Scaffolded polynucleotide synthesis
The use of scaffolded polynucleotide synthesis with adaptor oligonucleotides addresses the inefficiencies of current methods by enabling efficient assembly and incorporation of modified nucleotides, facilitating the synthesis of large nucleic acid molecules with custom modifications.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- BOARD OF RGT THE UNIV OF TEXAS SYST
- Filing Date
- 2025-12-18
- Publication Date
- 2026-06-25
AI Technical Summary
Current methods for synthesizing large nucleic acid molecules face challenges in incorporating modified nucleotides and suffer from low yields and inefficiencies, particularly with complex assemblies, making them unsuitable for on-demand synthesis of constructs with custom modifications.
A method involving the use of a scaffold polynucleotide and adaptor oligonucleotides to arrange and ligate fragment oligonucleotides, leveraging cooperative binding to form the desired polynucleotide, which includes a mixture of a polynucleotide scaffold, adaptor oligonucleotides, and fragment oligonucleotides, with a ligase to facilitate the ligation process.
This approach enables efficient synthesis of polynucleotides with custom modifications, overcoming yield limitations and complexity issues, allowing for flexible and effective synthesis of large nucleic acid molecules.
Smart Images

Figure US2025060298_25062026_PF_FP_ABST
Abstract
Description
Attorney Docket No. 206161-0084-00WGScaffolded Polynucleotide SynthesisCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Application No. 63 / 735,789 filed on December 18, 2024 incorporated herein by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under Grant no. CCF2200290 awarded by the National Science Foundation. The government has certain rights in the invention.REFERENCE TO A “SEQUENCE LISTING” SUBMITTED AS AN XML FILE
[0003] The present application hereby incorporates by reference the entire contents of the sequence listing xml document named “206161-0084-00WO_seqlisting.xml”. The xml file containing the Sequence Listing of the present application was created on December 18, 2025 and is 90,871 bytes.BACKGROUND
[0004] A need exists for more effective and versatile methods of synthesizing polynucleotides (e.g., long nucleic acid strands, such as DNA and / or RNA strands, which may also be referred to herein as “target strands”). The present invention satisfies this need.SUMMARY
[0005] In some embodiments, the present disclosure pertains to methods of synthesizing a polynucleotide. In some embodiments, the methods of the present disclosure include a step ofAttorney Docket No. 206161-0084-00WG associating a polynucleotide scaffold with a plurality of adaptor oligonucleotides and a plurality of fragment oligonucleotides to form a mixture. In some embodiments, each of the adaptor oligonucleotides includes subsequences (i.e., “domains”) that become hybridized (i.e., bound via standard nucleic acid base-pairing) with the polynucleotide scaffold, and other subsequences that become hybridized with subsequences of the fragment oligonucleotides to form adaptor nucleotide: fragment oligonucleotide complexes. In some embodiments, the methods of the present disclosure also include a step of adding a ligase to the mixture to ligate the adjacent fragment oligonucleotides of the adaptor oligonucleotide: fragment oligonucleotide complexes to one another to form the polynucleotide. In some embodiments, the methods of the present disclosure also include a step of purifying the formed polynucleotides.
[0006] In some embodiments, the hybridization of subsequences of adaptor oligonucleotides with subsequences of fragment oligonucleotides occurs through cooperative binding. In some embodiments, cooperative binding includes the binding of a first subsequence of a fragment oligonucleotide to a subsequence of a first adaptor oligonucleotide, and a binding of a second subsequence of the fragment oligonucleotide to a subsequence of a second adaptor oligonucleotide. In some embodiments, the bindings occur through self-assembly. In some embodiments, each of the individual bindings are unstable while the joint bindings are more stable.BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIGS. 1 A-1E illustrate a method of synthesizing a polynucleotide (i.e., a target strand) in accordance with various embodiments of the present disclosure.
[0008] FIGS. 2A-2C summarize the limitations of the existing techniques for synthesizing large nucleic acid molecules.
[0009] FIGS. 3A-3B provide gel electrophoretic analyses of reactions synthesizing polynucleotides (i.e., target strands) without a polynucleotide scaffold (which may also be referred as “unseeded assembly”) (FIG. 3A) and with a polynucleotide scaffold (which may also be referred to herein as “seeded assembly”) (FIG. 3B).Attorney Docket No. 206161-0084-00WO
[0010] FIG. 4 provides a visual exploration and methylation analysis of sequencing data for a polynucleotide synthesis reaction (i.e., target strand synthesis) in accordance with an embodiment of the present disclosure.
[0011] FIG. 5A-5B provide gel electrophoretic analyses of reactions synthesizing polynucleotides (i.e., target strands) with a fluorophore modification. Fig. 5A shows an image of a gel prior to SYBR gold staining. FIG. 5B shows an image of the gel after SYBR gold staining.
[0012] FIG. 6 provides gel electrophoretic analyses of reactions synthesizing long polynucleotides (i.e., target strands) with repeats.
[0013] FIG. 7 provides an Agilent Bioanalyzer trace showing an analysis of reactions synthesizing long polynucleotides (i.e., target strands) with repeats.
[0014] FIG. 8 shows a schematic of a method for synthesizing a target polynucleotide.
[0015] FIG. 9 shows a schematic of an end of a scaffold-adaptor complex and fragment oligonucleotides.DETAILED DESCRIPTION
[0016] It is to be understood that both the foregoing general description and the following detailed description are illustrative and explanatory, and are not restrictive of the subject matter, as claimed. In this application, the use of the singular includes the plural, the word “a” or “an” means “at least one”, and the use of “or” means “and / or”, unless specifically stated otherwise. Furthermore, the use of the term “including”, as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements or components comprising one unit and elements or components that include more than one unit unless specifically stated otherwise.
[0017] The section headings used herein are for organizational purposes and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated herein by reference in their entirety for anyAttorney Docket No. 206161-0084-00WO purpose. In the event that one or more of the incorporated literature and similar materials defines a term in a manner that contradicts the definition of that term in this application, this application controls.
[0018] Definitions
[0019] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
[0020] “Amplification,” as used herein, refers to any in vitro process for increasing the number of copies of a nucleotide sequence or sequences, i.e., creating an amplification product which may include, by way of example additional target molecules, or target-like molecules or molecules complementary to the target molecule, which molecules are created by virtue of the presence of the target molecule in the sample. These amplification processes include but are not limited to polymerase chain reaction (PCR), multiplex PCR, Rolling Circle PCR, ligase chain reaction (LCR) and the like, in a situation where the target is a nucleic acid, an amplification product can be made enzymatically with DNA or RNA polymerases or transcriptases. Nucleic acid amplification results in the incorporation of nucleotides into DNA or RNA. As used herein, one amplification reaction may consist of many rounds of DNA replication. PCR is an example of a suitable method for DNA amplification. For example, one PCR reaction may consist of 2-40 “cycles” of denaturation and replication.
[0021] “Amplification products,” “amplified products” “PCR products” or “amplicons” comprise copies of the target sequence and are generated by hybridization and extension of an amplification primer. This term refers to both single stranded and double stranded amplification primer extension products which contain a copy of the original target sequence, including intermediates of the amplification reaction.
[0022] “Nucleic acid” or “oligonucleotide” or “polynucleotide” as used herein may mean at least two nucleotides covalently linked together. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantiallyAttorney Docket No. 206161-0084-00WG identical nucleic acids.
[0023] Nucleic acids may be single stranded or double stranded, or may contain portions of both double stranded and single stranded sequence. Nucleic acids may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods. As used herein, the term nucleic acids includes both natural and non-natural nucleic acids. Non-natural nucleic acids include, but are not limited to, 2'F, 2'-fluoro; 2'0Me, 2'-O-methyl; LNA, locked nucleic acid; FANA, 2'-fluoro arabinose nucleic acid; HNA, hexitol nucleic acid; 2'MOE, 2'-O-methoxyethyl; ribuloNA, (l'-3')-P-L-ribulo nucleic acid; TNA, a-L-threose nucleic acid; tPhoNA, 3 '-2' phosphonomethyl-threosyl nucleic acid; dXNA, 2 '-deoxyxylonucleic acid; PS, phosphorothioate; phNA, alkyl phosphonate nucleic acid; and PNA, peptide nucleic acid.
[0024] “Homologous” refers to the sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, e g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared X 100. For example, if 6 of 10 positions in two sequences are matched or homologous then the two sequences are 60% homologous. By way of example, the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, a comparison is made when two sequences are aligned to give maximum homology.
[0025] “Isolated” means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.Attorney Docket No. 206161-0084-00WO
[0026] “Instructional material”, as that term is used herein, includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the mixtures and / or individual components thereof of the invention in a kit. Optionally, or alternately, the instructional material may describe one or more methods of synthesizing a target polynucleotide. The instructional material of the kit may, for example, be affixed to a container that contains one or more components of the invention or be shipped together with a container that contains the one or more components of the invention. Alternatively, the instructional material may be shipped separately from the container with the intention that the recipient uses the instructional material and the components cooperatively.
[0027] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
[0028] As used herein, the term “bind” or “binding” refers to the specific association or other specific interaction between two molecular species, such as, but not limited to, nucleic acid- nucleic acid interactions (e.g., hybridization or base-pairing), protein-DNA / RNA interactions and protein-protein interactions, for example, the specific association between proteins and their DNA / RNA targets, receptors and their ligands, enzymes and their substrates, etc. Such binding may be specific or non-specific, and can involve various noncovalent interactions, such as hydrogen bonding, metal coordination, hydrophobic forces, van der Waals forces, pi-pi interactions, and / or electrostatic effects.
[0029] Current methods of synthesizing large nucleic acid molecules assemble the target sequence from smaller fragments, followed by in-vivo or in-vitro amplification to improve yield and fidelity. Since these methods rely on DNA polymerase to elongate and / or amplify theAttorney Docket No. 206161-0084-00WO assembled target sequence in-vivo or in vitro, they cannot incorporate modified nucleotides, such as methylated nucleotides, during synthesis.
[0030] For instance, the polymerase cycling assembly method relies on a pool of primers and DNA polymerase to extend and assemble large nucleic acid molecules. However, standard DNA polymerases are unable to preserve a specific pattern of oligonucleotide modifications.
[0031] Gibson assembly, a commonly used method, is based on isothermal enzymatic processing to join overlapping DNA fragments. This process involves three primary enzymes: an exonuclease that chews back the 5’ ends of fragments, a polymerase that fills in the gaps, and a ligase that seals the nicks left after polymerization. However, as the number of fragments increases, the combinatorial complexity reduces the likelihood of forming compatible intermediates. Middle fragments, in particular, may anneal with various upstream or downstream fragments, often creating partial subassemblies that halt further progress, which diminishes the probability of obtaining the correct full-length product.
[0032] Golden Gate Assembly, another prominent method, uses type IIS restriction enzymes to create sticky ends to guide ligation. While promising for one-step, one-pot assemblies, Golden Gate faces similar challenges with overlapping partial products leading to “dead ends” in assembly. Moreover, Golden Gate faces even more severe issues related to possible ambiguity in fragment ordering due to repeats. The sticky ends generated by the restriction enzymes — typically 4 base pairs — have lower thermodynamic stability, increasing the likelihood of transient dissociation or ineffective annealing, particularly in complex assemblies with many fragments.
