Cell line for producing erythrocytes into which β-globin gene for production of hba-containing erythrocytes is introduced

Abstract

The present invention relates to: a cell line for producing erythrocytes, into which an immortalized gene and β-globin gene for the production of adult type hemoglobin (HbA)-containing erythrocytes are introduced; and a method for producing erythrocytes in vitro, using the cell line. Specifically, the cell line for producing erythrocytes, of the present invention, can stably and efficiently produce erythrocytes containing a large amount of HbA in vitro, thereby enabling stable supply of erythrocytes for transfusion and effectively solving blood shortage problems and transfusion side effects.

Description

Cell line for producing erythrocytes with introduced β-globin gene for the production of HBA-containing erythrocytes

[0001] The present invention relates to a cell line for producing red blood cells having an immortalization gene and a β-globin gene introduced to produce red blood cells containing HbA (Adult type hemoglobin), and a method for producing red blood cells in vitro using said cell line.

[0002] Due to the global shortage of blood for transfusions and the various side effects associated with receiving donor blood, research into producing red blood cells outside the body is garnering attention as the only viable alternative. In particular, the blood supply issue is becoming more severe as the blood donor population declines due to low birth rates and an aging society; furthermore, there are practical limitations to hospitals in storing and maintaining large quantities of blood over the long term. To overcome this, the development of artificial blood production technology capable of mass-producing red blood cells when needed is considered critically important.

[0003] Erythrocytes are primarily generated by differentiation from hematopoietic stem cells in the bone marrow. During this process, they differentiate stepwise into proerythroblasts, basophilic erythroblasts, polychromatic erythroblasts, and orthochromatic erythroblasts, undergoing nucleus condensation and enucleation to form reticulocytes, eventually becoming mature erythrocytes. In this process, after the proerythroblast stage, self-renewal becomes impossible, and the cells mature solely into erythrocytes. Hematopoietic stem cells can be obtained from human-derived umbilical cord blood, peripheral blood, and bone marrow, and culturing them into erythrocyte-like cells in vitro generally takes about three weeks. Additionally, methods to produce erythrocytes by differentiating pluripotent stem cells, which are capable of indefinite proliferation, into hematopoietic stem cells are also being actively researched.

[0004] However, existing cell lines for in vitro red blood cell production are mainly studied by immortalizing cells through the introduction of immortalization genes (HPV E6 / E7 or c-MYC / BCL-XL), but when immortalized erythroblast progenitor cell lines derived from immortalized pluripotent stem cells are differentiated into red blood cells, most red blood cells contain fetal hemoglobin (HbF; alpha-globin2, gamma-globin2) rather than adult hemoglobin (HbA; alpha-globin2, beta-globin2).

[0005] However, HbF has a stronger affinity for oxygen compared to HbA, so it cannot effectively release oxygen into tissues, which has the disadvantage of lower oxygen transport efficiency. Therefore, it is important to induce red blood cells produced in vitro to contain a large amount of HbA rather than HbF.

[0006] Accordingly, the inventors completed the present invention by confirming that red blood cells containing a large amount of HbA can be produced in vitro by introducing the β-globin gene and the immortalization gene, which are essential components of adult-type hemoglobin (HbA), into a red blood cell production cell line.

[0007] One aspect is to provide a nucleic acid structure comprising: an immortalization region containing an immortalization gene; and a hemoglobin region containing a gene encoding β-globin.

[0008] Another aspect is to provide a vector containing the above nucleic acid structure.

[0009] Another aspect is to provide a cell line for producing red blood cells comprising the nucleic acid structure or the vector.

[0010] Another aspect provides a method for producing a cell line for red blood cell production, comprising the step of transforming the nucleic acid structure or the vector into cells capable of differentiating into red blood cells.

[0011] Another aspect is to provide a method for producing red blood cells in vitro, comprising the step of differentiating the above cell line into red blood cells.

[0012] One aspect provides a nucleic acid structure comprising: an immortalization region containing an immortalization gene; and a hemoglobin region containing a gene encoding β-globin.

[0013] The term 'nucleic acid construct' refers to a combination of gene fragments arranged in an artificial order, and may be a single or double-stranded nucleic acid molecule that is artificially synthesized, manipulated to include a specific sequence in a manner not found in nature, or isolated from nature, and may include a regulatory sequence.

[0014] The term 'region' above refers to a functional unit that performs an independent function within a nucleic acid structure. For example, it refers to a polynucleotide segment that performs functions such as inducing the expression of a specific gene, being responsible for the replication of the structure, or providing selection markers.

[0015] The term 'immortalization' above refers to the ability of a cell to proliferate indefinitely as a normal cell without aging. Specifically, primary cells isolated from humans or animals do not continue to grow when cultured continuously and stop growing after a limited number of divisions. This is called replicative senescence in vitro, and cells that possess the ability to proliferate indefinitely as a normal cell without aging are called immortalized cells.

[0016] In one embodiment, the immortalization gene may encode one or more proteins selected from the group consisting of HPV (human papillomavirus) E6, HPV E7, c-MYC, BCL-XL, SV40, hTERT, EBV, MycT58A, RasV12, and p53. When the immortalization gene is introduced into a cell, immortalization can be induced in the cell. Specifically, the immortalization gene may be a gene encoding HPV E6 and a gene encoding HPV E7, and more specifically, the immortalization gene may be a gene encoding HPV16 E6 and a gene encoding HPV16 E7. HPV16 refers to HPV number 16, is known as a major cause of cervical cancer, and can confer a stronger immortalization ability.

[0017] The above HPV16 E6 may include the amino acid sequence of SEQ ID NO. 35. The above HPV16 E7 may include the amino acid sequence of SEQ ID NO. 36.

[0018] The gene encoding HPV16 E6 may include the nucleotide sequence of SEQ ID NO. 2. The gene encoding HPV16 E7 may include the nucleotide sequence of SEQ ID NO. 3.

[0019] The above 'immortalization domain' refers to a polynucleotide unit containing an immortalization gene capable of inducing infinite proliferation by inhibiting cell aging and preventing apoptosis.

[0020] In one embodiment, the immortalization region may further include an inducible promoter, and the inducible promoter may be operably linked to the immortalization gene. The 'inducible promoter' refers to a promoter in which the transcriptional activity of the operably linked gene is selectively initiated or regulated in response to external signals, such as chemical substances, temperature changes, or specific physiological conditions.

[0021] The term 'promoter' above refers to a DNA sequence capable of regulating the expression of a coding sequence or functional RNA. A promoter consists of adjacent and distant upstream elements; while the promoter region is generally considered to be upstream from the start codon, it may also exist downstream as well as in introns. The adjacent element typically includes a TATA box, which enables RNA polymerase II to initiate RNA synthesis at a suitable transcription initiation site. The distant element includes a regulatory sequence called an enhancer, which is an additional regulatory element involved in tissue-specific or time-specific expression located upstream of the TATA box at a location where it is difficult to estimate the distance from the start codon. The enhancer is a DNA sequence capable of promoting promoter activity and may be an intrinsic element of the promoter or a heterologous element inserted to enhance the promoter's tissue specificity or expression level. The promoter may be derived entirely from the original gene, or may consist of different elements derived from different promoters found in nature, or may even include synthetic DNA. The promoter may be constitutive, inducible, repressive, or tissue-specific.

[0022] The above 'operably linked' refers to a functional coupling between a regulatory sequence related to gene expression (e.g., a promoter, a signal sequence, or a transcription regulator) and another gene, thereby allowing the regulatory sequence to regulate the transcription and / or translation of the other gene.

[0023] The above-mentioned inducible promoter may be one selected from the group consisting of a TRE (Tetracycline Response Element) promoter, a Gal1 promoter, an UAS (Upstream Activating Sequence) promoter, a MT (Metallothionein) promoter, an HSP (heat-shock protein) promoter, an ecdysone inducible promoter, a mifepristone inducible promoter, a HIF-1 reactive promoter, a GAL1 promoter, and a polyhedrin promoter. Specifically, the above-mentioned inducible promoter may be a TRE promoter. The above-mentioned TRE promoter may include the nucleotide sequence of SEQ ID NO. 37 or a nucleotide sequence having 90% or more homology thereto.

[0024] In one embodiment, the nucleic acid structure may further comprise an expression regulatory region comprising a gene encoding a transcription regulator. The 'expression regulatory region' refers to a polynucleotide unit that expresses a transcription regulator controlling the activity of an inducible promoter included in the immortalization region. Specifically, the expression regulatory region may comprise a gene encoding a constitutive promoter and a transcription regulator operably linked thereto within the cell.

[0025] The expression regulation region may exist separately from the immortalization region or hemoglobin region within the nucleic acid structure, or may exist in overlap with the immortalization region or hemoglobin region. For example, a constitutive promoter within the expression regulation region may exist in overlap with a constitutive promoter within the hemoglobin region, in which case the constitutive promoter and the gene encoding a transcription regulator and a gene encoding β-globin within the expression regulation region may be operably linked.

