment, the invention relates to a compound of general formula (I) or a pharmaceutically acceptable salt thereof of general formula (I’) wherein R1 and R2 taken together are a methylenedioxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2, and wherein X is a Cl atom, for use in the treatment of cancer in a human subject, wherein said compound of general formula (I) is administered intravenously in a therapeutically effective dose to said human subject, wherein said cancer comprises or consists of a solid tumour, and wherein said cancer comprises or consists of at least one selected from the group consisting of an advanced tumour, a refractory tumour, a resistant tumour, a relapsed / recurrent tumour, and any combination thereof, and wherein said treatment is administered in combination with an additional cancer therapy. More preferably wherein said additional cancer therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, and a combination thereof. Even more preferably wherein said additional cancer therapy is the cancer therapy considered a standard of care treatment for said cancer, and wherein said cancer is selected from the group consisting of pleural mesothelioma, peritoneal mesothelioma, small cell lung cancer, non-small-cell lung cancer, colorectal cancer, and ovarian cancer.
[0066] Preferably, said pharmaceutical composition comprises a compound of general formula or a pharmaceutically acceptable salt thereof of general formula (I’) wherein
[0067] R1 and R2, which can be the same group or a different group, are independently a hydroxy group or a methoxy group or, taken together, a methylenedioxy group,
[0068] R3 and R4, which can be the same group or a different group, are independently a hydroxy group or a methoxy group,
[0069] R5 is phenyl group, wherein said phenyl group optionally comprises 1 to 4 substituents independently selected among the group consisting of halogen, cyano, nitro, hydroxy, amino, (di)alkyl(C1-C6)amino, alkyl(C1-C6)carbonylamino, alkoxy(C1-C6), alkyl(C1-C6)carbonyloxy, alkoxy(C1-C6)carbonyl, alkyl(C1-C6); and wherein any of said substituents alk*(C1-C6), each independently, contains optionally 1 to 4 halogen atoms independently selected among the group consisting of F, Cl, Br e I, and
[0070] R6 is a phenyl group, wherein said phenyl group optionally comprises 1 to 4 substituents independently selected among the group consisting of halogen, cyano, nitro, hydroxy, amino, (di)alkyl(C1-C6)amino, alkyl(C1-C6)carbonylamino, alkoxy(C1-C6), alkyl(C1-C6)carbonyloxy, alkoxy(C1-C6)carbonyl, alkyl(C1-C6); and wherein any of said substituents alk*(C1-C6), each independently, contains optionally 1 to 4 halogen atoms independently selected among the group consisting of F, Cl, Br e I, and wherein
[0071] X represents an inorganic acid ion, an organic acid ion or a halide, preferably X represents a halogen atom, more preferably a Cl atom, and wherein n is 2.
[0072] Preferably, said pharmaceutical composition comprises a compound of formula (I) or a pharmaceutically acceptable salt thereof of general formula (I’) wherein R1 and R2 taken together are a methylenedioxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2.
[0073] Preferably, said pharmaceutical composition comprises a compound of formula (I) or a pharmaceutically acceptable salt thereof of general formula (I’) wherein R1 and R2 taken together are a methylenedioxy group, R3 is a methoxy group, R4 is a hydroxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2.
[0074] Preferably, said pharmaceutical composition comprises a compound of formula (I) or a pharmaceutically acceptable salt thereof of general formula (I’) wherein R1 and R2 taken together are a methylenedioxy group, R3 is a hydroxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2.
[0075] Preferably, said pharmaceutical composition comprises a compound of formula (I) or a pharmaceutically acceptable salt thereof of general formula (I’) wherein R1 is a methoxy group, R2 is a hydroxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2.
[0076] Preferably, said pharmaceutical composition comprises a compound of formula (I) or a pharmaceutically acceptable salt thereof of general formula (I’) wherein R1 is a hydroxy group, R2 is a methoxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group, and wherein n is 2. More preferably, in any of the preferred embodiments disclosed above, when R5 is a phenyl group and / or R6 is a phenyl group, said phenyl group, independently, comprises 1 to 4 substituents independently selected among the group consisting of halogen, cyano, nitro, hydroxy, amino, (di)alkyl(C1-C6)amino, alkyl(C1-C6)carbonylamino, alkoxy(C1-C6), alkyl(C1-C6)carbonyloxy, alkoxy(C1-C6)carbonyl, alkyl(C1-C6); and wherein any of said substituents alk*(C1-C6), each independently, contains optionally 1 to 4 halogen atoms independently selected among the group consisting of F, Cl, Br e I.
[0077] Preferably, said pharmaceutical composition is a liquid pharmaceutical composition comprising a pharmaceutically acceptable vehicle such that said liquid pharmaceutical composition is isotonic and such that said liquid pharmaceutical composition has a physiologic pH value, preferably said pharmaceutically acceptable vehicle is a phosphate buffer.
[0078] Preferably, said pharmaceutical composition is in the form of a lyophilized powder for reconstitution and for injection in humans.
[0079] Preferably, said pharmaceutical composition is administered intravenously, more preferably said pharmaceutical composition is administered intravenously at least once a week.
[0080] Likewise, the invention also includes other features of detail illustrated in the detailed description of an embodiment of the invention and in the accompanying figures.
[0081] Brief description of the drawings
[0082] Further advantages and features of the invention will become apparent from the following description, in which, without any limiting character, preferred embodiments of the invention are disclosed, with reference to the accompanying drawings in which: Figures 1A to 1 D show a subset of the results and analysis obtained from a panel of cancer cell lines (NCI 60 Screening Methodology - NIH) treated with 13-(3,3- diphenylpropyl)-9,10-dimethoxy-5,6-dihydrobenzo[g]-1 ,3-benzodioxolo [5,6- a]quinolizinium chloride (Compound #1 salt).
[0083] Figure 2 shows the antitumoral efficacy and safety of Compound #1 when administered intravenously alone or in combination with cisplatin on tumour growth (A) and animal body weight (B) in an experimental orthotopic model of mesothelioma. Values are represented as Mean ± SEM of 6 animals in each group. Statistical analysis was carried out by one way ANOVA followed by the Dunnett test. Asterisks indicate significant difference when treatment groups were compared with the Vehicle control group (group 1) *P=0.014; **P<0.005.
[0084] Figures 3A and 3B show the antitumoral efficacy (Fig. 3A) and safety (Fig. 3B) of Compound #1 when administered intravenously alone in a NSCLC Xenograft Model. Intravenous administration of cisplatin was performed for comparison. In Figure 3A values are represented as Mean ± SEM of 6 animals in each group. Statistical analysis was carried out by one way ANOVA followed by the Dunnett test. Asterisks indicate significant difference when treatment groups were compared with the Vehicle control group (group 1) ***P<0.001. In Figure 3B values are represented as Mean ± SEM of 6 animals in each group. Statistical analysis was carried out by Two-way ANOVA followed by Bonferroni test.
[0085] Figures 4A and 4B show the antitumoral efficacy (Fig. 4A) and safety (Fig. 4A) of Compound #1 in an AOM / DSS model for studying colorectal carcinogenesis based on the number of tumors counted after experiment termination (A) and body weight measurements throughout the course of the study period (B).