[0033] Thus, for both Gibson and Golden Gate assemblies, as sequence length increases, or if repeats lead to erroneous binding of fragments, yield decreases substantially. To overcome the low yields inherent to these methods, scientists typically resort to cellular amplification, transforming small amounts of correctly assembled DNA into cells. Cellular machinery then amplifies the DNA through replication, enabling efficient production of full-length products. Although effective, this approach introduces additional, labor-intensive steps that require specific expertise and well-equipped labs, making it less flexible for on-demand synthesis.Attorney Docket No. 206161-0084-00WO
[0034] Moreover, cellular systems and in vitro PCR amplification are unsuitable for constructs with custom modifications — such as methylated bases, fluorophores, or other chemical attachments — since DNA polymerase cannot replicate these modifications. This limitation poses challenges for research in various fields, such as epigenetics, synthetic biology, and DNA nanotechnology, where modified oligonucleotides are essential for probing biological functions or engineering functional nanostructures.
[0035] As such, a need exists for more effective and versatile methods of synthesizing large nucleic acid molecules (i.e., polynucleotides). Numerous embodiments of the present disclosure aim to address the aforementioned need.
[0036] The present invention provides for the synthesis of a desired target polynucleotide using a scaffold and plurality of adapter oligonucleotides. The scaffold and adapter oligonucleotides aid in arranging target polynucleotide portions, referred to herein as fragment oligonucleotides or monomers, which are then ligated to form the desired target polynucleotide. In brief, a scaffold polynucleotide is bound to any number of shorter adaptor oligonucleotides such that the adaptor oligonucleotides are arranged in a specified order along the scaffold. The individual adaptor oligonucleotides, while bound to the scaffold, act as a docking site for individual target polynucleotide portions such that the target polynucleotide portions are arranged in a specified order. The arranged target polynucleotide portions may then be ligated to form the target polynucleotide.
[0037] Mixture
[0038] In some aspects, the invention relates to a mixture for synthesizing one or more polynucleotides. Now referring to Figure 1, in some aspects, the invention relates to a mixture for synthesizing a target polynucleotide 18. In some embodiments, the mixture comprises a polynucleotide scaffold 10, one or more adaptor oligonucleotides 12, and one or more fragment oligonucleotides 14. In some embodiments, the mixture further comprises a ligase 16.
[0039] The scaffold 10, one or more adaptors 12, and one or more fragments 14, may be designed such that in a mixture one scaffold 10 molecule binds one or more adaptors 12 forming a scaffold-adaptor complex. The one or more adaptors 12 may each further comprise a freeAttorney Docket No. 206161-0084-00WO region, also referred to as a fragment binding region, that does not bind to the scaffold 10. The free region of adaptors 12 bind one or more fragments 14. Therefore, the scaffold-adaptor complex comprise any number of adaptor 12 fragment binding regions that bind one or more fragments 14. Scaffolds 10, adaptors 12, and fragments 14 may be designed such that when one or more fragments 14 are bound to the scaffold-adaptor complex, the fragments 14 are positioned such that the one or more fragments when ligated to each other then form a desired target polynucleotide 18. The one or more fragments 14 may be ligated by a ligase 16.
[0040] The one or more polynucleotide scaffolds 10 may be a single stranded DNA (ssDNA) comprising any nucleotide sequence. The one or more polynucleotide scaffolds 10 may comprise a nucleotide sequence of adequate length for binding to any number of adaptor oligonucleotides 12. The one or more adaptor oligonucleotides 12 may be a single stranded DNA (ssDNA). In some embodiments, each adaptor oligonucleotide 12 comprises a scaffold binding region and a fragment binding region. The scaffold binding region may comprise a nucleotide sequence that is complementary to a portion of the polynucleotide scaffold 10 and the fragment binding region may comprise a nucleotide sequence that is complementary to a portion of the nucleotide sequence of the desired target polynucleotide 18. In some embodiments, the one or more adaptor oligonucleotides 12 comprises a set of any combination of adaptor oligonucleotides 12. The fragment oligonucleotides 14 may comprise a nucleotide sequence of a portion of the desired target polynucleotide 18 such that one or more fragments 14 may be ligated to form the desired target polynucleotide 18. The fragment oligonucleotides 14 may comprise a set of fragment oligonucleotides 14 such that in combination the set comprises the sequence of the target polynucleotide 18. In other words, fragment oligonucleotides 14 may be ligated to form a desired target polynucleotide 18.
[0041] The mixture may comprise a scaffold 10, one or more adaptor oligonucleotides 12, one or more fragment oligonucleotides 14, and / or ligase at any concentration. The mixture may comprise a scaffold 10, one or more adaptor oligonucleotides 12, one or more fragment oligonucleotides 14, and / or ligase at any relative concentration. In some examples, the concentration of a scaffold 10 in the mixture is or is about 10 nM or 100 nM. In some examples, the concentration of a scaffold 10 in the mixture is in the range of 1 nM to 500 nM, 1 nM to 250Attorney Docket No. 206I61-0084-00WO nM, 1 nM to 200 nM, 5 nM to 500 nM, 10 nM to 250 nM, 5 nM to 250 nM, 5 nM to 200 nM, 5 nM to 100 nM, 10 nM to 200 nM, or 10 nM to 100 nM.
[0042] In some examples, the one or more adaptor oligonucleotides 12 comprise a set of any number of distinct adaptor oligonucleotides 12. In some examples, the set comprise each of the distinct adaptor oligonucleotides 12 in equal or about equal amounts. In some examples, the concentration of each adaptor 12 of the set of adaptor oligonucleotides 12 in the mixture is or is about 20 nM or 200 nM. In some examples, , the concentration of each adaptor 12 of the set of adaptor oligonucleotides 12 in the mixture is in the range of 1 nM to 1 mM, 1 nM to 500 nM, 1 nM to 400 nM, 1 nM to 200 nM, 10 nM to 1 mM, 20 nM to 500 nM, 10 nM to 500 nM, 10 nM to 400 nM, 10 nM to 200 nM, 20 nM to 400 nM, or 20 nM to 200 nM.
[0043] In some examples, the one or more fragments 14 comprise a set of any number of distinct fragments 14. In some examples, the set comprises each of the distinct fragments 14 in equal or about equal amounts. In some examples, the concentration of each fragment 14 of the set of fragments 14 in the mixture is or is about 20 nM or 200 nM. In some examples, the concentration each fragment 14 of the set of fragments 14 in the mixture is in the range of 1 nM to 1 mM, 1 nM to 500 nM, 1 nM to 400 nM, 1 nM to 200 nM, 10 nM to 1 mM, 20 nM to 500 nM, 10 nM to 500 nM, 10 nM to 400 nM, 10 nM to 200 nM, 20 nM to 400 nM, or 20 nM to 200 nM.
[0044] In some examples, the relative concentrations among the scaffold 10, each of the set of one or more adaptors 12, and each of the set of one or more fragments 14, are any relative concentration. In some examples, the concentration of each of the set of one or more adapters 12 and each of the set of one or more fragments 14 in the mixture are equal or about equal. In some examples, the concentration of each of the set of one or more adapters 12 and / or the concentration of each of the set of one or more fragments 14 is or is about equal to the concentration of the scaffold 10. In some examples, the concentration of each of the set of one or more adapters 12 and / or the concentration of each of the set of one or more fragments 14 are greater than the concentration of the scaffold 10. In some examples, the concentration of each of the set of one or more adapters 12 and / or the concentration of each of the set of one or more fragments 14 is or is about 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2.0 times, 2.1 times, 2.2 times, 2.3 times, 2.4 times, 2.5 times, 2.6Attorney Docket No. 206161-0084-00WO times, 2.7 times, 2.8 times, 2.9 times, 3 times, 3.5 times, 4 times, 4.5 times, or 5 times greater than the concentration of the scaffold 10.
[0045] Although fragment oligonucleotides 14 and / or adaptors 12 may be provided in molar excess relative to the scaffold 10, the assembly of a target polynucleotide 18 may be driven by cooperative binding effects. In other words, the formation of a continuous bridge between adjacent adaptor oligonucleotides 12 (mediated by the scaffold 10) may be thermodynamically favored over the binding of separate fragments 14 to isolated adaptor 12 sites. This cooperativity may promote the assembly of the full continuous target polynucleotide 18 even in the presence of excess free fragments 12, effectively mitigating saturation or prozone effects.
[0046] The mixture may comprise any solvent. In some embodiments, the solvent comprises a salt concentration suitable for maintaining ssDNA in suspension. In some embodiments, the solvent comprises MgCh. In some embodiments, the solvent comprises or comprises about 10 mM Magnesium ions. In some embodiments, the solvent comprises or comprises about 20 mM Calcium ions. In some embodiments, the solvent comprises or comprises about 10 mM MgCh. In some embodiments, the solvent comprises water. In some embodiments, the solvent comprises any solvent such as a buffer useful for suspending nucleic acids in solution. In some embodiments, the solvent comprises T4 DNA ligase buffer. In some embodiments, the solvent comprises Tris-HCl. In some embodiments, the solvent comprises Tris-HCl at a concentration of 50 mM or about 50 mM. The solvent may have any pH. In some embodiments, the solvent has a pH of 7.5 or about 7.5.
[0047] In some embodiments, the mixture comprises a ligase 16. Ligases are enzymes that catalyze the joining of two molecules by forming a new chemical bond (i.e., by covalently linking the phosphate backbone of adjacent fragment oligonucleotides). In the context of the assembly of fragment oligonucleotides, ligases are key for catalyzing nick closure between contiguous fragment oligonucleotides, thereby ensuring a stable and continuous polynucleotide. Ligase 16 may comprise any enzyme useful for ligating DNA and / or repairing nicks in DNA such as a DNA ligase enzyme. Ligase 16 may comprise T4 DNA ligase. The concentration of ligase 16 in the mixture may be any concentration. The concentration of ligase 16 may be any concentration known in the art to promote ligase 16 enzymatic activity. In some embodiments,Attorney Docket No. 206161-0084-00WO the concentration of ligase in the mixture is in the range of 1 Weiss-Units / pL to 6 Weiss- Units / pL. Ligase 16 may be suspended in any solvent prior to adding ligase 16 to the mixture. In some embodiments, the ligase 16 is suspended in glycerol prior to adding ligase 16 to the mixture.
[0048] Polynucleotide scaffolds
[0049] Polynucleotide scaffolds generally refer to polynucleotides that can hybridize with a set of one or more adaptor oligonucleotides 12. In some embodiments, the polynucleotide scaffold includes, without limitation, DNAs, RNAs, single-stranded DNAs, double-stranded DNAs, partially double-stranded DNAs, DNA origamis, plasmids, single-stranded plasmids, phages, M13 phages, or combinations thereof. In some embodiments, the polynucleotide scaffolds include an M13 phagemid DNA (e.g., an M13 phage single-stranded plasmid of SEQ ID NO: 1).
[0050] The polynucleotide scaffolds of the present disclosure can be of any suitable length. For instance, in some embodiments, the polynucleotide scaffold comprises at least or at least about 500 nucleotides. In some embodiments, the polynucleotide scaffold 10 comprises at least or at least about 1,000 nucleotides. In some embodiments, the polynucleotide scaffold 10 comprises at least or at least about 2,500 nucleotides. In some embodiments, the polynucleotide scaffold 10 comprises at least or at least about 7,000 nucleotides. In some embodiments, the polynucleotide scaffold is at least as long or at least about as long as a desired target polynucleotide target 18. In some embodiments, the polynucleotide scaffold 10 comprises in the range of 500 to 7,000 nucleotides.