[0026] The above transcription regulator may be one or more selected from the group consisting of rtTA (reverse tetracycline-transactivator), tTA (tetracycline-transactivator), CymR (cumate repressor), VgEcR (Ecdysone receptor), and GLp65 (gene-linked p65). Specifically, the above transcription regulator may be rtTA. rtTA can bind to doxycycline and cannot interact with the TRE promoter before binding to doxycycline, but after binding to doxycycline, it can interact with the TRE promoter to induce the expression of the gene linked thereto. More specifically, the above transcription regulator may be rtTA2s-M2, and rtTA2s-M2 may include the nucleotide sequence of SEQ ID NO. 39 or a nucleotide sequence having 90% or more homology thereto.

[0027] In one embodiment, the nucleic acid structure may further include a selection region. The 'selection region' refers to a polynucleotide unit that provides a marker to distinguish cells into which the nucleic acid structure has been introduced from cells into which it has not been introduced, or to selectively enable survival and proliferation. The selection region may include a selection marker, such as an antibiotic resistance gene or a fluorescent protein gene, and a promoter operably linked thereto.

[0028] The above antibiotic resistance gene may be selected from the group consisting of BleoR, PuroR, NeoR, HygroR, and Bsr. Specifically, the above antibiotic resistance gene may be BleoR or PuroR.

[0029] The above fluorescent protein may be selected from the group consisting of EGFP, ZsGreen1, EmGFP, mCherry, tdTomato, DsRed, mKate2, BFP, and CFP.

[0030] In one embodiment, the nucleic acid structure may further include an integration region. The 'integration region' refers to a region containing a base sequence that mediates the process of physical integration or recombination of the whole or part (payload) of the nucleic acid structure into the genomic DNA of a cell. In the case of a viral vector, the integration region may be located at the 5' and 3' ends of the structure and exist in a form that wraps other regions in the 5' and 3' directions.

[0031] The above integration may be any one selected from the group consisting of virus-mediated integration, transposon-mediated integration, homologous recombination-based integration, integration using sequence-specific recombinant enzymes, and random integration.

[0032] Virus-mediated integration is generally the most widely used method. When using lentivirus or retrovirus vector systems, viral DNA generated through reverse transcription after infection is inserted into random locations on the host genome by the action of integrase. This process is mediated by the Long Terminal Repeat (LTR) sequence at the end of the vector and has the advantage of inducing permanent gene integration with high efficiency in various host cells, including non-dividing cells. Additionally, in the case of adeno-associated virus (AAV) systems, a method utilizing wild-type Rep proteins to induce integration at specific chromosomal locations, such as AAVS1, can also be considered.

[0033] Representative transposon-mediated integration systems include the PiggyBac or Sleeping Beauty systems, which utilize a 'cut and paste' mechanism in which a transposase recognizes an ITR (Inverted Terminal Repeat) sequence within the vector, cleaves a specific sequence of the host DNA (e.g., TTAA sequence), and inserts a target nucleic acid construct at that location. This method has the advantage of high biological safety as it does not use viruses and can efficiently integrate relatively large gene sequences.

[0034] Homologous recombination-based integration is a method that uses engineered nucleases such as CRISPR / Cas9, TALEN, and ZFN to induce double-strand breaks at safe harbor loci of the host genome and precisely inserts (knocks in) a target gene using a vector containing a sequence homologous to that location as a template. This has the advantage of minimizing the risk of insertion mutations associated with random integration.

[0035] Sequence-specific recombinase-based integration includes systems such as Flp-In and Cre-LoxP, which are methods that utilize site-specific recombinases to integrate a vector into a specific location on a host cell into which a target sequence has been pre-introduced.

[0036] Random integration is a method that induces the random integration of linearized plasmids, introduced into cells via physical / chemical transfusion, into the genome through the cell's non-homologous end binding (NHEJ) mechanism, and then selects them using antibiotics or the like.

[0037] The integration region may include one or more selected from the group consisting of LTR sequences, ITR sequences, transposon repeat sequences, and AAVS (adeno-associated virus integration site) sequences. Specifically, the integration region may include an LTR sequence or an AAVS sequence, and more specifically, the integration region may include an AAVS1 sequence.

[0038] In one embodiment, the integration region may be integrated at a safe-harbor locus of a host cell. The "safe-harbor locus" refers to a genomic region capable of stably expressing an external gene without altering the phenotype of the host cell, and may be one selected from the group consisting of AAVS1 (Adeno-associated virus integration site 1), chemokine (CC motif) receptor 5 (CCR5), and ROSA26. Specifically, the safe-harbor locus may be AAVS1. AAVS1 is located in the first intron region of the PPP1R12C gene in region 19 of chromosome 19 (19q13.42).

[0039] In one embodiment, the hemoglobin region may further include a constitutive promoter, and the constitutive promoter may be operably linked to the gene encoding the β-globin. The 'constitutive promoter' refers to a promoter that continuously induces transcription of the operably linked gene regardless of the cell growth stage or the presence or absence of external stimuli.

[0040] The above-mentioned constitutive promoter may be one or more selected from the group consisting of a CAG promoter, a CAGGS promoter, a CMV promoter, an EF1α promoter, a PGK promoter, a UbC promoter, an RSV LTR promoter, an EFS promoter, and an SV40 promoter. Specifically, the above-mentioned constitutive promoter may be a CAG promoter or a CAGGS promoter. The above-mentioned CAG promoter may include the nucleotide sequence of SEQ ID NO. 38 or a nucleotide sequence having 90% or more homology thereto.

[0041] In one embodiment, the β-globin may comprise the amino acid sequence of SEQ ID NO. 1.

[0042] Even if the present specification states "a nucleotide sequence of a specific sequence number or an amino acid sequence of a specific sequence number," it does not exclude meaningless sequence additions before or after the nucleotide sequence or amino acid sequence of the said sequence number, naturally occurring mutations, or silent mutations thereof, and it is evident that even in cases having such sequence additions or mutations, they fall within the scope of the present invention. That is, even if there are differences in some sequences, if they exhibit homology above a certain level and show the same activity, they may fall within the scope of the present invention. Specifically, it may include, but is not limited to, a base sequence or amino acid sequence having 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the base sequence or amino acid sequence of SEQ ID NOs 1 to 3 and SEQ ID NOs 35 to 41.

[0043] The above "homology" or "identity" refers to the degree of mutual relationship between two given amino acid sequences or base sequences and may be expressed as a percentage, and "homology" and "identity" may be used interchangeably.

[0044] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Substantially, homologous or identical sequences can generally be hybridized under moderate or high-strict conditions along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its total length. It is evident that hybridization also involves polynucleotides containing common codons or codons that account for codon degeneracy.

[0045]

[0046] Another aspect provides a vector comprising a nucleic acid structure comprising: an immortalization region containing an immortalization gene; and a hemoglobin region containing a gene encoding β-globin.

[0047] The above terms "nucleic acid structure," "immortalization gene," "immortalization region," "gene encoding β-globin," "hemoglobin region," etc., are within the scope described above.

[0048] The term "vector" above may refer to a polynucleotide product containing a regulatory sequence of a gene and a nucleotide sequence to enable the expression of a target gene within a suitable host cell. Alternatively, it may refer to a polynucleotide product containing a homologous recombination-capable nucleotide sequence to be introduced into a host cell to alter the regulatory sequence of an endogenous gene on the host genome or to insert a target gene capable of expression into a specific region of the genome. Therefore, the vector may additionally include a selection marker to confirm whether it has been introduced into a host or inserted into a chromosome; the selection marker may be one that confers selectable phenotypes, such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or the expression of surface proteins. Since only cells expressing the selection marker survive or exhibit other phenotypic traits in an environment treated with a selector, the transformed cells can be selected. For example, it may be a plasmid vector, cosmid vector, virus vector, lentivirus vector, retrovirus vector, HIV (Human immunodeficiency virus) vector, MLV (Murineleukemia virus) vector, ASLV (Avian sarcoma / leukosis) vector, SNV (Spleen necrosis virus) vector, RSV (Rous sarcoma virus) vector, MMTV (Mouse mammary tumor virus) vector, adenovirus vector, adeno-associated virus vector, herpes simplex virus vector, and episomal vector, but is not limited thereto.In addition, the vector that can be used as the recombinant vector may be produced by manipulating plasmids (e.g., pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series and pUC19, etc.) commonly used in the industry, phages (e.g., λgt4λB, λ-Charon, λ△z1 and M13, etc.) or viruses (e.g., SV40, etc.).

[0049] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The expression vector may be a conventional one used in the art to express foreign proteins in plants, animals, or microorganisms. The above recombinant vector can be constructed through various methods known in the art.

[0050] The above-mentioned recombinant vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, if the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. If the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., CAG promoter, metallothionein promoter) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and HSV tk promoter) may be used, and generally have a polyadenylation sequence as a transcription termination sequence.