[0086] Figure 5A shows the fluorescence spectra measured for each combination of nucleic acid oligo (sequences in Table S1) and Compound #1. Each DNA oligo was dissolved in potassium phosphate buffer (185 mM NaCI, 185 mM KCI, 2 mM NaF^PC 1 mM Na2EDTA, 6 mM Na2HPC>4 at pH 7 and introduced into a separated dialysis unit (Thermo Fisher) and a blank sample containing only buffer. All dialysis units were allowed to equilibrate during 24 h at room temperature in a beaker containing the 1 pM solution of the appropriate binder. At the end of the dialysis experiment, the amount of Compound #1 bound to the DNA was quantified by measuring the fluorescence spectra.
[0087] Figure 5B shows the amount (a.u. = arbitrary units) of Compound #1 bound to DNA for each one of the tested DNA oligo sequences calculated from the fluorescence data shown in Figure 5A.
[0088] Figure 6A shows the CD spectra of the control duplex oligo (ds26, grey) and the TYMS- 1 DNA oligo (SEQ ID NO 10) in cacodylate buffer (CACO; 50 mM cacodylate, 100 mM KCI, pH 7.4) (black) and phosphate-buffered saline (PBS; 10 mM phosphate, 137 mM NaCI, 2.7 mM KCI, pH 7.4) (dot line). Figures 6B and 6C show CD spectra of TYMS-1 RNA oligo (SEQ ID NO 11) in cacodylate buffer (CACO; 50 mM cacodylate, 100 mM KCI, pH 7.4) (black) and phosphate-buffered saline (PBS; 10 mM phosphate, 137 mM NaCI, 2.7 mM KCI, pH 7.4) (dot line), respectively.
[0089] Figure 7 shows fluorescence spectroscopy measurements for the different combinations of DNA / RNA oligos and Compound #1. A fixed concentration of Compound #1 (10 pM) was titrated with increasing concentrations (0-6 pM) of TYMS-1 DNA (SEQ ID NO 10) and TYMS-1 RNA (SEQ ID NO 11) oligonucleotides respectively. Fluorescence intensity was recorded at the emission maximum (~511 nm).
[0090] Figure 8 shows1H-NMR spectra of titrations performed using the TYMS-1 DNA oligo (SEQ ID NO 10) listed in Table S2. Increasing amounts of ligand to the oligonucleotide at different ratios R=[drug] / [DNA] from R=0 to R=4.0. The tested ligand to oligo ratios R were 0; 0.25; 0.5; 1.0; 2.0; 3.0, and 4.0.
[0091] Figure 9 shows TS mRNA levels in HeLa cells treated with different concentrations (0.3, 1 and 3 pM) of Compound #1 (Cmpd #1) for 8 h (A), 15 h (B), 24 h (C) and 48 h (D) determined by qRT-PCR and normalized with the PPIA gene. Figure 10 shows TS protein levels in HeLa cells after 15 h of Compound #1 incubation at IC50 dose (3 pM). (A) and the representative images of western blots (B). The levels of protein were normalized with Tubulin protein.
[0092] Figure 11A-C show MSTO-211 H mesothelioma cells viability preincubated with thymidine (1-100 pM) for 24 hours, followed by treatment with either Compound #1 or 5-Fll for additional 48 hours. Cell viability was assessed by MTT assay. Thymidine-alone controls were maintained for up to 72 hours to assess intrinsic cytotoxicity.
[0093] Figure 12 show the biodistribution of Compound #1 in pleural mesothelioma tumours by quantitative mass spectrometry imaging (QMSI). Top panels: Hematoxylin and eosin (H&E)-stained sections of representative tumours from control (left) and Compound #1- treated (right) animals. Tumour areas are outlined in red dashed lines. Bottom panels: Corresponding QMSI maps acquired from adjacent tissue sections showing spatial distribution of Compound #1. Signal intensity reflects relative compound concentration, as indicated by the colour scale (0-100%). The treated tumour (right) shows marked compound accumulation throughout the tumour mass, while negligible signal is observed in the control tumour (left).
[0094] Figure 13 shown the data of a histopathological analysis of tumour necrosis following Compound #1 treatment. Left panel (A): Representative hematoxylin and eosin (H&E) stained section of a tumour from a vehicle-treated animal. The tumour mass is densely cellular with preserved architecture and minimal evidence of necrosis. Right panel (B): Representative H&E-stained section from an animal treated with Compound #1. The tumour exhibits extensive areas of acellular, eosinophilic necrosis, with a marked reduction in viable tumour cell density and loss of structural integrity.
[0095] Detailed description of embodiments of the invention
[0096] Example 1 :
[0097] Synthesis of berberine derivative 13-(3,3-diphenylpropyl)-9,10-dimethoxy-5,6-dihydro- benzo[g]-1 ,3-benzodioxolo [5,6-a]quinolizinium chloride (Compound #1 salt) Compound #1 of formula shown below, for example in the form of its chloride salt also shown below, can be advantageously manufactured for the therapeutic uses according to the invention by the following method. alt
[0098] A solution of 3,3-diphenylpropanoic acid (10 g) in dry dichloromethane (70 mL) was cooled to 0°C, and 1 ,1'-carbonyldiimidazole (CDI) (8 g) was added portion-wise. The reaction mixture was stirred for 1 hour while maintaining the temperature at 0-10°C. Diisobutylaluminum hydride (DIBAL-H, 1.0 M in dichloromethane, 93 mL) was added dropwise while keeping the reaction temperature below 10°C. After stirring for 2 hours, the reaction was quenched with an aqueous solution of tartaric acid. The organic phase was separated, dried, and concentrated to afford 3,3-diphenylpropanal, which was used in the next step without further purification. The reduction was successfully performed in 10 g scale and allowed obtaining and isolating 7 g of the aldehyde 3,3-diphenylpropanal.
[0099] Berberine hydrochloride (10 g) was suspended in isopropanol (200 mL) and treated with a sodium hydroxide solution (prepared from 5 g NaOH and 95 mL of purified water) at 20-30°C. Sodium borohydride (NaBH4) (11 g) was added in portions while maintaining the temperature. After stirring for 1 hour, the mixture was cooled to 0-10°C and stirred for an additional 2 hours. The precipitated solid was filtered, washed with isopropanol, and dried under vacuum to obtain dihydroberberine. 7.82 g of dihydroberberine.
[0100] Dihydroberberine (3 g) and 3,3-diphenylpropanal (1.9 g) were dissolved in a mixture of isopropanol (24 mL) and acetic acid (6 mL). The reaction mixture was heated to reflux and stirred for 5 hours. After completion, the reaction mixture was allowed to cool to room temperature and stirred for an additional 12 hours. The solid product was filtered and washed with isopropanol, yielding the crude berberine derivative 13-(3,3-diphenylpro- pyl)-9,10-dimethoxy-5,6-dihydrobenzo[g]-1 ,3-benzodioxolo [5,6-a]quinolizinium chloride. 1.89 g of 13-(3,3-diphenylpropyl)-9,10-dimethoxy-5,6-dihydrobenzo[g]-1 ,3-benzo- dioxolo [5,6-a]quinolizinium chloride (Compound #1 salt) were obtained.
[0101] Compound #1 , for example in the form of its chloride salt, can be formulated in a liquid pharmaceutical composition comprising a pharmaceutically acceptable vehicle such that said liquid pharmaceutical composition is isotonic and such that said liquid pharmaceutical composition has a physiologic pH value, for example in a phosphate buffer.