[0051] Polynucleotide scaffolds may comprise one or more adaptor binding regions. For example, a polynucleotide scaffold 10 may comprise any number of adaptor binding regions. An adaptor binding region comprises a nucleotide sequence that is complementary or substantially complementary to the nucleotide sequence of a scaffold binding region of an adaptor oligonucleotide 12, such that the adaptor binding region hybridizes with the scaffold binding region. In some embodiments, a scaffold 10 comprises one adaptor binding region corresponding to each distinct adaptor oligonucleotide 12 of a set of adaptor oligonucleotides 12. For example, a polynucleotide scaffold 10 may comprise a first adaptor binding region that is complimentaryAttorney Docket No. 206161-0084-00WO to a scaffold binding region of a first adaptor oligonucleotide 12, a second adaptor binding region that is complimentary to a scaffold binding region of a second adaptor oligonucleotide 12, etc. In some embodiments, the first, second, and any number of subsequent adaptor binding regions may begin immediately after the previous adaptor binding region. In some embodiments, there is a spacer sequence between each adaptor binding region. In some embodiments, each adaptor binding region of a scaffold 10 has low homology with other adaptor binding regions of a scaffold 10. Low homology among adaptor binding regions of a scaffold 10 may decrease the probability of an adaptor oligonucleotide 12 of a set binding to a non-corresponding adaptor binding region of a scaffold 10.
[0052] The adaptor binding regions of a polynucleotide scaffold 10 may be any length. Each adaptor binding region of a polynucleotide scaffold 10 may be the same length or about the same length. The adaptor binding regions of a polynucleotide scaffold 10 may be a length matching the scaffold binding region length of any adaptor oligonucleotides 12 in a mixture. For example, an adaptor binding region of a scaffold 10 may be or be about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. For example, an adaptor binding region of a scaffold 10 may be in the range of 10 to 50, 10 to 40, 10 to 30, 15 to 30, 15 to 25, or 20 to 25 nucleotides. For example, scaffold 10 may comprise an M13 phage singlestranded plasmid of SEQ ID NO: 1, and adaptor binding regions of scaffold 10 may be any portions of the M13 phage single-stranded plasmid of SEQ ID NO: 1. For example, the adaptor binding regions may be any subsequent portions of the Ml 3 phage single-stranded plasmid of SEQ ID NO: 1. For example, the adaptor binding regions may be any subsequent portions of the Ml 3 phage single-stranded plasmid of SEQ ID NO: 1 of equal or about equal length.
[0053] Each adaptor binding region of a scaffold 10 may have any melting temperature. Each adaptor binding region of a scaffold 10 may have the same or about the same melting temperature. Each adaptor binding region of a scaffold 10 may have a different melting temperature. In some embodiments, each adaptor binding region of a scaffold 10 has a higher melting temperature than fragment binding regions of each distinct adaptor oligonucleotide 12 of a set of distinct adaptor oligonucleotides. Each adaptor binding region of a scaffold 10 may have any GC content. Each adaptor binding region of a scaffold 10 may have the same or about theAttorney Docket No. 206161-0084-00WO same GC content.
[0054] A polynucleotide scaffold 10 may have any melting temperature. A polynucleotide scaffold 10 may have any GC content.
[0055] Adaptor oligonucleotides
[0056] Adaptor oligonucleotides generally refer to nucleotides that can co-hybridize with a polynucleotide scaffold and one or more fragment oligonucleotides. The mixtures and methods of the present disclosure may utilize various adaptor oligonucleotides. For instance, in some embodiments, the adaptor oligonucleotides include, without limitation, DNA-based nucleotides, RNA-based nucleotides, natural nucleotides, unnatural nucleotides, modified nucleotides, or combinations thereof.
[0057] For example, an adaptor oligonucleotide 12 may comprise a scaffold binding region and a fragment binding region. The scaffold binding region may be followed immediately by the fragment binding region. In other words, in some embodiments, there is no spacer between the scaffold binding region and the fragment binding region. Alternatively, in some embodiments, there is a spacer of any length between the scaffold binding region and the fragment binding region. In some embodiments, the scaffold binding region is at the 5’ end of the adaptor oligonucleotide 12 and the fragment binding region is at the 3’ end of the adaptor oligonucleotide 12. In some embodiments, the scaffold binding region is at the 3’ end of the adaptor oligonucleotide 12 and the fragment binding region is at the 5’ end of the adaptor oligonucleotide 12.
[0058] The scaffold binding region may comprise a sequence that is complementary or substantially complementary to any adaptor binding region of a scaffold 10. The fragment binding region may comprise a sequence that is complementary or substantially complementary to one or more fragments 14 or at least a portion of one or more fragments 14. For example, a fragment binding region may comprise a first fragment binding portion that is complementary to a first fragment 14 or portion thereof and a second fragment binding portion that is complementary to a second fragment 14 or portion thereof. For example, a fragment binding region may comprise a first fragment binding portion that binds to a first fragment 14 or portionAttorney Docket No. 206161-0084-00WO thereof and a second fragment binding portion that binds to a second fragment 14 or portion thereof. The first fragment binding portion may be followed immediately by the second fragment binding portion. In other words, in some embodiments, there is no spacer between the first fragment binding portion and the second fragment binding portion. The first fragment binding portion and the second fragment binding portion may be or be about the same length. The first fragment binding portion and the second fragment binding portion may be different lengths. The first fragment binding portion and the second fragment binding portion may have the same or about the same GC content. The first fragment binding portion and the second fragment binding portion may have different GC contents.
[0059] The scaffold binding region of an adaptor oligonucleotide 12 may be or be about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. For example, an adaptor binding region of a scaffold 10 may be in the range of 10 to 50, 10 to 40, 10 to 30, 15 to 30, 15 to 25, or 20 to 25 nucleotides.
[0060] The fragment binding region of an adaptor oligonucleotide 12 may be or be about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. For example, a fragment binding region of a scaffold 10 may be in the range of 5 to 50, 10 to 50, 10 to 40, 10 to 30, 15 to 30, 15 to 25, or 20 to 25 nucleotides.
[0061] The scaffold binding region and fragment binding region of an adaptor oligonucleotide 12 may be or be about the same length. The scaffold binding region and a fragment binding region of an adaptor oligonucleotide 12 may be different lengths. The scaffold binding region and fragment binding region of an adaptor oligonucleotide 12 may have the same or about the same GC content. The scaffold binding region and a fragment binding region of an adaptor oligonucleotide 12 may have different GC contents.
[0062] A set of one or more adaptor oligonucleotides 12 may comprise any number of distinct adaptor oligonucleotides 12. In some embodiments, a set of one or more adaptor oligonucleotides 12 comprises a number of distinct adaptor oligonucleotides 12 such that the total length of fragment binding regions of the distinct adaptor nucleotides 12 of the set is or is about the length of the desired target polynucleotide 18. In some embodiments, each distinctAttorney Docket No. 206161-0084-00WO adaptor 12 of the set has a scaffold binding region that is complementary to a different adaptor binding region of a scaffold 10. In some embodiments, each distinct adaptor 12 of the set has a scaffold binding region that binds to a different adaptor binding region of a scaffold 10. In some embodiments, each distinct adaptor 12 of the set has a scaffold binding region such that when bound to the scaffold 10 each distinct adaptor 12 binds to subsequent adaptor binding regions of the scaffold 10. For example, in a case in which two distinct adaptors 12 are bound to subsequent adaptor binding regions of a scaffold 10, the first portion of the fragment binding region of the first distinct adaptor 12 and the second portion of the fragment binding region of the second distinct adaptor may bind the same fragment 14 at different portions of fragment 14. In other words, a fragment 14 may simultaneously bind the first portion of the fragment binding region of the first distinct adaptor 12 and the second portion of the fragment binding region of the second distinct adaptor. For example, the fragment binding region sequences of a set of subsequent adaptors 12 may, in total, make up a nucleotide sequence that is complementary to the nucleotide sequence of a desired target polynucleotide 18.
[0063] A set of adaptors 12 may comprise any number of distinct adaptors 12. For example, a set of adaptors 12 may comprise in the range of 2 to 200, 2 to 150, 2 to 250, 2 to 300, 2 to 125, 2 to 100, 2 to 90, 2 to 80, 2 to 450, 2 to 400, 2 to 70, 2 to 60, 2 to 50, 2 to 40, 2 to 30, or 2 to 40 distinct adaptors 12. For example, a set of adaptors 12 may comprise at least or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 distinct adaptors 12. For example, a set of adaptors 12 may comprise or comprise about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 distinct adaptors 12. A set of adaptors 12 may comprise the same number or about the same number of distinct adaptors 12 as the number of distinct fragments 14 in a set of fragments 14. A set of adaptors 12 may comprise 1 more distinct adaptor 12 or 1 less distinct adaptor 12 than the number of distinct fragments 14 in a set of fragments 14.
[0064] Each distinct adaptor 12 of a set may have a scaffold binding region at the 5’ end of the adaptor 12 and a fragment binding region at the 3’ end. Each distinct adaptor 12 of a set may have a scaffold binding region at the 3’ end of the adaptor 12 and a fragment binding region atAttorney Docket No. 206I61-0084-00WO the 5’ end.
[0065] In some embodiments, distinct adaptor oligonucleotides 12 of a set do not have high complementarity to each other to avoid any adaptor 12 to adaptor 12 binding. In some embodiments, distinct adaptor oligonucleotides 12 of a set have low complementarity to any other adaptors 12 of a set to decrease the probability of adaptor 12 to adaptor 12 binding. In some embodiments, distinct adaptor oligonucleotides 12 of a set have scaffold binding regions with low homology to one another such that there is high probability of each adaptor 12 binding to the corresponding adaptor binding region of a scaffold 10.
[0066] In some embodiments, a first or second portions of a fragment binding region of an adaptor 12 of a set comprises a nucleotide sequence that does not bind any fragment 14. Now referring to Figure 9, depicted is an end of a scaffold-adaptor complex bound to at least two fragments 14. As described previously, distinct adaptors 12 of a set may be bound to a set of subsequent adaptor binding regions of scaffold 10. In this embodiment, adaptors 12 bound to the first or last of the set of subsequent adaptors may comprise a first or second portion of a fragment binding region that does not bind to a fragment 14. For example, an adaptor 12 may be bound to the first or last of a set of subsequent adaptors such that the outermost portion of the fragment binding region does not bind a fragment 14. A portion of a fragment binding that does not bind a fragment 14 may comprise a nucleotide sequence that is not complementary to any fragment 14 of a set. A fragment binding portion that does not bind a fragment 14 may comprise a polyT, Poly A, PolyC, or PolyG nucleotide sequence. A fragment binding portion that does not bind a fragment 14 may any suitable nucleotide length.
