Method for producing genome-edited hemp plant having increased CBD content and decreased THC content by csthcas gene editing, and genome-edited hemp plant produced thereby
The CRISPR/Cas9 system targets the CsTHCAS gene in hemp to increase CBD and decrease THC, addressing the need for enhanced hemp plants with improved therapeutic properties.
Patent Information
- Application Number
- PCT/KR2025/095727
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-27
- Filing Date
- 2025-11-13
- Publication Date
- 2026-06-04
AI Technical Summary
Existing methods do not effectively produce hemp plants with increased CBD content and decreased THC content, which are crucial for medicinal applications, as they lack a genome-editing approach to specifically target and modify the CsTHCAS gene.
A method using the CRISPR/Cas9 system to introduce a guide RNA and endonuclease protein specifically targeting the hemp-derived CsTHCAS gene, followed by redifferentiating hemp plants to increase CBD content and decrease THC content.
The method significantly increases CBD content by 2 to 3 times and decreases THC content by 3 to 9 times compared to controls, providing a cost-effective and time-efficient means to enhance hemp's therapeutic potential.
Smart Images

Figure KR2025095727_04062026_PF_FP_ABST
Abstract
Description
Method for producing a genome-edited hemp plant with increased CBD content and decreased THC content by CSTHCAS gene editing, and a genome-edited hemp plant with increased CBD content and decreased THC content produced by the said method
[0001] The present invention relates to a method for producing a genome-edited hemp plant with increased CBD (cannabidiol) content and decreased THC (delta9-tetrahydrocannabinol) content by CsTHCAS (Cannabis sativa delta9-tetrahydrocannabinolic acid synthase) gene editing, and to a genome-edited hemp plant with increased CBD content and decreased THC content produced by the said method.
[0002]
[0003] This result was researched through the Regional Innovation-Centered University Support System (RISE) project (Project No.: 2025-RISE-13-JBU), which was conducted with funding from the Ministry of Education and Jeonbuk Special Self-Governing Province and supported by the Jeonbuk RISE Center in 2025.
[0004] Hemp (Cannabis sativa) is an annual herbaceous plant belonging to the Cannabis family. It has been cultivated as a fiber crop in Korea and China, while in the West, it has been utilized as a medicinal plant for its terpenoid-based component, cannabinoid. To resist natural disasters such as drought and pests, hemp secretes about 50 types of plant resins known as cannabinoids. Major cannabinoids with high secretion volumes include CBN (cannabinol), CBD (cannabidiol), and THC (delta-9-tetrahydrocannabinol). THC, which is contained in high concentrations in cannabis leaves and unfertilized female flowers, is a narcotic substance that causes hallucinogenic effects and is therefore subject to regulation; the THC content in general hemp is known to be approximately 3–20%. CBD is a naturally occurring cannabinoid compound produced by the decarboxylation of cannabidiolic acid (CBDA) precursors, and cases demonstrating its therapeutic effects on numerous diseases are currently being reported in various clinical trials.
[0005] Among the methods for genome editing, the CRISPR / Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-associated protein 9) system has recently been attracting attention. Using CRISPR / Cas9, a third-generation gene editing technology, it is possible to specifically edit only the desired genes within a cell in a short period of time. It has been proven to be more accurate and efficient than existing first-generation Zinc Finger Nucleases (ZFNs) and second-generation Transcriptor Activator-Like Effector Nucleases (TALENs), and it has the advantages of a simple design and low cost. Furthermore, it has recently been reported that this technology has been successfully used to induce transformation in various plant species, such as tomatoes, grapes, and rice. It has also been confirmed that these mutant individuals are stably transmitted to the next generation.