[0102] Compound #1 , for example in the form of its chloride salt, can also be lyophilized to obtain a lyophilized powder suitable for reconstitution and for injection in human, preferably via intravenous route. Example 2:
[0103] Figures 1 A to 1 D show a subset of the results and analysis of a panel of cancer cell lines (NCI 60 screening methodology) treated with the berberine derivative 13-(3,3- diphenylpropyl)- 9,10-dimethoxy- 5,6-dihydrobenzo [g]- 1 ,3-benzodioxolo [5,6-a] quinolizinium chloride (Compound #1 salt).
[0104] Table 1
[0105] Table 1 above shows cytotoxicity data (IC50) of Compound #1 determined by colorimetric MTT Assay performed in a panel of cancer cell lines, including cell lines resistant to their respective Standard of Care treatment.
[0106] The data shown in Figures 1A to 1 D and in Table 1 demonstrates significant inhibition of cell viability across a range of cancer types including solid tumours (preferably mesothelioma, non-small cell lung cancer, colon cancer, ovarian cancer), including resistant cancer types (see for example pleural mesothelioma and ovarian), and haematological tumours (leukaemia) at very small doses. This demonstrates the potential of Compound #1 as an anticancer agent, particularly for resistant types of cancer solid tumours.
[0107] Based on the available experimental data included below, Compound #1 seems to function as a post-transcriptional regulator of oncogenes by directly binding to complex secondary structures present in the mRNA of said oncogenes. For example, Compound #1 seems to function as a post-transcriptional regulator of the Thymidylate Synthase (TS) gene by directly binding to complex secondary structures present in the 5' untranslated region (5' UTR) of TS mRNA, for example hairpin loops or G-quadruplexes, effectively silencing the expression of this protein in tumours, based on different in-vitro assay for measuring gene and protein expression that have been performed (data not shown). Under normal conditions, the TS protein in its ligand-free form binds to these elements in its own mRNA, thereby repressing its translation and controlling TS levels within the cell. However, in tumour cells, where rapid proliferation demands higher TS production, all available TS is quickly utilized, leading to overproduction and a loss of the protein's ability to effectively regulate its mRNA. Consequently, these regulatory sites in the 5' UTR become ideal targets for therapeutic intervention and Compound #1 can bind to TS mRNA and replicate the normal regulatory function of the TS protein, thus restoring control over TS translation and providing an alternative mechanism to regulate TS expression in tumour cells. By potentially binding specifically to these RNA complex secondary structures, Compound #1 inhibits the translation of the TS protein, thereby disrupting an essential pathway on which cancer cells rely. This targeted approach contrasts sharply with traditional therapies that broadly affect all rapidly dividing cells, enhancing therapeutic precision and potentially lowering overall toxicity, and may explain the results obtained in resistant cell lines and the ability to synergize with standard of care treatments. For example, compared to current clinically used TS inhibitors such as pemetrexed that bind the protein and inhibits its activity, Compound #1 binds directly to mRNA and silences the expression of TS enzyme in the tumour while overcoming resistance associated with certain drugs commonly used to treat solid tumours. This mechanism may be the same for compounds closely related to Compound #1 based on their structural features, particularly the combination of the berberine ring structure combined with the diphenyl propyl substituent in position C13. Considering Compound #1 has shown affinity for other oncogenes that have sequences with the ability to form complex secondary structures, compound #1 is proposed as a first-in-class compound for the treatment of cancer, preferably of advanced cancers. Evidence of the abovedescribed mechanisms is provided below in Examples 6 and 7.
[0108] Example 3:
[0109] Orthotopic MSTO-211 H pleural mesothelioma model
[0110] Compound #1 was tested in vivo in pleural mesothelioma orthotopic (surgically implanted tumour in pleural tissue) xenograft models with MSTO-211 H. Intravenous (i.v.) administration of Compound #1 alone or in combination with cisplatin was performed.
[0111] The treatment with Compound #1 , either as a monotherapy or in combination with cisplatin, resulted in a significant in vivo reduction in tumor growth compared to the control and standard of care (pemetrexed + cisplatin) groups as shown in Figure 1 panel A. Body weight measurements indicate no significant signs of toxicity, with stable animal weight observed throughout the study period as shown in Figure 1 panel B. The combination therapy demonstrated a synergistic effect, leading to delayed tumor progression without major safety concerns. At tissue level, histological analysis correlated treatment with compound #1 with necrosis associated with tumour reduction (data not shown).
[0112] In a further in vivo study performed in an orthotopic MSTO-211 H pleural mesothelioma model (data not shown), the addition of Compound #1 to the standard of care cisplatin therapy showed a clear benefit in tumour growth delay, while proved synergistic effects allowing to reduce the dose of Compound #1 in vivo and thus, reducing potential toxic side-effects due to the drug. The delay in tumour growth was maintained after completing the treatment. No major signs of toxicity or safety concerns were found.
[0113] Example 4:
[0114] NSCLC Xenograft Model model
[0115] Compound #1 was tested in a in A549 induced-mouse model (xenograft) of non-small cell lung cancer (NSCLC). The antitumor efficacy of Compound #1 was tested by intravenous (i.v.) route with twice weekly administrations for four weeks in A549 induced- mouse model (xenograft) of lung cancer in comparison with i.v. administration of cisplatin.
[0116] As shown in Figures 3A Compound #1 shows a dose-dependent efficacy, with the 3 mg / kg dose showing a 47% inhibition of tumor growth, which was statistically significant when compared to active compound cisplatin. No toxic effects were observed in animal body weight remained stable throughout the study, indicating a favorable safety profile (Fig. 3B). The in vivo potency of Compound #1 was comparable to, or exceeded, that of cisplatin, confirming its potential as a more effective and safer treatment option for lung cancer.
[0117] Intravenous administration presents challenges both from a formulation point of view of the compound as well as from an in vivo efficacy and a safety perspective, e.g. the risk of reduced efficacy due problems during preparation of the injectable formulation or potential side effects derived from the compound being delivered directly into the blood stream. To the best knowledge of the inventors, efficacious intravenous administration to treat cancer, in particular solid tumours, has not been proved before for compounds such as Compound #1. Thus, the examples above show how Compound #1 and likely closely related compounds can exert its antitumoral activity in vivo and upon intravenous administration, particularly against solid tumours, and demonstrates that Compound #1 can safely achieve its therapeutical effect against a variety of cancers via this administration route, thus allowing therapeutic treatments that have the advantages of such administration route such as the compound rapidly reaching its target and the therapeutic effect being achieved quickly.
[0118] Example 5:
[0119] AOM / DSS colorectal carcinogenesis model
[0120] AOM / DSS model is a well-established system for studying inflammation-driven colorectal carcinogenesis. Figure 4 shows the results of testing Compound #1 in the AOM / DSS model mice. Compound #1 (3mg / kg) reduced significantly the number of tumours in vivo as compared to untreated animals. The number of tumours were counted after experiment termination. Body weight measurements indicate no significant signs of toxicity, with stable animal weight observed throughout the study period.
[0121] Example 6:
[0122] The following experimental data support that Compound #1 according to the present invention exerts its anticancer activity by binding to nucleic acid complex secondary structures.
[0123] Competitive dialysis studies using G-quadruplex forming nucleic acids and compound #1 :
[0124] BACKGROUND - To gain more information about the binding properties of Compound #1 with regards to nucleic acid structures and sequences, competitive dialysis experiments were performed (Reference: P. Ragazzon and J. B. Chaires, Methods, 2007, 43, 313-323). In these, different dialysis units containing different nucleic acid oligos with specific sequences, some of them prone to form folded secondary structures, are placed inside a solution of the studied ligand. After an equilibration period, part of the ligand enters the dialysis units depending on its selectivity towards each sequence or structure, as well on the binding stoichiometry.