[0067] In some embodiments, a scaffold comprises an M13 phage single-stranded plasmid of SEQ ID NO: 1 and the set of adaptor oligonucleotides 12 comprises any combination of one or more adaptors 12 having a sequence selected from the group consisting of: SEQ ID NOs: 2-32. In some embodiments, a scaffold comprises an M13 phage single-stranded plasmid of SEQ ID NO: 1, and the set of adaptor oligonucleotides 12 comprises any combination of one or more adaptors 12 having a scaffold binding region of the scaffold binding region or any portion thereof of sequences selected from the group consisting of: SEQ ID NOs: 2-32. In some embodiments, a scaffold comprises an M13 phage single-stranded plasmid of SEQ ID NO: 1,Attorney Docket No. 206161-0084-00WO and the set of adaptor oligonucleotides 12 comprises a group of one or more adaptors 12 having a scaffold binding region of the scaffold binding region or any portion thereof of subsequent sequences selected from the group consisting of: SEQ ID NOs:2-32 (e.g., SEQ ID NOs:l, 2, 3, SEQ ID NOs: 14, 15, 16, 17, 18, SEQ ID NOs: 20, 21, 22, 23, 24, 25, 26, 27, 28, etc.). The scaffold binding regions of SEQ ID NOs: 2-32 comprise the 21 nucleotides beginning at the 5’ end (i.e., first 21 nucleotides) of SEQ ID NOs: 2-32.
[0068] In some embodiments, a scaffold comprises an Ml 3 phage single- stranded plasmid of SEQ ID NO: 1, and the set of adaptor oligonucleotides 12 comprises any combination of one or more adaptors 12 having a scaffold binding region selected from the group consisting of: SEQ ID NOs: 63-93. In some embodiments, a scaffold comprises an M13 phage single-stranded plasmid of SEQ ID NO: 1, and the set of adaptor oligonucleotides 12 comprises a group of one or more adaptors 12 having a scaffold binding region of subsequent sequences selected from the group consisting of: SEQ ID NOs: 63-93 (e.g., SEQ ID NOs: 71, 72, 73, SEQ ID NOs: 84, 85, 86, 87, 88, SEQ ID NOs: 80, 81, 82, 83, 84, 85, 86, 87, 88, etc.).
[0069] The adaptor oligonucleotides 12 of the present disclosure can be of any suitable length. For instance, in some embodiments, the adaptor oligonucleotides 12 of the present disclosure comprise at least or at least about 10 nucleotides. In some embodiments, the adaptor oligonucleotides 12 of the present disclosure comprise at least or at least about 20 nucleotides. In some embodiments, the adaptor oligonucleotides 12 of the present disclosure comprise at least or at least about 30 nucleotides. In some embodiments, the adaptor oligonucleotides 12 of the present disclosure comprise at least or at least about 40 nucleotides. In some embodiments, the adaptor oligonucleotides 12 of the present disclosure comprise in the range of about 10 nucleotides to about 100 nucleotides. In some embodiments, the adaptor oligonucleotides 12 of the present disclosure comprise in the range of 10 to 60, 10 to 50, 20 to 50, 25 to 45, 30 to 50, 35 to 45, or 40 to 45 nucleotides. In some embodiments, the adaptor oligonucleotides 12 of the present disclosure comprise 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides.
[0070] In some embodiments, the adaptor oligonucleotides 12 of a set do not share complementary sequences with one another. In some embodiments, the adaptor oligonucleotidesAttorney Docket No. 206161-0084-00WO12 of the present disclosure do not hybridize to one another. As such, in some embodiments, each adaptor oligonucleotide 12 can have any concentration in excess of the polynucleotide scaffold 10 concentration, which may ensure that every polynucleotide scaffold could have all the appropriate adaptor oligonucleotides bound to it, with excess adaptor oligonucleotides in the mixture not interacting with each other.
[0071] Fragment oligonucleotides
[0072] A fragment oligonucleotide 14 may be a polynucleotide of any length. A fragment oligonucleotide 14 may be a DNA-based nucleotide, an RNA-based nucleotide, a natural nucleotide, an unnatural nucleotide, a modified nucleotides, or a combination thereof.
[0073] A set of fragment oligonucleotides 14 may comprise a set of distinct oligonucleotides that may be assembled to form the target polynucleotide 18. In other words, a set of fragment oligonucleotides 14, may comprise a first distinct fragment oligonucleotide 14 having a sequence of a first portion of target oligonucleotide 18, a second distinct fragment oligonucleotide 14 having a sequence of a second portion of target oligonucleotide 18, etc. In this embodiment, each first portion, second portion, etc. may be sequential portions of target polynucleotide 18 that when assembled make up a larger portion of or the entire sequence of target polynucleotide 18.
[0074] A set of fragment oligonucleotides 14 may comprise any number of distinct fragment oligonucleotides 14. For example, A set of fragment oligonucleotides 14 may comprise in the range of 2 to 200, 2 to 150, 2 to 250, 2 to 300, 2 to 125, 2 to 100, 2 to 90, 2 to 80, 2 to 450, 2 to 400, 2 to 70, 2 to 60, 2 to 50, 2 to 40, 2 to 30, or 2 to 40 distinct fragment oligonucleotides 14. For example, A set of fragment oligonucleotides 14 may comprise at least or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 distinct fragment oligonucleotides 14. For example, A set of fragment oligonucleotides 14 may comprise or comprise about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 distinct fragment oligonucleotides 14. A set of fragment oligonucleotides 14 may comprise the same number or about the same number of distinct fragments 12 as the number of distinct adaptors 12 in a set of adaptors 12. A set of fragment oligonucleotides 14 mayAttorney Docket No. 206161-0084-00WO comprise 1 less distinct fragment 14 or 1 more distinct fragment 14 than the number of distinct adaptors 12 in a set of adaptors 12.
[0075] Each distinct fragment oligonucleotide 14 of a set may bind to one or more adaptors 12. For example, a fragment oligonucleotide 14 may comprise a first adaptor binding portion that binds a first adaptor 12 and a second adaptor binding portion that binds a second adaptor 12. For example, a fragment oligonucleotide 14 may comprise a first adaptor binding portion that comprises a nucleotide sequence that is complementary to first adaptor 12 and a second adaptor binding portion that comprises a nucleotide sequence that is complementary to a second adaptor 12. For example, a fragment 14 may co-hybridize to two adaptors 12 that are bound to adjacent adaptor binding regions of a scaffold 10.
[0076] In some examples, first adaptor binding portion of a fragment 14 is immediately followed by second adaptor binding portion of the fragment 14. In some examples, there is a spacer between first adaptor binding portion and second adaptor binding portion. In this embodiment, the spacer will then be included in a formed target polynucleotide 18. The spacer may be any length of nucleotides. For example, the spacer may be or be about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, or 400 nucleotides. For example, the spacer may be a length in the range of 1 to 400 nucleotides. Fragments 14 having a spacer may allow for synthesizing longer target polynucleotides 18 without increasing the number of distinct adaptors 12, distinct fragments 14, and / or the length of the scaffold 10 in a mixture.
[0077] First and second adaptor binding portions of a fragment 14 may be any length. In some embodiments, the length of first and / or second adaptor binding portions of a fragment 14 are shorter than the scaffold binding regions of a set of adaptors 12 in a mixture. In some embodiments, the length of first and / or second adaptor binding portions of a fragment 14 are shorter than the adaptor binding regions of a scaffold 10 in a mixture. In some embodiments, the first and / or second adaptor binding portions of a fragment 14 have a lower melting temperature than the adaptor binding regions of a scaffold 10 in a mixture. In some embodiments, the first and / or second adaptor binding portions of a fragment 14 have a lower melting temperature than the adaptor binding regions of a scaffold 10 in a mixture. A fragment 14 having first and / orAttorney Docket No. 206161-0084-00WO second adaptor binding portions with a lower melting temperature than the adaptor binding regions of a scaffold 10 may allow for the formation of a scaffold-adaptor complex in solution prior to the binding of fragment 14 to one or more adaptors 12. The formation of a scaffoldadaptor complex prior to fragment 14 binding to adaptors 12 may be favorable for increasing yield.
[0078] Fragment oligonucleotides 14 may be any polynucleotide. For instance, in some embodiments, the fragment oligonucleotides include without limitation, DNA-based nucleotides, RNA-based nucleotides, natural nucleotides, unnatural nucleotides, modified nucleotides, or combinations thereof.
[0079] Distinct fragments 14 of a set may comprise modifications at any nucleotide at which the desired target polynucleotide 18 comprises a modification. Since fragments 14 may be assembled to form a target polynucleotide 18, modifications included in a fragment 14 will also be included at the corresponding location of the target polynucleotide 18. Any nucleotide modification known in the art may be incorporated in any base of a fragment 14.
[0080] In some embodiments, the fragment oligonucleotides 14 of the present disclosure comprise modified nucleotides. In some embodiments, the modified nucleotides are modified with one or more molecules. In some embodiments, the molecules include, without limitation, methyl groups, amine groups, alkyne groups, thiol groups, azide groups, digoxigenin, cholesterol, triethylene glycerol (TEG), fluorophores, phosphorylated groups, quenchers, fluorescent dyes, biotin, cross-linking agents, spacers, molecules that include covalent carbonheteroatom bonds, molecules that include phosphorothioate bonds, or combinations thereof.
[0081] The fragment oligonucleotides 14 of the present disclosure can be of any suitable length. For instance, in some embodiments, the fragment oligonucleotides 14 of the present disclosure comprise at least 10 nucleotides. In some embodiments, the fragment oligonucleotides 14 of the present disclosure comprise at least 20 nucleotides. In some embodiments, the fragment oligonucleotides 14 of the present disclosure comprise in the range of about 10 nucleotides to about 50 nucleotides. In some embodiments, the fragment oligonucleotides 14 of the present disclosure comprise in the range of 5 to 60, 5 to 30, 5 to 25, 10 to 25, 15 to 25, 10 to 15, 18 to 24,Attorney Docket No. 206161-0084-00WO or 10 to 18 nucleotides. In some embodiments, the fragment oligonucleotides 14 of the present disclosure comprise about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. In some embodiments, the fragment oligonucleotides 14 of the present disclosure comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. The first adaptor binding portion and second adaptor binding portion of a fragment 14 may be the same length or about the same length. The first adaptor binding portion and second adaptor binding portion of a fragment 14 may be a different length. The first adaptor binding portion and / or second adaptor binding portion of a fragment 14 may be or be about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. The first adaptor binding portion and / or second adaptor binding portion of a fragment 14 may be in the range of 5 to 40, 5 to 30, 5 to 25, 10 to 25, 10 to 30, 5 to 20, 15 to 25, 5 to 15, 9 to 12, 8 to 13, or 20 to 25 nucleotides.
[0082] Method
[0083] In some embodiments, the present disclosure pertains to a method of synthesizing a polynucleotide. In some embodiments illustrated in FIGS. 1A-1E, the methods of the present disclosure include a step of associating a polynucleotide scaffold 10 with a plurality of adaptor oligonucleotides 12 and a plurality of fragment oligonucleotides 14 to form a mixture (FIGS. 1A-1C). In some embodiments, each of the adaptor oligonucleotides 12 includes subsequences that become hybridized with the polynucleotide scaffold 10, and other subsequences that become hybridized with subsequences of the fragment oligonucleotides 14 to form adaptor nucleotide: fragment oligonucleotide complexes (FIG. 1C).
[0084] In some embodiments, the methods of the present disclosure also include a step of adding a ligase 16 to the mixture containing adaptor oligonucleotide: fragment oligonucleotide complexes (FIGS. 1C and IE). In some embodiments, the ligase ligates the adjacent fragment oligonucleotides 14 of the adaptor oligonucleotide: fragment oligonucleotide complexes to one another to form the target polynucleotide 18 (FIG. ID).Attorney Docket No. 206161-0084-00WO
[0085] Association of nucleotide components
[0086] Various methods may be utilized to associate a polynucleotide scaffold with a plurality of adaptor oligonucleotides and a plurality of fragment oligonucleotides (hereinafter “nucleotide components”). For instance, in some embodiments, the association occurs by mixing the nucleotide components.