[0006] Meanwhile, Korean registered patent No. 2415907 discloses a 'method for cultivating hemp (cannabidiol) to increase CBD content' through LED treatment, and Korean registered patent No. 2346700 discloses a 'method for mass-producing high-content cannabidiol from hemp' through heat treatment, but there is no description of a method for producing a genome-edited hemp plant with increased CBD content and decreased THC content by CsTHCAS gene editing of the present invention, nor of a genome-edited hemp plant with increased CBD content and decreased THC content produced by said method.
[0007] The present invention was derived from the above requirements, and the inventors completed the present invention by confirming that the CBD content of a gene-edited hemp plant produced using a CRISPR / Cas9 system targeting the hemp-derived CsTHCAS (Cannabis sativadelta9-tetrahydrocannabinolic acid synthase) gene increased by about 2 to 3 times compared to the control group, and the THC content decreased by about 3 to 9 times compared to the control group.
[0008] To solve the above problem, the present invention provides a method for producing a genome-edited hemp plant with increased CBD (cannabidiol) content and decreased THC (delta9-tetrahydrocannabinol) content, comprising: (a) a step of correcting the genome by introducing a guide RNA and an endonuclease protein specific to the target nucleotide sequence of a hemp-derived CsTHCAS (Cannabis sativadelta9-tetrahydrocannabinolic acid synthase) gene into a hemp plant cell; and (b) a step of redifferentiating a hemp plant from the genome-edited hemp plant cell.
[0009] In addition, the present invention provides a genome-edited hemp plant with increased CBD content and reduced THC content produced by the above method, and seeds thereof.
[0010] In addition, the present invention provides a genome editing composition for increasing CBD content and decreasing THC content in a hemp plant, comprising as an active ingredient a recombinant vector comprising DNA encoding a guide RNA specific to a target base sequence of a hemp-derived CsTHCAS gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to a target base sequence of a hemp-derived CsTHCAS gene and an endonuclease protein.
[0011] The method for producing genome-edited plants according to the present invention is expected to save costs and time, unlike GMO crops which require enormous costs and time to evaluate safety and environmental hazards, as the plants do not have external genes inserted and possess only minor mutations indistinguishable from natural variations. Furthermore, since CRISPR gene editing technology introduces mutations in specific genes, it is expected to serve as a permanent method for enhancing quantitative traits.
[0012] In addition, the manufacturing method of the present invention can increase the content of CBD (cannabidiol), a useful component of hemp plants, and decrease the content of THC (delta9-tetrahydrocannabinol), an addictive narcotic component, so it can be usefully used in the development of new varieties of medical hemp.
[0013] Figure 1 shows the process of isolating protoplasts from hemp seedlings.
[0014] Figure 2 shows the process of Agrobacterium-mediated transformation using mature hemp embryos.
[0015] Figure 3 shows the sequences and locations of sgRNA1, sgRNA2, and sgRNA3 targeting the hemp-derived CsTHCAS gene.
[0016] Figure 4 shows the results of measuring the In / del mutation frequencies of sgRNA1, sgRNA2, and sgRNA3 in hemp protoplasts.
[0017] Figure 5 shows a photograph (a) of CsTHCAS gene-edited hemp transformants (#3, #4) prepared and soil-acclimated, and the PCR analysis results (b) for the gene encoding Cas9 in the CsTHCAS gene-edited hemp transformants (#3, #4). Control group, N: Wild-type hemp plant. P: Vector used for gene editing in DNA form.
[0018] Figure 6 shows the results of measuring the CBD (a) and THC (b) content of CsTHCAS gene-edited hemp transformants (#3, #4).
[0019] To achieve the objective of the present invention, the present invention comprises the steps of: (a) correcting the genome by introducing a guide RNA and an endonuclease protein specific to the target nucleotide sequence of a hemp-derived CsTHCAS (Cannabis sativadelta9-tetrahydrocannabinolic acid synthase) gene into hemp plant cells; and
[0020] (b) a step of redifferentiating a hemp plant from the genome-corrected hemp plant cell; thereby providing a method for producing a genome-corrected hemp plant with increased CBD (cannabidiol) content and decreased THC (delta9-tetrahydrocannabinol) content.