[0125] METHODOLOGY - 100 pl of a 50 pM DNA of the different DNA oligos with sequences as per Table S1 were dissolved in potassium phosphate buffer (185 mM NaCI, 185 mM KOI, 2 mM NaH2PO4, 1 mM Na2EDTA, 6 mM Na2HPO4 at pH 7 and introduced into a separated dialysis unit (Thermo Fisher) and a blank sample containing only buffer. All dialysis units were allowed to equilibrate during 24 h at room temperature in a beaker containing the 1 pM solution of Compound #1 as binder. At the end of the dialysis experiment, the amount of binder bound to the DNA was quantified by measuring the fluorescence spectra. Quantification is carried out by measuring emission fluorescence at 600 nm.
[0126] RESULTS - Different DNA oligos with sequences as per Table S1 representing several nucleic acid secondary structures were used. T20 was used as a model for an unfolded single-stranded DNA sequence. As models of dsDNA, a 26-mer hairpin (ds26) was used. Several sequences known to form G-quadruplex structures were used. It was observed that the measured fluorescence in tubes containing DNA sequences was much higher than that measured for the blank (Fig. 5A and 5B). Therefore, it was clear that Compound #1 showed a strong tendency to interact with the stable DNA structures formed by the considered sequences at approximately 20°C (room temperature). Quantitative information from this experiment needs to be carefully considered as ligands show slightly different values of quantum yields, and the binding stoichiometry may be different among DNA sequences, affecting the measured fluorescence. However, qualitative information and quantitative trends can be observed. First, Compound #1 shows low tendency to interact with the ds26 (a duplex) or the T20 sequence which forms a rather unfolded species under these conditions. Second, the fluorescence intensity was higher for G4s structures such as parallel G-quadruplexes (cKit-GG1 , DL40) and hybrid quadruplexes (Bcl-2, TYMS-1 DNA). Table S1
[0127] Example 7:
[0128] Further, experimental evidence was obtained that Compound #1 according to the present invention exerts its anticancer activity by directly binding to complex secondary structures present in the 5' untranslated region (5' UTR) of the Thymidylate Synthase mRNA (TS mRNA), for example hairpin loops or G-quadruplexes, effectively silencing the expression of Thymidylate Synthase in tumours. This structural interaction blocks ribosomal access and prevents translation initiation without degrading the transcript. This mechanism has been experimentally confirmed, as shown below, via CD, NMR and EMSA. Western blot analysis demonstrates a reduction in TS protein levels, and RT-qPCR confirms unchanged TS mRNA, thereby establishing translational silencing as the primary mode of action. This makes the compounds according to the invention (i.e. Compound #1) first-in-class agents with therapeutic potential particularly, in solid tumours.
[0129] Evidence of G-quadruplex (G4) structures present in TS mRNA. In silico prediction of G-quadruplex structure candidates on TS mRNA:
[0130] BACKGROUND - Using the QGRS Mapper and G4Predictor tools, the 5’ UTR region of the TS mRNA was analysed and the sequence GGAAAAGGCGCGCGGAAGGGG (Position: 14, Length: 21 nt, G-Score: 20 - TYMS-1 RNA - SEQ ID NO 11) was identified as a high-probability G-quadruplex (G4) candidate. This sequence meets key G4 criteria, including consecutive guanine tracts and a high G-Score, suggesting its potential to form stable G4 structures in vitro.
[0131] Further experimental validation using Thermal Difference Spectra (TDS) and Circular Dichroism (CD) spectroscopy was performed to confirm G4 formation.
[0132] Thermal Difference Spectra (TDS):
[0133] BACKGROUND - Thermal Difference Spectra (TDS), derived from the differential absorption spectra of DNA at varying temperatures, is a key technique for assessing nucleic acid secondary structures and their thermal stability. This method exploits the distinct spectral signatures of folded (native) and denatured DNA states, allowing the identification of characteristic peaks associated with specific conformations (e.g., duplexes, G-quadruplexes, or i-motifs) (Mergny, J.L.; Li, J.; Lacroix, L.; Amrane, S.; Chaires, J.B. Nucleic Acids Res. 2005, 33 ,138).
[0134] As DNA undergoes thermal denaturation, changes in base stacking, hydrogen bonding, and helicity alter its UV absorption profile. TDS captures these shifts by comparing spectra at a low temperature (e.g., 15°C, where the structure is intact) and a high temperature (e.g., 80°C, where the DNA is fully unfolded). The resulting difference spectrum highlights wavelength-dependent absorbance changes, with peaks and troughs corresponding to structural transitions. For instance: Duplex DNA shows a positive peak near 260-270 nm due to unstacking of base pairs, G-quadruplexes: exhibit distinct features (e.g., -295 nm for parallel topologies) and i-Motifs display unique signatures linked to protonated C-C+ base pairing. By correlating these spectral features with temperature, TDS provides insights into melting behaviour and structural integrity, complementing techniques like CD spectroscopy.
[0135] METHODOLOGY - Thermal melting curves were obtained by monitoring the absorption change at 295 nm for the oligodeoxynucleotide (ODN) listed in Table S2, from 15 °C to 70 °C, with a linear temperature ramp of 0.5 °C / min in Teflon-stoppered 1-cm quartz cells, using a JASCO V-650 spectrophotometer equipped with a Peltier temperature control. UV spectra of the oligonucleotides were recorded at 15 °C (folded) and 80 °C (unfolded) to calculate thermodynamic parameters (TDS). Measurements were conducted in either cacodylate buffer (CACO; 50 mM cacodylate, 100 mM KCI, pH 7.4) or phosphate-buffered saline (PBS; 10 mM phosphate, 137 mM NaCI, 2.7 mM KCI, pH 7.4). Reference spectra were collected at 15°C (folded state) and 80°C (denatured state). Peak assignments were based on established signatures for DNA secondary structures.
[0136] RESULTS - Table S2 shows the sequence and preparation conditions of the oligos used for the experiments: ds26 is a control double-stranded DNA (dsDNA) oligo, TYMS-1 DNA is a single-stranded DNA oligo with the G-quadruplex forming sequence present in the 5’UTR of the TS mRNA.
[0137] Table S2
[0138] Circular Dichroism (CD) Spectroscopy: BACKGROUND - CD Spectroscopy is a technique based on the calculation of the differences between the absorption of left and right circularly polarised light that allows the detection and analysis of phenomena related to the chirality of molecules, yielding very specific spectra for macromolecules (proteins and nucleic acids). Higher order non- canonical nucleic structures, e.g. triplex, G-quadruplex, i-motif, all show characteristic CD spectra that differ from each other as well as from those of for example the DNA double helix structures. CD is particularly useful as it gives information on the nucleic acid topology (parallel or antiparallel) and on the three-dimensional structure, all useful aspects for the study of complex secondary structures such as quadruplexes. (Reference: Nagatoishi, S.; Tanaka, Y. Biochem Biophys Res Commun. 2007, 352, 812- 817.). For example, the ability of nucleic acid sequences to form complex secondary structures can be shown by Circular dichroism (CD). Using this technique, parallel quadruplex structures typically show a maximum at 260 nm and a minimum at 240 nm. Antiparallel quadruplex structures typically show maxima at 240 and 295 nm and a minimum at 270 nm. It is possible to have hybrid structures, which are a mix of parallel and antiparallel structures.
