Method for producing magea3-fc transgenic plant

A recombinant vector for plant expression of MAGEA3-Fc fusion protein using Agrobacterium-mediated transformation addresses the challenges of high expression and stability, providing cost-effective and scalable protein production.

WO2026135160A1PCT designated stage Publication Date: 2026-06-25CHUNG ANG UNIV IND ACADEMIC COOP FOUND
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
CHUNG ANG UNIV IND ACADEMIC COOP FOUND
Filing Date
2025-12-16
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Existing methods for producing therapeutic proteins, such as MAGEA3-Fc fusion proteins, face challenges in achieving high expression efficiency and stability, particularly in microbial or animal cell-based systems, which are costly and lack scalability.

Method used

A recombinant vector is developed for plant expression of the MAGEA3-Fc fusion protein using Agrobacterium-mediated transformation, enabling stable insertion into the plant genome and high-level protein production, with the ability to isolate and purify the protein from transgenic plants.

Benefits of technology

The method achieves high expression and stable production of MAGEA3-Fc fusion protein in plants, offering economic efficiency and scalability, surpassing the limitations of traditional systems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025021859_25062026_PF_FP_ABST
    Figure KR2025021859_25062026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a method for producing a MAGEA3-Fc transgenic plant, and enables, through a platform using a tobacco plant, stable expression of a recombinant protein MAGEA3-Fc in which a human IgG Fc fragment is fused to a MAGEA3 protein. The method of the present invention enables high-level expression efficiency and stable protein production by using an Agrobacterium binary vector to introduce a target gene into a plant genome. The present invention enables recombinant proteins to be readily produced on a large scale through direct isolation and purification from transgenic tobacco plants, and is more economical and scalable than conventional microbial or animal cell-based expression systems, and thus can be effectively used as a fusion protein production platform.
Need to check novelty before this filing date? Find Prior Art

Description

Method for producing MAGEA3-FC transgenic plants

[0001] The present invention relates to a method for producing MAGEA3-Fc transgenic plants.

[0002] The present application claims priority to Korean Patent Application No. 10-2024-0188200 filed on December 17, 2024 and Korean Patent Application No. 10-2025-0141827 filed on September 30, 2025, and the entire specification is a reference to the present application.

[0003] Fusion proteins are a technical approach that realizes complex biological activities within a single protein by artificially linking protein domains of different origins or functions. This strategy is widely used to enhance protein stability, solubility, pharmacological half-life, and target specificity. In particular, fusions combining proteins with immunological activity with other functional proteins hold high potential for application as therapeutic agents, diagnostic agents, and vaccine platforms.

[0004] In the design of fusion proteins, the hinge region and the bonding method are important factors that determine the protein's three-dimensional structure and biological activity. Conjugating stabilizing proteins, such as the Fc domain, not only increases expression efficiency but also significantly extends the half-life in vivo. Therefore, fusion protein technology is overcoming the limitations of existing protein therapeutics and establishing itself as a core foundational technology for the development of new biological agents.

[0005] Meanwhile, heterologous protein expression technology using plants offers unique advantages over existing microbial or animal cell-based systems in terms of cost-effectiveness and scalability. Plant cells can perform complex post-translational modifications typical of eukaryotes, allowing for the maintenance of the quality and activity of therapeutic proteins. Furthermore, since mass production is possible through large-scale cultivation, they are gaining attention as a cost-effective protein production platform.

[0006] In particular, Agrobacterium-mediated transformation technology has been established as a standard approach for the stable insertion of target genes into plant genomes. Transformed plants can express target proteins in various tissues, such as leaves, stems, and seeds, and the proteins isolated and purified through this process are utilized for industrial and therapeutic purposes. For this reason, plant-based expression systems are emerging as an important alternative platform for the development of next-generation protein drugs.

[0007] The object of the present invention is to provide a recombinant vector for plant expression of a MAGEA3-Fc fusion protein comprising a nucleotide sequence encoding a MAGEA3-Fc fusion protein (MAGEA3-immunoglobulin Fc fusion protein).

[0008] Another objective of the present invention is to provide a recombinant cell into which the recombinant vector for plant expression of the MAGEA3-Fc fusion protein is introduced.

[0009] Another objective of the present invention is to provide a transgenic plant transformed with a recombinant vector for plant expression of the MAGEA3-Fc fusion protein.

[0010] Another objective of the present invention is to provide a transformed seed of a plant according to the above.

[0011] Another object of the present invention is to provide a method for producing a MAGEA3-Fc fusion protein comprising the following steps:

[0012] A step of introducing the above recombinant vector into a recombinant cell;

[0013] A step of introducing the above recombinant cell into a plant to transform the plant; and

[0014] A step of expressing a MAGEA3-Fc fusion protein from the above-mentioned transgenic plant, and then isolating and purifying the expressed MAGEA3-Fc fusion protein.

[0015] Another objective of the present invention is to provide a kit for producing a MAGEA3-Fc fusion protein, comprising a recombinant vector for plant expression of the MAGEA3-Fc fusion protein and instructions.

[0016] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art to which the present invention belongs from the description below.

[0017] The present invention provides a recombinant vector for plant expression of a MAGEA3-Fc fusion protein comprising a nucleotide sequence encoding a MAGEA3-Fc fusion protein (MAGEA3-immunoglobulin Fc fusion protein).

[0018] In one embodiment of the present invention, the MAGEA3-Fc fusion protein may include any one amino acid sequence selected from the group consisting of SEQ ID NO. 16 and SEQ ID NO. 17, but is not limited thereto.

[0019] In one embodiment of the present invention, the nucleotide sequence encoding the MAGEA3-Fc fusion protein may include any one nucleotide sequence selected from the group consisting of SEQ ID NOs 13 to 15, but is not limited thereto.

[0020] In one embodiment of the present invention, the recombinant vector may further include one or more nucleotide sequences selected from the group consisting of restriction enzyme recognition sequences, expression regulation sequences, signal sequences, and hinge sequences in an operable order, but is not limited thereto.

[0021] In one embodiment of the present invention,

[0022] The above restriction enzyme recognition sequence is one or more selected from the group consisting of HindIII, NcoI, BamHI, EcoRI, XhoI, SalI, NotI, PstI, SpeI, XbaI, and KpnI;

[0023] The above expression regulatory sequence is one or more promoters or terminators selected from the group consisting of E / 35S-P (CaMV 35S promoter with enhancer; Cauliflower mosaic virus 35S promoter with enhancer), NOS-T (Nopaline synthase terminator), Ubiquitin promoter (Ubi-P; Ubiquitin promoter), Actin promoter, FMV promoter (Figwort mosaic virus promoter), 2x35S promoter (Double CaMV 35S promoter), OCS terminator (Octopine synthase terminator), HSP terminator (Heat shock protein terminator), RBCL terminator (Ribulose-1,5-bisphosphate carboxylase / oxygenase large subunit terminator), CMV promoter (Cytomegalovirus promoter), and EF1α promoter (Elongation factor 1 alpha promoter);

[0024] The above signal sequence is one or more selected from the group consisting of SP (Signal peptide), KDEL (Lys-Asp-Glu-Leu), PR1a signal peptide (Pathogenesis-related protein 1a signal peptide), Calreticulin signal peptide (Calreticulin-derived signal peptide), SEKDEL (Ser-Glu-Lys-Asp-Glu-Leu), HDEL (His-Asp-Glu-Leu), and OST signal peptide (Oligosaccharyltransferase signal peptide); and

[0025] The above hinge sequence may be one or more selected from the group consisting of IgG1 hinge (IgG1 hinge region), IgG4 hinge (IgG4 hinge region), IgG2 hinge (IgG2 hinge region), and IgG3 hinge (IgG3 hinge region), but is not limited thereto.

[0026] In one embodiment of the present invention, the recombinant vector may include any one base sequence selected from the group consisting of SEQ ID NO. 19 and SEQ ID NO. 21, but is not limited thereto.

[0027] The present invention provides a recombinant cell into which a recombinant vector for plant expression of the above MAGEA3-Fc fusion protein is introduced.

[0028] The present invention provides a transgenic plant transformed with a recombinant vector for plant expression of the above MAGEA3-Fc fusion protein.

[0029] The present invention provides a transformed seed of a plant according to the above.

[0030] The present invention provides a method for producing a MAGEA3-Fc fusion protein comprising the following steps:

[0031] A step of introducing the above recombinant vector into a recombinant cell;

[0032] A step of introducing the above recombinant cell into a plant to transform the plant; and

[0033] A step of expressing a MAGEA3-Fc fusion protein from the above-mentioned transgenic plant, and then isolating and purifying the expressed MAGEA3-Fc fusion protein.

[0034] The present invention provides a kit for producing a MAGEA3-Fc fusion protein, comprising a recombinant vector for plant expression of the MAGEA3-Fc fusion protein and instructions.