[0021] In a method for producing a genome-edited hemp plant with increased CBD content and decreased THC content according to one embodiment of the present invention, the hemp-derived CsTHCAS gene may preferably be composed of the nucleotide sequence of SEQ ID NO. 1, but is not limited thereto.
[0022] In addition, in a method for producing a genome-edited hemp plant with increased CBD content and decreased THC content according to one embodiment of the present invention, the target nucleotide sequence of the CsTHCAS gene may be composed of any one of SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4, but is not limited thereto. That is, there are a total of three locations within the CsTHCAS gene targeted by the guide RNA specific to the target nucleotide sequence according to the present invention, which are the nucleotide sequences of SEQ ID NO. 2, SEQ ID NO. 3, or SEQ ID NO. 4, but are not limited thereto.
[0023] In addition, in a method for producing a genome-edited hemp plant with increased CBD content and decreased THC content according to one embodiment of the present invention, the hemp plant is preferably a hemp plant of the Cheongsam variety, but is not limited thereto.
[0024] In this specification, the term "genome / gene editing" refers to a technique capable of introducing targeted mutations into the genomic sequences of animal and plant cells, including human cells, and capable of knocking out or knocking in specific genes by the deletion, insertion, or substitution of one or more nucleic acid molecules through DNA cutting, or introducing mutations into non-coding DNA sequences that do not produce proteins. For the purposes of the present invention, the genome editing may specifically involve introducing mutations into a plant using an endonuclease, such as the Cas9 protein, and a guide RNA.
[0025] The term "target gene" refers to a portion of DNA within the genome of a plant to be corrected through the present invention. That is, in principle, it is not limited to the type of gene and may include both coding and non-coding regions. A person skilled in the art may select the target gene according to the desired variation in the genome-edited plant to be manufactured, depending on the purpose.
[0026] The term "guide RNA" refers to RNA specific to DNA that encodes the base sequence of a target gene, and refers to a ribonucleic acid that binds wholly or partially complementarily to the target DNA base sequence to guide an endonuclease protein to the corresponding target DNA base sequence. The guide RNA refers to a dual RNA comprising two RNAs, namely crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA), as components; or a single-stranded guide RNA (sgRNA) form comprising a first region containing a sequence wholly or partially complementary to the base sequence within the target DNA and a second region containing a sequence that interacts with the RNA-guide nuclease; however, any form capable of having activity at the target base sequence may be included within the scope of the present invention without limitation. The guide RNA according to the present invention may preferably be in the form of a single-stranded guide RNA, but is not limited thereto, and may be appropriately selected according to known techniques in the art regarding the type of endonuclease used or the microorganism from which the endonuclease originates.
[0027] Additionally, the guide RNA may be transcribed from a plasmid template or transcribed in vitro (e.g., an oligonucleotide double strand), but is not limited thereto.
[0028] In addition, in a manufacturing method according to one embodiment of the present invention, introducing the guide RNA and endonuclease protein of step (a) into a hemp plant cell may use a recombinant vector comprising a DNA sequence encoding a guide RNA specific to a target sequence of a hemp-derived CsTHCAS gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to a target sequence of a hemp-derived CsTHCAS gene and an endonuclease protein; but is not limited thereto.
[0029] In a manufacturing method according to one embodiment of the present invention, the endonuclease protein may be one or more selected from the group consisting of Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease), or functional analogs thereof, and preferably may be a Cas9 protein, but is not limited thereto.
[0030] Cas9 protein or genetic information can be obtained from known databases such as GenBank of the NCBI (National Center for Biotechnology Information). For example, the Cas9 protein may be one or more selected from the group consisting of Cas9 protein derived from Streptococcus pyogenes, Cas9 protein derived from Campylobacter jejuni, Cas9 protein derived from Streptococcus thermophilus or Streptococcus aureus, Cas9 protein derived from Neisseria meningitidis, Cas9 protein derived from Pasteurella multocida, Cas9 protein derived from Francisella novicida, but is not limited thereto.