[0139] METHODOLOGY - Circular dichroism (CD) spectroscopy was performed using a Jasco J-815 spectropolarimeter equipped with a Peltier temperature-controlled cell holder (Jasco CDF-4265 / 15) maintained at 20 °C. Measurements were carried out in 1 cm path- length quartz cuvettes using the following acquisition parameters: a spectral range of 220-310 nm, scan speed of 100 nm / min, bandwidth of 1 nm, data pitch of 0.5 nm, and a response time of 4 s. The study evaluated three oligonucleotide samples: TYMS-1 DNA (SEQ ID NO 10), a single-stranded DNA oligonucleotide corresponding to the 5' untranslated region (5’ UTR) sequence of Thymidylate Synthase mRNA; TYMS-1 RNA (SEQ ID NO 11), an RNA oligonucleotide with an identical nucleobase sequence to TYMS-1 DNA (See Tables S1 and S2) but synthesized through distinct chemical routes (phosphoramidite chemistry for DNA versus in vitro transcription or RNA-specific chemical synthesis for RNA), and ds26, a canonical double-stranded DNA control. While both TYMS-1 DNA and TYMS-1 RNA oligos share the same nitrogenous base sequence (see SEQ ID NO 10 and SEQ ID NO 11), their chemical backbones differ (2'-deoxyribose vs. ribose), potentially impacting their folding properties and structural stability. All oligonucleotides were prepared at a concentration of 4 pM in either cacodylate buffer (CACO; 50 mM cacodylate, 100 mM KCI, pH 7.4) or phosphate-buffered saline (PBS; 10 mM phosphate, 137 mM NaCI, 2.7 mM KCI, pH 7.4). Prior to measurement, samples were annealed by heating to 95 °C for 5 minutes, followed by slow cooling to room temperature and overnight incubation at 4 °C to promote proper folding. The choice of buffer allowed comparison of structural features under different ionic environments: the K+-rich cacodylate buffer was used to favour G-quadruplex formation, while PBS mimicked physiological conditions to evaluate the robustness of structural motifs.
[0140] CD spectra were then analysed to characterize secondary structure topologies, particularly with respect to G-quadruplex formation. Specific attention was given to identifying spectral signatures consistent with parallel G-quadruplexes, such as a positive peak near 265 nm and a negative trough around 240 nm. The ds26 duplex provided a reference for canonical B-form DNA. The inclusion of both DNA and RNA forms of the TYMS-1 sequence (SEQ ID NO 10 and SEQ ID NO 11 respectively) enabled a direct comparison of how backbone chemistry modulates the conformational landscape of nucleic acids under identical sequence and experimental conditions. This approach supported a nuanced understanding of structure-function relationships in nucleic acid folding and their modulation by buffer composition and molecular composition.
[0141] RESULTS - Figure 6A shows the CD spectra of the control duplex (ds26, grey) and TYMS-1 DNA in cacodylate buffer (CACO; 50 mM cacodylate, 100 mM KCI, pH 7.4) (black) phosphate-buffered saline (PBS; 10 mM phosphate, 137 mM NaCI, 2.7 mM KCI, pH 7.4) (dot line). The ds26 duplex displays the characteristic B-form DNA profile, with a positive band around 275 nm and a negative minimum near 245 nm. In contrast, TYMS- 1 DNA exhibits a distinct spectral pattern with a prominent positive band near 265 nm, a secondary shoulder or local maximum near 290 nm, and a negative band around 240 nm, more evident in CACO buffer. This spectral signature is consistent with the formation of a G-quadruplex structure of hybrid topology. The lower intensity observed in PBS suggests reduced stabilization and possible coexistence of multiple G4 conformations under these ionic conditions. Figures 6B and 6C show CD spectra of TYMS-1 RNA in PBS and CACO buffer, respectively. The TYMS-1 RNA oligonucleotide shows consistent parallel G-quadruplex signatures in both buffers, with a strong positive band at -260- 265 nm and a negative band at -240 nm. The CACO buffer produces sharper and more intense signals, suggesting improved G4 folding and stability under potassium-rich conditions. These results highlight the buffer-dependent behaviour of G-quadruplex formation and its structural sensitivity to ionic environment.
[0142] Evidence of Compound #1 binding to G-quadruplex structure in 5’UTR of the TS mRNA.
[0143] To evaluate the ability of Compound #1 to interact with G-quadruplex structures formed within the 5'IITR of the TS mRNA, we employed two complementary biophysical techniques: steady-state fluorescence spectroscopy and proton nuclear magnetic resonance (1H-NMR) titration. These methods provide orthogonal insights into ligand binding: fluorescence spectroscopy enables sensitive detection and quantification of binding affinities based on environment-dependent changes in ligand fluorescence, while NMR spectroscopy allows direct observation of structural changes in the nucleic acid upon ligand interaction, particularly in the imino proton region characteristic of G- quartets.
[0144] Fluorescence spectroscopy:
[0145] METHODOLOGY - Fluorescence titrations were performed to evaluate the binding (affinity and stoichiometry) of Compound #1 to G-quadruplex (G4) structures in nucleic acids. Experiments were carried out on a JASCO FP-6200 spectrofluorometer equipped with a temperature-controlled ETC-272T unit, using quartz cuvettes (10 mm path length). Excitation was set at 430 nm, with emission spectra collected from 450 to 600 nm. Slit widths were 10 nm, and the scan speed was 250 nm / min. A fixed concentration of Compound #1 (10 pM) was titrated with increasing concentrations (0-6 pM) of TYMS-1 DNA and TYMS-1 RNA oligonucleotides. Fluorescence intensity was recorded at the emission maximum (-511 nm), and binding constants (Ka) were determined using a 1 :1 binding model.
[0146] RESULTS - Figure 7 shows the results for the fluorescence spectroscopy measurements for the different combinations of oligo sequences and concentrations of Compound #1. Addition of TYMS-1 DNA and TYMS-1 RNA led to a marked increase in fluorescence intensity of Compound #1 , consistent with specific binding to G-quadruplex structures.
[0147] Table S3 below shows the affinity constants (Ka) and stoichiometry of compound #1 to the oligonucleotides tested.
[0148] Table S3
[0149] CONCLUSIONS - Fluorescence titration experiments revealed a concentrationdependent increase in fluorescence intensity upon addition of TYMS-1 oligonucleotides indicating that Compound #1 binds specifically to G4 structures such as TYMS-1 DNA / RNA. Further, the calculated affinity constants were in the range of 106M"1, is consistent with high-affinity interactions. These results demonstrate that Compound #1 selectively recognizes the G4 forming sequence within the 5' untranslated region (5'UTR) of the TS gene and binds comparably to both RNA and DNA forms of the sequence under in vitro conditions.
[0150] 1 H-NMR titrations to confirm binding of Compound #1 to nucleic acid sequences: METHODOLOGY - To further confirm the interaction of Compound #1 with G- quadruplex DNA,1H-NMR titrations were performed using TYMS-1 DNA oligos listed in Table S3. Samples were prepared in H2O / D2O (9:1) with 25 mM KH2PO4, 150 mM KOI, and 1 mM EDTA at pH 6.7. The oligonucleotide samples were annealed by heating at 85 °C for 1 min and slowly cooled to room temperature overnight. Compound #1 was dissolved in DMSO-d6at a concentration of 27 mM. NMR Spectra were recorded on a Bruker AV600 spectrometer at 600.10 MHz. NMR titrations were performed at by adding increasing amounts of ligand to the oligonucleotide at different ratios R=[drug] / [DNA] from R=0 to R=4.0. The tested ligand to oligo ratios R were 0; 0.25; 0.5; 1.0; 2.0; 3.0, and 4.0 for each compound.