[0035] In addition, the present invention provides the use of the MAGEA3-Fc fusion protein for transformation in any one or more plants selected from the group consisting of recombinant cells into which the recombinant vector; and the recombinant vector for plant expression of the MAGEA3-Fc fusion protein are introduced.

[0036] In addition, the present invention provides a use for preparing a preparation for the transformation of a MAGEA3-Fc fusion protein into any one or more plants selected from the group consisting of the recombinant vector; and recombinant cells into which the recombinant vector for plant expression of the MAGEA3-Fc fusion protein has been introduced.

[0037] In addition, the present invention provides a use for producing a MAGEA3-Fc fusion protein using the recombinant vector; a recombinant cell into which the recombinant vector for plant expression of the MAGEA3-Fc fusion protein has been introduced; a transgenic plant transformed with the recombinant vector for plant expression of the MAGEA3-Fc fusion protein; or a seed of the plant transformed according to the above.

[0038] In addition, the present invention provides a use for producing a preparation for producing a MAGEA3-Fc fusion protein of the recombinant vector; a recombinant cell into which the recombinant vector for plant expression of the MAGEA3-Fc fusion protein has been introduced; a transgenic plant transformed with the recombinant vector for plant expression of the MAGEA3-Fc fusion protein; or a seed of the plant transformed according to the above.

[0039] According to the method for preparing MAGEA3-Fc transgenic plants, the recombinant protein MAGEA3-Fc, in which a human IgG Fc fragment is fused to the MAGEA3 protein, can be stably expressed through a platform utilizing tobacco plants. The method of the present invention enables high-level expression efficiency and stable protein production by introducing a target gene into the plant genome using an Agrobacterium binary vector. Since mass production can be easily achieved by directly isolating and purifying the recombinant protein from the transgenic tobacco plants, it can be usefully utilized as a fusion protein production platform in that it offers economic efficiency and scalability compared to existing microbial or animal cell-based expression systems.

[0040] Figure 1 shows the entire process of transforming a tobacco plant using the MAGEA3-Fc fusion protein expression vector of the present invention.

[0041] Figure 2a shows a schematic design of the MAGEA3-Fc fusion protein expression vector of the present invention.

[0042] Figure 2b shows a schematic diagram of the structure of the MAGEA3-Fc fusion protein of the present invention.

[0043] Figure 2c shows the results of confirming gene insertion of the pBINPLUS vector and the MAGEA3-Fc fusion protein expression vector via electrophoresis (M: DNA marker, V: pBINPLUS vector, I: MAGEA3-Fc fusion protein expression vector, S1: pBINPLUS vector + MAGEA3-Fc fusion protein expression vector).

[0044] Figures 3a and 3b show the results of confirming the expression of MAGEA3-Fc fusion protein in transgenic tobacco plants.

[0045] Figure 4 shows the results of identifying the gene of the MAGEA3-Fc fusion protein introduced into the transgenic tobacco plant.

[0046] Figure 5a shows the results of confirming the gene insertion of the pBINPLUS vector and the MAGEA9-Fc fusion protein via electrophoresis (M: DNA marker, V: pBINPLUS vector, I: MAGEA9-Fc fusion protein expression vector, S1: pBINPLUS vector + MAGEA9-Fc fusion protein expression vector).

[0047] Figures 5b and 5c show the results of confirming MAGEA9-Fc expression and gene introduction in MAGEA9-Fc transgenic tobacco plants.

[0048] In the present invention, a recombinant vector for plant expression was constructed for high expression of the MAGEA3-Fc fusion protein gene, and it was verified that high expression of the MAGEA3-Fc fusion protein is possible by transforming plants using this vector (Fig. 1). The experimental methods to confirm this are as described in Examples 1 to 3. Furthermore, in Examples 4 and 5, it was proven that the MAGEA3-Fc fusion protein was expressed in the transformed plants produced using the above vector, and that the gene was introduced into the plant transformants. In addition, in Example 6, it was confirmed that the vector using such an Fc region sequence is specific to MAGEA3 by comparative analysis targeting MAGEA9.

[0049] Accordingly, the present invention provides a MAGEA3-Fc fusion protein comprising a MAGEA3 protein (Melanoma Antigen Family A, 3) and an immunoglobulin Fc (fragment crystallizable) region.

[0050] In addition, the present invention provides a recombinant vector for plant expression of a MAGEA3-Fc fusion protein comprising a nucleotide sequence encoding a MAGEA3-Fc fusion protein (MAGEA3-immunoglobulin Fc fusion protein).

[0051] In the present invention, “recombinant vector” or “recombinant expression vector” refers to a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. Generally, any plasmid and vector may be used if they can replicate and stabilize within a host. The recombinant expression vector of the present invention may preferably include a promoter, which is a transcription initiation factor to which RNA polymerase binds; any operator sequence for regulating transcription; a sequence encoding a suitable mRNA ribosome binding site; a sequence regulating the termination of transcription and translation; a terminator, etc.

[0052] In the present invention, an expression vector comprising a recombinant expression vector and a suitable transcriptional or translational regulatory signal may be constructed by methods known to those skilled in the art. Such methods may include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombinant techniques, but are not limited to specific techniques.

[0053] The recombinant expression vector may additionally include a tag gene for increasing the production of the recombinant protein, a tag gene for maintaining the structural stability of the recombinant protein, a tag gene for easily isolating the recombinant protein, and a selection marker gene such as an antibiotic resistance gene for selecting transformants, and tags for easy isolation may include, but are not limited to, Avi tag, Calmodulin tag, polyglutamate tag, E tag, FLAG tag, HA tag, His tag, Myc tag, S tag, SBP tag, IgG-Fc tag, CTB tag, Softag 1 tag, Softag 3 tag, Strep tag, TC tag, V5 tag, VSV tag, Xpress tag, etc. In addition, representative marker genes for screening may include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol, and aadA genes, but are not limited thereto.

[0054] An example of a recombinant vector of the present invention is a Ti-plasmid vector capable of transferring a portion of itself, the so-called T-region, into a plant cell when present in a suitable host. Other types of Ti-plasmid vectors are currently used to transfer hybrid DNA sequences into plant cells or protoplasts from which new plants can be produced by appropriately inserting the hybrid DNA into the plant genome. A particularly preferred form of a Ti-plasmid vector is a so-called binary vector as claimed in EP 0120 516B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce DNA according to the present invention into a plant host may be selected from viral vectors, such as those derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, Gemini viruses, etc., such as incomplete plant viral vectors. The use of such vectors may be advantageous, particularly when it is difficult to appropriately transform the plant host.

[0055] In the present invention, the “Fc region (Fragment crystallizable region)” is a protein region of a constant structure located at the C-terminus of an immunoglobulin G (IgG) molecule, corresponding to the constant region of an antibody. The Fc region binds to an Fc receptor or a complement protein to mediate immune effector functions such as antibody-dependent cytotoxicity (ADCC) or complement-dependent cytotoxicity (CDC). Additionally, the Fc region can provide advantages such as conferring stability during fusion protein design, extending the blood half-life, and facilitating purification through protein A / G affinity chromatography.

[0056] In the present invention, the immunoglobulin Fc may refer to the Fc of IgG, but is not limited thereto.

[0057] In the present invention, the “Fc fusion protein” is a specific protein with an immunoglobulin domain directly attached, which can increase its half-life by avoiding degradation in lysosomes due to interaction with the Fc receptor (FcRn), thereby extending therapeutic activity and ultimately improving the tumor microenvironment and enhancing utility in vaccines.

[0058] In the present invention, “MAGEA3 (Melanoma Antigen Family A, 3)” is a tumor antigen that exhibits cancer-specific expression, and is known to be suppressed in normal tissues but specifically expressed in various cancer cells.

[0059] In the present invention, the “MAGEA3-Fc fusion protein” may be a single continuous polypeptide in which the Fc region of human immunoglobulin G is fused with the full length or a functional fragment that retains antigenicity of human melanoma-associated antigen A3 (MAGE-A3). As a type of configuration for fusion, it may include both forms of MAGEA3-linker-Fc or Fc-linker-MAGEA3. In this case, the linker may include any linker generally applicable in the art, for example, a Gly-Gly-Gly-Gly-Ser repeat linker. Additionally, it may further include a secretion signal sequence as needed. The Fc region may be designed to provide conventional Fc functions, such as dimerization ability via disulfide bonds and binding to the Fc receptor or complement. Furthermore, it may include, but is not limited to, isoforms, glycosylated variants, and conservatively substituent variants such as IgG2 or IgG4, provided that functional equivalence is maintained. The above MAGEA3 portion may include conservative substitutions, cleavages, or codon-optimized variants within a range that maintains immunogenicity or epitope recognition. The definition of the present invention includes all polypeptides produced in any expression system, such as plant, bacterial, yeast, insect, or mammalian cells, and may encompass all proteins in which the MAGEA3 antigen domain and the human Fc region are fused into a single ORF to exhibit functional characteristics, regardless of the presence or absence of a label tag, glycosylation status, terminal processing, or reduction / non-reduction status.

