Ketone aroma-type lacticaseibacillus paracasei and use thereof in preparation of fermented dairy product

Abstract

Disclosed in the present invention are a ketone aroma-type Lacticaseibacillus paracasei and use thereof in the preparation of a fermented dairy product, belonging to the technical field of microorganisms. Provided in the present invention is a strain of ketone aroma-type Lacticaseibacillus paracasei TGK, with a deposit number of CCTCC NO: M20242380. The Lacticaseibacillus paracasei TGK is used as a starter culture to prepare fermented milk, and the obtained fermented milk has a relatively high sensory score. Compared with conventional fermented milk, the fermented milk contains a large amount of ketone compounds, with diacetyl and acetoin contents reaching 3.2 mg / kg and 2.7 mg / kg, respectively. Diacetyl and acetoin are two important ketone compounds in the fermented milk, giving the fermented milk a strong milk aroma. Therefore, the ketone aroma-type Lacticaseibacillus paracasei TGK of the present invention has great application value in improving the aroma quality of the fermented milk.

Description

A ketone-flavored Lactobacillus paracasei strain and its application in the preparation of fermented dairy products Technical Field

[0001] This invention relates to a ketone-flavored Lactobacillus paracasei strain and its application in the preparation of fermented dairy products, belonging to the field of microbial technology. Background Technology

[0002] Fermented milk is a dairy product made from raw milk or milk powder that has undergone reconstitution and sterilization processes, then inoculated with a starter culture containing lactic acid bacteria, and fermented at a certain temperature for a period of time. The lactic acid produced by the lactic acid bacteria causes the milk to curdle, forming fermented milk. Its unique flavor and nutritional value are highly favored by consumers.

[0003] The key to the quality of fermented milk lies in the starter culture, lactic acid bacteria. These bacteria metabolize carbohydrates to form flavor compounds such as ketones, aldehydes, and lactones, which impart aromas like milk and fruit to fermented milk. Among these, ketones are crucial in influencing the flavor of fermented milk; compounds like diacetyl, acetoin, 2-undecone, and 2-nonanone significantly contribute to the milky aroma. Therefore, ketone-flavored lactic acid bacteria can metabolize these compounds during milk fermentation, forming a rich variety of ketones that give fermented milk its distinctive flavor.

[0004] Chinese patent CN116555114B discloses a starter culture and its application, a type of milk tofu and its preparation method. It includes *Lactococcus lactis* and *Lactaseibacillus paracasei*; the viable count of the *Lactococcus lactis* is ≥2.5 × 10⁻⁶. 6 CFU / mL; the viable count of the *Lactobacillus paracasei* is ≥2.5 × 10⁻⁶. 5CFU / mL. The milk tofu prepared using this starter contains high levels of ketones such as 2-heptanone, 2-nonanone, and acetoin, exhibiting a unique fruity and creamy aroma. During storage, the milk tofu prepared with this starter does not harden; its toughness increases, its brittleness index decreases, and its textural properties are improved. However, this method discloses the combined use of *Lactococcus lactis* and *Lactaseibacillus paracasei*, without clarifying the role of *Lactaseibacillus paracasei* alone during fermentation. Furthermore, this method is for preparing milk tofu, and the addition of *Lactococcus lactis* is associated with improved texture. Adding *Lactaseibacillus paracasei* further improves the aroma properties, but the acetoin content in the prepared milk tofu is less than 5 μg / L, resulting in limited improvement to the product's aroma.

[0005] Chinese patent CN115261264A discloses a strain of *Lactobacillus paracasei* isolated from kimchi, named *Lactobacillus paracasei* PC804, which has been deposited at the China General Microbiological Culture Collection Center (CGMCC) under accession number CGMCC No. 23917. This *Lactobacillus paracasei* PC804 exhibits a high survival rate in gastrointestinal fluids, good bile salt tolerance, and strong survival ability in the human body. *Lactobacillus paracasei* PC804 possesses probiotic characteristics such as enhancing immune resistance, increasing intestinal flora diversity, and improving intestinal flora stability. Furthermore, PC804 can be well-suited for use as a probiotic in fermented dairy products. However, this patent only indicates that PC804 can be well-suited for use as a probiotic in fermented dairy products, but it does not specify which substances *Lactobacillus paracasei* primarily obtains during fermentation.