[0051] The above recombinant vector may be obtained by treating a nucleic acid molecule and a plasmid vector with the same restriction enzyme, and then introducing the nucleic acid molecule treated with the restriction enzyme into the plasmid vector treated with the same restriction enzyme.

[0052] In one embodiment, the restriction enzyme may be NheI, BamHI, EcoRI, HindIII, kpnI, NotI, PstI, SmaI, XhoI, FokI, Alw26I, BbvI, BsrI, EarI, HphI, MboI, SfaNI, Tth111I, NeaI, NgoMIV, Eco57I, BcgI, BpI, Bsp24I, BaeI, CjeI, EcoPI, StyLTI, Bal31, T4, T7, RecBCD, P25736I, P09030II, P1, DnaseI, Endo R, Cas9, Cpf1, C2c1, C2c2, C2c3, Cas3, Cas3-HD, Cas5, Cas7, Cas8, Cas10. Preferably, the restriction enzyme may be NheI or BamHI, but is not limited thereto.

[0053] In one embodiment, the vector may include the nucleotide sequence of SEQ ID NO. 40 or a nucleotide sequence having 90% or more homology therewith. The nucleotide sequence of SEQ ID NO. 40 is the nucleotide sequence of the vector prepared in Examples 1-2 of the present invention, and includes a nucleotide sequence for the TRE promoter, a nucleotide sequence for the HPV 16 E7 gene, a nucleotide sequence for the HPV 16 E6 gene, a nucleotide sequence for the CAG promoter, a nucleotide sequence for the β-globin gene, and a nucleotide sequence for some of rtTA2s. In addition, the vector further includes a nucleotide sequence that undergoes homologous recombination with the safe harbor locus AAVS1, so that the immortalization gene and the β-globin gene can be introduced into the genomic DNA within the cell through CRISPR / Cas9 gene editing technology, etc.

[0054] In one embodiment, the vector may include the nucleotide sequence of SEQ ID NO. 41 or a nucleotide sequence having 90% or more homology thereto. The nucleotide sequence of SEQ ID NO. 41 is the nucleotide sequence of the vector prepared in Example 2-2 of the present invention, and includes a nucleotide sequence for the TRE promoter, a nucleotide sequence for the HPV 16 E6E7 gene, a nucleotide sequence for the CAGGS promoter, a nucleotide sequence for the β-globin gene, and a nucleotide sequence for some of rtTA. In addition, the vector includes a 5'LTR sequence and a 3'LTR sequence, so that when packaged into a viral particle and introduced into a cell, the immortalization gene and the β-globin gene can be introduced into the genomic DNA.

[0055]

[0056] Another aspect provides a cell line for producing red blood cells comprising the nucleic acid structure or the vector.

[0057] The above terms "nucleic acid structure," "immortalization gene," "immortalization region," "gene encoding β-globin," "hemoglobin region," "vector," etc., are within the scope described above.

[0058] In one embodiment, the cell line may be any one selected from the group consisting of pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCs), hematopoietic stem cells (HSCs), and erythroblast progenitor cells. All of the pluripotent stem cells, induced pluripotent stem cells, hematopoietic stem cells, and erythroblast progenitor cells are capable of differentiating into red blood cells, and accordingly, the cell line may possess the ability to differentiate into red blood cells.

[0059] The above-mentioned pluripotent stem cells may be embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs). Specifically, the embryonic stem cells or induced pluripotent stem cells may be of human origin. More specifically, the above-mentioned induced pluripotent stem cells may be Rh- O type-derived induced pluripotent stem cells. Induced pluripotent stem cells derived from Rh- O type cells have the advantage of being transplantable to patients of all blood types.

[0060] The above-mentioned 'pluripotent stem cells' refer to stem cells possessing self-renewal capability that are pluripotent or totipotent, capable of differentiating into cells of all tissues of an individual, and may include embryonic stem cells or induced pluripotent stem cells. Embryonic stem cells are cells obtained by extracting an inner cell mass from an early embryo just before a fertilized egg implants in the mother's uterus and culturing it in vitro; they possess self-renewal capability that is pluripotent or totipotent, capable of differentiating into cells of all tissues of an individual. In a broader sense, embryoid bodies derived from embryonic stem cells are also included. 'Induced pluripotent stem cells' refer to cells induced to possess pluripotent differentiation capability through an artificial dedifferentiation process from differentiated cells, and are also called dedifferentiated stem cells. The artificial dedifferentiation process involves virus-mediated or non-viral vectors using retroviruses and lentiviruses; Alternatively, it may be performed by introducing non-viral-mediated dedifferentiation factors using proteins and cell extracts, etc., or may include a dedifferentiation process using stem cell extracts, compounds, etc. Induced pluripotent stem cells have characteristics almost identical to embryonic stem cells, specifically, they show similar cell morphology, have similar gene and protein expression patterns, possess pluripotency in vitro and in vivo, form teratomas, form chimera mice when inserted into mouse blastocysts, and enable germline transmission of genes.

[0061] The above 'hematopoietic stem cells' refer to cells that can potentially differentiate into bone marrow or erythrocyte lineage cells found in the blood, such as red blood cells, T cells, neutrophils, granulocytes, monocytes, natural killer cells, basophils, dendritic cells, eosinophils, mast cells, B cells, platelets, and megakaryocytes. The above hematopoietic stem cells are preferably, but not limited to, hematopoietic stem cells isolated from human-derived umbilical cord blood, peripheral blood, or bone marrow-derived cells, or differentiated from pluripotent stem cells.

[0062] The above 'erythroblast progenitor cell' refers to all cells involved in the process of erythrocyte formation, excluding mature red blood cells, and specifically refers to erythroid cells prior to enucleation. For example, the above erythroblast progenitor cell is CD34 + It may be a cell. In addition, the erythrocyte progenitor cell may be selected from the group consisting of burst-forming unit-erythroid (BFU-E), colony-forming unit-erythroid (CFU-E), proerythroblast, basophilic erythroblast, polychromatic erythroblast, orthochromatic erythroblast, and reticulocyte. The erythrocyte progenitor cell may be obtained from various sources, such as peripheral blood, umbilical cord blood, or bone marrow.

[0063] When only the immortalization gene is introduced into the above-mentioned cell line for producing red blood cells and then differentiated into red blood cells, the cells do not have adult-type hemoglobin (HbA; α2β2) but have fetal-type hemoglobin (HbF; α2γ2); therefore, the above-mentioned cell line for producing red blood cells must have the β-globin gene introduced. Accordingly, the cell line for producing red blood cells containing the above-mentioned nucleic acid structure or the above-mentioned vector can produce red blood cells that express a large amount of HbA. Therefore, the above-mentioned red blood cells may express HbA.

[0064] In one embodiment, the cell line may possess cell proliferation ability. Since the nucleic acid structure or vector included in the cell line contains an immortalization gene, when the immortalization gene is expressed, cell aging does not occur and proliferation can continue.

[0065] Furthermore, if the immortalization gene within the cell line is operably linked to an inducible promoter, the cell line can reversibly induce or stop cell proliferation. For example, if the immortalization gene is operably linked to a TRE promoter, the cell line retains the ability to proliferate in the presence of doxycycline, but cell proliferation ceases when doxycycline is removed. This acts as a safety mechanism to prevent side effects, such as cancer induction, from occurring if red blood cells produced by the cell line proliferate indefinitely within the body.

[0066] In one embodiment, the cell line may have an increased β-globin expression and a decreased γ-globin expression compared to the wild-type cell line. When the β-globin expression increases and the γ-globin expression decreases, the proportion of fetal hemoglobin (α2γ2) decreases and the proportion of adult hemoglobin (α2β2) increases.

[0067]

[0068] Another aspect provides a method for producing a cell line for red blood cell production, comprising the step of transforming the nucleic acid structure or the vector into a cell capable of differentiating into red blood cells.

[0069] The above terms "nucleic acid structure," "immortalization gene," "immortalization region," "gene encoding β-globin," "hemoglobin region," "vector," etc., are within the scope described above.

[0070] In one embodiment, the cell having the ability to differentiate into red blood cells may be any one selected from the group consisting of pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCs), hematopoietic stem cells (HSCs), and erythroblast progenitor cells.

[0071] The aforementioned 'transformation' refers to a phenomenon in which DNA introduced from an external source is introduced into a host cell, altering the cell's genetic composition through that genetic information and resulting in the appearance of a new phenotype. This process is essential for producing specific proteins or for studying and improving cell functions by delivering target genes to bacteria, plants, or animal cells using vectors such as plasmids.

[0072] To introduce a vector into a host cell, a delivery method widely known in the art may be used. For example, if the host cell is a prokaryotic cell, methods such as conjugation, the CaCl2 method, or electroporation may be used, and if the host cell is a eukaryotic cell, methods such as Agrobacterium-mediated transformation, microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, and gene bombardment may be used.