[0060] In one embodiment of the present invention, the MAGEA3-Fc fusion protein may comprise any one amino acid sequence selected from the group consisting of SEQ ID NO. 16 and SEQ ID NO. 17, but is not limited thereto. Here, SEQ ID NO. 16 corresponds to a mature protein that does not contain a signal peptide (SP) sequence, and SEQ ID NO. 17 corresponds to a precursor protein that contains an SP sequence at the N-terminus. That is, since it is obvious in the art that the SP sequence is cleaved during the usual translation and processing process, both the precursor containing the SP sequence and the mature protein from which the SP sequence has been removed may be included.

[0061] Accordingly, the fusion protein of the present invention may include both a precursor state in which an SP sequence is present and a mature protein state in which an SP sequence is cleaved, and the present invention may include within its technical scope a fusion protein composed of the same MAGEA3 and Fc regions regardless of the presence or absence of an SP sequence. Furthermore, in the present invention, the term “MAGEA3-Fc fusion protein” may include all functionally equivalent variants regardless of the presence or absence of a signal peptide, the degree of cleavage, N-terminal / terminal processing, glycosylation state, and the addition or removal of linkers / tags. Furthermore, it may include a precursor with an attached SP, a mature product in which an SP is completely or partially cleaved, and intermediates between these.

[0062] In the present invention, the MAGEA3-Fc fusion protein may comprise a recombinant antigen protein in which a mutation has occurred in at least one amino acid of the polypeptide representing it. The mutation may include substitution, deletion, or addition of amino acids, but preferably includes substitution. The yield of the antigen may be increased due to the substitution of the amino acid sequence of the polypeptide. The term "substitution" means that an existing amino acid sequence is replaced with a different amino acid sequence. At least one amino acid may be substituted, preferably 1 to 11 amino acids may be substituted, for example, 2 to 10 amino acids may be substituted with other amino acids, and another example is that 9, 8, 7, 6, 5, 4, 3, or 2 amino acids may be substituted.

[0063] In one embodiment of the present invention, the nucleotide sequence encoding the MAGEA3-Fc fusion protein may include any one nucleotide sequence selected from the group consisting of SEQ ID NOs 13 to 15, but is not limited thereto. In the present invention, the “nucleotide sequence encoding the MAGEA3-Fc fusion protein” may be used interchangeably with the “gene of the MAGEA3-Fc fusion protein,” or the “MAGEA3-Fc gene.”

[0064] As described above, SEQ ID NO. 13 is synthesized without a precursor signal because there is no SP at the N-terminus of the translation product, and at the amino acid level, it may correspond to a mature form lacking SP, and the amino acid sequence of the MAGEA3-Fc fusion protein in this case may be represented as SEQ ID NO. 16. Additionally, SEQ ID NO. 14 and SEQ ID NO. 15 are synthesized as precursors containing SP during translation, and since SP can be cleaved by a signal peptidase after co-translational transfer to the ER, the amino acid sequence of the MAGEA3-Fc fusion protein in this case may be represented as SEQ ID NO. 17. Accordingly, in one embodiment of the present invention, the nucleotide sequence encoding the MAGEA3-Fc fusion protein represented by SEQ ID NO. 16 among the MAGEA3-Fc fusion proteins may include the nucleotide sequence of SEQ ID NO. 13, and the nucleotide sequence encoding the MAGEA3-Fc fusion protein represented by SEQ ID NO. 17 may include any one nucleotide sequence selected from the group consisting of SEQ ID NO. 14 and SEQ ID NO. 15, but is not limited thereto.

[0065] In the present invention, SEQ ID NO 15 may include a linker sequence between the sequences prior to the stop codon, and said sequence may be located between each sequence constituting SEQ ID NO 15 of Table 1, but is not limited thereto.

[0066] In the present invention, a schematic diagram of the MAGEA3-Fc fusion protein is as shown in FIG. 2b, and may additionally include a hinge region, a linker connecting the KDEL configuration, etc., if necessary, but is not limited thereto. In one embodiment of the present invention, the recombinant vector may further include one or more nucleotide sequences selected from the group consisting of a restriction enzyme recognition sequence, an expression regulation sequence, a signal sequence, and a hinge sequence in an operable order, but is not limited thereto.

[0067] Accordingly, the recombinant vector according to the present invention may include a base sequence encoding the MAGEA3-Fc fusion protein or a base sequence encoding the MAGEA3-Fc fusion protein, wherein, if necessary, a base sequence additionally including a hinge region, a linker connecting the KDEL configuration, etc., is connected in an operable order with one or more base sequences selected from the group consisting of a restriction enzyme recognition sequence, an expression regulation sequence, a signal sequence, and a hinge sequence.

[0068] More specifically, it may include any one base sequence selected from the group consisting of SEQ ID NOs 13 to 15 being connected in an operable order to any one or more base sequences selected from the group consisting of restriction enzyme recognition sequences, expression regulation sequences, signal sequences, and hinge sequences.

[0069] At this time, the term "base sequence of each sequence" may mean a base sequence representing each component; or a base sequence encoding an amino acid sequence representing each component. For example, in the present invention, the term "base sequence of the hinge sequence" may include not only the base sequence of the hinge sequence of the present invention, but also a base sequence encoding an amino acid sequence representing the hinge sequence.

[0070] In the present invention, a “restriction enzyme recognition sequence” refers to a unique nucleotide sequence that can be recognized and cleaved by a specific restriction enzyme, and facilitates the insertion, removal, and cloning of a target gene in recombinant DNA technology.

[0071] By including a selected restriction enzyme recognition sequence in a recombinant vector, the introduction and replacement of the desired expression cassette can be performed precisely. Such sequences maximize cloning efficiency and enable modular utilization across various vector backbones. Therefore, the restriction enzyme recognition sequence presented in this invention provides a foundation for simultaneously ensuring the reproducibility and universality of genetic manipulation.

[0072] In the present invention, the “expression regulatory sequence” refers to a nucleic acid sequence, such as a promoter, enhancer, and terminator, included to regulate the transcription initiation, elongation, and termination processes of a target gene.

[0073] Expression regulatory sequences act as key factors inducing high levels of transcriptional activity within plant cells or conferring stability to expressed transcripts. The selection of promoters and terminators is considered a critical variable determining protein expression levels, tissue specificity, and expression persistence. The expression regulatory sequences used in this invention provide an optimal molecular environment for maintaining the expression of a target protein at a stable and high level.

[0074] In the present invention, “signal sequence” refers to a peptide sequence for inducing the transport of an expressed protein to an intracellular location or organelle, or for retaining the protein in a specific intracellular compartment.

[0075] Signal sequences serve to ensure that expressed proteins are accurately transported to specific locations within the cell, such as organelles, secretory pathways, or the endoplasmic reticulum. These sequences contribute to guaranteeing physiological activity by inducing structural stability and proper folding of the protein. Therefore, the signal sequences presented in this invention are essential elements for ensuring the quality and functional integrity of recombinant proteins.

[0076] In the present invention, a “hinge sequence” refers to an amino acid sequence that provides a flexible structure connecting two domains in a fusion protein, thereby ensuring the structural stability and physiological functionality of the protein.

[0077] Hinge sequences provide sufficient flexibility between individual domains of fusion proteins, thereby preventing spatial collisions and facilitating functional interactions between proteins. In particular, when an antibody Fc region binds to an antigen protein, the hinge sequence plays a crucial role in ensuring stable expression and unique structural orientation. In the present invention, the hinge sequence functions as a key component of the molecular design to maximize the mechanistic efficacy of the fusion protein.

[0078] In one embodiment of the present invention,

[0079] The above restriction enzyme recognition sequence is one or more selected from the group consisting of HindIII, NcoI, BamHI, EcoRI, XhoI, SalI, NotI, PstI, SpeI, XbaI, and KpnI;

[0080] The above expression regulatory sequence is one or more promoters or terminators selected from the group consisting of E / 35S-P (CaMV 35S promoter with enhancer; Cauliflower mosaic virus 35S promoter with enhancer), NOS-T (Nopaline synthase terminator), Ubiquitin promoter (Ubi-P; Ubiquitin promoter), Actin promoter, FMV promoter (Figwort mosaic virus promoter), 2x35S promoter (Double CaMV 35S promoter), OCS terminator (Octopine synthase terminator), HSP terminator (Heat shock protein terminator), RBCL terminator (Ribulose-1,5-bisphosphate carboxylase / oxygenase large subunit terminator), CMV promoter (Cytomegalovirus promoter), and EF1α promoter (Elongation factor 1 alpha promoter);

[0081] The above signal sequence is one or more selected from the group consisting of SP (Signal peptide), KDEL (Lys-Asp-Glu-Leu), PR1a signal peptide (Pathogenesis-related protein 1a signal peptide), Calreticulin signal peptide (Calreticulin-derived signal peptide), SEKDEL (Ser-Glu-Lys-Asp-Glu-Leu), HDEL (His-Asp-Glu-Leu), and OST signal peptide (Oligosaccharyltransferase signal peptide); and

[0082] The above hinge sequence may be one or more selected from the group consisting of IgG1 hinge (IgG1 hinge region), IgG4 hinge (IgG4 hinge region), IgG2 hinge (IgG2 hinge region), and IgG3 hinge (IgG3 hinge region), but is not limited thereto.