[0151] RESULTS - The oligonucleotides show imino proton peaks from 10.8 to 12.0 ppm, indicative of the formation of a G-quadruplex fold, but the broadening of these signals suggests the co-existence of multiple G-quadruplexes (Figure 8 R=0). Significant line broadening of the imino resonances can be observed upon titration with Compound #1 as ligand even at low ratio (Figure 8 - R= 0.25 and 0.5). Continuous titration to a 1 :1 , 1 :2, 1 :3 and 1 :4 G-quadruplex / ligands stoichiometry accentuated the broadening of the imino proton resonances.
[0152] The imino proton region (10.8-12.0 ppm) of the TYMS 1-DNA spectrum displayed signals indicative of G-quadruplex (G4) folding. Upon addition of compound #1 , significant broadening of these peaks was observed, even at low ligand-to-DNA ratios (Figure 8 - R = 0.25 and 0.5). Progressive titration to a 1 :1 , 1 :2 ,1 :3 and 1 :4 G-quadruplex / ligands stoichiometry accentuated the broadening of the imino proton resonances signal (10-12 ppm)., consistent with strong binding of compound #1 to the G4 core. Such broadening effects could be attributed to the strong binding of these ligands, resulting in intermediate- to-slow exchange between free and bound ligand states on the NMR timescale. These spectral changes confirm the direct interaction between Compound #1 and the G-quadruplex structure in the TYMS 1-DNA sequence. CONCLUSIONS - The spectral changes confirm the direct interaction between Compound #1 and the G-quadruplex structure present in the 5’UTR sequence of the TS mRNA.
[0153] Evidence of TS translational silencing as the primary mode of action of Compound #1
[0154] To investigate whether Compound #1 (Cmpd #1 in figures) exerts its effect on TS expression through a post-transcriptional mechanism, we evaluated TS mRNA and protein levels in HeLa cells following compound exposure at various time points and concentrations. Cells were treated with increasing concentrations of Compound #1 (0.3, 1 , and 3 pM) and harvested at 8, 15, 24, and 48 hours. TS mRNA transcript levels were quantified by qRT-PCR and normalized to the housekeeping gene PPIA (Figure S9A- D). In parallel, TS protein levels were assessed by Western blot following 15 h treatment at the IC50concentration (3 pM) (Figure S10A-B).
[0155] The results presented in Figures 5A, 5B, 9, and 10 demonstrate that treatment with Compound #1 leads to a significant reduction in TS protein levels without a corresponding decrease in TS messenger RNA (TS mRNA) levels, consistent with a mechanism of translational silencing. The dissociation between steady-state mRNA and protein levels is characteristic of post-transcriptional regulation and specifically supports a mechanism of translational inhibition.
[0156] Mechanistically, this observation aligns with previous structural and biophysical data showing that Compound #1 binds selectively to a G-quadruplex (G4) structure located within the 5' untranslated region (5'UTR) of the TS mRNA. G4 structures are known to serve as cis-regulatory elements that modulate translation by blocking ribosomal scanning or initiation. Stabilization of these motifs by small-molecule ligands as Compound #1 is sufficient to repress translation without altering transcript levels, a phenomenon consistent with the observed decrease in protein expression despite unchanged mRNA levels. This translational silencing mechanism stands in clear contrast to that of classical TS inhibitors such as 5-fluorouracil, pemetrexed, and capecitabine, which act by competitively inhibiting the enzyme’s catalytic activity. These conventional agents often trigger a compensatory cellular response involving upregulation of Thymidylate synthase expression at both the mRNA and protein levels, due to transcriptional activation and release of the enzyme's autoregulatory repression of its own mRNA (Chu E. et al., Proc Natl Acad Sci USA. 1991 Apr 1 ;88(21):8977-8981 ; Takeishi S. et al., Cancer Sci. 2011 Jul;102(7):1441-1447). Compound #1 circumvents this feedback mechanism by acting directly on the untranslated region of the mRNA, providing a distinct, RNA-guided mechanism of action that prevents TS synthesis at its origin, offering a potential advantage in terms of durability and resistance avoidance.
[0157] Evidence of mechanistic distinction of Compound #1 from classical TS protein Inhibitors.
[0158] BACKGROUND - To further distinguish the mechanism of action of Compound #1 from classical thymidylate synthase (TS) protein inhibitors, we evaluated whether its cytotoxic effect could be reversed by exogenous thymidine supplementation — a standard approach to determine whether deoxythymidine monophosphate (dTMP) depletion underlies cytotoxicity (Shih et al., 1997). Agents such as 5-fluorouracil (5-FU) act by inhibiting TS enzymatic activity, leading to nucleotide pool imbalance and impaired DNA synthesis. In such cases, cell death can often be rescued by thymidine, which bypasses the metabolic block. If Compound #1 acted via this classical antimetabolite mechanism, its cytotoxicity would be expected to be mitigated by thymidine supplementation. Conversely, a lack of rescue would suggest a non-canonical mechanism, such as post- transcriptional inhibition.
[0159] METHODOLOGY - To evaluate whether dTMP depletion contributes to the cytotoxicity of Compound #1 , MSTO-211 H mesothelioma cells were preincubated with thymidine (1- 100 pM) for 24 hours, followed by treatment with either Compound #1 or 5-FU for additional 48 hours. Cell viability was assessed by MTT assay. Thymidine-alone controls were maintained for up to 72 hours to assess intrinsic cytotoxicity. Thymidine treatment alone was non-toxic at concentrations up to 100 pM, with only modest viability reduction (-25%) observed at the highest dose (Figure 11A). As expected, thymidine co-treatment efficiently rescued cells from 5-fluorouracil-induced cytotoxicity (Figure 11 B), confirming the classical TS inhibition mechanism of that agent. In contrast, thymidine supplementation provided no protective effect against Compound #1 (Figure 11C). On the contrary, higher thymidine concentrations significantly potentiated the cytotoxicity of Compound #1 (p < 0.01 vs. Compound #1 alone). This lack of rescue confirms that Compound #1 does not act through dTMP depletion or nucleotide biosynthesis inhibition. Instead, the exacerbation of cytotoxicity suggests a mechanism independent of TS catalytic inhibition. The results support a structure-guided, post-transcriptional mechanism, consistent with selective binding of Compound #1 to RNA G-quadruplex structures located in the 5' untranslated region of TS mRNA, leading to translational silencing. Importantly, there is no evidence that Compound #1 interacts directly with genomic DNA. Unlike platinum-based agents, it does not intercalate DNA, form covalent adducts, or trigger DNA damage responses. In vivo, intravenous administration of Compound #1 in murine models of pleural mesothelioma, non-small cell lung cancer, and colorectal cancer was well tolerated at therapeutically effective doses, with no significant weight loss, hematologic abnormalities, or systemic organ toxicity — side effects commonly associated with classical TS inhibitors or DNA-damaging agents.
[0160] Taken together, the data confirm that Compound #1 exerts its anticancer effects through a distinct, non-genotoxic mechanism of action that bypasses nucleotide metabolism and targets RNA structure to silence oncogenic translation.