[0073]

[0074] Another aspect provides a method for in vitro production of red blood cells comprising the step of differentiating the above-mentioned cell line for red blood cell production into red blood cells.

[0075] The above terms "nucleic acid structure," "immortalization gene," "immortalization region," "gene encoding β-globin," "hemoglobin region," "vector," etc., are within the scope described above.

[0076] The term "differentiation" above refers to the phenomenon in which the structure or function of cells becomes specialized during growth through cell division and proliferation; that is, it signifies the change in form or function of biological cells, tissues, etc., to perform the specific tasks assigned to them. Specifically, in the present invention, it refers to differentiating induced pluripotent stem cells, hematopoietic stem cells, etc., into red blood cells.

[0077] The step of differentiating red blood cells from the above-mentioned induced pluripotent stem cells is medium A (STEMdiff TM Hematopoietic Basal Medium + STEMdiff TM Hematopoietic Supplement A), Medium E1 (STEMdiff TM Hematopoietic Basal Medium + STEMdiff TM Erythroid Supplement E1) and medium E2 (STEMdiff TM Hematopoietic Basal Medium + STEMdiff TM Differentiation can be performed using Erythroid Supplement E2, but is not limited to this.

[0078] In addition, hematopoietic stem cells can be differentiated into red blood cells using StemPro®-34 SFM and Stemline II hematopoietic stem cell expansion medium, but are not limited thereto.

[0079] In one embodiment, the production method may further include a step of proliferating the cell line prior to the differentiation step. Since the cell line possesses the ability to proliferate through an immortalization gene, cell proliferation is possible. Therefore, it is expected that red blood cells can be efficiently produced when the cells are differentiated into red blood cells after proliferation.

[0080]

[0081] In one embodiment, to obtain Rh- O-derived induced pluripotent stem cells (iPSCs) transplantable to patients of all blood types, peripheral blood mononuclear cells (PBMCs) from a female Rh- O donor were transfected with reprogramming factors (KOS, hc-Myc, hKlf4) using a Sendai virus vector, and cultured in a vitronectin-coated dish through stepwise media exchange. As a result, it was confirmed that induced pluripotent stem cells were successfully induced and formed from the peripheral blood cells of the Rh- O donor (see Example 1-1).

[0082] In another example, to construct a nucleic acid construct for knocking in the immortalization gene (HPV 16 E6 / E7) and the β-globin gene at the AAVS1 locus, which is a safe harbor for induced pluripotent stem cells, the immortalization gene region (including HPV 16 E6 / E7) and the β-globin gene region were constructed in the form of plasmids through PCR amplification and restriction enzyme treatment, respectively, and then a multi-step cloning process was performed in which these were sequentially linked to a vector containing an AAVS1 homologous sequence (Homology Arm) and expression regulatory factors (rtTA2s, etc.). As a result, it was confirmed that a final nucleic acid construct was successfully constructed in which the immortalization gene, the β-globin gene, and the sequences regulating their expression were correctly inserted between the AAVS1 homologous sequences (see Examples 1-2).

[0083] In another embodiment, to introduce an immortalization gene and a β-globin gene into the AAVS1 locus within the genome of induced pluripotent stem cells, AAVS1 target sgRNA, Cas9 protein, and donor DNA were injected into cells via electroporation, and then the cells were cultured while gradually increasing the concentration of puromycin to select the transformed cells, and a luciferase activity analysis was performed. As a result, since luciferase activity was confirmed in the selected cell colonies, it was confirmed that the genes were successfully knocked into the AAVS1 locus of the induced pluripotent stem cells (see Examples 1-3).

[0084] In another example, to verify whether a nucleic acid construct was accurately inserted into the AAVS1 locus within the genomic DNA of a selected cell line, genomic PCR was performed using primer pairs capable of specifically amplifying the terminal regions of the inserted gene. As a result, DNA bands of 1162 bp and 1085 bp, which were the predicted sizes for each primer pair, were clearly detected, confirming that the immortalization gene and the β-globin gene were accurately inserted (knock-in) into the target site, the AAVS1 locus (see Examples 1-4).

[0085] In another example, to verify whether the expression of the immortalization gene and reporter gene introduced into the prepared cell line is normally regulated in response to doxycycline treatment, a luciferase assay was performed under doxycycline treatment conditions. As a result, by confirming that high luminescence activity (RLU) was observed in the doxycycline-treated group, it was confirmed that not only was the immortalization gene successfully introduced, but a safety mechanism capable of selectively controlling only the expression of the immortalization gene depending on the presence or absence of doxycycline was functioning normally (see Examples 1-5).

[0086] In one embodiment, in order to induce hematopoietic stem cells from the induced pluripotent stem cells prepared in Example 1-1, selected cell aggregates were prepared in a dedicated differentiation medium (STEMdiff TM After stepwise culture using the Erythroid Kit, the expression of hematopoietic stem cell surface markers (CD34, CD43, CD45) was analyzed via flow cytometry (FACS). As a result, by confirming the expression of the corresponding surface markers along with stable colony formation, it was confirmed that hematopoietic stem cells were successfully induced to differentiate from induced pluripotent stem cells (see Example 2-1).

[0087] In another example, to construct a lentivirus nucleic acid construct for delivering an immortalization gene and a β-globin gene to hematopoietic stem cells, the β-globin gene, rtTA, the CAG promoter, and the HPV16 E6 / E7 gene fragment were obtained through PCR amplification and restriction enzyme treatment, and a multi-step cloning process was performed to sequentially link them. As a result, it was confirmed that the CSIV-TRE-HPV16 E6E7-CAG-β-globin plasmid, a final lentivirus vector in which the immortalization gene (HPV16 E6E7) and the β-globin gene were correctly assembled, was successfully constructed (see Example 2-2).

[0088] In another embodiment, to introduce the immortalization gene and the β-globin gene into hematopoietic stem cells, a prepared nucleic acid construct for lentivirus was packaged into viral particles, and then the process of treating pluripotent stem cell-derived hematopoietic stem cells or erythroblast progenitor cells with the same to infect them was performed. As a result, it was confirmed that hematopoietic stem cells in which the immortalization gene and the β-globin gene were introduced into the cells were successfully produced (see Examples 2-3).

[0089] In another example, to verify whether the gene delivered via lentivirus was stably inserted into the genome of hematopoietic stem cells, genomic DNA was extracted from transfected cells, and PCR was performed using specific primers targeting the rtTA sequence within the transplanted gene. As a result, DNA bands of the predicted size were clearly observed under all viral infection concentration conditions (MOI 25, 50, and 100), confirming that the target gene, including the β-globin gene, was successfully inserted into the hematopoietic stem cells (see Examples 2-4).

[0090] In one embodiment, to verify the differentiation ability of induced pluripotent stem cells (AEβ cell line) into hematopoietic stem cells and erythrocytes and the presence of β-globin expression of induced pluripotent stem cells (AEβ cell line) into which an immortalization gene and a β-globin gene have been introduced, the AEβ cell line and a wild-type control were prepared in an aggregate form, and then a dedicated differentiation kit (STEMdiff TM A stepwise differentiation induction process was performed by sequentially switching to medium A, medium E1, and medium E2 using the Erythroid Kit. As a result, stable colony formation and floating cell generation were observed in both cell lines, confirming that the AEβ cell line maintained its differentiation ability into normal hematopoietic stem cells and erythroblast progenitor cells, as well as viability, despite gene introduction (see Example 3-1).

[0091] In another embodiment, to verify whether the differentiated cells possess the characteristics of actual hematopoietic stem cells and erythrocyte progenitor cells, flow cytometry analysis was performed on cells at differentiation days 10 and 17 for hematopoietic stem cell markers (CD34, CD43) and erythrocyte markers (CD71, CD235), respectively. As a result, surface antigens specific to each differentiation stage (CD34 + / CD43 + and CD71 + / CD235 +By confirming that ) was expressed at a level equivalent to that of the control group, it was confirmed that the introduction of immortalization and the β-globin gene did not negatively affect the differentiation ability of the hematopoietic system and induced normal differentiation (see Example 3-2).

[0092] In another example, to quantitatively analyze the expression patterns of adult and fetal hemoglobins in differentiated erythroblast progenitor cells, total RNA was extracted from suspension cells on day 17 of differentiation, and qRT-PCR was performed to measure the relative expression levels of β-globin and γ-globin genes. As a result, it was confirmed that the expression level of β-globin significantly increased (approx. 1.3 times) compared to the control group, while the expression level of γ-globin significantly decreased (approx. 0.2 times), thereby confirming that the cell line is suitable for producing erythrocytes in which fetal globin expression is suppressed and adult globin expression is dominant (see Example 3-3).

[0093] According to one aspect, the cell line for producing red blood cells into which an immortalization gene and a β-globin gene have been introduced to produce red blood cells expressing adult-type hemoglobin (HbA) according to the present invention can stably and efficiently produce red blood cells containing a large amount of HbA in vitro, thereby enabling a stable supply of red blood cells for transfusion and effectively solving the problem of blood shortage and transfusion side effects.