[0083] In one embodiment of the present invention, the recombinant vector may include any one base sequence selected from the group consisting of SEQ ID NO. 19 and SEQ ID NO. 21, but is not limited thereto.

[0084] In addition, the recombinant vector according to the present invention may comprise a base sequence selected from the group consisting of SEQ ID NOs 19 and 21, additionally connected in an operable order to one or more base sequences selected from the group consisting of a restriction enzyme recognition sequence, an expression regulation sequence, a signal sequence, and a hinge sequence.

[0085] The present invention provides a recombinant cell into which a recombinant vector for plant expression of the above MAGEA3-Fc fusion protein is introduced.

[0086] As used herein, the term “recombinant cell” refers to a cell in which a recombinant vector containing a foreign gene is introduced, maintained, or expressed. Such recombinant cells may express a target protein, peptide, or fusion protein, or may function as an intermediate for delivering said recombinant gene to another host. Recombinant cells include not only cases where recombinant DNA is stably inserted into the cell genome, but also cases where it is maintained in the form of external genetic material such as a plasmid or episome.

[0087] As mentioned above, recombinant cells can include bacteria, yeast, animal cells, plant cells, etc. For example, recombinant cells can include bacteria, such as Agrobacterium tumefaciens, Agrobacterium rhizogenes, Escherichia coli, Pseudomonas spp., Bacillus subtilis, or Corynebacterium glutamicum. Additionally, yeast or fungi can be used as recombinant cells, such as Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, or Aspergillus niger. Furthermore, animal cells can also be used as recombinant cells, for example, Chinese Hamster Ovary (CHO) cells, Human Embryonic Kidney 293 (HEK293) cells, Baby Hamster Kidney (BHK) cells, NS0 or SP2 / 0 mouse myeloma cell lines. Finally, plant cells can also be examples of recombinant cells, such as Nicotiana tabacum (tobacco cells), Arabidopsis thaliana, Oryza sativa (rice cells), Zea mays (corn cells), or Glycine max (soybean cells).

[0088] In particular, the bacteria of the genus Agrobacterium used in the present invention are well known as widely used carriers for stably delivering a target recombinant vector into the genome of a plant. However, the scope of the present invention is not limited to specific cell types, and any cell capable of expressing or delivering a target protein by introducing a recombinant vector may be included in the term “recombinant cell” in this specification.

[0089] Methods for introducing recombinant vectors into recombinant cells may include various intracellular gene delivery techniques commonly used in the industry. Specifically, electroporation is a method that applies an electric field to a cell suspension to form temporary nanoscale pores in the cell membrane, thereby enabling the efficient introduction of recombinant vectors into the cell; this method can be applied to various cell types, such as bacteria, yeast, and animal cells. Chemical transformation is a method in which cells are treated with a treatment agent, such as calcium chloride (CaCl₂) solution or polyethylene glycol (PEG), to increase the permeability of the cell membrane, and then the introduction of the vector is induced by applying heat shock or controlling osmotic conditions. Additionally, microinjection is a method of directly injecting recombinant vectors into cells using a micro-needle, which enables precise transformation at the individual cell level.

[0090] Furthermore, lipofection is a method that utilizes cationic lipids to form a lipid nanocomplex with a recombinant vector, which is then fused to the cell membrane to deliver DNA into the cytoplasm; physical methods using nanoparticle delivery systems can also be utilized. For plant cells with cell walls, Agrobacterium-mediated transformation is widely used, in which Agrobacterium mediates the T-DNA region of a Ti plasmid to ensure the stable insertion of the target gene into the plant cell genome. Additionally, the particle bombardment (gene gun method) involves attaching DNA to gold or tungsten particles and injecting the DNA into the plant cell by bombarding it with high pressure; this method can be effectively applied even to plant tissues with cell walls.

[0091] Accordingly, the introduction of a recombinant vector in the present invention may include not only electroporation but also all gene introduction methods known in the art, such as chemical treatment, microinjection, repopulation, Agrobacterium-mediated transformation, and particle gun method, and the desired recombinant cell can be stably produced through these various methods.

[0092] The present invention provides a transgenic plant transformed with a recombinant vector for plant expression of the above MAGEA3-Fc fusion protein.

[0093] In the present invention, “transformation” may collectively refer to the change in the genetic properties of an organism caused by injected DNA. In the present invention, “transformed organism or cell” refers to a cell or organism in which a foreign gene is introduced into a cell or organism in the form of a recombinant vector, etc., and the foreign gene is in a state where it can be maintained or expressed within the cell. Transformed organisms include not only cases where recombinant DNA is stably inserted into the chromosomal genome of a cell, but also cases where it exists as a plasmid, episome, or other non-genomic nucleic acid structure. Therefore, transformed organisms encompass all cell types, such as bacteria, yeast, animal cells, insect cells, and plant cells, and include all cells capable of expressing a target protein or performing a genetic function through the introduction of a vector.

[0094] In the present invention, the terms “transformed plant” or “plant transformant” refer to a plant in which a foreign gene is introduced into a plant cell via a recombinant vector and inserted into the plant genome, thereby possessing the ability to express a target protein. Such a transformed plant exhibits stable gene expression throughout the body and can express the target protein in various plant tissues, such as leaves, stems, roots, and seeds. Transformed plants include not only cases exhibiting transient expression but also cases where stable genome insertion is achieved.

[0095] In the present invention, the term “plant” may be used without limitation as long as it is a plant capable of mass-producing the recombinant protein of the present invention, but is not limited thereto. Examples of transgenic plants include both dicotyledonous and monocotyledonous plants. For example, dicotyledonous plants may include tobacco (Nicotiana tabacum), Arabidopsis (Arabidopsis thaliana), soybean (Glycine max), pea (Pisum sativum), tomato (Solanum lycopersicum), potato (Solanum tuberosum), canola (Brassica napus), sunflower (Helianthus annuus), cotton (Gossypium hirsutum), etc. In addition, monocotyledonous plants may include rice (Oryza sativa), corn (Zea mays), barley (Hordeum vulgare), wheat (Triticum aestivum), sorghum (Sorghum bicolor), oats (Avena sativa), sugarcane (Saccharum officinarum), but are not limited thereto.

[0096] A transformation method refers to a process of introducing a target recombinant vector into a cell or plant body to stably insert the gene into the cell genome or to cause it to be transiently expressed. The transformation method used in the present invention may include Agrobacterium-mediated co-cultivation, which is a known technique in which a foreign gene is transferred into the plant cell genome using the T-DNA boundary of a tumor-inducing plasmid. Specifically, after a binary vector containing a target gene is introduced into an Agrobacterium cell, the T-DNA is transferred to the plant cell by co-culturing with a plant explant (e.g., leaf section, stem section, embryonic tissue) for a certain period of time. After co-culturing, the plant body is cultured in a selection medium to select only the transformed cells possessing resistance to antibiotics or herbicides, and subsequently undergoes a regeneration process to regenerate into a complete plant body.

[0097] In addition to the aforementioned co-culture method, various techniques may be included in the transformation method. For example, the particle bombardment (gene gun method) is a method of physically introducing genes by attaching DNA to gold or tungsten microparticles and colliding them with cells at high speed. Furthermore, when using protoplast cells, DNA can be directly absorbed into plant cells from which the cell walls have been removed through a polyethylene glycol (PEG) treatment method. In some cases, DNA influx can be induced by applying a momentary electric field to protoplasts or microstructures through electroporation. As such, the transformation method of the present invention includes, but is not limited to, Agrobacterium-mediated co-culture, and encompasses all forms of plant cell transformation techniques commonly used in the art.

[0098] The present invention provides a transformed seed of a plant according to the above.