[0006] Screening starter cultures with excellent ketone-producing properties and utilizing these starter cultures to enhance the aroma through endogenous fermentation processes to produce ketone-flavored fermented milk has significant potential for the development of starter culture products and the dairy industry. Summary of the Invention

[0007] In the prior art, there is a lack of high-quality lactic acid bacteria with excellent ketone aroma-producing properties, and the contribution of lactic acid bacteria to the flavor of fermented milk is unknown. To address this technical problem, the present invention provides a ketone-aromatic strain of *Lactobacillus paracasei* and its application in the preparation of fermented dairy products.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] This invention first provides a strain of Lacticaseibacillus paracasei TGK, which was deposited at the China Center for Type Culture Collection (CCTCC) on October 30, 2024, at Wuhan University, Wuhan, China, 430072, China, with accession number CCTCC NO: M 20242380.

[0010] The ketone-flavored Lactobacillus paracasei TGK provided by this invention has the biological name Lactobacillus paracasei and the classification name Lactobacillus paracasei, and is abbreviated as Lactobacillus paracasei TGK.

[0011] The ketone-flavored Lactobacillus paracasei TGK provided by this invention is mainly used to increase the content of diacetyl and acetoin in fermented milk during the fermentation process, thereby enhancing the ketone aroma.

[0012] The present invention further provides the 16S rRNA of *Lactobacillus paracasei* TGK, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0013] The present invention further provides a starter containing the aforementioned ketone-flavored Lactobacillus paracasei TGK.

[0014] In one embodiment of the present invention, the fermentation agent containing the ketone-flavored Lactobacillus paracasei TGK includes physiological saline and the ketone-flavored Lactobacillus paracasei TGK suspended in physiological saline.

[0015] The present invention further provides a product containing the ketone-flavored Lactobacillus paracasei TGK or the fermentation agent.

[0016] In one embodiment of the present invention, the product includes food, medicine or health products.

[0017] In one embodiment of the present invention, the food includes dairy products, soy products, fruit and vegetable products, or meat products.

[0018] The present invention further provides a method for preparing a starter containing the ketone-flavored Lactobacillus paracasei TGK, comprising the following steps:

[0019] Step 1): Streak the TGK strain of Lactobacillus paracasei with ketone aroma onto a culture medium plate and incubate it in a 37°C incubator for 24-48 hours until a single colony grows.

[0020] Step 2): Pick the single colony and culture it in MRS broth until the concentration reaches 1×10⁻⁶. 8 CFU / mL or higher, cultured at 37℃ for 14-16 h; the resulting culture medium was washed twice with physiological saline.

[0021] Step 3): Collect the bacterial precipitate, mix it with the protectant solution and freeze-dry it to obtain the starter containing the ketone-flavored Lactobacillus paracasei TGK.

[0022] In one embodiment of the present invention, the culture medium in step 1) is MRS agar medium.

[0023] In one embodiment of the present invention, the mass concentration of the physiological saline in step 2) is 0.85%, and the washing method is: controlling the rotation speed at 6000-8000 r / min and centrifuging for 5-10 min.

[0024] In one embodiment of the present invention, the freeze-drying protectant in step 3) is prepared by dissolving 100g of skim milk powder and 5g of sucrose in 100mL of distilled water and sterilizing at 110℃ for 10min.

[0025] This invention further provides the application of the ketone-flavored *Lactobacillus paracasei* TGK or a starter containing the ketone-flavored *Lactobacillus paracasei* TGK in the preparation of fermented dairy products. The prepared fermented dairy products are ketone-flavored.

[0026] In one embodiment of the present invention, the fermented dairy product is fermented milk.

[0027] In one embodiment of the present invention, whole milk powder or whole milk is used as raw material when preparing fermented dairy products.

[0028] This invention also provides a method for preparing ketone-flavored fermented milk, the method comprising:

[0029] Whole milk powder is dissolved in water at 50-55℃ and stirred to obtain reconstituted milk with a mass fraction of 10-12%. Sucrose at a mass ratio of 5-7% is added and sterilized at 85-95℃ for 5-15 minutes.

[0030] After cooling to 30-40℃, add the ketone-flavored Lactobacillus paracasei TGK or a starter containing the ketone-flavored Lactobacillus paracasei TGK, mix well, and ferment at 37℃ until the pH reaches 4.6.