[0094] Figure 1 shows a nucleic acid structure for knocking in the beta-globin gene into the safe-harbor locus AAVS1 (Adeno-associated virus integration site 1) of induced pluripotent stem cells.

[0095] Figure 2 is a diagram showing the production schedule of induced pluripotent stem cells with the β-globin gene inserted.

[0096] Figure 3 shows the PCR analysis results of induced pluripotent stem cells with the β-globin gene inserted.

[0097] Figure 4 shows the results of a luciferase assay of induced pluripotent stem cells with a β-globin gene inserted.

[0098] Figure 5 shows a schematic diagram of a nucleic acid structure for a lentivirus to deliver the β-globin gene to hematopoietic stem cells.

[0099] Figure 6 is a figure showing whether the β-globin gene was inserted into genomic DNA by PCR after being delivered to hematopoietic stem cells via a lentivirus.

[0100] Figure 7 is a schematic diagram of the differentiation induction schedule of gene-introduced induced pluripotent stem cells into hematopoietic stem cells and erythroblast progenitor cells.

[0101] Figures 8 to 11 are graphs of flow cytometry results of induced pluripotent stem cells into which genes have been introduced.

[0102] Figures 12 and 13 are graphs of qRT-PCR results for β-globin and γ-globin of hematopoietic stem cells / erythroblast progenitor cells differentiated from gene-introduced induced pluripotent stem cells.

[0103] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0104]

[0105] Example 1. Preparation of induced pluripotent stem cells into which the immortalization gene and the β-globin gene were introduced

[0106] 1-1. Preparation of Rh- O type induced pluripotent stem cells

[0107] To secure Rh- O-derived induced pluripotent stem cells that can be transplanted into patients of all blood types, induced pluripotent stem cells were prepared using peripheral blood mononuclear cells (PBMCs) isolated from the blood of an Rh- O- female donor.

[0108] Specifically, separated PBMC (1.25 × 10⁻⁶ 5 After inoculating cells / ml) into an ultra-low attachment 24-well plate and culturing for 96 hours, the Sendai virus vector (CytoTune TM Transduction was performed using the iPS 2.0 Sendai Reprogramming Kit (Cat #A16517). The transduction was approximately 2.5 × 10⁶ 5 ~ 5×10 5 The study was conducted on dog cells, and dedifferentiation was induced by setting the MOI (Multiplicity of Infection) of the genes KOS (hKlf4, Oct3 / 4, Sox2), hc-Myc, and hKlf4 included in the Sendai virus vector to 5, 5, and 3.

[0109] The culture medium was replaced 24 hours after transduction (Day 1), and 48 hours later (Day 3), the cells were transferred to a culture dish coated with Vitronectin protein, followed by StemPro that did not contain cytokines TM Additional culture was performed for 96 hours (up to Day 7) using -34 medium. During this period, the medium was replaced every 24 hours. Subsequently, on Day 8, Essential 8 TM Badges and StemPro TM -34 medium was mixed in equal proportions and cultured for 24 hours. From then on, until induced pluripotent stem cells were formed, Essential 8 TM Culture was continued using only the medium.

[0110] As a result, it was confirmed that induced pluripotent stem cells were successfully formed from peripheral blood mononuclear cells of Rh- O type women.

[0111]

[0112] 1-2. Construction of nucleic acid constructs for knocking in immortality genes and β-globin genes

[0113] A nucleic acid structure was prepared to insert an immortalization gene and a β-globin gene into the AAVS1 locus, which is a safe harbor of the induced pluripotent stem cells prepared in Example 1-1 above (Fig. 1). The preparation process of the nucleic acid structure was carried out in three parts: Part 1, Part 2, and Part 3.

[0114] Part 1 describes the process for constructing the immortalized gene region. First, the following primers were used to construct the TA-TRE promoter-HPV 16 E7-T2A-HPV 16 E6-P2A-Nluc-bGHpA-CAG promoter (part of the CAG promoter sequence):

[0115] PmeI-hGHpA F (5'-GTTTAAACGGGTGGCATCCCTGTGACCCCT-3') (Sequence No. 4);

[0116] TRE-AsiSI R (5'-GCGATCGCCGGCGATCTGACGGTTCA-3') (Sequence No. 5);

[0117] AsisI-bGHpA F (5'-GCGATCGCCTGTGCCTTCTAGTTGCC-3') (Sequence No. 6);

[0118] bGHpA-CAG-SpeIXbaI R (5'-TCTAGAACTAGTCAATAATCAATGTCCCAT-3') (Sequence No. 7);

[0119] AscI-E6 F (5'-GGCGCGCCATGCACCAAAAGAGAACTG-3') (Sequence No. 8);

[0120] E6-BstbI R (5'-TTCGAACGACCCCTTATATTATGGA-3') (Sequence No. 9);

[0121] PacI-E7 F (5'-TTAATTAAGGCCACCATGCATGGAGATACACCTA-3') (SEQ ID 10); and

[0122] E7-MluI R (5'-ACGCGTTGGTTTCTGAGAACAGAT-3') (Sequence No. 11).

[0123] Specifically, PmeI-hGHpA F and TRE-AsiSI R primers were used to construct the TA-PmeI-hGHpA-TRE promoter-AsiSI plasmid, AscI-E6 F and E6-BstbI R primers were used to construct the TA-AscI-HPV 16 E6-BstbI plasmid, PacI-E7 F and E7-MluI R primers were used to construct the TA-PacI-HPV 16 E7-MluI plasmid, and AsisI-bGHpA F and bGHpA-CAG-SpeIXbaI R primers were used to construct the TA-AsiSI-bGHpA-CAG promoter sequence part (GACATTGATTATTG) plasmid, and polymerase chain reaction (PCR) was performed. Subsequently, each amplified gene sequence was ligated with a TA cloning vector to construct each plasmid. Then, each plasmid was ligated in the following order to complete the TA-TRE promoter-HPV 16 E7-T2A-HPV 16 E6-P2A-Nluc-bGHpA-CAG promoter sequence partial plasmid (immortalization region plasmid).

[0124] 1) To construct the TA-hGHpA-TRE promoter-bGHpA-CAG promoter sequence partial plasmid, the TA-bGHpA-CAG promoter plasmid and the TA-bGHpA-CAG promoter sequence partial plasmid were treated with restriction enzymes (AsiSI and XbaI) to purify the DNA, and then the genes were linked to construct the TA-hGHpA-TRE promoter-bGHpA-CAG promoter sequence partial plasmid.

[0125] 2) To construct TA-EcoRIPacI-T2A-HPV 16 E6-P2A-Nluc-PacI, the TA-T2A-HVEM-P2A-Nluc plasmid was treated with restriction enzymes AscI and ClaI, and the TA-AscI-HPV 16 E6-BstbI plasmid was treated with restriction enzymes AscI and BstbI and purified, and then the genes were linked to construct the TA-T2A-HPV 16 E6-P2A-Nluc plasmid.

[0126] 3) To construct the TA-EcoRIPacI-HPV 16 E7-T2A-HPV 16 E6-P2A-Nluc-PacI plasmid, the TA-EcoRIPacI-T2A-HPV 16 E6-P2A-Nluc-PacI plasmid and the TA-AscI-HPV 16 E7-MluI plasmid were treated with restriction enzymes EcoRI and MluI to purify the DNA, and then the genes were linked to construct the TA-EcoRIPacI-HPV 16 E7-T2A-HPV 16 E6-P2A-Nluc-PacI plasmid.

[0127] 4) To construct the TA-TRE promoter-HPV 16 E7-P2A-HPV 16 E6-P2A-Nluc-bGHpA-CAG promoter sequence partial plasmid, the TA-hGHpA-TRE promoter-bGHpA-CAG promoter sequence partial plasmid was treated with restriction enzyme AsiSI, and the TA-EcoRIPacI-HPV 16 E7-T2A-HPV 16 E6-P2A-Nluc-PacI plasmid was treated with restriction enzyme PacI. Subsequently, the genes were ligated to construct the TA-TRE promoter-HPV 16 E7-P2A-HPV 16 E6-P2A-Nluc-bGHpA-CAG promoter sequence partial plasmid.

[0128]

[0129] Part 2 is the hemoglobin region preparation process, in which the TA-MfeI-rtTA2s sequence subset (SEQ No. 14)-T2A-rTSKid-β-globin plasmid was constructed. First, the following primers were designed for the Part 2 process:

[0130] β-globin F: 5'-ACCGGTATGGTGCATCTGACTC-3' (SEQ ID 12); and

[0131] β-globin R: 5'-GCGGCCGCATTTAAATTTAGTGATACTTGTGGGCC-3' (Sequence No.: 13).