[0099] In the present invention, “seed” may refer to a reproductive material comprising an embryo, endosperm, or seed coat for the germination and early growth of a plant. In particular, it may refer to a seed obtained from a plant of the present invention in which the nucleic acid of the present invention is stably inserted into the plant genome. For example, in the present invention, the nucleic acid is a sequence operably linked to a regulatory sequence capable of being expressed in a plant, and may be the MAGEA3-Hinge-Fc-KDEL coding sequence, but is not limited thereto. The term “stable” may refer to a state in which the inserted sequence is inherited by the offspring generation through meiosis, but is not limited thereto.

[0100] Seeds may be obtained by self-pollination, cross-pollination, or mating, etc. However, the method of obtaining them from a plant is not specified. Furthermore, in the present invention, seeds are not limited to a specific form of processing. For example, they may include all treatments such as drying, coating, pelletizing, and chemical coating. Seeds contain an embryo that can be converted into a seedling upon germination.

[0101] The concept of a nucleic acid molecule of a polynucleotide sequence of the present invention (used interchangeably with a base sequence) includes functional equivalents of the nucleic acid molecule constituting it, for example, variants in which some base sequences of the nucleic acid molecule have been modified by deletion, substitution, or insertion, but which can perform the same function as the nucleic acid molecule. That is, it may include base sequences having sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% with respect to the base sequence of the present invention. For example, it includes polynucleotides having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology.

[0102] The “% of sequence homology” for a polynucleotide is determined by comparing two optimally arranged sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region may contain additions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions or deletions) for the optimal arrangement of the two sequences.

[0103] In addition, the same concept as the polynucleotide sequence can be applied to the amino acid sequence of the present invention. That is, the amino acid sequence is a concept that includes variants capable of performing the same functional action as the one described above, and that is, it may include base sequences having sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% with respect to the amino acid sequence indicated by the sequence number described above in the present invention. For example, it includes an amino acid sequence having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology.

[0104] The present invention provides a method for producing a MAGEA3-Fc fusion protein comprising the following steps:

[0105] A step of introducing the above recombinant vector into a recombinant cell;

[0106] A step of introducing the above recombinant cell into a plant to transform the plant; and

[0107] A step of expressing a MAGEA3-Fc fusion protein from the above-mentioned transgenic plant, and then isolating and purifying the expressed MAGEA3-Fc fusion protein.

[0108] In the present invention, the step of expressing a MAGEA3-Fc fusion protein from a transgenic plant refers to a process in which an expression cassette into which a target foreign gene has been inserted undergoes transcription and translation processes within the plant genome to be produced as an actual protein.

[0109] The expression cassette used in the present invention includes a signal peptide as needed to transport the protein into the endoplasmic reticulum (ER), and by adding a KDEL or SEKDEL sequence to retain the protein within the ER, it can induce stable folding and accumulation of the protein. Additionally, the fusion of the IgG Fc fragment increases the expression level of the protein, ensures the structural stability of the expressed protein, and contributes to extending the protein half-life within plant cells. Transformed plants can express the protein in various tissues such as leaves, stems, and roots, and leaf tissue, in particular, is advantageous for the production of recombinant proteins due to the high amount of protein accumulation.

[0110] Furthermore, the level of protein expression can be controlled by the compound added during co-culture (e.g., acetosyringone), the type of expression regulatory sequence, whether codon optimization is performed, and plant culture conditions such as temperature and light cycle. Therefore, it was confirmed that the MAGEA3-Fc fusion protein expression step in the present invention enables high-level protein production through the design of the expression cassette, control of intracellular localization, and optimization of culture conditions.

[0111] The step of isolating and purifying the MAGEA3-Fc fusion protein expressed from a transgenic plant refers to a process of effectively recovering the target protein from plant tissue and separating it from impurities and endogenous proteins to obtain a high-purity recombinant protein. For example, first, leaf, stem, or root tissues of a transgenic plant are harvested, and then a crude extract is obtained by homogenizing the extract with the addition of a buffer solution such as PBS (phosphate-buffered saline) or by performing mechanical disruption. The supernatant containing the protein can be obtained by removing cell debris, fibrous material, and insoluble components from the extract through centrifugation, filtration, or precipitation processes.

[0112] In the next step, since the MAGEA3-Fc fusion protein contains an IgG Fc domain, it can be selectively purified using Protein A or Protein G affinity chromatography. In this process, the Fc portion specifically binds to the immobilized Protein A / G resin, non-specific proteins and impurities are removed through a washing step, and finally, high-purity protein is recovered by elution using an acidic solution or a high-salt buffer. If necessary, ion exchange chromatography can be additionally applied to increase separation efficiency based on charge difference, and aggregates or small molecular weight impurities can be removed by performing protein size-based separation through gel filtration chromatography (SEC), but are not limited thereto.

[0113] In addition, to maintain the structural stability and biological activity of the protein, protein stabilizing additives (e.g., glycerol, trehalose, amino acid buffers) may be used during the purification process, and residual salts and low-molecular-weight compounds may be removed through desalting or dialysis. In some cases, the protein may be concentrated by applying ultrafiltration (tangential flow filtration, TFF), or formulation may be performed through a sterile step via aseptic filtration. Finally, the purified MAGEA3-Fc fusion protein can be stably stored under lyophilization or cryogenic storage conditions (e.g., -80°C), and this series of processes includes protein purification techniques commonly applied in the industry.

[0114] Accordingly, the “separation and purification step” according to the present invention may include all of the following steps to finally obtain a high-purity MAGEA3-Fc fusion protein: preparation of a raw extract, removal of impurities by centrifugation and filtration, specific purification by protein A / G affinity chromatography, additional high-purity separation by ion exchange and gel filtration chromatography, protein stabilization including stabilizing additives, and desalting and concentration processes.

[0115] The present invention provides a kit for producing a MAGEA3-Fc fusion protein, comprising a recombinant vector for plant expression of the MAGEA3-Fc fusion protein and instructions.

[0116] In the present invention, the above description may teach a method for preparing a transformant expressing the MAGEA3-Fc fusion protein of the present invention, but is not limited thereto.

[0117] In the present invention, “kit” refers to a tool that additionally includes a formulation or a substance for the function, storage, etc., of the kit to enable the use of the kit claimed in the present invention. In addition to the above substances, the kit of the present invention may include other components, compositions, solutions, devices, etc., that are typically required for the storage and processing methods thereof. In this case, each component may be applied one or more times without limitation on the number of times, and there is no restriction on the order in which each substance is applied, and the application of each substance may proceed simultaneously or at different times.

[0118] In the present invention, the kit may include a container; instructions; etc. The container may serve to package the material and may also serve to store and secure it. The material of the container may take the form, for example, a bottle, a tub, a sachet, an envelope, a tube, an ampoule, etc., and these may be formed partially or wholly from plastic, glass, paper, foil, wax, etc. The container may be equipped with a cap that is initially part of the container or can be attached to the container by mechanical, adhesive, or other means and is fully or partially detachable, and may also be equipped with a stopper that allows access to the contents by a syringe needle. The kit may include an outer package, and the outer package may include instructions regarding the use of the components.

[0119] Preferred embodiments are presented below to aid in understanding the present invention. However, the following embodiments are provided merely to facilitate a better understanding of the invention, and the scope of the invention is not limited by the following embodiments.

[0120]

[0121] Examples

[0122] Example 1. Construction and verification of a plant expression recombinant vector for MAGEA3-Fc fusion protein expression

[0123] Example 1-1. Construction of a plant expression recombinant vector for MAGEA3-Fc fusion protein expression

[0124] In this embodiment, the following process was performed to construct a recombinant vector for the expression of MAGEA3-immunoglobulin Fc fusion protein (hereinafter, MAGEA3-Fc fusion protein).

[0125] First, a schematic diagram of the MAGEA3-Fc fusion protein and the protein expression cassette is shown in FIG. 2a, and FIG. 2b schematically illustrates the structure of the MAGEA3-Fc fusion protein. The sequences of the MAGEA3-Fc fusion protein and the protein expression cassette were each synthesized by Macrogen. The sequences associated with the MAGEA3-Fc fusion protein expression recombinant vector used in the present invention are shown in Table 1.

[0126]

[0127]

[0128] Among the recovered cells, those transformed using a vector containing the gene for the MAGEA3-Fc fusion protein (SEQ No. 15) were plated and cultured on LB Amp+ medium, and those transformed using a protein expression cassette (SEQ No. 18) were plated on LB Km+ medium and cultured at 37°C.

[0129] Each plasmid was obtained in large quantities from cultured E. colicell using the FavorPrep plasmid extraction mini kit (Favorgen, Cat#: FADPE 300). Subsequently, 1% agarose gel electrophoresis was performed after treatment with restriction enzymes BamHI (Enzynomics, Cat#: R003H) and NcoI (Enzynomics, Cat#: R004H). The vector portion of the protein expression cassette gene (approx. 3.6 kb) and the insert portion of the MAGEA3-Fc fusion protein gene (approx. 1.8 kb) were obtained using the Gel / PCR purification Mini kit (Favorgen, Cat#: FAGCK001-1). At this time, the vector and insert were ligated overnight at 4°C using T4 DNA ligase (Promega, M180B) and T4 DNA ligase 10X buffer (Promega, C125A) to prepare the MAGEA3-Fc fusion protein expression vector (Sequence No. 19).