[0087] In some embodiments, the sample containing the nucleotide components may be denatured. In some embodiment, denaturing may occur by heating the nucleotide components to 90 °C.
[0088] In some embodiments, the nucleotide components may be associated with one another at the same time. For instance, in some embodiments, a polynucleotide scaffold may be simultaneously associated with a plurality of adaptor oligonucleotides and a plurality of fragment oligonucleotides.
[0089] In some embodiments, the nucleotide components may be associated with one another at different times. For instance, in some embodiments, a polynucleotide scaffold may first be associated with a plurality of adaptor oligonucleotides and then be associated with a plurality of fragment oligonucleotides.
[0090] Nucleotide components may be associated with one another at various ratios. For instance, in some embodiments, adapter oligonucleotides and fragment oligonucleotides may be in excess concentration over the polynucleotide scaffold. In some embodiments, the polynucleotide scaffold, the adaptor oligonucleotides, and the fragment oligonucleotides may be associated with one another at a molar ratio of 1 :2:2.
[0091] In some embodiments, the association step also includes a step of heating and then cooling the mixture containing the nucleotide components. The heating step may occur for various periods of time. For instance, in some embodiments, the heating step may occur for about 30 seconds to about 90 seconds. In some embodiments, the heating step may occur for less than 60 seconds.
[0092] The heating step may occur at various temperatures. For instance, in some embodiments, the heating step may occur at a temperature ranging from about 60 °C to about 90 °C. In someAttorney Docket No. 206161-0084-00WO embodiments, the heating step may occur at a temperature of at least about 90 °C.
[0093] In some embodiments, the cooling step includes a step of reducing the mixture temperature. In some embodiments, the temperature reduction step occurs after the heating step.
[0094] The temperature reduction step may reduce the mixture temperature to various temperature ranges. For instance, in some embodiments, the reduced temperature ranges from about 60 °C to about 40 °C. In some embodiments, the reduced temperature is less than about 60 °C. In some embodiments, the cooling includes reducing the mixture temperature by at least 30 °C in less than about 30 minutes (e.g., cooling from about 90 °C to about 60 °C in about 30 minutes), and further reducing the mixture temperature by at least 30 °C in more than about 6 hours (e.g., cooling from about 60 °C to about 40 °C in about 12 hours).
[0095] Mixtures may be maintained at reduced temperatures for various periods of time. For instance, in some embodiments, a mixture may be maintained at a reduced temperature for at least about 1 hour. In some embodiments, a mixture may be maintained at a reduced temperature for at least about 5 hours.
[0096] In some aspects, the invention relates to a method of synthesizing a polynucleotide. Now referring to Figure 8, in some embodiments, the invention relates to a method 200 for synthesizing a target polynucleotide 18. In some embodiments, method 200 comprises the steps of 210 forming a mixture comprising a target polynucleotide scaffold 10, a set of one or more adaptor oligonucleotides 12, and a set of one or more fragment oligonucleotides 14, 220 cooling the mixture, and 230 adding a DNA ligase to the mixture. In some embodiments, step 230 results in the formation of one or more target polynucleotides 18 in the mixture. In some embodiments, method 200 further comprises the step of 240 retrieving the one or more target polynucleotides 18 from the solution.
[0097] In some embodiments, method 200 comprises the step of 210 forming a mixture comprising a scaffold 10, a set of one or more adaptor oligonucleotides 12, and a set of one or more fragment oligonucleotides 14. A scaffold 10, a set of one or more adaptor oligonucleotides 12, and a set of one or more fragment oligonucleotides 14 may be referred to herein as nucleotide components. In some embodiments, the mixture of step 210 comprises any mixture describedAttorney Docket No. 206161-0084-00WO herein comprising a polynucleotide scaffold 10, a set of one or more adaptor oligonucleotides 12, and a set of one or more fragment oligonucleotides 14. In some embodiments, the mixture of step 210 further comprises a ligase 16.
[0098] In some embodiments, a first mixture is formed comprising the scaffold 10 and the set of one or more adaptor oligonucleotides 12. Then, the set of one or more fragments 14 may be added to the first mixture to form the mixture comprising the scaffold 10, the set of one or more adaptor oligonucleotides 12, and the set of one or more fragment oligonucleotides 14.
[0099] The mixture of step 210 may be formed by any method. For example, the mixture of step 210 may be formed by mixing any number of individual mixtures comprising any combination of one or more of: a scaffold 10, a set of one or more adaptor oligonucleotides 12, and a set of one or more fragment oligonucleotides 14. For example, the mixture of step 210 may be formed by mixing any number of individual mixtures comprising any combination of one or more of: a scaffold 10, a set of one or more adaptor oligonucleotides 12, a set of one or more fragment oligonucleotides 14, and a ligase 16.
[0100] For example, the mixture of step 210 may be formed by suspending (i.e., dissolving) any combination of one or more of: a scaffold 10, a set of one or more adaptor oligonucleotides 12, and a set of one or more fragment oligonucleotides 14 in a solvent. For example, the mixture of step 210 may be formed by suspending (i.e., dissolving) any combination of one or more of: a scaffold 10, a set of one or more adaptor oligonucleotides 12, a set of one or more fragment oligonucleotides 14, and a ligase in a solvent. The mixture of step 210 may be formed by a combination of mixing individual mixtures and directly resuspending nucleotide components and / or a ligase 16 in the mixture.
[0101]
[0102] The mixture of step 210 may be formed at any temperature. In some embodiments, the mixture of step 210 is formed at any temperature, for example, room temperature, and is then heated to reach a first temperature. The first temperature may be any temperature. In some embodiments, the first temperature is sufficiently high such that any nucleic acids of the mixture are melted. In some embodiments, the first temperature is at least greater than the meltingAttorney Docket No. 206161-0084-00WG temperature of the scaffold 10, an adaptor oligonucleotide 12, a fragment oligonucleotide 14, and / or a target polynucleotide 18. In some embodiments, the first temperature is or is about 60 °C, 65 °C, 70 °C, 75 °C, 80 °C, 81 °C, 82 °C, 83 °C, 84 °C, 85 °C, 86 °C, 87 °C, 88 °C, 89 °C, 90 °C, 91 °C, 92 °C, 93 °C, 94 °C, 95 °C, 96 °C, 97 °C, 98 °C, or 99 °C. In some embodiments, the first temperature is at least or at least about 60 °C, 65 °C, 70 °C, 75 °C, 80 °C, 81 °C, 82 °C, 83 °C, 84 °C, 85 °C, 86 °C, 87 °C, 88 °C, 89 °C, 90 °C, 91 °C, 92 °C, 93 °C, 94 °C, 95 °C, 96 °C, 97 °C, 98 °C, or 99 °C. In some embodiments, the first temperature is in the range of 60 °C to 90 °C.
[0103] In some embodiments, the mixture is maintained at the first temperature for any duration. In some embodiments, the mixture is maintained at the first temperature for at least or at least about 30 second, 60 seconds, or 90 seconds. In some embodiments, the mixture is maintained at the first temperature for a duration in the range of 30 seconds to 90 seconds. In some embodiments, the mixture is maintained at the first temperature for less than 30 seconds, 60 seconds, or 90 seconds.
[0104] In some embodiments, method 200 comprises the step of 220 cooling the mixture. In some embodiments, step 220 comprises cooling the mixture from the first temperature to a reduced temperature. In some embodiments, the reduced temperature is sufficiently low such that any single stranded nucleic acids of the mixture are annealed to a complementary single stranded nucleic acid. In some embodiments, the reduced temperature is sufficiently low such that any single stranded nucleic acids have a high probability of annealing to a complementary single stranded nucleic acid. In some embodiments, the reduced temperature is at most less than the melting temperature of the scaffold 10, an adaptor oligonucleotide 12, a fragment oligonucleotide 14, and / or a target polynucleotide 18.
[0105] In some embodiments, the reduced temperature is or is about 40 °C, 41 °C, 42 °C, 43 °C, 44 °C, 45 °C, 46 °C, 47 °C, 48 °C, 49 °C, 50 °C, 51 °C, 52 °C, 53 °C, 54 °C, 55 °C, 56 °C, 57 °C, 58 °C, 59 °C, or 60 °C. In some embodiments, the reduced temperature is less than 40 °C, 41 °C, 42 °C, 43 °C, 44 °C, 45 °C, 46 °C, 47 °C, 48 °C, 49 °C, 50 °C, 51 °C, 52 °C, 53 °C, 54 °C, 55 °C, 56 °C, 57 °C, 58 °C, 59 °C, or 60 °C. In some embodiments, the reduced temperature is in the range of 40 °C to 60 °C.Attorney Docket No. 206161-0084-00WO
[0106] The mixture may be cooled such that the temperature of the mixture is reduced from the first temperature to the reduced temperature at any rate. In some embodiments, the cooling includes reducing the mixture temperature by at least 30 °C in less than about 30 minutes (e.g., cooling from about 90 °C to about 60 °C in about 30 minutes), and further reducing the mixture temperature by at least 30 °C in more than about 6 hours (e.g., cooling from about 60 °C to about 40 °C in about 12 hours).
[0107] The mixture may be cooled such that the temperature of the mixture is reduced from the first temperature to the reduced temperature in a duration of or of about 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs or 24 hrs. The mixture may be cooled such that the temperature of the mixture is reduced from the first temperature to the reduced temperature in a duration of at least 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs or 24 hrs. The mixture may be cooled such that the temperature of the mixture is reduced from the first temperature to the reduced temperature in a duration of less than 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs or 24 hrs. The mixture may be cooled such that the temperature of the mixture is reduced from the first temperature to the reduced temperature in a duration in the range of 15 min to 24 hours.
[0108] In some embodiments, cooling more gradually allows for scaffold 10 to adaptor 12 binding prior to adaptor 12 to fragment 14 binding. For example, scaffold 10 to adaptor 12 binding may favored at a higher temperatures than adaptor 12 to fragment 14 binding is favored. Therefore gradual cooling may allow the mixture to exhibit higher temperatures for a duration that allows for substantial scaffold 10 to adaptor 12 binding prior to reaching temperatures that allow for substantial adaptor 12 to fragment 14 binding.
[0109] In some embodiments, step 220 comprises the steps of cooling the mixture to reach a first reduced temperature, and subsequently cooling the mixture to reach a second reduced temperature. In some embodiments, the first reduced temperature is greater than the second reduced temperature. The first temperature may be a temperature favorable for scaffold 10 to adaptor 12 binding. The first temperature may be a temperature greater than a temperature favorable for scaffold 10 to adaptor 12 binding. The second temperature may be a temperatureAttorney Docket No. 206161-0084-00WO favorable for adaptor 12 to fragment 14 binding. In some embodiments, cooling the mixture to reach a first temperature comprises rapidly cooling. In some embodiments, subsequently cooling the mixture to reach a second temperature comprises gradual cooling.