[0132] After amplifying the β-globin gene by performing a polymerase chain reaction with β-globin F primers and β-globin R primers, the TA-AgeI-β-globin-SwaINotI plasmid was constructed by linking it to a TA cloning vector.

[0133]

[0134] Next, the restriction enzymes AgeI and NotI were treated with the above-mentioned TA-AgeI-β-globin-SwaINotI plasmid and the TA-MfeI-rtTA2s sequence part-T2A-rTSKid-iCas9-NotI plasmid, and the TA-MfeI-rtTA2s sequence part-T2A-rTSKid-β-globin plasmid (hemoglobin region plasmid) was constructed by linking them.

[0135] Part of the rtTA2s sequence: CAATTGAGCTGTTCGACCGGCAGGGAGCCGAACCTGCCTTCCTTTTCGGCCTGGAACTAATCATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCCGGCCGACGCCCTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTTGACCTTGATATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTC (SEQ ID NO: 14)

[0136]

[0137] In Part 3, the final nucleic acid construct was constructed to insert the immortalization gene and the β-globin gene.

[0138] To this end, the AAVSI HA-L-SA-T2A-PuroR-bGHpA-CAG promoter-Nluc-WPRE-bGHpA-AAVSI-HA-R plasmid, bGHpA-TRE promoter-mCherry-P2A-iCas9-hGHpA-CAG promoter-rtTA2s-M2-T2A-tTSkid-P2A-Nluc-hGHpA-EF promoter-EGFP / PuroR plasmid, and the TA-MfeI-rtTA2s sequence part-T2A-rTSKid-β-globin plasmid constructed in Part 2 were used. The AAVSI HA-L-SA-T2A-PuroR-bGHpA-CAG promoter-Nluc-WPRE-bGHpA-AAVSI-HA-R plasmid was treated with restriction enzymes MreI and EcoRV, the bGHpA-TRE promoter-mCherry-P2A-iCas9-hGHpA-CAG promoter-rtTA2s-M2-T2A-tTSkid-P2A-Nluc-hGHpA-EF promoter-EGFP / PuroR plasmid was treated with restriction enzymes MreI and NheI, and the TA-MfeI-rtTA2s sequence part-T2A-rTSKid-β-globin plasmid was treated with restriction enzymes NheI and SwaI. Afterwards, DNA was purified and three nucleic acid constructs were linked to construct the AAVSI HA-L-SA-T2A-PuroR-bGHpA-CAG promoter-rtTA2s-M2-T2A-tTSkid-P2A-β-globin-WPRE-bGHpA-AAVSI-HA-R plasmid.

[0139] Finally, the plasmids constructed in Part 1 (TA-TRE promoter-HPV 16 E7-P2A-HPV 16 E6-P2A-Nluc-bGHpA-CAG promoter sequence subset plasmid) and the AAVSI HA-L-SA-T2A-PuroR-bGHpA-CAG promoter-rtTA2s-M2-T2A-tTSkid-P2A-β-globin-WPRE-bGHpA-AAVSI-HA-R plasmids were treated with restriction enzymes PmeI and SpeI, after which the DNA was purified and ligated. As a result, a final nucleic acid construct containing the immortalization gene (HPV 16 E6 / E7), the β-globin gene, and the rtTA2 sequence regulating it was successfully constructed.

[0140]

[0141] 1-3. Preparation of CRISPR / Cas9-mediated β-globin gene-introduced induced pluripotent stem cells

[0142] Using CRISPR / Cas9 gene editing technology and a homology-directed repair (HDR) mechanism, an immortalization gene and a β-globin gene were inserted into AAVS1, a safe harbor locus of the induced pluripotent stem cells prepared in Example 1-1.

[0143] First, the following primers were used to prepare the AAVS1-targeted sgRNA:

[0144] AAVS1-sgRNA-Forward primer: 5'-GAA ATT AAT ACG ACT CAC TAT AGT CCC TAG TGG CCC CAC TGT GGT TTT AGA GCT AGA AAT AGC-3' (SEQ ID: 15); and

[0145] sgRNA-Reverse primer: 5'-AAA AAA GCA CCG ACT CGG TGC CAC TTT TTC AAG TTG ATA ACG GAC TAG CCT TAT TTT AAC TTG CTA TTT CTA GCT CTA AAA C-3' (Sequence No.: 16).

[0146] The induced pluripotent stem cells prepared in Example 1-1 above were cultured in StemFit Basic04 CT (AINOMOTO, Cat #AJBASIC04CT) medium in a culture vessel coated with Matrigel® Basement Membrane Matrix (Corning®, Cat #356234). For cell harvesting, cells were isolated by treating with EDTA (Invitrogen, Cat #15575-038) for 4 minutes, and the cells were counted using a hemocytometer.

[0147] 1×10 cells 6 1 μg of donor DNA, 20 μg of Cas9 protein, and 20 μg of AAVS1 sgRNA were mixed and the genes were introduced using electrophoresis (1050V, 20ms, 2 pulses). Three days after transduction, the cells were subcultured in a 6cm culture dish, and starting two days later, puromycin was applied at increasing concentrations in the order of 0.2 μg / mL (120 hours) → 0.3 μg / mL (120 hours) → 0.4 μg / mL (120 hours) (Fig. 2).

[0148] Through a stepwise puromycin screening process, cells without the introduced gene died, and only cell colonies with resistance induced by transduction survived. The surviving colonies were selected and cultured in 24-well culture dishes. When the colonies reached an appropriate size, cells were harvested by treating them with Accutase (Gibco, Cat #A11105-01) and performing the Nano-Glo® Luciferase Assay (Promega, Cat #N1110). As a result, induced pluripotent stem cell lines with successfully inserted β-globin genes were selected by identifying cell lines exhibiting luciferase activity.

[0149]

[0150] 1-4. Confirmation of Immortalization Gene and β-Globin Gene Insertion via PCR

[0151] PCR was performed to verify whether the nucleic acid construct of the present invention was accurately inserted into the AAVS1 locus within the genomic DNA of the cell lines selected in Examples 1-3 above. Genomic PCR was conducted using two pairs of oligonucleotide primers capable of amplifying the terminal regions of the inserted gene (donor DNA), and the primer sequences used are as follows:

[0152] AAVS1-F1: CCTGAGTCCGGACCACTTTGAGC (Sequence No.: 17);

[0153] AAVS1-R1: GAGGAAGAGTTCTTGCAGCTCG (Sequence No.: 18);

[0154] AAVS1-F2: AAAGCCTGGGGTGCCTAATG (Sequence No.: 19); and

[0155] AAVS1-R2: AAAAGGCAGCCTGGTAGACAG (Sequence No.: 20).

[0156] As a result of performing genomic PCR, a PCR band of 1162 bp was clearly detected in the reaction using the first primer pair (AAVS1-F1 / R1), and a PCR band of 1085 bp was clearly detected in the reaction using the second primer pair (AAVS1-F2 / R2) (Fig. 3). This result is consistent with the predicted DNA size, confirming that the immortalization gene and β-globin gene intended to be introduced in the present invention were accurately inserted (knock-in) into the AAVS1 locus.

[0157]

[0158] 1-5. Confirmation of Immortality Gene Control via Luciferase Analysis

[0159] In order to verify whether the immortalization gene (E6, E7) and reporter gene (Luciferase) inserted into the cell lines prepared in Examples 1-3 above are normally expressed in response to doxycycline treatment under the control of the TRE promoter, a Luciferase assay was performed.

[0160] As a result, it was confirmed that all induced pluripotent stem cells of the present invention exhibited high RLU (Relative Light Unit) values ​​under conditions treated with doxycycline (Fig. 4). This demonstrates that the immortalization gene and the β-globin gene were successfully introduced into the cells.

[0161] In particular, these results demonstrate that the expression of immortalization genes (HPV E6, HPV E7) can be selectively controlled using the doxycycline and rtTA system. That is, it means that during the production of therapeutic red blood cells, the adult hemoglobin (β-globin) gene can be kept activated to be always expressed (CAG promoter), while only the immortalization genes can be inactivated by removing doxycycline. This suggests that the safety mechanism designed to prevent side effects, such as cancer induction, which may occur upon implantation in the body, is functioning properly.

[0162]

[0163] Example 2. Preparation of hematopoietic stem cells into which immortalization gene and β-globin gene were introduced

[0164] 2-1. Preparation of Hematopoietic Stem Cells

[0165] Hematopoietic stem cells were induced using the induced pluripotent stem cells prepared in Example 1-1 above.

[0166] Specifically, 8×10 3 Canine induced pluripotent stem cells were seeded into 3 cm cell culture dishes coated with Matrigel® Basement Membrane Matrix (Corning®, Cat #356234) and cultured for 24 hours. Subsequently, ReLeSR TM Cells were separated into aggregates by treatment with (Stemcell Technologies, Cat #100-0483), and only aggregates with a diameter of 100-200 μm were selected.