[0031] The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. For the Cas9 protein to accurately bind to the base sequence of the target DNA and cut the DNA strand, a short base sequence consisting of three bases known as PAM (Protospacer Adjacent Motif) must be present next to the base sequence of the target DNA, and the Cas9 protein cuts by estimating the interval between the 3rd and 4th base pairs from the PAM sequence (NGG).
[0032] In a manufacturing method according to one embodiment of the present invention, the guide RNA and the endonuclease protein form a ribonucleoprotein complex and function as an RNA-Guided Engineered Nuclease (RGEN).
[0033] The CRISPR / Cas9 system used in the present invention is a gene correction method based on the NHEJ (non-homologous end joining) mechanism, which induces insertion-deletion (InDel) mutations caused by incomplete repair induced during the DNA repair process by introducing a double helix cut at a specific location of a specific gene to be corrected.
[0034] In the manufacturing method according to the present invention, the method of transfecting the complex of the guide RNA and the endonuclease protein into a plant cell can be suitably selected from the calcium / polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection into plant elements, particle impaction of various plant elements (DNA or RNA-coated), and infection by a virus in Agrobacterium tumefaciens-mediated gene transfer (incompleteness).
[0035] In addition, introducing the recombinant vector into a plant cell constitutes a transformation method. Transformation of plant species is now common for plant species including both dicotyledonous and monocotyledonous plants. In principle, any transformation method can be used to introduce the recombinant vector according to the present invention into a suitable progenitor cell.
[0036] The “plant cell” used for the above-mentioned modification may be any plant cell. The plant cell is a cultured cell, cultured tissue, cultured organ, or whole plant. The “plant tissue” includes differentiated or undifferentiated plant tissues, such as, but not limited to, roots, stems, leaves, pollen, seeds, female tissue, and various forms of cells used for culture, namely single cells, protoplasts, shoots, and callus tissue. The plant tissue may be in planta or in organ culture, tissue culture, or cell culture.
[0037] In the manufacturing method of the present invention, any method known in the art may be used for redifferentiating a genome-corrected plant from a genome-corrected plant cell. The genome-corrected plant cell must be redifferentiated into a whole plant. Techniques for redifferentiating mature plants from callus or protoplast cultures are known in the art for numerous different species.
[0038] The present invention also provides a genome-edited hemp plant with increased CBD (cannabidiol) content and decreased THC (delta9-tetrahydrocannabinol) content produced by the above manufacturing method, and seeds of said plant.
[0039] The genome-edited hemp plant with increased CBD content and decreased THC content according to the present invention is a hemp plant in which the CsTHCAS gene is edited using a CRISPR / Cas9 system, so that the hemp-derived CsTHCAS gene is knocked out or knocked down, and the CBD content is increased and the THC content is decreased compared to a hemp plant without genome editing. The CBD content of the gene-edited hemp plant may be increased by about 2 to 3 times compared to the control group, and the THC content may be decreased by about 3 to 9 times compared to the control group, but is not limited thereto.
[0040] The present invention also provides a genome editing composition for increasing the CBD (cannabidiol) content and decreasing the THC (delta9-tetrahydrocannabinol) content of a hemp plant, comprising as an active ingredient a recombinant vector comprising DNA encoding a guide RNA specific to a target base sequence of a hemp-derived CsTHCAS (Cannabis sativadelta9-tetrahydrocannabinolic acid synthase) gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to a target base sequence of a hemp-derived CsTHCAS (Cannabis sativadelta9-tetrahydrocannabinolic acid synthase) gene and an endonuclease protein.
[0041] In the genome editing composition of the present invention, the target nucleotide sequence of the CsTHCAS gene may be composed of any one of the nucleotide sequences of SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4, but is not limited thereto.