[0161] In vivo evidence of efficacy, tumour targeting, and safety of Compound #1 in a pleural mesothelioma model
[0162] To demonstrate the therapeutic relevance and translational mechanism of Compound #1 , we performed an in vivo study using an orthotopic model of malignant pleural mesothelioma. This experiment was designed to assess not only the compound’s antitumor activity but also its safety profile and pathological effects at the tissue level. The data related to the efficacy and tolerability relating to this study was already disclosed in Example 3 of the application as originally filed.
[0163] Efficacy, tolerability and safety:
[0164] As shown in Figure 2A, intravenous treatment with Compound #1 (administered at 3 mg / kg, twice weekly for four weeks) significantly reduced tumour growth in comparison to vehicle-treated controls (P = 0.014), both as a monotherapy and in combination with cisplatin (P < 0.005 for the combination group). The reduction in tumour burden was dose-responsive and additive when combined with standard chemotherapy. Importantly, no significant changes in body weight were observed across treatment groups (Figure 2B of the application as originally filed), indicating good systemic tolerability of Compound #1 at the effective dose. Data are presented as mean ± SEM (n = 6 per group) and were analysed using one-way ANOVA with Dunnett’s post-hoc test. Histological evaluation of liver, kidney, spleen, and lung revealed no treatment-related abnormalities, inflammation, or signs of off-target toxicity in any group. This supports the favourable safety profile of Compound #1
[0165] Tissue-specific distribution and tumour targeting:
[0166] To confirm whether Compound #1 accumulates effectively in the tumour microenvironment, a guantitative mass spectrometry imaging (QMSI) analysis was performed on transversal cryosections of the entire thoracic region from a representative tumour-bearing mouse, sacrificed 15 minutes after receiving the final intravenous dose of Compound #1 (3 mg / kg, twice weekly for 4 weeks).
[0167] Tissue blocks were embedded in optimal cutting temperature (OCT) compound, and 10 pm cryosections were mounted onto ITO-coated slides for MALDI-MS imaging. Adjacent sections were stained with hematoxylin and eosin (H&E) to provide anatomical reference. To enable absolute guantification, known concentrations of Compound #1 were co-deposited as calibration standards directly on the same slide. Figure 12 shows histological (top) and QMSI (bottom) images of tumours from control and treated animals. The compound exhibited strong and selective accumulation in pleural tumour tissue, as visualized by the high-intensity signal in the treated tumour while no relevant signal was detected in tumours from control animals. Signal intensity, color-coded from 0 to 100%, reflects compound distribution and concentration. These data confirm selective and effective intratumorally delivery of Compound #1 following intravenous administration. Preferential accumulation within the tumour tissue supports the compound’s pharmacological selectivity and mechanism of action via local engagement with the target in the tumour area.
[0168] Histopathology and necrotic response:
[0169] As shown in Figure 13, histopathological analysis of tumour sections stained with hematoxylin and eosin revealed a marked contrast between treated and control animals. Vehicle-treated tumours retained cellular architecture with minimal necrosis (Fig. S9 panel A), whereas tumours from Compound #1-treated animals exhibited widespread necrotic areas with loss of viable tumour cells and disorganized structure (Fig. S9 panel B). These observations were corroborated by morphometric quantification of tumour surface area and necrotic fraction, confirming a direct cytotoxic effect of the compound within the tumour. This necrotic phenotype effect is mechanistically distinct from that of classical thymidylate synthase inhibitors.
[0170] In summary, the in vivo study provides robust evidence that Compound #1 effectively reaches its target tissue, control tumour growth and induce necrosis while being well tolerated. These results substantiate Compound #1 as a first-in-class agent with therapeutic potential particularly, in solid tumours.
[0171] The project leading to these Examples has received funding from the European Union's Programme for Research and Innovation Horizon 2020 (Grant Agreement ID 829416), funding from the European Union’s Horizon 2020 research and innovation programme under the Marie Sklodowska-Curie (Grant Agreement No 766214) and funding from the CDTI as part of the programme to support SMEs with the Seal of Excellence of the Horizon Europe EIC Accelerator (SoE2022-1025).
[0172] The subject-matter referred thereto in the claims of the priority application as originally filed is reproduced below in the form of clauses so as to include it as part of the description of the present application.
[0173] Clause 1.- A compound of general formula (I)
[0174] R1 and R2, which can be the same group or a different group, are independently a hydroxy group or a methoxy group or, taken together, a methylenedioxy group,
[0175] R3 and R4, which can be the same group or a different group, are independently a hydroxy group or a methoxy group,
[0176] R5 is phenyl group, wherein said phenyl group optionally comprises 1 to 4 substituents independently selected among the group consisting of halogen, cyano, nitro, hydroxy, amino, (di)alkyl(C1-C6)amino, alkyl(C1-C6)carbonylamino, alkoxy(C1-C6), alkyl(C1-C6)carbonyloxy, alkoxy(C1-C6)carbonyl, alkyl(C1-C6); and wherein any of said substituents alk*(C1-C6), each independently, contains optionally 1 to 4 halogen atoms independently selected among the group consisting of F, Cl, Br e I, and
[0177] R6 is a phenyl group, wherein said phenyl group optionally comprises 1 to 4 substituents independently selected among the group consisting of halogen, cyano, nitro, hydroxy, amino, (di)alkyl(C1-C6)amino, alkyl(C1-C6)carbonylamino, alkoxy(C1-C6), alkyl(C1-C6)carbonyloxy, alkoxy(C1-C6)carbonyl, alkyl(C1-C6); and wherein any of said substituents alk*(C1-C6), each independently, contains optionally 1 to 4 halogen atoms independently selected among the group consisting of F, Cl, Br e I, and wherein n is 2; for use in the treatment of cancer in a human subject, wherein said compound of general formula (I) is administered in a therapeutically effective dose to said human subject.
[0178] Clause 2.- The compound for use according to clause 1 , wherein said compound is administered intravenously.
[0179] Clause 3.- The compound for use according to any one of the preceding clauses, wherein said therapeutically effective dose is a dose sufficiently to cause an effective treatment of a of said cancer, more preferably, more preferably wherein said therapeutically effective dose is comprised between a Minimal Starting Dose (MSD) and Maximum Tolerated Dose (MTD).
[0180] Clause 4.- The compound for use according to any one of the preceding clauses, wherein said cancer comprises or consists of a solid tumour.
[0181] Clause 5.- The compound for use according to any one of the preceding clauses, wherein said cancer comprises or consists of an advanced tumour, wherein said advanced tumour is a tumour that is at a stage where it has either grown significantly in size, and / or it has spread to nearby tissues, and / or it has metastasized to distant parts of the body.
[0182] Clause 6.- The compound for use according to any one of the preceding clauses, wherein said cancer comprises or consists of a tumour selected from the group consisting of a refractory tumour, a resistant tumour, a relapsed / recurrent tumour, and a combination thereof.
[0183] Clause 7.- The compound for use according to any one of the preceding clauses, wherein said cancer comprises or consists of an advanced refractory solid tumour or an advanced resistant solid tumour.
[0184] Clause 8.- The compound for use according to any one of clauses 4 to 7, wherein said cancer is mesothelioma, preferably pleural mesothelioma or peritoneal mesothelioma, and more preferably pleural mesothelioma.
[0185] Clause 9.- The compound for use according to any one of clauses 4 to 7, wherein said cancer is a lung cancer, preferably wherein said lung cancer is a small cell lung cancer or a non-small-cell lung cancer, more preferably wherein said lung cancer is a non-small cell lung cancer subtype, and even more preferably wherein said lung cancer is a non- small cell lung cancer subtype selected from the group consisting of adenocarcinoma and a squamous cell carcinoma.