[0167] Next, 40 to 80 selected aggregates were inoculated into 12-well cell culture dishes. STEMdiff was used to induce differentiation into hematopoietic stem cells. TM Medium A (STEMdiff) of the Erythroid Kit (Stemcell Technologies, Cat #100-0074) TMHematopoietic Basal Medium + STEMdiff TM The medium was replaced with Hematopoietic Supplement A and cultured for 72 hours (up to day 3). Subsequently, the medium was changed to medium E1 (STEMdiff TM Hematopoietic Basal Medium + STEMdiff TM The culture was replaced with Erythroid Supplement E1) and cultured for an additional 7 days, and the medium was changed on days 5 and 7.

[0168] The expression of hematopoietic stem cell surface antigens CD34, CD43, and CD45 in differentiated cells was analyzed using Fluorescence-Activated Cell Sorting (FACS).

[0169] After inoculating the aggregates and culturing for 24 hours, it was observed that 16 to 40 colonies were stably formed per well. Subsequently, flow cytometry was performed on the differentiated cells to confirm the expression of hematopoietic stem cell surface markers (CD34, CD43, CD45), thereby confirming that hematopoietic stem cells were successfully induced from induced pluripotent stem cells.

[0170]

[0171] 2-2. Preparation of a lentivirus nucleic acid construct for the transduction of immortalization genes and β-globin genes

[0172] A lentiviral vector was constructed to deliver the immortalization gene and the β-globin gene to the hematopoietic stem cells prepared in Example 2-1 above (Fig. 5). The construction process was carried out through several cloning steps.

[0173] First, the following primers were designed to amplify the β-globin gene, and PCR was performed:

[0174] AscI-β-globin F: 5'-GGCGCGCCGATGGTGCATCTGACTCCTG-3'(Sequence No.: 21); and

[0175] β-globin-HpaINotI R: 5'-GCGGCCGCGTTAACTTAGTGATACTTGTGGGCCAG-3' (Sequence No.: 22).

[0176] Subsequently, the amplified β-globin gene was linked to a TA cloning vector to construct the TA_AscI_β-globin_HpaINotI plasmid.

[0177] To introduce the rtTA gene, the TA_AscI_β-globin_HpaINotI plasmid and the TA_rtTA_partial_tTs_iCAS9 plasmid were treated with restriction enzymes AscI and NotI, and the DNA was purified and ligated to construct the TA_MfeI_rtTA_partial_β-globin_NotI plasmid.

[0178] To introduce the CAG promoter, the restriction enzymes ScaI and MfeI were applied to the TA_mcherry_iCAS9_CAG protomter_rtTA_tTSkid_Nluc plasmid and the TA_MfeI_rtTA_part_β-globin_NotI plasmid, and the DNA was purified and ligated to construct the TA_mcherry_iCAS9_CAG_rtTA_β-globin_NotI plasmid.

[0179] In addition, the following primers were designed to amplify the HPV16 E6E7 and CMV subsets from the CSIV-TRE-HPV16 E6E7-UBC-KT vector, and PCR was performed:

[0180] E7 partial F: 5'-Gatacacctacattgcatg-3'(Sequence No.: 23); and

[0181] XhoICMVSpeI R: 5'-ACTAGTCAATAATCAATGTCagatctcccgatctcgag-3' (Sequence No.: 24).

[0182] Subsequently, the TA_HPV16 E6E7_XhoI_CMV_SpeI plasmid was constructed by connecting a portion of the amplified HPV16 E6E7 and CMV to the TA cloning vector.

[0183] The TA_HPV16 E6E7_XhoI_CMV_SpeI plasmid and the TA-SacI-rtTA-MfeI-AscI-β-globin-NotI plasmid were treated with restriction enzymes SpeI and SalI, and the DNA was purified and ligated to construct the TA_HPV16 E6E7_CAG protmoer_rtTA_β-globin plasmid.

[0184] Finally, the CSIV-TRE-HPV16 E6E7-UbC-KT plasmid and the TA_HPV16 E6E7_CAG protmoer_rtTA_β-globin plasmid were treated with restriction enzymes XhoI and HpaI, and DNA purification and ligation processes were performed.

[0185] Through the above series of cloning processes, the CSIV-TRE-HPV16 E6E7-CAG-β-globin plasmid, a nucleic acid construct for lentivirus containing both the immortalization gene (HPV16 E6E7) and the β-globin gene, was successfully completed.

[0186]

[0187] 2-3. Preparation of β-globin gene-introduced hematopoietic stem cells using lentivirus

[0188] Next, the nucleic acid structure for lentivirus prepared in Example 2-2 above was packaged into actual virus particles, and an immortalization gene and a β-globin gene were introduced into hematopoietic stem cells using this.

[0189] To this end, a lentivirus was produced by commissioning the KIST Virus Facility to virally package a lentivirus construct containing an immortalization gene and a β-globin gene. Subsequently, the produced lentivirus was treated with pluripotent stem cell-derived hematopoietic stem cells or erythroblast progenitor cells to perform transduction.

[0190] Hematopoietic stem cells in which the immortalization gene and the β-globin gene were introduced into the cell were successfully produced through the above transfection process.

[0191]

[0192] 2-4. Confirmation of β-globin gene insertion via PCR

[0193] We wanted to verify whether the gene delivered via lentivirus was stably inserted into the genome of hematopoietic stem cells.

[0194] Specifically, 4 days after performing transfection on pluripotent stem cell-derived hematopoietic stem cells or erythrocyte progenitor cells in Examples 2-3 above, genomic DNA was extracted from the cells. Using the extracted DNA as a template, PCR was performed using two pairs of primers capable of specifically amplifying the rtTA gene among the transplanted genes (TRE-HPV-E6 / E7-CAGGS-rtTA-b-globin). The primer sequences used are as follows:

[0195] rtTA-F1: GAGGAACAGGAGCATCAAGTAG (Sequence No.: 25);

[0196] rtTA-R1: GTCAGCAGGCAGCATATCA (Sequence No.: 26);

[0197] rtTA-F4: GAGGAACAGGAGCATCAAGTAG (Sequence No.: 27); and

[0198] rtTA-R4: CAAGGTCAAAATCGTCAAGAG (Sequence No.: 28).

[0199] As a result, clear DNA bands were observed under all conditions of viral infection concentrations, MOI (Multiplicity of Infection) of 25, 50, and 100 (Fig. 6). Specifically, a band of 200 bp was identified in the rtTA-F1 / rtTA-R1 primer pair and a band of 300 bp was identified in the rtTA-F4 / rtTA-R4 primer pair. This confirmed that the β-globin gene was inserted into the hematopoietic stem cells of the present invention.

[0200]

[0201] Example 3. Confirmation of hematopoietic differentiation ability and β-globin expression of induced pluripotent stem cells introduced with immortalization gene and β-globin gene

[0202] 3-1. Induction of differentiation into hematopoietic stem cells / erythroblast progenitor cells

[0203] In order to confirm whether the induced pluripotent stem cells (hereinafter referred to as 'AEβ cell line') prepared in Example 1 above, into which the immortalization gene and the β-globin gene were introduced, have the ability to differentiate into actual hematopoietic stem cells and red blood cells and express β-globin, a comparative experiment was performed with wild-type induced pluripotent stem cells (WT iPSC) as a control.

[0204] The specific differentiation induction process is as follows.

[0205] First, AEβ cell lines and WT cell lines were each 8×10 3 Individual samples were prepared and inoculated into 3 cm cell culture dishes coated with Matrigel® Basement Membrane Matrix (Corning®, Cat #356234), and cultured for 24 hours. Subsequently, ReLeSR TMCells were treated with (STEMCELL Technologies, Cat #100-0483) to separate them into colonies / aggregates rather than single cells, and aggregates with a diameter of approximately 100–200 μm were selected. Approximately 40–80 selected aggregates were dispensed into 12-well cell culture dishes and settled.

[0206] Differentiation into hematopoietic stem cell and erythrocyte lineages is STEMdiff TM Induction was performed stepwise using the Erythroid Kit (STEMCELL Technologies, Cat #100-0074) (Fig. 7). 1) Initial differentiation induction (Day 0-3): The medium in the culture dish was medium A (STEMdiff TM Hematopoietic Basal Medium + STEMdiff TM The medium was replaced with Hematopoietic Supplement A and cultured for 72 hours. 2) Hematopoietic Stem Cell Proliferation and Differentiation (Day 3-10): On day 3 of differentiation, the medium was changed to medium E1 (STEMdiff TM Hematopoietic Basal Medium + STEMdiff TM The medium was switched to Erythroid Supplement E1 and cultured for an additional 7 days. During this time, the medium was replaced with fresh E1 medium on days 5 and 7 of differentiation, respectively. 3) Erythroblast cell maturation (Day 10-22): From day 10 of differentiation, the medium was changed to medium E2 (STEMdiff TM Hematopoietic Basal Medium + STEMdiff TM The suspension cells were replaced with Erythroid Supplement E2, and the suspended cells were harvested and cultured for an additional 12 days to induce maturation into erythroblasts.