[0031] After stirring and breaking the emulsion, the mixture is stored at 4°C for 12 hours to obtain ketone-flavored fermented milk.

[0032] In one embodiment of the present invention, after adding *Lactobacillus paracasei* TGK or a starter containing *Lactobacillus paracasei* TGK, the concentration of *Lactobacillus paracasei* TGK is 1 × 10⁻⁶. 8 CFU / mL or higher.

[0033] In one embodiment of the present invention, the preferred sterilization conditions are: sterilization at 85°C for 15 minutes or sterilization at 95°C for 5 minutes.

[0034] The present invention also provides fermented dairy products obtained by fermentation using *Lactobacillus paracasei* TGK or a starter containing *Lactobacillus paracasei* TGK. The *Lactobacillus paracasei* TGK or the starter containing *Lactobacillus paracasei* TGK increases the content of diacetyl and acetoin in the fermented milk, resulting in a fermented milk with a prominent milky aroma.

[0035] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0036] (1) The ketone-flavored Lactobacillus paracasei TGK of the present invention was fermented in whole milk to pH=4.6. The diacetyl yield was measured to be 3.2 mg / kg and the acetoin yield was 2.7 mg / kg by GC-MS external standard method, which is the highest yield among 29 strains of Lactobacillus paracasei. Diacetyl and acetoin are two important ketone compounds in fermented milk, which give fermented milk a rich milky aroma.

[0037] (2) The Lactobacillus paracasei TGK of the present invention also significantly increases the types (including ketones, alcohols, acids, heterocyclic compounds, aldehydes and lactones) and contents of flavor compounds in fermented milk. Through flavor detection and sensory evaluation of fermented milk containing it, it was found that the ketone-flavored Lactobacillus paracasei TGK of the present invention has a good ability to produce ketones in fermented milk, and a high sensory score. It increases the types of flavor compounds in fermented milk and improves the aroma quality of fermented milk. It has broad prospects in the field of fermented dairy products.

[0038] Preservation of biological materials

[0039] A strain of *Lacticaseibacillus paracasei* TGK, taxonomically named *Lacticaseibacillus paracasei*, was deposited on October 30, 2024, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20242380. Attached Figure Description

[0040] Figure 1 shows the diacetyl content in fermented milk of different strains isolated from fermentation samples;

[0041] Figure 2 shows the acetoin content of different fermentation samples in fermented milk of the isolated strains;

[0042] Figure 3 shows the growth curve of Lactobacillus paracasei TGK;

[0043] Figure 4 shows the optimal growth temperature of Lactobacillus paracasei TGK.

[0044] Figure 5. Sensory evaluation radar chart of fermented milk containing Lactobacillus paracasei TGK;

[0045] Figure 6. Radar diagram of the electronic nose response of fermented milk containing Lactobacillus paracasei TGK. Detailed Implementation

[0046] To make the present invention more apparent and understandable, preferred embodiments are described in detail below.

[0047] The *Lacticaseibacillus paracasei* TGK used in the various embodiments of this invention has the biological name *Lacticaseibacillus paracasei* and is classified as *Lacticaseibacillus paracasei*. It was deposited on October 30, 2024, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China, 430072, with accession number CCTCC NO: M 20242380.

[0048] Example 1: Isolation of ketone-flavored Lactobacillus paracasei

[0049] The steps for collecting and isolating a strain of *Lactobacillus paracasei* with a ketone aroma are as follows:

[0050] (1) Sample collection and sample pretreatment

[0051] Samples were taken from fermented dairy products, including cheese, fermented milk, milk curds, and milk chews. The collected samples were placed in an ice box for refrigeration. Then, 5 mL of liquid sample or 5 g of solid sample was placed in a 200 mL Erlenmeyer flask containing 45 mL of sterile water. After shaking, the samples were allowed to stand for 20 minutes for later use.

[0052] (2) Isolation of lactic acid bacteria strains

[0053] The pretreated sample was serially diluted with sterile water at a volume ratio of 1:10. 0.1 mL of the diluted sample was taken from each dilution and spread on MRS agar plates. The plates were incubated at 37°C for 24-48 h under anaerobic conditions. Single colonies with a diameter of 3 mm ± 1 mm were picked up with a sterile toothpick. The colonies were round, medium-sized, raised, slightly white, moist, with neat edges.

[0054] Then, the bacteria were streaked on MRS agar plates to obtain pure single colonies, i.e., purified strains, and then Gram staining was performed.