[0042] The genome editing composition of the present invention comprises a recombinant vector comprising DNA encoding a guide RNA specific to a target base sequence of the CsTHCAS gene and a nucleic acid sequence encoding an endonuclease protein, or a complex of a guide RNA specific to a target base sequence of the CsTHCAS gene and an endonuclease protein, so that when the composition is applied to hemp plant cells, the complex of the guide RNA and the endonuclease protein acts as an RNA gene scissors to edit the target gene.
[0043] The genome editing composition of the present invention preferably comprises a guide RNA specific to a target nucleotide sequence of the CsTHCAS gene consisting of any one of the nucleotide sequences of SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4, so that the CsTHCAS gene can be knocked out, and through the knockout of the CsTHCAS gene, the CBD content of the hemp plant can be increased and the THC content can be decreased.
[0044]
[0045] The present invention will be explained in detail below through examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.
[0046]
[0047] Materials and Methods
[0048] 1. Separation of protoplasts
[0049] Six-day-old seedlings of the hemp (Cannabis sativa) variety Cheongsam (Fig. 1a) were cultured at 23°C under long-day conditions (16 hours light / 8 hours dark). Then, using a surgical blade, cotyledons and true leaves were cut at intervals of 0.5–1.0 mm along the vein direction relative to the petiole, and 20 leaves of each were collected and placed in an enzyme solution (0.4 M mannitol, 20 mM KCl, 20 mM MES-KOH, 1.5% cellulase, 0.4% macherozyme, 1% factorase, 8 mM CaCl2, 0.1% bovine serum albumin) (Fig. 1b), and cultured at 50–70 rpm at 23°C for 12 hours. Afterward, filtered using filter paper, an equal amount of W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 1.5 mM MES-KOH) was added to stop the activity of the enzyme solution, and after centrifuging at 100g for 5 minutes to remove all the supernatant, 5 ml of W5 solution was added on top of 5 ml of 21% (v / v) sucrose. Afterward, the protoplasts separated into the middle layer by a 21% (v / v) sucrose concentration gradient were transferred to a new round-bottom tube by centrifugation at 80 g for 7 minutes (Fig. 1c), 5 ml of W5 solution was added and mixed to remove all of the supernatant, 210 µl of MMG solution (0.4 M mannitol, 15 mM MgCl2, 4 mM MES-KOH) was added, and the number of protoplasts was measured using a hemocytometer and a microscope (Fig. 1d).
[0050]
[0051] 2. PEG-mediated protoplast RNP (Ribonucleoprotein) transfection
[0052] An RNP mixture was prepared by adding 100 µl of MMG solution to the RNP formed by thoroughly mixing 5 µl of each sgRNA (25 µg) and 5 µl of Cas9 protein (25 µg) and incubating for 15 minutes. The RNP mixture was prepared as 5×10 5After adding and mixing 100 µl of protoplast, an equal amount of PEG solution (40% PEG 4000, 200 mM mannitol, 50 mM CaCl2) was added and incubated for 10 minutes. Subsequently, 950 µl of W5 solution was added, and the supernatant was completely removed by centrifugation at 100g for 3 minutes. Then, 1 ml of W5 solution was added, and the mixture was incubated in the dark at 23°C for 24 hours. After incubation, the supernatant was completely removed by centrifugation at 70g for 5 minutes, and the remaining protoplast was used to proceed with subsequent experiments.
[0053]
[0054] 3. Agrobacterium-mediated transformation
[0055] Agrobacterium GV3101 transformed with pBAtC, a vector for gene editing system expression, was used. Agrobacterium was inoculated into 5 ml of YEB medium (100 µg / L spectinomycin, 25 µg / L rifampicin) and cultured at 30°C and 250 rpm for 16–18 hours, after which 1 ml was inoculated into 50 ml of YEP medium (100 µg / L spectinomycin, 25 µg / L rifampicin, 100 µg / L acetosyringon) and cultured at 30°C and 250 rpm for 16–18 hours. Subsequently, the supernatant was completely removed by centrifugation at 5000 g for 15 minutes, and the solution was prepared by diluting it with MS medium (100 µg / L acetosyringon) to an OD value of 0.1.