[0110] The first reduced temperature may be or be about 40 °C, 41 °C, 42 °C, 43 °C, 44 °C, 45 °C, 46 °C, 47 °C, 48 °C, 49 °C, 50 °C, 51 °C, 52 °C, 53 °C, 54 °C, 55 °C, 56 °C, 57 °C, 58 °C, 59 °C, or 60 °C, 61 °C, 62 °C, 63 °C, 64 °C, 65 °C, 66 °C, 67 °C, 68 °C, 69 °C, or 70 °C. The first reduced temperature may be in the range of 40 °C to 70 °C. The first reduced temperature may be less than 50 °C, 51 °C, 52 °C, 53 °C, 54 °C, 55 °C, 56 °C, 57 °C, 58 °C, 59 °C, or 60 °C, 61 °C, 62 °C, 63 °C, 64 °C, 65 °C, 66 °C, 67 °C, 68 °C, 69 °C, or 70 °C. In some embodiments, the mixture is cooled from the first temperature to the first reduced temperature in a duration of or of about 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs, or 24 hrs. In some embodiments, the mixture is cooled from the first temperature to the first reduced temperature in a duration of less than 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs, or 24 hrs. In some embodiments, the mixture is cooled from the first temperature to the first reduced temperature in a duration in the range of 15 min to 24 hours.
[0111] The mixture may be maintained at the first reduced temperature for any duration prior to cooling the mixture to reach the second reduced temperature. The mixture may be maintained at the first reduced temperature for a duration of or of about 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs, or 24 hrs. The mixture may be maintained at the first reduced temperature for a duration of at least or of at least about 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs, or 24 hrs.
[0112] The second reduced temperature may be or be about 40 °C, 41 °C, 42 °C, 43 °C, 44 °C, 45 °C, 46 °C, 47 °C, 48 °C, 49 °C, 50 °C, 51 °C, 52 °C, 53 °C, 54 °C, 55 °C, 56 °C, 57 °C, 58 °C, 59 °C, or 60 °C. The second reduced temperature may be or be about 1 °C, 2 °C, 3 °C, 4 °C, 5 °C, 6 °C, 7 °C, 8 °C, 9 °C, 10 °C, 11 °C, 12 °C, 13 °C, 14 °C, 15 °C, 16 °C, 17 °C, 18 °C, 19 °C, 20 °C, 21 °C, 22 °C, 23 °C, 24 °C, 25 °C, 26 °C, 27 °C, 28 °C, 29 °C, or 30 °C less than the first reduced temperature. In some embodiments, the mixture is cooled from the first reducedAttorney Docket No. 206161-0084-00WO temperature to the second reduced temperature in a duration of or of about 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs or 24 hrs. In some embodiments, the mixture is cooled from the first reduced temperature to the second reduced temperature in a duration of greater than 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs or 24 hrs. In some embodiments, the mixture is cooled from the first temperature to the first reduced temperature in a duration in the range of 15 min to 24 hours.
[0113] The mixture may be maintained at the second reduced temperature for any duration. The mixture may be maintained at the second reduced temperature for a duration of or of about 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs or 24 hrs. The mixture may be maintained at the second reduced temperature for a duration of at least or of at least about 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs or 24 hrs.
[0114] In some embodiments, performing the steps of 210 forming a mixture comprising a polynucleotide scaffold 10, a set of one or more adaptor oligonucleotides 12, and a set of one or more fragment oligonucleotides 14 and the step of 220 cooling the mixture results in the association of nucleotide components.
[0115] In some embodiments, the hybridization of subsequences of adaptor oligonucleotides 12 with subsequences of fragment oligonucleotides 14 occur through cooperative binding. In some embodiments illustrated in FIG. ID, cooperative binding includes the binding of a first subsequence of a fragment oligonucleotide 14 to a subsequence of a first adaptor oligonucleotide 12, and a binding of a second subsequence of the fragment oligonucleotide 14 to a subsequence of a second adaptor oligonucleotide 12. In some embodiments, the first and second subsequences may be contiguous. In some embodiments, the first and second subsequences may be non-contiguous. In some embodiments, the bindings occur through self-assembly. In some embodiments, each of the individual bindings are unstable while the joint bindings are more stable. Hence, each fragment oligonucleotide 14 binds stably to the assembly via at least two subsequences: one subsequence on one adapter oligonucleotide 12 and another subsequence on another adapter oligonucleotide 12 (i.e., multiple adapter oligonucleotides 12 “cooperate” to helpAttorney Docket No. 206161-0084-00WO fragment oligonucleotide 14 bind).
[0116] In some embodiments, a fragment oligonucleotide may bind to more than two adaptor nucleotides. For instance, in some embodiments, cooperative binding includes the binding of a first subsequence of a fragment oligonucleotide to a subsequence of a first adaptor oligonucleotide, a binding of a second subsequence of the fragment oligonucleotide to a subsequence of a second adaptor oligonucleotide, and a binding of a third subsequence of the fragment oligonucleotide to a subsequence of a third adaptor oligonucleotide.
[0117] In more specific embodiments illustrated in FIGS. 1 A-1C, cooperative binding may occur once mixing temperatures are lowered. As the temperature is slowly lowered (annealing), adapter oligonucleotides 12 begin binding to the polynucleotide scaffold 10 at a temperature at which certain numbers of base pairs (e.g., 21 base pairs (bp)) become slightly favorable to bind (e.g., around 45-55 C). At the same temperature, it also becomes favorable for each fragment oligonucleotide 14 to bind to adapter oligonucleotides 12 at a certain number of base pairs (e.g., 21 bp). This example illustrates how adapter oligonucleotides 12 use cooperative binding, where, at a temperature where certain numbers of base pairs (e.g., 21 bp for two domains) are stable but other / fewer numbers of base pairs (e.g., 10-11 bp for one domain) may not be stable, two adjacent adapter oligonucleotides 12 must both be bound to the polynucleotide scaffold 10 before a fragment oligonucleotide 14 can bind with a total desirable base pair (e.g., 21 total bp (e.g., 10 on one adapter oligonucleotide 12 and 11 on the other adapter oligonucleotide 12). After reaching a certain temperature (e g., room temperature), a ligase 16 (e.g., a T4 DNA ligase) is added, and the temperature is raised to 37 C for one hour, allowing ligase 16 to close the nicks between adjacent fragment oligonucleotides 14, thereby joining them into polynucleotide 18.
[0118] In some embodiments, method 200 comprises the step of 230 adding a ligase to the mixture. The ligase may be ligase 16. In some embodiments, the ligase is added to the mixture after cooling the mixture. In some embodiments, ligase 16 is added to the mixture prior to or subsequent to cooling the mixture to reach a ligase temperature. The ligase temperature may be lower than the reduced temperature, first reduced temperature, and / or second reduced temperature. The ligase temperature may be any temperature at which a ligase enzyme is active. The ligase temperature may be or be about 32 °C, 33 °C, 34 °C, 35 °C, 36 °C, 37 °C, 38 °C, 39Attorney Docket No. 206161-0084-00WO°C, 40 °C, 41 °C, or 42 °C. The ligase temperature may be in the range of 32 °C to 42 °C.
[0119] In some embodiments, after the step of adding ligase 16 the mixture is incubated at the ligase temperature for any duration. The duration of incubation may be a duration long enough such that all of or a substantial portion of fragments 14 in the mixture are ligated by the ligase 16. The duration of incubation may be a duration of or of about 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs or 24 hrs. The duration of incubation may be a duration of at least or at least about 15 min, 30 min, 45 min, 1 hr, 1.5 hrs, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 12 hrs, 16 hrs, 20 hrs or 24 hrs.
[0120] As set forth in more detail herein, the methods of the present disclosure can have numerous embodiments.
[0121] Polynucleotide purification
[0122] In some embodiments, method 200 comprises the step of 240 retrieving the target polynucleotide 18 from the mixture. In some embodiments, retrieving the target polynucleotide 18 comprises purifying the target polynucleotide.
[0123] In some embodiments, the methods of the present disclosure also include a step of purifying the formed polynucleotides such as target polynucleotide 18. Various methods may be utilized to purify formed polynucleotides. For instance, in some embodiments, polynucleotide purification comprises separating the formed polynucleotide from other mixture components and extracting the separated polynucleotide. In some embodiments, the separating occurs by gel electrophoresis. In some embodiments, the separating occurs by agarose gel electrophoresis. In some embodiments, the separating occurs by polyacrylamide gel electrophoresis.
[0124] In some embodiments, separation is performed via magnetic beads by exploiting the binding affinity of modified nucleotides to specific functionalized magnetic beads. In some embodiments, magnetic bead based separation comprises capturing the target polynucleotide 18 using a 5’ biotin tag. For example, one or more fragments 14 may comprise a molecule useful for separation and or capture such as biotin or streptavidin. In some embodiments, the molecule useful for separation and / or capture is attached to the fragment 14 and therefore targetAttorney Docket No. 206161-0084-00WO polynucleotide 18 via a cleavable linker. In some embodiments, the cleavable linker is a photocleavable linker. In some embodiments, the cleavable linker may be leaved via an enzyme. In some embodiments, a spacer is added between the molecule useful for separation and capture and the cleavable linker. For example, a formed polynucleotide such as target polynucleotide 18 may be first separated via the molecule useful for separation which may then be cleaved such that only a purified target polynucleotide 18 may be provided without any additional bound molecule.
[0125] In some embodiments, magnetic bead based separation further comprises capturing target polynucleotide 18 via an oligonucleotide 18 that is complementary to any portion of target polynucleotide 18. For example, a target polynucleotide may first be separated by using a molecule useful for separation or capture and may then be further purified via a complementary oligonucleotide. Purification via a complementary oligonucleotide may removing any remaining contaminants (e.g., partial products, potential streptavidin monomers, and / or bead fragments). A variation of this could be using enzyme to cleave instead of using a photocleavable linker. In some embodiments, further purification is performed via any gel-based method or any methods for molecule size selection for example using (solid-phase reversible immobilization) SPRI beads.
[0126] In some embodiments, separation involves Methanol -Responsive Polymer PCR (MeRPy-PCR), where primers bearing a polyacrylamide-co-acrylate tag are used. In some embodiments, such a method facilitates the selective precipitation and recovery of the formed oligonucleotide strands after amplification. Alternatively, separation can also be achieved by combining any of the above methods.Target Polynucleotides
[0127] The mixtures and methods of the present disclosure may be utilized to form various target polynucleotides. For instance, in some embodiments, the target polynucleotides include single-stranded polynucleotides, DNA, double-stranded polynucleotides, single-stranded DNA, double-stranded DNA, partially double-stranded DNAs, RNA, double-stranded RNA, singleAttorney Docket No. 206161-0084-00WO stranded RNA, modified nucleotides, or combinations thereof. The target polynucleotide may be any target polynucleotide 18.
[0128] In some embodiments, a target polynucleotide comprises double-stranded DNA or RNA. In some embodiments, the double-stranded DNA or RNA is formed by an amplification of a formed single-stranded DNA or RNA, such as through a polymerase chain reaction.
[0129] In some embodiments, double-stranded DNA or RNA may be formed by first synthesizing a polynucleotide as two complementary strands in separate reactions via the mixtures and / or methods described herein. The complementary strands may then be hybridized together.
[0130] In another embodiment, double-stranded DNA or RNA may also be formed by taking the initially formed target polynucleotide, and mixing it with shorter complementary strands (complementary monomers). These complementary monomers can hybridize with the initial polynucleotide, and ligase can then be used to covalently join the complementary monomers, resulting in double-stranded DNA or RNA.