[0055] The purified strains were preserved in the appropriate isolation medium with 30% glycerol added as a protectant and frozen at -20°C.

[0056] The MRS agar medium used on the above-mentioned MRS agar plates is a selective medium for lactic acid bacteria, which was purchased from Beijing Luqiao Company.

[0057] Twenty-nine strains isolated from fermented dairy products exhibited filamentous, viscous, and mucous-like appearances on MRS agar medium.

[0058] (3) Determination of ketone-producing ability of different strains

[0059] Lactic acid bacteria screened on MRS agar medium were cultured in MRS liquid medium at 37°C for 12 hours, followed by a second activation at an inoculum size of 2% (v / v). After 12 hours of activation, the bacterial suspension was centrifuged at 6000 rpm for 10 minutes at 4°C, and the bacterial cells were collected. The cells were washed three times with physiological saline, then mixed with physiological saline and set aside as a bacterial suspension.

[0060] Whole milk powder was dissolved in water at 50°C and stirred to obtain a reconstituted milk with a mass fraction of 12%. The reconstituted milk was then sterilized at 85°C for 15 minutes or at 95°C for 5 minutes. The inoculum size of the bacterial suspension was adjusted to 1×10⁻⁶. 8 CFU / mL, add the above bacterial suspension at a dosage of 4% (v / v). Simultaneously, add commercial starter YF-L904 to the sterilized reconstituted milk at a dosage of 4% (v / v) (adjust the inoculum size to 1×10⁻⁶). 8 (CFU / mL). After mixing, ferment at 37°C until pH=4.6, then cool to room temperature and store at 4°C.

[0061] Weigh 5.00 g of the fermented milk after refrigeration for 12 h and place it in a 20 mL headspace solid phase microextraction vial. Place the headspace vial in a 55 °C constant temperature water bath, insert the aged extraction head (50 / 30 μm DVB / CAR / PDMS), and perform headspace adsorption for 40 min. After extraction, place the extraction head in a GC-MS analyzer for 5 min to complete the sample injection.

[0062] The GC-MS program conditions were as follows: HP-INNOWAX column (60m × 0.25mm × 0.25mm); injection port temperature: 230℃; temperature program: 40℃ for 3 min, then increased to 120℃ at 4℃ / min, and finally increased to 230℃ at 5℃ / min, held for 10 min; carrier gas: He; flow rate: 1 mL / min; injection mode: splitless injection. Mass spectrometry conditions were as follows: ion source temperature: 230℃; ion source: EI; electron energy: 70 eV; scan range: 30-300 amu; full ion scan mode. The external standard method was used to quantitatively analyze ketone aroma compounds, diacetyl, and acetoin. The regression positions of the standard curves for the two compounds were y = 0.0009x + 0.1449, R0. 2 =0.9948; y=0.0009x+0.1231, R 2 =0.9984. The experimental results are listed in Table 1, Figure 1 and Figure 2. It can be seen from the figures that the milk fermented by strain K7 isolated from the milk curds has relatively high levels of diacetyl and acetoin, which are higher than those fermented by commercial starter cultures. This strain was selected and named ketone-flavored TGK.

[0063] The ketone-scented TGK strains obtained from the initial screening were further identified using molecular biology and bioinformatics methods, including PCR amplification of genomic DNA and 16S rRNA sequence detection.

[0064] Table 1 Preliminary isolation of ketone-producing lactic acid bacteria

[0065] Example 2: Identification of ketone-scented TGK strains

[0066] The ketone-scented TGK strain obtained in Example 1 was subjected to microbiological identification.

[0067] (1) Colony characteristics

[0068] The strain was streaked on an MRS plate for isolation and anaerobic culture at 37°C for 48 hours. The strain grew well, and its colonies were round, raised, with neat edges, milky white in color, opaque, moist and smooth, and could be drawn into threads when picked up.

[0069] (2) Bacterial morphology characteristics

[0070] Gram staining of the TGK strain was performed, and the results showed that the bacteria were non-motile rod-shaped, mostly arranged in chains of varying lengths, and also scattered individually. They did not produce spores and were Gram-positive.