[0186] Clause 10.- The compound for use according to any one of clause 4 to 7, wherein said cancer is colorectal cancer.
[0187] Clause 11.- The compound for use according to any one of clause 4 to 7, wherein said cancer is ovarian cancer.
[0188] Clause 12.- The compound for use according to any one of the preceding clause, wherein said treatment is administered in combination with an additional cancer therapy, preferably wherein said additional cancer therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, and a combination thereof, and more preferably wherein said additional cancer therapy is the cancer therapy considered the standard of care treatment for said cancer, and even more preferably said additional cancer therapy is cisplatin.
[0189] Clause 13.- The compound for use according to any one of the preceding clauses, wherein
[0190] R1 and R2 taken together are a methylenedioxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group; or wherein
[0191] R1 and R2 taken together are a methylenedioxy group, R3 is a methoxy group, R4 is a hydroxy group, R5 is a phenyl group, and R6 is a phenyl group; or wherein
[0192] R1 and R2 taken together are a methylenedioxy group, R3 is a hydroxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group; or wherein
[0193] R1 is a methoxy group, R2 is a hydroxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group; or wherein
[0194] R1 is a hydroxy group, R2 is a methoxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group.
[0195] Clause 14.- A pharmaceutical composition for use according to any one of clauses 1 to 10, characterized in that said pharmaceutical composition comprises a compound of general formula I as defined in any one of claims 1 or 13, and in that said pharmaceutical composition is administered to said human subject such that a therapeutically effective dose of said compound of general formula (I) is administered to said human subject. Clause 15.- The pharmaceutical composition for use according to clause 14, wherein said pharmaceutical composition is a liquid pharmaceutical composition comprising a pharmaceutically acceptable vehicle such that said liquid pharmaceutical composition is isotonic and such that said liquid pharmaceutical composition has a physiologic pH value, and preferably wherein said pharmaceutically acceptable vehicle is a phosphate buffer.
[0196] Clause 16.- The pharmaceutical composition for use according to clauses 14 or 15, wherein said pharmaceutical composition is in the form of a lyophilized powder for reconstitution and for injection in humans, preferably via intravenous route.
Claims
- 54 -CLAIMS1.- A compound of general formula (I)or a pharmaceutically acceptable salt thereof, preferably a salt of general formula (I’)wherein- 55 -R1 and R2 taken together are a methylenedioxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group; or whereinR1 and R2 taken together are a methylenedioxy group, R3 is a methoxy group, R4 is a hydroxy group, R5 is a phenyl group, and R6 is a phenyl group; or whereinR1 and R2 taken together are a methylenedioxy group, R3 is a hydroxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group; or whereinR1 is a methoxy group, R2 is a hydroxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group; or whereinR1 is a hydroxy group, R2 is a methoxy group, R3 is a methoxy group, R4 is a methoxy group, R5 is a phenyl group, and R6 is a phenyl group, and whereinX represents an inorganic acid ion, an organic acid ion or a halide, preferably wherein X represents a Cl atom, and wherein n is 2; for use in the treatment of cancer in a human subject, wherein said cancer comprises or consists of an advanced tumour, wherein said advanced tumour is a tumour that is at a stage where it has grown to a size which makes it not susceptible to be treated by surgery, and / or it has spread to nearby tissues, and / or it has metastasized to distant parts of the body, and wherein said compound of general formula (I) is administered in a therapeutically effective dose to said human subject.2.- The compound or the pharmaceutically acceptable salt thereof for use according to claim 1 , wherein said compound of general formula (I) or said pharmaceutically acceptable salt thereof effectively treats said cancer by directly binding to complex- 56 - secondary structures present in the 5' untranslated region (5' UTR) of the Thymidylate Synthase mRNA, for example hairpin loops or G-quadruplexes, effectively silencing the expression of Thymidylate Synthase in said tumour.3.- The compound or the pharmaceutically acceptable salt thereof for use according to any one of claims 1 or 2, wherein said compound or said pharmaceutically acceptable salt thereof is administered intravenously.4.- The compound or the pharmaceutically acceptable salt thereof for use according to any one of the preceding claims, wherein said therapeutically effective dose is a dose sufficiently to cause an effective treatment of a of said cancer, more preferably, more preferably wherein said therapeutically effective dose is comprised between a Minimal Starting Dose (MSD) and Maximum Tolerated Dose (MTD).5.- The compound or the pharmaceutically acceptable salt thereof for use according to any one of the preceding claims, wherein said cancer comprises or consists of a solid tumour.6.- The compound or the pharmaceutically acceptable salt thereof for use according to any one of the preceding claims, wherein said cancer comprises or consists of a tumour selected from the group consisting of a refractory tumour, a resistant tumour, a relapsed / recurrent tumour, and a combination thereof.7.- The compound or the pharmaceutically acceptable salt thereof for use according to any one of the preceding claims, wherein said cancer comprises or consists of an advanced refractory solid tumour or an advanced resistant solid tumour.8.- The compound or the pharmaceutically acceptable salt thereof for use according to any one of claims 4 to 7, wherein said cancer is mesothelioma, preferably pleural mesothelioma or peritoneal mesothelioma, and more preferably pleural mesothelioma.- 57 -9.- The compound or the pharmaceutically acceptable salt thereof for use according to any one of claims 4 to 7, wherein said cancer is a lung cancer, preferably wherein said lung cancer is a small cell lung cancer or a non-small-cell lung cancer, more preferably wherein said lung cancer is a non-small cell lung cancer subtype, and even more preferably wherein said lung cancer is a non-small cell lung cancer subtype selected from the group consisting of adenocarcinoma and a squamous cell carcinoma.10.- The compound or the pharmaceutically acceptable salt thereof for use according to any one of claims 4 to 7, wherein said cancer is colorectal cancer.11.- The compound or the pharmaceutically acceptable salt thereof for use according to any one of claims 4 to 7, wherein said cancer is ovarian cancer.12.- The compound or the pharmaceutically acceptable salt thereof for use according to any one of the preceding claims, wherein said treatment is administered in combination with an additional cancer therapy, preferably wherein said additional cancer therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, and a combination thereof, and more preferably wherein said additional cancer therapy is the cancer therapy considered the standard of care treatment for said cancer, and even more preferably said additional cancer therapy is cisplatin.13.- A pharmaceutical composition for use according to any one of claims 1 to 12, characterized in that said pharmaceutical composition comprises a compound of general formula I or a pharmaceutically acceptable salt thereof as defined in claim 1 , and in that said pharmaceutical composition is administered to said human subject such that a therapeutically effective dose of said compound of general formula (I) is administered to said human subject.14.- The pharmaceutical composition for use according to claim 13, wherein said pharmaceutical composition is a liquid pharmaceutical composition comprising a pharmaceutically acceptable vehicle such that said liquid pharmaceutical composition isisotonic and such that said liquid pharmaceutical composition has a physiologic pH value, and preferably wherein said pharmaceutically acceptable vehicle is a phosphate buffer.
15. The pharmaceutical composition for use according to claims 13 or 14, wherein said pharmaceutical composition is in the form of a lyophilized powder for reconstitution and for injection in humans, preferably via intravenous route.
Citation Information
Patent Citations
Benzoquinolizinium salt derivatives as anticancer agents
US8188109B2