[0130] Ligated samples were placed in 50–100 μl of DH5α cells, iced for 30 minutes, and then heat-shocked in a 42°C water bath for 1 minute 30 seconds to induce transformation. Subsequently, LB (-) medium was added to a volume of 1 ml, and the cells were recovered for 2–3 hours at 37°C and 200 rpm. The recovered cells were spread onto LB km+ medium and cultured at 37°C. Afterward, plasmids were mass-obtained from E. colicell selected from antibiotic medium using the FavorPrep plasmid extraction mini kit. The obtained plasmids were treated with restriction enzymes BamHI and NcoI, followed by 1% agarose gel electrophoresis to confirm the presence of identical bands in the protein expression cassette vector and the MAGEA3-Fc fusion protein insert. In addition, sequencing was performed by Cosmojintech to reconfirm whether the protein expression cassette vector and the MAGEA3-Fc fusion protein expression vector insert portion were inserted into the MAGEA3-Fc fusion protein expression vector.

[0131] The MAGEA3-Fc fusion protein expression vector identified by sequencing was introduced into the pBINPLUS vector (SEQ No. 20), and finally, the pBINPLUS vector into which the MAGEA3-Fc fusion protein expression vector was introduced was prepared (SEQ No. 21).

[0132] To this end, the vector was excised using restriction enzymes EcoRI (Enzynomics, Cat#: R002S) and HindⅢ (Enzynomics, Cat#: R008S), followed by 1% agarose gel electrophoresis. Using the Gel / PCR purification Mini kit, the vector portion of pBINPLUS (approx. 12.3 kb) and the insert portion of the MAGEA3-Fc fusion protein expression vector (approx. 2.8 kb) were obtained. Subsequently, the processes of ligation, transformation, recovery, and plasmid acquisition were performed in the same manner as previously described. Finally, electrophoresis was performed after treatment with restriction enzymes EcoRI and HindⅢ; after confirming identical bands in the vector and insert, sequencing was conducted via Cosmogenetec to finally reconfirm that the sequence of the MAGEA3-Fc fusion protein expression vector had been successfully introduced into the pBINPLUS vector.

[0133]

[0134] Example 1-2. Verification of MAGEA3-Fc Fusion Protein Expression Vector

[0135] In Example 1-2, it was confirmed whether the gene encoding the MAGEA3-Fc fusion protein was inserted into the MAGEA3-Fc fusion protein expression vector constructed in Example 1-1. To this end, DNA sequencing was performed, and the primer sequences used are shown in Table 2. The primers below are part of the gene sequence encoding the recombinant protein, MAGEA3-Fc fusion protein. For verification, sequencing was commissioned to Cosmogenetech to verify the MAGEA3-Fc fusion protein expression vector. The received sequence was compared with Sequence No. 19 in Table 1 using Nucleotide BLAST on the NCBI site (https: / blast.ncbi.nlm.nih.gov / Blast.cgi).

[0136] As a result, it was confirmed that the gene encoding the MAGEA3-Fc fusion protein was properly inserted into the MAGEA3-Fc fusion protein expression vector prepared in Example 1-1.

[0137] SEQ ID No.NameSequence (5' → 3')22DNA sequencing Primer 1CTAGAATCCTCATAACTCTG23DNA sequencing Primer 2GAACAGAGAAGCCAGCATT24DNA sequencing Primer 3GATGGAAGTTGACCCCAT25DNA sequencing Primer 4CATTGCATGAATGGGTTCTG26DNA sequencing Primer 5GTATGTTGATGGCGTAGAA

[0138]

[0139] Examples 1-3. Verification of the pBINPLUS vector containing the MAGEA3-Fc fusion protein expression vector

[0140] In Example 1-3, electrophoresis was performed to confirm whether the sequence of the MAGEA3-Fc fusion protein expression vector was accurately inserted into the pBINPLUS vector into which the MAGEA3-Fc fusion protein expression vector prepared in Example 1-1 was introduced. Specifically, the electrophoresis experimental method is described in Example 1-1.

[0141] The plasmid of the transformed Agrobacterium was obtained, and the results of restriction enzyme electrophoresis were confirmed as shown in Fig. 2c (M: DNA marker, V: pBINPLUS vector, I: MAGEA3-Fc fusion protein expression vector, S1: pBINPLUS vector + MAGEA3-Fc fusion protein gene).

[0142] First, a DNA size marker was identified in lane M of Fig. 2c. A band of the pBINPLUS vector was observed in lane V, and a band of the MAGEA3-Fc fusion protein expression vector insert (Table 1, SEQ No. 19) was identified in lane I. In lane S1, the pBINPLUS vector band and the MAGEA3-Fc fusion protein expression vector insert band were observed simultaneously, verifying that the MAGEA3-Fc fusion protein expression vector sequence was inserted into the pBINPLUS vector.

[0143]

[0144] Example 2. Production of Agrobacterium transformants introduced with a MAGEA3-Fc fusion protein expression vector

[0145] In Example 2, the gene encoding the MAGEA3-Fc fusion protein was transformed into the species Agrobacterium tumefaciens LBA4404 using electroporation with the MAGEA3-Fc fusion protein expression vector prepared in Example 1.

[0146] First, 20 to 50 μl of Agrobacterium LBA4404 (Takara, Cat#: 9115, Lot#: AK80113A) and a sample of the reconfirmed pBINPLUS+MAGEA3-Fc fusion protein expression vector (SEQ No. 21) were added to a 1.5 ml tube at a concentration of 500 to 700 ng / μl, and then incubated on ice for 15 to 20 minutes. Subsequently, 20 to 40 μl of the sample was placed in a genepulser / micropulser cuvette (0.1 gap, Bio-rad, Cat#: 1652089), and electroporation was performed by setting the mode of the micropulser (Micropulser, Bio-rad, serial#: 411BR13225) to Agr.

[0147] Meanwhile, LB medium was prepared as follows. LB (-) medium was prepared by mixing 10 g NaCl (Duchefa Biochemie, Prod#: S0520.5000), 10 g tryptone (Gibco, Cat#: 211705), and 5 g yeast extract (Gibco, Cat#: 212750) in 1 L distilled water (DW), followed by autoclave sterilization at 120°C for 15 minutes. LB Amp+ medium was prepared by adding 7.5 g micro agar (Duchefa Biochemie, Prod#: M1002.0500) to the same composition, sterilizing the mixture, and then adding 1 ml of 100 mg / ml ampicillin (Duchefa Biochemie, Prod#: A0104.0025) at 60°C to 65°C and stirring. Subsequently, 25 ml was dispensed into culture dishes (100 Φ culture dish, SPL, Cat#: 10090) and solidified for use. LB km+ medium was prepared in the same manner as LB Amp+, but 1 ml of kanamycin (Duchefa Biochemie, Prod#: K0126.0025) was added as an antibiotic. Electrophoresis was performed using 1% agarose, and the apparatus used was the [Mupid-2 plus (Submarine electrophoresis system)] (Takara, Prod#: AD110). LBRK+ medium was prepared in the same way as LB Amp+, but with the addition of 1 ml of kanamycin (prod#.: K0126.0025) and 1 ml of rifampicin (Duchefa Biochemie, Prod#: R0146.0001) as antibiotics, with the concentrations of the antibiotics used being 100 mg / ml for kanamycin, 100 mg / ml for ampicillin, and 10 mg / ml for rifampicin.

[0148] The cuvette on which the electroporation was performed was immediately incubated on ice for 5 to 10 minutes. Afterward, 1 ml of LB(-) medium was added and pipetted, then transferred to a 15 ml tube and wrapped in foil. It was recovered by incubating at 28°C and 250 rpm for at least 4 hours.

[0149] The recovered cells were spread in 50 to 100 μl aliquots onto LB RK+ medium and cultured at 28°C for 48 to 72 hours. Through this, it was confirmed that the gene encoding the MAGEA3-Fc fusion protein had been transformed into Agrobacterium, and Agrobacterium transformants into which the MAGEA3-Fc fusion protein expression vector was introduced were constructed.

[0150]

[0151] Example 3. Production of transgenic plants using Agrobacterium transformants introduced with a MAGEA3-Fc fusion protein expression vector

[0152] In this Example 3, plant transformation was performed using an Agrobacterium transformant into which the MAGEA3-Fc fusion protein expression vector prepared in Example 2 was introduced.