[0207] As a result of inducing differentiation of AEβ cell lines and WT cell lines according to the above method, it was confirmed that both cell lines stably formed aggregates during the early stages of differentiation. Specifically, when aggregates were dispensed into a 12-well culture dish and observed after 24 hours, it was confirmed that approximately 16 to 40 colonies were formed per well and attached to the culture vessel.

[0208] Subsequently, proliferation continued during the stepwise differentiation protocol using medium A, medium E1, and medium E2, and floating cells were observed during the medium exchange process. This suggests that the AEβ cell line maintains differentiation ability and viability to differentiate into hematopoietic stem cells and erythroblast progenitor cells, similar to general induced pluripotent stem cells, despite the introduction of immortality genes and β-globin genes.

[0209]

[0210] 3-2. Confirmation of differentiation into hematopoietic stem cells / erythroblast progenitor cells

[0211] In order to verify whether the cells differentiated by the method of Example 3-1 above actually differentiated into cells having the characteristics of hematopoietic stem cells and erythroblast progenitor cells, stepwise cell surface antigen expression was confirmed through flow cytometry.

[0212] Specifically, cells harvested on day 10 (D10) after differentiation induction were stained using antibodies against CD34 and CD43, which are markers for hematopoietic stem cells and early progenitor cells. Additionally, cells harvested on day 17 (D17) after differentiation induction were stained using antibodies against CD71 (Transferrin receptor) and CD235 (Glycophorin A), which are markers for erythroblasts, and then analyzed using a FACS instrument. In this case, AEβ cell lines were used for the experimental group, and WT iPSC-derived differentiated cells were used as the control group.

[0213] Flow cytometry results showed that CD34-positive (+) and CD43-positive (+) phenotypes characteristic of hematopoietic stem cells were observed in both AEβ and WT cell lines at differentiation day 10 (D10). + / CD43 + A dual-positive cell population (early hematopoietic stem progenitor cells) was observed. In addition, analysis of cells on day 17 of differentiation (D17) revealed that both cell lines exhibited CD71-positive (+) and CD235-positive (+) phenotypes characteristic of erythrocyte progenitor cells. + / CD235 + A distinct double positive cell group was observed.

[0214] These results indicate that the introduction of immortalization genes and β-globin genes does not have a negative effect on the hematopoietic differentiation ability of induced pluripotent stem cells. In other words, it was confirmed that the AEβ cell line of the present invention undergoes an initial hematopoietic stem cell stage and is induced to differentiate normally into erythroblast progenitor cells at a level equivalent to that of the wild-type cell line.

[0215]

[0216] 3-3. Analysis of β-globin and γ-globin expression in differentiated hematopoietic stem cells / erythroblast progenitor cells

[0217] Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to determine whether the red blood cell progenitor cells identified in Example 3-2 above express β-globin, a component of actual adult hemoglobin, and whether there is a change in the expression pattern of γ-globin, which is fetal hemoglobin.

[0218] Specifically, suspension cells were collected from the culture media of the AEβ cell line and the WT cell line, respectively, on day 17 after differentiation induction (D17). Total RNA was extracted from the collected cells using NucleoSpin RNA, Mini kit for RNA purification (Macherey-Nagel, Cat#740955.50), and cDNA was synthesized using the extracted RNA as a template with ReverTra Ace qPCR RT Master Mix (TOYOBO, cat#FSQ-201). The expression levels of the β-globin (HbB) and γ-globin (HbG) genes were analyzed using the synthesized cDNA, with the GAPDH gene used as an internal control. The expression levels of each gene were calculated as relative values ​​after adjusting the expression levels of the WT cell line to 1. The primer sequences used in this analysis are as follows:

[0219] β-globin F: 5'-CAGGCTGCTGGTGGTCTAC-3'(Sequence No. 29);

[0220] β-globin(HbB)_Reverse: 5'-GCCATGAGCCTTCACCTTAG-3'(Sequence No. 30);

[0221] γ-globin F: 5'-TGGGTCATTTCACAGAGGAG-3'(Sequence No. 31);

[0222] γ-globin R: 5'-AGACAACCAGGAGCCTTCC-3'(Sequence No. 32);

[0223] GAPDH F: 5'-GAGTCAACGGATTTGGTCGT-3'(Sequence No. 33);

[0224] GAPDH R: 5'-TTGATTTTGGAGGGATCTCG-3'(Sequence No. 34).

[0225] As a result of qRT-PCR analysis, it was confirmed that the relative expression level of β-globin (HBB), an adult-type globin, in the AEβ cell line of the present invention was statistically significantly increased compared to the control WT cell line. Specifically, the β-globin expression level in the AEβ cell line was found to be about 1.3 times higher than that of the WT cell line. This means that the introduced β-globin gene functions normally within differentiated erythroblast progenitor cells to promote the synthesis of adult-type hemoglobin.

[0226] On the other hand, in the case of fetal globin, γ-globin (HbG), expression was detected in both cell lines, but the expression level in the AEβ cell line was significantly lower, at about 0.2 times the level of the WT cell line.

[0227] Generally, induced pluripotent stem cell-derived red blood cells have the limitation of mainly containing fetal hemoglobin (HbF) rather than adult hemoglobin (HbA); however, the above results suggest that the AEβ cell line of the present invention has the characteristic that the expression of fetal hemoglobin is suppressed and the expression of adult hemoglobin becomes dominant during the erythroblast differentiation process. Therefore, it has been confirmed that the cell line of the present invention is a suitable platform for producing adult red blood cells with high oxygen transport efficiency in vitro.

[0228]

[0229] In conclusion, the cell line for producing red blood cells into which the immortalization gene and β-globin gene of the present invention have been introduced can stably and efficiently produce red blood cells containing a large amount of HbA in vitro, thereby enabling a stable supply of red blood cells for transfusion and effectively resolving the problem of blood shortage and transfusion side effects.

Claims

1. A nucleic acid structure comprising: an immortalization region containing an immortalization gene; and a hemoglobin region containing a gene encoding β-globin.

2. In Claim 2, The above immortalization gene is a nucleic acid construct encoding one or more proteins selected from the group consisting of HPV (human papillomavirus) E6, HPV E7, c-MYC, BCL-XL, SV40, hTERT, EBV, MycT58A, RasV12 and p53.

3. In Claim 2, The above immortalization gene is a nucleic acid structure that is a gene encoding HPV16 E6 and a gene encoding HPV16 E7.

4. In Claim 1, The above immortalization region further includes an inducible promoter, and A nucleic acid structure in which the inducible promoter is operably linked to the immortalization gene.

5. In Claim 4, The above-mentioned inducible promoter is a nucleic acid construct that is a TRE (tetracycline-responsive element) promoter.

6. In Claim 4, The above nucleic acid structure is a nucleic acid structure that further comprises an expression regulatory region containing a gene encoding a transcription regulator.

7. In Claim 6, The above transcription regulator is a nucleic acid construct selected from the group consisting of rtTA (reverse tetracycline-transactivator), tTA (tetracycline-transactivator), CymR (cumate repressor), VgEcR (Ecdysone receptor), and GLp65 (gene-linked p65).

8. In Claim 1, The above hemoglobin region further includes a constitutive promoter, and A nucleic acid structure in which the constitutive promoter is operably linked to the gene encoding the β-globin.

9. In Claim 8, The above-mentioned constitutive promoter is a nucleic acid construct that is a CAG promoter or a CAGGS promoter.

10. A vector comprising the nucleic acid structure of Claim 1.

11. A cell line for producing red blood cells comprising the nucleic acid structure of Claim 1 or the vector of Claim 10.

12. In Claim 11, The cell line is a cell line selected from the group consisting of pluripotent stem cells, hematopoietic stem cells, and erythroblast progenitor cells.

13. In Claim 11, The above red blood cells are a cell line that expresses HbA (Adult type hemoglobin).

14. In Claim 11, The above cell line is a cell line that possesses erythrocyte differentiation ability and cell proliferation ability.

15. In Claim 11, The cell line is a cell line in which the expression of β-globin increases and the expression of γ-globin decreases compared to a wild-type cell line.

16. A method for producing a cell line for producing red blood cells, comprising the step of transforming the nucleic acid structure of claim 1 or the vector of claim 10 into a cell capable of differentiating into red blood cells.

17. In Claim 16, A method for manufacturing in which the cell having the ability to differentiate into red blood cells is selected from the group consisting of pluripotent stem cells, hematopoietic stem cells, and erythroblast progenitor cells.

18. A method for producing erythrocytes in vitro, comprising the step of differentiating the cell line of claim 11 into erythrocytes.

19. In Claim 18, A method of production in which the above red blood cells express HbA.

20. In Claim 18, The above production method further comprises a step of proliferating the cell line prior to the differentiation step.

Images