[0071] (3) Genetic identification of ketone-scented TGK strains

[0072] The TGK strains obtained from the initial screening were further identified using molecular biology techniques, including PCR amplification of genomic DNA and whole-genome sequencing. After PCR amplification of the TGK strain DNA, the amplification products were subjected to agarose gel electrophoresis, and the amplified bands were observed under a gel imaging system. The TGK strain bands were clear, approximately 1500 bp in length.

[0073] A single colony of the purified TGK strain was inoculated into 10 mL of MRS liquid medium and incubated at 37°C for 12 h. The bacterial culture was then centrifuged (4000 r / min, 15 min) to collect the cells. Genomic DNA was extracted from the obtained bacterial cells using a genomic DNA extraction kit (Sangon Biotech (Shanghai) Co., Ltd.). PCR amplification was performed using two synthetic universal primers (16S 27F: GAGAGTTGATCCTGGCTCAG; 16S 1492R: CGGCTACCTTGTTACGACTT). The PCR products were recovered using a column-based PCR product purification kit (Sangon Biotech (Shanghai) Co., Ltd.) and then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0074] The 16S rRNA nucleotide sequence of the obtained strain is shown in SEQ ID NO.1, specifically:

[0075] Using the National Center for Biotechnology Information (NCBI) database, the obtained nucleotide sequences were compared with GenBank sequences using BLAST. Through BLAST comparison analysis, the TGK strain, which was initially identified as having good ketone aroma production ability, showed the highest homology (99%) with Lacticaseibacillus paracasei strain R094. Therefore, the TGK strain can be identified as a ketone aroma type Lactobacillus paracasei, named Lactobacillus paracasei TGK, and has been deposited at the China Center for Type Culture Collection, with accession number CCTCC NO: M 20242380.

[0076] Example 3: Analysis of the growth characteristics of *Lactobacillus paracasei* TGK with ketone aroma

[0077] (1) Growth curve of Lactobacillus paracasei TGK with ketone aroma

[0078] TGK of *Lactobacillus paracasei* was inoculated into MRS broth medium and cultured at 37°C. The OD of the culture medium was measured every 2 hours. 600nm , with OD 600nmThe growth curve of *Lactobacillus paracasei* TGK in MRS was obtained by plotting the values ​​against time. The results (Figure 3) show that *Lactobacillus paracasei* TGK grows rapidly in MRS medium, entering the logarithmic phase at about 4 hours and the stationary phase at about 10 hours.

[0079] (2) Optimal culture temperature of Lactobacillus paracasei TGK with ketone aroma

[0080] Lactobacillus paracasei TGK was inoculated at a rate of 2% (v / v) into 10 mL of MRS liquid medium and incubated at 25℃, 30℃, 37℃, 42℃, and 45℃ for 12 h, respectively. Uninoculated MRS liquid medium was used as a control. The OD values ​​of the cultures incubated at different temperatures were measured. 600nm According to OD 600nm The optimal growth temperature was determined. The results (Figure 4) showed that *Lactobacillus paracasei* TGK could grow in the range of 25-45℃, with the optimal growth temperature being 37℃.

[0081] Example 4: Preparation of Lactobacillus paracasei TGK starter culture

[0082] Following the method in step (3) of Example 1, activate *Lactobacillus paracasei* TGK, and adjust the concentration of *Lactobacillus paracasei* TGK after two generations of activation to 1×10⁻⁶. 8 CFU / mL, take 1 mL of fermentation broth, centrifuge to remove the supernatant liquid culture medium, add 1 mL of lyophilization protectant, and freeze-dry to obtain the lyophilized preparation of Lactobacillus paracasei TGK fermentation broth. The lyophilization protectant is prepared by dissolving 100 g of skim milk powder and 5 g of sucrose in 100 mL of distilled water and sterilizing at 110 °C for 10 min.

[0083] Example 5: Preparation of fermented milk using Lactobacillus paracasei TGK

[0084] The preparation of fermented milk containing *Lactobacillus paracasei* TGK with a ketone aroma includes the following steps:

[0085] The lyophilized preparation of *Lactobacillus paracasei* TGK obtained above was reconstituted in physiological saline for later use. Using whole milk powder as raw material, it was dissolved in water at 50°C and stirred to obtain a reconstituted milk with a mass fraction of 12%. Sucrose at a mass ratio of 7% was added, and the mixture was sterilized at 85°C for 15 min. After cooling to 35°C, the reconstituted lyophilized preparation containing the ketone-flavored *Lactobacillus paracasei* TGK strain (initial concentration >1×10⁻⁶) was used. 8 The CFU / mL extract was added at a volume ratio of 4%, mixed well, and fermented at 37°C until the pH reached 4.6. After stirring to break the emulsion, it was stored at 4°C for 12 hours to obtain fermented milk of *Lactobacillus paracasei* TGK with a ketone aroma.