[0153] First, the Agrobacterium LBA4404 strain was suspended in a co-culture medium containing acetosyringone (Sigma Aldrich, Cat#: D1344060-5g). The co-culture medium was prepared using Murashige & Skoog medium (basal salt mixture), Duchefa Biochemie, Prod#: M0221.0050, Murashige & Skoog medium (Gamborg B5 vitamins), Duchefa Biochemie, Prod#: M0231.0050, and plant agar (Duchefa Biochemie, Prod#: P1001.1000) as the basic composition.

[0154] After co-culture, the initial explants were cultured in cell culture dishes for callus induction and proliferation, and during the regeneration stage, a regeneration medium containing NAA (α-naphthaleneacetic acid, Duchefa Biochemie, Prod#: N0903.0025) and 6-benzylaminopurine (N6-Benzyladenine, 6-BAP, Duchefa Biochemie, Prod#: B0904.0005) was used. Subsequently, cefotaxime (Duchefa Biochemie, Prod#: C0111.0025) was added to inhibit the proliferation of Agrobacterium.

[0155] Transformed plants were selected from an antibiotic-selective medium prepared based on NT medium. Transformed plants growing in the antibiotic-selective medium were transferred to a Magentabox (Magentabox, Bioworld, Prod#: 30930007-2) for culture. All media were classified into co-culture medium, regenerative medium, and antibiotic medium, and an SPL (Cat#: 20100) was used as the culture dish. Through the above process, plant transformants were produced using Agrobacterium introduced with the MAGEA3-Fc fusion protein expression vector, and these were named MAGEA3-Fc transformed tobacco plants.

[0156]

[0157] Example 4. Confirmation of MAGEA3-Fc fusion protein expression in MAGEA3-Fc transgenic tobacco plants

[0158] In this example, proteins were extracted from the leaves of a transformed tobacco plant, and the expression of the MAGEA3-Fc fusion protein was confirmed by western blot.

[0159] Since this process can be verified when the shoot portion of the transformed tobacco plant has grown, leaves of the transformed tobacco plant were used to confirm the expression of the MAGEA3-Fc fusion protein. First, the leaves of the transformed tobacco plant were cut and weighed. The leaves were crushed by adding an amount of PBS solution equivalent to three times their weight. The PBS was prepared by adding 950 ml of double-distilled water to 50 ml of 20X PBS (Dongin Biotech, Cat#: GIM005-1L), sterilizing at 120°C for 15 minutes, and then cooling to room temperature before use.

[0160] 20 μl of the obtained leaf lysate was mixed with 5X sample buffer (GenScript, Cat#: MB01015) and heated at 100°C to 105°C for 5 minutes. 20 μl of the prepared sample was injected into a 10% SDS-PAGE gel, and electrophoresis was performed using an SDS-PAGE electrophoresis device (Bio-rad, Prod#: 164-5050). The electrophoresis conditions were set to 80 V for 30 minutes, followed by 130 V for 1 hour. Electrophoresis was performed using 1X running buffer, which was prepared by adding 900 ml of distilled water to 100 ml of 10X Tris-Glycine buffer [w / SDS] (Biosesang, Prod#: TR2015-100-00).

[0161] The SDS-PAGE samples, after electrophoresis was completed, were transferred to an Amersham protran 0.45 μm nitrocellulose blotting membrane (Cytiva, Prod#: 10600002). The transfer was performed for 1 hour and 30 minutes under conditions of 300 mA. A 1X transfer buffer was used for this purpose; the 1X transfer buffer was prepared by mixing 200 ml of 5X Transfer buffer (Biosesang, Prod#: TR2033-100-00), 200 ml of methyl alcohol (Duksan, Prod#: 0060-18L), and 600 ml of double distilled water, and was stored at 4℃ for use.

[0162] The transferred membrane was blocked for 30 minutes to 1 hour by adding 10 to 20 ml of blocking buffer, prepared by adding 2 g of skim milk (BD, Cat#: 232100) to 40 ml of 1X TBS-T buffer. After blocking, the solution was removed, and 4 μl of goat anti-human IgG heavy and light chain antibody, HRP conjugated (Bethyl, Cat#: A80-199P), was added to the remaining 20 ml of blocking buffer and mixed, after which the membrane was incubated for 2 hours. Subsequently, the solution was removed, and the membrane was washed 3 to 5 times with 1X TBS-T buffer for 10 minutes each. 1X TBS-T was prepared by mixing 50 ml of 20X TBS (Biosesang, Prod#: TR2008-100-00), 1 ml of Tween-20 (Sigma Aldrich, Cat#: P5927-500 ml), and 949 ml of secondary distilled water.

[0163] Equal volumes of ECL solution A and B (ATTA, Cat#: WSE-7120L) were mixed and dispensed onto the washed membrane. Finally, the Western blot results were verified using an ImageQuant LAS4000 (GE Healthcare).

[0164] As a result, the results shown in Figures 3a and 3b were confirmed (+: positive control (human immunoglobulin Fc portion); -: negative control (untransformed tobacco plant (Nicotiana tabacum NT)); 3-1 to 3-7: transformed tobacco plants 1 to 7).

[0165] Specifically, in Fig. 3a, the + control (human immunoglobulin Fc) showed a distinct single band, while no signal was observed in the - control (Nicotiana tabacum NT). Meanwhile, a specific band was observed around 75 kDa in transgenic tobacco plants 3-1 to 3-7. In addition, the results of Western blot experiments performed on other transgenic plants using the same method are shown in Fig. 3b. According to this, the expression of the MAGEA3-Fc fusion protein was confirmed in 3-1 to 3-3 as well. Through these results, it was confirmed that the MAGEA3-Fc fusion protein is successfully expressed in plant transgenic plants prepared according to the MAGEA3-Fc fusion protein expression vector of the present invention.

[0166]

[0167] Example 5. Confirmation of gene introduction encoding MAGEA3-Fc fusion protein introduced into MAGEA3-Fc transgenic tobacco plants

[0168] In this example, the introduction of a gene encoding the MAGEA3-Fc fusion protein (hereinafter referred to as the MAGEA3-Fc gene) into a transgenic tobacco plant was confirmed.

[0169] At this time, leaves of a transformed tobacco plant were used, as in Example 4. To confirm the insertion of the MAGEA3-Fc gene, genomic DNA was extracted from the plant, and the extracted genomic DNA was amplified by PCR (Polymerase Chain Reaction) and then subjected to electrophoresis to re-verify the insertion of the MAGEA3-Fc gene in the tobacco plant expressing the MAGEA3-Fc fusion protein.

[0170] First, a leaf of the transformed tobacco plant was cut and placed in a 1.5 ml tube, and liquid nitrogen was added to completely crush it. Subsequently, genomic DNA was extracted from the leaf tissue using a Plant genomic DNA extraction mini kit (Favorgen, Cat#: FAPK001-2).

[0171] The extracted genomic DNA was subjected to PCR amplification using primers F and R (Table 3). The PCR reaction was prepared using a PCR premix (Bioneer, Cat#: K-2012), and PCR was performed after adding the extracted genomic DNA and each primer. The PCR reaction was carried out under the following conditions. First, the pre-denaturation process was conducted at 95°C for 5 minutes. Subsequently, the denaturation, binding, and extension process was repeated 30 times at 95°C for 20 seconds, 58°C for 20 seconds, and 72°C for 1 minute 30 seconds. The final extension process was performed at 72°C for 5 minutes.

[0172] SEQ ID No.NameSequence (5' → 3')27PCR primer F_MAGEA3-FcGATGGAAGTTGACCCCAT28PCR primer R_MAGEA3-FcAGGAAAACAGAAGGCCCACC

[0173]

[0174] As a result, the results shown in Fig. 4 were confirmed (+: positive control (MAGEA3-Fc (transformed Agrobacterium)); -: negative control (untransformed tobacco plant (Nicotiana tabacumNT); 3-1 ~ 3-7: transformed tobacco plants 1 ~ 7).

[0175] Specifically, in Figure 4, the + control (transformed Agrobacterium possessing MAGEA3-Fc) showed a specific amplification band, while no band was observed in the - control (Nicotiana tabacumNT). In all samples from 3-1 to 3-7, a specific band at the same location as the control (+) was identified, verifying that the MAGEA3-Fc gene was introduced into the genome of each tobacco sample.

[0176]

[0177] Example 6. Verification of Expression Specificity of MAGEA3-Fc Fusion Protein: Comparative Analysis with MAGEA9-Fc

[0178] In Example 6, the specificity of the MAGEA3-Fc fusion protein expression vector for the MAGEA3-Fc fusion protein was confirmed through comparative analysis with MAGEA9-Fc. To this end, the MAGEA9-Fc fusion protein expression vector was constructed and verified through electrophoresis, and MAGEA9-Fc transgenic tobacco plants were constructed to sequentially analyze whether the MAGEA9-Fc fusion protein was expressed and whether the gene encoding the MAGEA9-Fc fusion protein (hereinafter, the MAGEA9-Fc gene) was introduced.