[0056] Mature embryos were used as plant material for Agrobacterium-mediated transformation. After treating hemp green hemp seeds in 1% (v / v) H2O2 under dark conditions for 2 days, the outer shell of the seeds and the membrane surrounding the embryo were removed, followed by treatment with 5% (v / v) sodium hypochlorite for 15 minutes, washing 5 times with sterile water, and then treating with the prepared Agrobacterium and incubating for 15 minutes. Afterwards, the specimens were transferred to two sheets of filter paper to remove the Agrobacterium solution, transferred to mature embryo culture medium (1 / 2 MS medium, 1.5% sucrose, 0.8% phytoaga, 300 mg / L timentin), and cultured for 3 days at 23°C under dark conditions (Fig. 2a). Then, they were transferred to a selection medium supplemented with 20 mg / L PPT (phosphinotricin) and cultured for 2 to 3 weeks at 23°C under long-day conditions (Fig. 2b). The selected specimens were then transferred to potting soil and acclimatized at 23°C under long-day conditions (Figs. 2c, 2d).
[0057]
[0058] Example 1. Selection of sgRNA (single guide RNA) targeting the CsTHCAS gene
[0059] Based on the nucleotide sequence of the CsTHCAS (Cannabis sativadelta9-tetrahydrocannabinolic acid synthase) gene isolated from the leaves of a hemp (Cannabis sativa) Cheongsam variety, sgRNA1, sgRNA2, and sgRNA3 targeting the CsTHCAS gene were designed using an sgRNA design program (http: / www.rgenome.net / cas-designer / ) (Fig. 3, Table 1).
[0060] CsTHCAS gRNA Information Classification gRNA Target Sequence (5'-3') Sequence Number sgRNA1GTGGGTATTGCCCTACTGT2sgRNA2GGGCTATACGTGGTGGTGG3sgRNA3AGAATAAGACTACAGTACA4
[0061] Subsequently, hemp protoplasts were transfected with RNP mixtures into which sgRNA1, sgRNA2, and sgRNA3 were introduced, and genomic DNA was extracted from each protoplast and analyzed using NGS (Next generation sequencing). Then, the frequency of In / del mutations of sgRNA1, sgRNA2, and sgRNA3 was measured using a Deep-seq analysis service (Toolgen).
[0062] As a result, it was confirmed that the gene editing efficiency of sgRNA2 was the highest by confirming that the In / del mutation frequency of sgRNA1 was 0.2%, the In / del mutation frequency of sgRNA2 was 0.8%, and the In / del mutation frequency of sgRNA3 was 0.7% (Fig. 4).
[0063] In addition, it was confirmed that the In / del tendencies of sgRNA1, sgRNA2, and sgRNA3 were different from each other (Table 2).
[0064] In / del tendencyTypeReadsgRNA1No mutation70,0431 bp insertion (Out of frame)121sgRNA2No mutation63,9901 bp insertion (Out of frame)4043 bp deletion (In frame)66sgRNA3No mutation44,7801 bp insertion (Out of frame)2375 bp deletion (Out of frame)87
[0065] Example 2. Confirmation of T-DNA in hemp transformants with CsTHCAS gene correction
[0066] Among sgRNA1, sgRNA2, and sgRNA3, sgRNA2, which had the highest gene editing efficiency, was cloned into the pBAtC vector. After performing Agrobacterium-mediated transformation using mature hemp embryos, genomic DNA was extracted from the third true leaf of a soil-acclimated hemp transformant (Fig. 5a) that survived in the screening medium. Subsequently, PCR analysis was performed using the primers in Table 3 below to identify the T-DNA of the CsTHCAS gene-edited hemp transformant through PCR analysis of the gene encoding Cas9 in the pBAtC vector.