[0086] Comparative Example 1: Preparation of fermented milk without ketone-flavored Lactobacillus paracasei TGK

[0087] Specifically, the steps include the following:

[0088] The steps are the same as in Example 4, except that the commercial fermentation agent YF-L904 is added at a rate of 4% (v / v) (the inoculum size is adjusted to 1×10⁻⁶). 8 Add CFU / mL to sterilized whole milk and ferment at 37°C until pH=4.6 to obtain fermented milk that does not contain ketone-flavored Lactobacillus paracasei TGK.

[0089] Example 1: Analysis of flavor compound content

[0090] A comparison of the ability of fermented milk containing *Lactobacillus paracasei* TGK and fermented milk without *Lactobacillus paracasei* TGK to produce flavor compounds.

[0091] Flavor compounds in fermented milk were enriched and extracted using headspace solid-phase microextraction (HS-SPME). 5.0 g of fermented milk containing *Lactobacillus paracasei* TGK and 5 g of fermented milk without *Lactobacillus paracasei* TGK were accurately weighed and placed in extraction flasks. The samples were equilibrated in a 55°C water bath for 5 min, and then extracted at 55°C for 40 min using a DVB / CAR / PDMS three-in-one extraction head. The chromatographic column used was an HP-INNOWAX (60 m × 0.25 mm × 0.25 μm); injection port temperature: 250°C; temperature program: 40°C for 3 min, ramped to 140°C at a rate of 5°C / min, held for 2 min, ramped to 240°C at a rate of 3°C / min, held for 15 min; carrier gas: helium (99.99% purity); flow rate: 2 mL / min; injection method: splitless injection. Mass spectrometry conditions: electron ionization energy: 70 eV; ion source temperature: 230℃; quadrupole temperature: 150℃; emission current: 35 μA; scan rate: 1.9 scans / s; mass scan range: 30-450 amu. All volatile compounds were qualitatively analyzed using the NIST17 mass spectrometry library, and compounds were identified based on matching degree, ion fragmentation, and other information. Retention indices (RIs) were calculated using C7-C30 n-alkanes and compared with reported values ​​in the literature. The combination of these methods enabled accurate qualitative analysis of paracheilolides.

[0092] The results are shown in Table 2. Seven ketone compounds were identified by GC-MS in fermented milk prepared with the commercial starter YF-L904 and with *Lactobacillus paracasei* TGK. This indicates that the addition of *Lactobacillus paracasei* TGK enriched the ketone flavor profile of the fermented milk. Compared to fermented milk with the commercial starter YF-L904, the levels of diacetyl and acetoin, two compounds that impart a ketone flavor to fermented milk, were increased by 2.48 and 1.13 times, respectively, in fermented milk containing *Lactobacillus paracasei* TGK.

[0093] Table 2. Differences in ketone compound content (μg / kg) between fermented milk prepared from ketone-flavored strain TGK and commercial starter cultures.

[0094] Example 2: Aroma Assessment

[0095] The aroma intensity of fermented milk containing and without *Lactobacillus paracasei* TGK was evaluated through sensory analysis experiments.

[0096] Sensory evaluations were conducted by 10 evaluators, all of whom received prior training to understand the sensory characteristics and be familiar with the evaluation criteria for fermented milk. Samples with random codes (samples from Example 5 and Comparative Example 1) were randomly selected from the refrigerator and presented to the evaluators for sensory evaluation testing. The sensory evaluators scored each fermented milk sample according to the attributes and definitions on the evaluation form. Specifically, in the sensory evaluation of fermented milk aroma, each aroma attribute was divided into intensity levels from 0 to 10 (intensity explanation: 0 = no intensity or imperceptible aroma, 5 = medium intensity, 10 = very strong). Each fermented milk sample was tested three times.