[0179]

[0180] Example 6-1. Production of MAGEA9-Fc fusion protein expression vector and MAGEA9-Fc transgenic tobacco plants using the same

[0181] First, a plant transformant mediated by Agrobacterium transformation into which a MAGEA9-Fc fusion protein expression vector was introduced was produced using the same method as described in the example above, and was hereinafter referred to as the MAGEA9-Fc transgenic tobacco plant. At this time, the composition and sequence for producing the MAGEA9-Fc transgenic tobacco plant are as shown in Table 4.

[0182]

[0183]

[0184] Example 6-2. Verification of MAGEA9-Fc Fusion Protein Expression Vector

[0185] The method for verifying the MAGEA9-Fc fusion protein expression vector was applied in the same way as in Examples 1-3.

[0186] The results of obtaining the transformed Agrobacterium plasmid and performing restriction enzyme electrophoresis were also confirmed as shown in Fig. 5a (M: DNA marker, V: pBINPLUS vector, I: MAGEA9-Fc fusion protein expression vector, S1: pBINPLUS vector + MAGEA9-Fc fusion protein expression vector gene).

[0187] First, a DNA size marker was identified in lane M of Fig. 5a. A band of the pBINPLUS vector was observed in lane V, and a band of the MAGEA9-Fc gene expression vector insert was identified in lane I. In lane S1, the pBINPLUS vector band and the MAGEA9-Fc fusion protein expression vector gene insert band were observed simultaneously, verifying that the MAGEA9-Fc fusion protein expression vector gene was successfully inserted into the pBINPLUS vector.

[0188]

[0189] Example 6-3. Expression of MAGEA9-Fc fusion protein and confirmation of MAGEA9 gene introduction in MAGEA9-Fc transgenic tobacco plants

[0190] The expression of the MAGEA9-Fc fusion protein in MAGEA9-Fc transgenic tobacco plants and the introduction of the MAGEA9-Fc gene into the plants were analyzed. At this time, protein expression was determined using the same method as in Example 4, and the introduction of the gene into the plants was determined using the same method as in Example 5. The primers used to confirm the introduction of the MAGEA9-Fc gene are as shown in Table 5.

[0191] SEQ ID No.NameSequence (5' → 3')34PCR primer F_MAGEA9-FcGAACTGACGTGAAAGAAGT35PCR primer R_MAGEA9-FcAGGAAAACAGAAGGCCCACC

[0192]

[0193] As a result, the expression level of the MAGEA9-Fc fusion protein in MAGEA9-Fc transgenic tobacco plants was confirmed as shown in Figure 5b. In addition, the results of identifying the MAGEA9-Fc gene introduced into the MAGEA9-Fc transgenic tobacco plants were confirmed as shown in Figure 5c.

[0194] First, according to Fig. 5b, the following experimental results were confirmed (+: positive control (human immunoglobulin Fc portion); -: negative control (untransformed tobacco plant (Nicotiana tabacum NT)); 9-1 to 9-7: transformed tobacco plants 1 to 7).

[0195] Specifically, the + control (human immunoglobulin Fc) showed a distinct band at the expected position, while no signal was observed in the - control (Nicotiana tabacumNT). Meanwhile, in samples 9-1 to 9-7, no specific band was detected at the same position as the + control, so the expression of MAGEA9-Fc fusion protein was not confirmed under these conditions.

[0196] In addition, according to Figure 5c, the expected amplification product was clearly identified in the +' control (positive control (plasmid of Agrobacterium with the MAGEA9-Fc gene inserted)), whereas the band was hardly identified in the - control (Nicotiana tabacumNT). Meanwhile, in samples 9-1 to 9-7, a specific band was not observed at the +' position, but rather the same band as in the - control was formed.

[0197] According to these experimental results, for the MAGEA9-Fc fusion protein, the entire process of plant expression vector construction, Agrobacterium transformation, and plant transformation was carried out under the same conditions as for MAGEA3-Fc. Despite the fact that the MAGEA9-Fc fusion protein expression vector contained the MAGEA9-Fc gene, Western blot and PCR analysis results for MAGEA9-Fc transformed tobacco plants were both confirmed to be negative. On the other hand, it was already confirmed in Examples 3 and 4 that MAGEA3-Fc showed positive results for gene introduction and fusion protein expression, respectively, under the same conditions. Therefore, the expression specificity of MAGEA3-Fc compared to MAGEA9-Fc was clearly verified due to the difference in the inserted gene, which is the only variable, under identical conditions of vector backbone, promoter, selection marker, and process conditions.

[0198] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

[0199] By directly isolating and purifying the recombinant protein from tobacco plants transformed to express the recombinant MAGEA3-Fc fusion protein, mass production can be easily achieved. Furthermore, since it offers economic efficiency and scalability compared to existing microbial or animal cell-based expression systems, it can be effectively utilized as a fusion protein production platform.

Claims

A recombinant vector for plant expression of a MAGEA3-Fc fusion protein containing a nucleotide sequence encoding a MAGEA3-Fc fusion protein (MAGEA3-immunoglobulin Fc fusion protein). In paragraph 1, A recombinant vector for plant expression of a MAGEA3-Fc fusion protein, wherein the MAGEA3-Fc fusion protein comprises any one amino acid sequence selected from the group consisting of SEQ ID NO. 16 and SEQ ID NO.

17. In paragraph 1, A recombinant vector for plant expression of a MAGEA3-Fc fusion protein, wherein the nucleotide sequence encoding the MAGEA3-Fc fusion protein comprises any one nucleotide sequence selected from the group consisting of SEQ ID NOs 13 to 15. In paragraph 1, A recombinant vector for plant expression of a MAGEA3-Fc fusion protein, wherein the recombinant vector further comprises one or more nucleotide sequences selected from the group consisting of restriction enzyme recognition sequences, expression regulation sequences, signal sequences, and hinge sequences in an operable order. In paragraph 4, The above restriction enzyme recognition sequence is one or more selected from the group consisting of HindIII, NcoI, BamHI, EcoRI, XhoI, SalI, NotI, PstI, SpeI, XbaI, and KpnI; The above expression regulatory sequence is one or more promoters or terminators selected from the group consisting of E / 35S-P (CaMV 35S promoter with enhancer; Cauliflower mosaic virus 35S promoter with enhancer), NOS-T (Nopaline synthase terminator), Ubiquitin promoter (Ubi-P; Ubiquitin promoter), Actin promoter, FMV promoter (Figwort mosaic virus promoter), 2x35S promoter (Double CaMV 35S promoter), OCS terminator (Octopine synthase terminator), HSP terminator (Heat shock protein terminator), RBCL terminator (Ribulose-1,5-bisphosphate carboxylase / oxygenase large subunit terminator), CMV promoter (Cytomegalovirus promoter), and EF1α promoter (Elongation factor 1 alpha promoter); The above signal sequence is one or more selected from the group consisting of SP (Signal peptide), KDEL (Lys-Asp-Glu-Leu), PR1a signal peptide (Pathogenesis-related protein 1a signal peptide), Calreticulin signal peptide (Calreticulin-derived signal peptide), SEKDEL (Ser-Glu-Lys-Asp-Glu-Leu), HDEL (His-Asp-Glu-Leu), and OST signal peptide (Oligosaccharyltransferase signal peptide); and A recombinant vector for plant expression of a MAGEA3-Fc fusion protein, wherein the hinge sequence is one or more selected from the group consisting of IgG1 hinge (IgG1 hinge region), IgG4 hinge (IgG4 hinge region), IgG2 hinge (IgG2 hinge region), and IgG3 hinge (IgG3 hinge region). In paragraph 1, The above recombinant vector is a recombinant vector for plant expression of a MAGEA3-Fc fusion protein, comprising any one nucleotide sequence selected from the group consisting of SEQ ID NO. 19 and SEQ ID NO.

21. A recombinant cell into which a recombinant vector for plant expression of a MAGEA3-Fc fusion protein of any one of claims 1 to 6 has been introduced. A transgenic plant transformed with a recombinant vector for plant expression of the MAGEA3-Fc fusion protein of any one of claims 1 to 6. Transformed seeds of a plant body according to Paragraph 8. A method for producing a MAGEA3-Fc fusion protein comprising the following steps: A step of introducing a recombinant vector of any one of claims 1 to 6 into a recombinant cell; A step of introducing the above recombinant cell into a plant to transform the plant; and A step of expressing a MAGEA3-Fc fusion protein from the above-mentioned transgenic plant, and then isolating and purifying the expressed MAGEA3-Fc fusion protein. A kit for producing a MAGEA3-Fc fusion protein, comprising a recombinant vector for plant expression of any one of claims 1 to 6, and instructions.