[0067] As a result, it was confirmed that a T-DNA band for the gene encoding Cas9 was observed in the CsTHCAS gene-edited hemp transformant (Fig. 5b).
[0068] Primer Information Used for PCR Analysis Classification: Target Primer Sequence (5'-3') Sequence Number T-DNA Identification: Cas9F:CTTGTACTTCTCGGGCAGC5R:GAAGTACCCCACCATCTACC6
[0069] Example 3. Analysis of CBD and THC content in CsTHCAS gene-edited hemp transformants
[0070] The content of CBD (cannabidiol) and THC (delta9-tetrahydrocannabinol) was analyzed in CsTHCAS gene-edited hemp transformants. Specifically, true leaves weighing at least 25 g were taken from CsTHCAS gene-edited hemp transformants cultured under long-day conditions at 23°C, and decarboxylation of CBDA (cannabidiolic acid) and THCA (tetrahydrocannabinolic acid) components was induced through heat treatment at 110°C under dark conditions for 90 minutes. Subsequently, the heat-treated samples were crushed into powder form and sent to the Gyeongbuk Bioindustry Research Institute for quantitative analysis of CBD and THC using liquid chromatography tandem mass spectrometry (LC-MS / MS). Wild-type hemp plants were used as a control.
[0071] As a result, it was confirmed that the CBD content of the CsTHCAS gene-edited hemp transformant increased by approximately 2 to 3 times compared to the control group (Fig. 6a), and the THC content of the CsTHCAS gene-edited hemp transformant decreased by approximately 3 to 9 times compared to the control group (Fig. 6b).
Claims
1. (a) a step of correcting the genome by introducing a guide RNA and an endonuclease protein specific to the target sequence of the hemp-derived CsTHCAS (Cannabis sativadelta9-tetrahydrocannabinolic acid synthase) gene into hemp plant cells; and (b) a step of redifferentiating a hemp plant from the genome-corrected hemp plant cell; comprising a method for producing a genome-corrected hemp plant with increased CBD (cannabidiol) content and decreased THC (delta9-tetrahydrocannabinol) content.
2. A method for producing a genome-edited hemp plant according to claim 1, characterized in that the target nucleotide sequence of the CsTHCAS gene consists of any one of the nucleotide sequences of SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO.
4.
3. A method for producing a genome-edited hemp plant according to claim 1, wherein introducing the guide RNA and endonuclease protein of step (a) into a hemp plant cell is characterized by using a recombinant vector comprising a DNA sequence encoding a guide RNA specific to a target base sequence of a hemp-derived CsTHCAS gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to a target base sequence of a hemp-derived CsTHCAS gene and an endonuclease protein.
4. A genome-edited hemp plant having increased CBD (cannabidiol) content and decreased THC (delta9-tetrahydrocannabinol) content, produced by the method of any one of paragraphs 1 to 3.
5. Seeds in which the genome of a hemp plant has been corrected pursuant to Paragraph 4.
6. A genome editing composition for increasing the CBD (cannabidiol) content and decreasing the THC (delta9-tetrahydrocannabinol) content of a hemp plant, comprising as an active ingredient a recombinant vector comprising DNA encoding a guide RNA specific to a target base sequence of a hemp-derived CsTHCAS (Cannabis sativadelta9-tetrahydrocannabinolic acid synthase) gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to a target base sequence of a hemp-derived CsTHCAS (Cannabis sativadelta9-tetrahydrocannabinolic acid synthase) gene and an endonuclease protein.
7. A genome editing composition for increasing the CBD (cannabidiol) content and decreasing the THC (delta9-tetrahydrocannabinol) content of a hemp plant, characterized in that, in claim 6, the target nucleotide sequence of the CsTHCAS gene consists of any one of the nucleotide sequences of SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4.