[0097] Table 3. Basic Sensory Terms for Descriptive Analysis of Fermented Milk

[0098] Based on the sensory analysis results (Figure 5), the fermented milk containing *Lactobacillus casei* TGK exhibited higher aromas in milk, butter, and cream compared to the fermented milk containing the commercial starter YF-L904. This is consistent with the high diacetyl and acetoin production capacity of *Lactobacillus casei* TGK in Example 1. Diacetyl and acetoin possess milky and creamy aromas, and both can significantly improve the overall flavor characteristics of fermented milk, providing consumers with a better sensory experience. This conclusion can also be drawn from the sensory evaluation radar chart.

[0099] Example 3: Analysis of differences in olfactory fingerprint information

[0100] An electronic nose was used to analyze the differences in olfactory fingerprint information between fermented milk containing *Lactobacillus paracasei* TGK and fermented milk without *Lactobacillus paracasei* TGK.

[0101] The fermented milk prepared in Example 4 and Comparative Example 1 was analyzed using a PEN3 electronic nose: 5g of fermented milk was measured in sample bottles, allowed to stand at 50°C for 5 minutes, and then the injection needle was inserted. Headspace analysis was performed using the electronic nose. The electronic nose measurement parameters were: cleaning time 120s, zeroing time 5s, pre-injection time 5s, measurement time 60s, and carrier gas flow rate 300mL / min. The differences in olfactory fingerprint information among different *Lactobacillus casei* strains were analyzed using odor radar mapping.

[0102] According to the radar chart of the sensor response values ​​of the electronic nose (Figure 6), the W1C, W2S, W5S, W2W, and W1W sensors showed higher response values ​​to fermented milk containing *Lactobacillus paracasei* TGK than to fermented milk without it. Specifically, W1C was sensitive to aromatic compounds, W2S to ketone compounds, and W5S, W2W, and W1W to nitrogen oxides, organosulfur compounds, and terpenes, respectively. The addition of *Lactobacillus paracasei* TGK increased the sensor response values ​​related to the ketone aroma of the fermented milk, indicating that *Lactobacillus paracasei* TGK imparts a richer aroma to the fermented milk.

[0103] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. A strain of Lacticaseibacillus paracasei TGK, with a ketone aroma, was deposited on October 30, 2024, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, 430072, China, with accession number CCTCC NO: M 20242380.

2. The 16S rRNA of *Lactobacillus paracasei* TGK according to claim 1, characterized in that, The sequence of the 16S rRNA is shown in SEQ ID NO.

1.

3. A starter culture containing the ketone-flavored Lactobacillus paracasei TGK as described in claim 1.

4. The fermenting agent according to claim 3, characterized in that, The fermentation agent includes a freeze-drying protectant; the freeze-drying protectant includes skim milk powder and sucrose.

5. A product containing the ketone-flavored Lactobacillus paracasei TGK of claim 1 or the starter culture of claim 3 or 4.

6. The product according to claim 5, characterized in that, The products include food, medicine, or health products.

7. The product according to claim 6, characterized in that, The food products include dairy products, soy products, fruit and vegetable products, or meat products.

8. A method for preparing the fermenting agent according to claim 3 or 4, characterized in that, After fermenting the *Lactobacillus paracasei* TGK according to claim 1, the bacterial cells are mixed with a protectant and freeze-dried to obtain a starter containing the ketone-flavored *Lactobacillus paracasei* TGK.

9. The use of the ketone-flavored Lactobacillus paracasei TGK of claim 1 or the starter culture of claim 3 or 4 in the preparation of fermented dairy products.

10. The application according to claim 9, characterized in that, The fermented dairy product is fermented milk; When preparing fermented dairy products, whole milk powder or whole milk is used as the raw material.

11. A method for preparing a ketone-flavored fermented milk, characterized in that, The method is as follows: Whole milk powder is dissolved in water at 50-55℃ and stirred to obtain reconstituted milk with a mass fraction of 10-12%. Sucrose at a mass ratio of 5-7% is added and sterilized at 85-95℃ for 5-15 minutes. After cooling to 30-40℃, add the ketone-flavored Lactobacillus paracasei TGK as described in claim 1 or the starter culture as described in claim 3 or 4 to obtain the fermentation substrate. After mixing, ferment at 37℃ until the pH reaches 4.

6. After stirring and breaking the emulsion, the mixture was stored at 4°C for 12 hours to obtain ketone-flavored fermented milk. The concentration of *Lactobacillus paracasei* TGK in the fermentation substrate was 1 × 10⁻⁶. 8 CFU / mL or higher.

Images