[0131] In some embodiments, the target polynucleotides may comprise more than 200 nucleotides. In some embodiments, the target polynucleotide comprises modified nucleotides. In some embodiments, the modified nucleotides are modified with one or more molecules. In some embodiments, the molecules comprise, without limitation, methyl groups, amine groups, alkyne groups, thiol groups, azide groups, digoxigenin, cholesterol, triethylene glycerol (TEG), fluorophores, quenchers, fluorescent dyes, biotin, cross-linking agents, spacers, molecules that include covalent carbon-heteroatom bonds, molecules that include phosphorothioate bonds, or combinations thereof.Kits
[0132] The present invention also pertains to kits useful in the methods of the invention. Such kits comprise various combinations of components useful in any of the methods described elsewhere herein, including for example, a polynucleotide scaffold 10, a set of one or more adaptor oligonucleotides 12, and / or a set of one or more fragment oligonucleotides 14. A kit may also comprise a ligase 16. A kit may also comprise instructional material. A kit may compriseAttorney Docket No. 206161-0084-00WG any nucleic acids or enzymes in any form, for example suspended in solution, lyophilized, frozen, etc. A kit may comprise mixtures of any combination of one or more of: a polynucleotide scaffold 10, a set of one or more adaptor oligonucleotides 12, a set of one or more fragment oligonucleotides 14, and a ligase 16. A kit may comprise materials useful for separating and / or purifying polynucleotides.
[0133] Advantages and Applications
[0134] The polynucleotide synthesis methods of the present disclosure provide numerous advantages over existing polynucleotide synthesis methods. For instance, in some embodiments, the polynucleotide synthesis methods of the present disclosure provide facile and low cost methods of synthesizing different types of polynucleotides without the need for sophisticated equipment, multiple steps, restriction enzymes, or restriction enzyme sites that may create “scar” sequences on the synthesized polynucleotides.
[0135] Moreover, since polynucleotides synthesized by the methods of the present disclosure do not represent replicated sequences (e.g., PCR amplified sequences), the synthesized polynucleotides can be more readily modified by various molecules (e.g., as described above).
[0136] Additionally, by relying on scaffolded self-assembly and cooperative binding, the polynucleotide synthesis methods of the present disclosure overcome the low-yield limitation present in other forms of polynucleotide synthesis methods. Specifically, the template-guided assembly process described herein can prevent the formation of overlapping partial products since each fragment oligonucleotide may independently find its target position rather than forming intermediate products. Similarly, repetitive sequences no longer pose a challenge, since each fragment oligonucleotide’s position is defined not by its end sequences alone (as in Gibson or Golden-Gate assembly), but by its complete complementarity to a specific scaffold region.
[0137] As such, the polynucleotide synthesis methods of the present disclosure can find numerous applications. Such applications include, without limitation, DNA-based biocomputing, personalized medicine, DNA or RNA-based vaccine development, diagnostics, and / or gene synthesis.EmbodimentsAttorney Docket No. 206161-0084-00WO
[0138] Embodiment 1. A mixture comprising a scaffold polynucleotide comprising a scaffold nucleotide sequence, a first adaptor oligonucleotide comprising a first scaffold binding nucleotide sequence and a first fragment binding nucleotide sequence, wherein the first scaffold binding nucleotide sequence is complementary to a first portion of the scaffold nucleotide sequence, a second adaptor oligonucleotide comprising a second scaffold binding nucleotide sequence and a second fragment binding nucleotide sequence, wherein the second scaffold binding nucleotide sequence is complementary to a second portion of the scaffold nucleotide sequence, a first fragment oligonucleotide comprising a first adaptor binding nucleotide sequence that is complementary to a first portion of the first fragment binding nucleotide sequence, and a second adaptor binding nucleotide sequence that is complementary to a first portion of the second fragment binding nucleotide sequence, and a second fragment oligonucleotide comprising a third adaptor binding nucleotide sequence that is complementary to a second portion of the first fragment binding nucleotide sequence.
[0139] Embodiment 2. The mixture of embodiment 1 further comprising a third fragment oligonucleotide comprising a fourth adaptor binding nucleotide sequence that is complementary to a second portion of the second fragment binding nucleotide sequence.
[0140] Embodiment 3. The mixture of any of the previous embodiments further comprising a ligase.
[0141] Embodiment 4. The mixture of any of the previous embodiments wherein the concentration of the first and second adaptor oligonucleotides is greater than the concentration of the scaffold polynucleotide.
[0142] Embodiment 5. The mixture of any of the previous embodiments wherein the concentration of the first and second fragment oligonucleotides is greater than the concentration of the scaffold polynucleotide.
[0143] Embodiment 6. The mixture of any of the previous embodiments wherein the first portion of the scaffold nucleotide sequence is immediately followed by the second portion of the scaffold nucleotide sequence.
[0144] Embodiment 7. The mixture of any of the previous embodiments wherein each of theAttorney Docket No. 206161-0084-00WO first and second adaptor binding nucleotide sequences are shorter than each of the first and second scaffold binding nucleotide sequences.
[0145] Embodiment 8. The mixture of any of the previous embodiments wherein the first portion of the first fragment binding sequence is immediately followed by the second portion of the first fragment binding sequence.
[0146] Embodiment 9. The mixture of any of the previous embodiments wherein the first fragment oligonucleotide comprises a spacer nucleotide sequence positioned between the first and second adaptor binding nucleotide sequences.
[0147] Embodiment 10. The mixture of any of the previous embodiments wherein the first scaffold binding nucleotide sequence is immediately followed by the first fragment binding nucleotide sequence.
[0148] Embodiment 11. The mixture of any of the previous embodiments wherein the scaffold polynucleotide is selected from the group consisting of: DNA, RNA, single-stranded DNAs, double-stranded DNA, partially double-stranded DNA, DNA origami, a plasmid, a singlestranded plasmid, a phage, an Ml 3 phage, or combinations thereof.
[0149] Embodiment 12. The mixture of any of the previous embodiments wherein the scaffold polynucleotide comprises an Ml 3 phagemid DNA.
[0150] Embodiment 13. The mixture of any of the previous embodiments wherein the first fragment oligonucleotide comprises a modified nucleotide.
[0151] Embodiment 14. The mixture of any of the previous embodiments wherein the first fragment oligonucleotide is configured to bind to the first and second adaptor oligonucleotides via cooperative binding.
[0152] Embodiment 15. A method for synthesizing a target polynucleotide comprising the steps of providing the mixture of claim 1 at a first temperature, adding a ligase to the mixture, and cooling the mixture to a ligase temperature.
[0153] Embodiment 16. The method of the previous embodiment further comprising the step of cooling the mixture from the first temperature to a second temperature prior to the step ofAttorney Docket No. 206161-0084-00WO cooling the mixture to the ligase temperature.
[0154] Embodiment 17. The method of any of the previous embodiments wherein the first temperature is about 90 °C.
[0155] Embodiment 18. The method of embodiment 16 or 17 wherein the second temperature is about 50 °C.
[0156] Embodiment 19. The method of any of the previous embodiments wherein the ligase temperature is about 37 °C.
[0157] Embodiment 20. The method of any of the previous embodiments wherein the cooling the mixture to a ligase temperature comprises gradual cooling for a duration of at least 1 hour.
[0158] Embodiment 21. The method of any of the previous embodiments further comprising the step of retrieving one or more polynucleotides from the mixture.
[0159] Embodiment 22. A method of synthesizing a polynucleotide comprising associating a polynucleotide scaffold with a plurality of adaptor oligonucleotides and a plurality of fragment oligonucleotides to form a mixture, wherein each of the adaptor oligonucleotides comprises an adaptor binding region that hybridizes with the polynucleotide scaffold and a fragment binding region that hybridizes with one or more fragment oligonucleotides to form a complex comprising the polynucleotide scaffold, at least one adaptor oligonucleotide, and at least one fragment oligonucleotide; and adding a ligase to the mixture, wherein the ligase ligates adjacent fragment oligonucleotides of the complex to form a target polynucleotide.
[0160] Embodiment 23. The method of the previous embodiment further comprising the step of purifying the target polynucleotide.
[0161] Embodiment 24. The method of the previous embodiment wherein the purifying comprises separating the target polynucleotide from other mixture components and extracting the separated target polynucleotide.
[0162] Embodiment 25. The method of the previous embodiment wherein the separating occurs by agarose gel electrophoresis.
[0163] Embodiment 26. The method of any of embodiments 22-25, wherein the hybridizationAttorney Docket No. 206161-0084-00WO of the fragment binding region with one or more fragment oligonucleotides occurs through cooperative binding, wherein the cooperative binding comprises the binding of a first portion of a fragment oligonucleotide to a first adaptor oligonucleotide, and a binding of a second portion of the fragment oligonucleotide to a second adaptor oligonucleotide.
[0164] Embodiment 27. The method of any of embodiments 22-26 wherein the adaptor oligonucleotides and fragment oligonucleotides are in excess concentration over the polynucleotide scaffold.
[0165] Embodiment 28. The method of any of embodiments 22-27 wherein the associating comprises heating and then cooling the mixture.
[0166] Embodiment 29. The method of the previous embodiment wherein the heating occurs for about 30 seconds to about 90 seconds at a temperature ranging from about 60 °C to about 90 °C.
[0167] Embodiment 30. The method of embodiment 28 or 29 wherein the cooling comprises reducing the mixture temperature after the heating step.
[0168] Embodiment 31. The method of embodiment 29 or 30, wherein the cooling comprises reducing the mixture temperature by at least 30 °C in less than about 30 minutes, and further reducing the mixture temperature by at least 30 °C in more than about 6 hours.
[0169] Embodiment 32. The method of any of embodiments 22-31 wherein the polynucleotide scaffold is selected from the group consisting of DNAs, RNAs, single-stranded DNAs, doublestranded DNAs, partially double-stranded DNAs, DNA origamis, plasmids, single-stranded plasmids, phages, Ml 3 phages, or combinations thereof.
[0170] Embodiment 33. The method of any of embodiments 22-32 wherein the polynucleotide scaffold comprises an Ml 3 phagemid DNA.
[0171] Embodiment 34. The method of any of embodiments 22-33 wherein the polynucleotide scaffold comprises at least 1,000 nucleotides.
[0172] Embodiment 35. The method of any of embodiments 22-34 wherein the polynucleotide scaffold comprises at least 2,500 nucleotides.Attorney Docket No. 206161-0084-00WO
[0173] Embodiment 36. The method of any of embodiments 22-35 wherein the polynucleotide scaffold comprises at least 7,000 nucleotides.
[0174] Embodiment 37. The method of any of embodiments 22-36 wherein the adaptor oligonucleotides are selected from the group consisting of DNA-based nucleotides, RNA-based nucleotides, natural nucleotides, unnatural nucleotides, modified nucleotides, or combinations thereof.
[0175] Embodiment 38. The method of any of embodiments 22-37 wherein the adaptor oligonucleotides comprise at least 20 nucleotides.
[0176] Embodiment 39. The method of any of embodiments 22-38 wherein the adaptor oligonucleotides comprise at least 40 nucleotides.
[0177] Embodiment 40. The method of any of embodiments 22-39 wherein the adaptor oligonucleotides do not share complementary sequences with one another.
[0178] Embodiment 41. The method of any of embodiments 22-40 wherein the adaptor oligonucleotides do not hybridize to one another.
[0179] Embodiment 42. The method of any of embodiments 22-41 wherein the fragment oligonucleotides are selected from the group consisting of DNA-based nucleotides, RNA-based nucleotides, natural nucleotides, unnatural nucleotides, modified nucleotides, or combinations thereof.
[0180] Embodiment 43. The method of any of embodiments 22-42 wherein the fragment oligonucleotides comprise modified nucleotides.
[0181] Embodiment 44. The method of the previous embodiment wherein the modified nucleotides are modified with one or more molecules selected from the group consisting of methyl groups, amine groups, alkyne groups, thiol groups, azide groups, digoxigenin, cholesterol, triethylene glycerol (TEG), fluorophores, phosphorylated groups, quenchers, fluorescent dyes, biotin, cross-linking agents, spacers, molecules comprising covalent carbonheteroatom bonds, molecules comprising phosphorothioate bonds, or combinations thereof.
[0182] Embodiment 45. The method of any of embodiments 22-44 wherein the fragmentAttorney Docket No. 206161-0084-00WO oligonucleotides comprise at least 10 nucleotides.
[0183] Embodiment 46. The method of any of embodiments 22-45 wherein the fragment oligonucleotides comprise at least 20 nucleotides.
[0184] Embodiment 47. The method of any of embodiments 22-46 wherein the fragment oligonucleotides do not share complementary sequences with one another.
[0185] Embodiment 48. The method of any of embodiments 22-47 wherein the fragment oligonucleotides do not hybridize to one another.
[0186] Embodiment 49. The method of any of embodiments 22-48 wherein the target polynucleotide comprises single-stranded polynucleotides, DNA, double-stranded polynucleotides, single- stranded DNA, double-stranded DNA, partially double-stranded DNAs, RNA, double- stranded RNA, single stranded RNA, modified nucleotides, or combinations thereof.
[0187] Embodiment 50. The method of any of embodiments 22-49 wherein the target polynucleotide comprises single- stranded DNA.
[0188] Embodiment 51. The method of any of embodiments 22-50 wherein the target polynucleotide comprises double-stranded DNA.
[0189] Embodiment 52. The method of any of embodiments 22-51 wherein the target polynucleotides comprise modified nucleotides.
[0190] Embodiment 53. The method of the previous embodiment wherein the modified nucleotides are modified with one or more molecules selected from the group consisting of methyl groups, amine groups, alkyne groups, thiol groups, azide groups, digoxigenin, cholesterol, triethylene glycerol (TEG), fluorophores, quenchers, fluorescent dyes, biotin, crosslinking agents, spacers, molecules comprising covalent carbon-heteroatom bonds, molecules comprising phosphorothioate bonds, or combinations thereof.
[0191] Additional Embodiments
[0192] Reference will now be made to more specific embodiments of the present disclosure and experimental results that provide support for such embodiments. However, Applicants note thatAttorney Docket No. 206161-0084-00WG the disclosure herein is for illustrative purposes only and is not intended to limit the scope of the claimed subject matter in any way.
[0193] Example 1. Self-assembling a long DNA strand from short strands through the utilization of a long scaffold DNA strand
[0194] In this Example, Applicants demonstrate the self-assembling of a long DNA strand from short DNA strands using an existing long DNA scaffold (e.g., a single stranded naturally derived M13 plasmid scaffold; also referred to as a polynucleotide scaffold or scaffold strand), single stranded oligonucleotide adapters (e.g., synthetic adaptors; also referred to as adaptor nucleotides or adaptor strand), single stranded oligonucleotide monomers (e.g., synthetic and phosphorylated monomers; also referred to as fragment oligonucleotides), and a ligase (e.g, a DNA T4 ligase).
[0195] FIGS. 1A-1E illustrate the polynucleotide synthesis process in this Example, where concatenation of the monomers resulted in the synthesis of a long single stranded DNA (e.g, a 630 nucleotide single stranded target with or without modifications). The process utilized 1 scaffold (M13) (SEQ ID NO: 1). The process utilized 31 adapters (i.e., green strands connecting the long scaffold to the monomers) that were each 42 nucleotides (nt) in length; and 30 monomers (i.e., red strands whose concatenation is the target strand) that were each 21 nt in length. The 31 adaptors had sequences of Adaptors 0 through 30 (SEQ ID NOs:2-32). The 30 monomers had sequences of Monomers 0 through 29 (SEQ ID NOs: 33-62). As such, the target strand was 630 nucleotides in length (i.e., 30 monomers x 21 nucleotides per monomer). In some cases, the monomers comprised a phosphorylation modification at the 5’ end.
[0196] All adapters and monomers were ordered unpurified from Integrated DNA Technologies (IDT). M13 was purchased from Bayou Biolabs at a concentration of 418 nM.
[0197] As illustrated in FIGS. 1 A-1E, the polynucleotide synthesis process occurred through a seeded assembly process that involved a “fast anneal” step and a “slow anneal” self-assembling step. In the fast anneal step, the monomers, adapters and scaffolds were mixed at a molar ratio of 2:2: 1 (e.g., 10 nM scaffold, 20 nM adaptors, and 20 nM monomers) in T4 ligase buffer, which included 10 mM MgCl. The reaction was then heated at 60 °C - 90 °C for about 30 seconds toAttorney Docket No. 206161-0084-00WG denature the DNA. In the slow anneal step, the reaction temperature was reduced to 60 °C to 40 °C for several hours (e.g., 5-13 hours) (FIGS. IB and 1C), where self-assembly of monomers onto the adapter-scaffold complex occurs via cooperative binding (FIG. ID). Next, a T4 ligase was added for ligation of the monomers to form the target strand. Ligation occurred at about 37 °C for 1 hour (FIG. IE).
[0198] Thereafter, the synthesized target strand was purified by adding a denaturing loading buffer and heating the mixture to 90 °C for 10 minutes to denature the DNA and deactivate the ligase. The sample was then placed in a denaturing gel along with a single-stranded ladder. The gel was then actuated. After gel electrophoresis, the synthesized target strand was identified and incised from the target band. A commercial spin column extraction kit was then used to recover the target strand free from agarose and other impurities.
[0199] FIGS. 2A-2C illustrate a limitation of existing techniques. In the unseeded assembly process (FIG. 2A), several partial products are formed such that the products are then unable to assemble to form the target strand due to “overlap”. In this example, both partial products contain monomer C, and therefore cannot bind to each other. In the current technique (FIG. 1C), cooperative binding occurs at a higher temperature (i.e., temperatures where un-seeded assembly would not happen).
[0200] FIG. 2B illustrates a second shortcoming of existing techniques relying on unseeded self-assembly: “crosstalk” between single-stranded fragments by which fragment oligonucleotides bind, in which unintended binding occurs, leading to incorrect assemblies. This is a problem, for instance, when the target sequence contains repeats. FIG. 2C shows a third limitation: the low yield of such self-assembly techniques, due to limitations shown in FIGS. 2A and 2B, mean that amplification of the target is required, which does not preserve chemical modifications.
[0201] FIGS. 3A-3B provide gel electrophoretic analyses of the unseeded and seeded assembly reactions and their ligated products. The first gel column represents the unseeded assembly reaction without the scaffold (i.e., a master mix of monomers and adapters illustrated in FIG. 3A). The second gel column represents the seeded assembly reaction with the scaffold (i.e., aAttorney Docket No. 206161-0084-00WO master mix of monomers, adapters, and Ml 3 illustrated in FIG. 3B). Each of the samples was loaded onto a 4% denaturing PAGE gel. The unseeded assembly reaction did not produce any full-length product (i.e., only partial products) while the seeded assembly reaction produced full and partial products. The sizes of the assembly products were determined using a 1-kb DNA ladder. Bands were visualized with the SynGene Imaging System. Un-assembled DNA (excess monomers and adapters), scaffold / M13, assembly of the full-length product (30 monomers x 21nts = 630nt), and partial products of varying lengths (multiples of 21nts) are also indicated on the image.
[0202] Applicants also utilized the developed process to synthesize single- stranded DNA targets with modifications. In particular, Applicants ordered single stranded polynucleotide monomers with various modifications. Such modifications included fluorophores (monO), methylation (5mC), CpG context (monl2), and all context (mon26).
[0203] The scaffold, adaptors and monomers were then mixed, annealed and ligated in accordance with the methods illustrated in FIGS. 1 A-1E and described supra to form singlestranded DNA targets with modifications. Since minlON sequencing requires double-stranded DNA, the synthetized single-stranded targets underwent one polymerase chain reaction (PCR) cycle.
[0204] The sample was then sequenced through nanopore sequencing. However, the input sample was not purified. Therefore, the input sample included the double-stranded target, single stranded partial products, Ml 3, and excess primers.
[0205] FIG. 4 shows a visual exploration and methylation analysis of sequencing data for a seeded assembly reaction, where 2 / 30 monomers (monl2 and mon26) were designed to have 5- Methyl deoxyCytidine (5mC) base modifications in a CpG-context (two 5mC in monl2) and allcontext (one 5mC in mon26). Oxford nanopore's DNA methylation-calling tools were used to detect methylation modifications in the sequence data. Additionally, the Integrative Genomics Viewer (IGV) was used to visually show the locations of these methylation modifications (dark dots) in full-length product reads. The locations of the detected methylation modifications with a likelihood of over 99% match the location of 5mC base modifications incorporated into theAttorney Docket No. 206161-0084-00WG sequence of monomer 12 and monomer 26 during the sequence design of the full-length product (630 nt).
[0206] Fig. 5A and Fig. 5B show a gel electrophoretic analysis of an assembly of a long ssDNA from 30 monomers (fragments) with in accordance with the methods illustrated in FIGS. 1A-1E, FIG. 8, and described supra. One monomer out of 30 total contained a fluorophore modification (Alexa 528). Fig. 5A shows a gel image taken before SYBR gold staining and shows selffluorescence due to the fluorophore. This highlighted bands (two repeats) show that the assembled full-length product, which is 630 nucleotides in length, has self-fluorescence due to the incorporation of the fluorophore-containing monomer. A negative control that includes all monomers, including the monomer with a fluorophore modification, adapters, but no Ml 3 scaffold, confirms that the scaffold mediates the assembly as expected. Fig. 5B shows an image of the gel after SYBR gold staining. The gel was 2% alkaline denaturing. Bands were visualized with the SynGene Imaging System.
[0207] Fig. 6 shows a gel electrophoretic analysis of an assembly of a long ssDNA with repeats in accordance with the methods illustrated in FIGS. 1A-1E, FIG. 8, and described supra. The target sequence of Fig. 6 is a 1,995 nucleotide sequence containing the ModD gene from a strain of Neisseria meningitidis containing seven 5’ACCGA-3’ tandem repeats. (S Seib KL, et al. FASEB J. 2011 Oct;25(10):3622-33). The assembly of portions of the target sequence from 73 / 95 monomers, 51 / 95 monomers, and 29 / 95 monomers is show. 4% denaturing PAGE electrophoretic analyses of sub assembly reactions for 1995 target sequence: a sub assembly reaction with a master mix of 29 of 95 monomers, adapters, and M13 to synthesize a full-length product of length 609 nucleotides (29 monomers multiplied by 21 nucleotides), and sub assembly reaction with a master mix of 51 of 95 monomers, adapters, and M13 to synthesize a full-length product of length 1,071 nucleotides (51 monomers multiplied by 21 nucleotides). The sizes of the assembly products were determined using a 1-kb DNA ladder bands were visualized with the SynGene Imaging System.
[0208] Fig. 7 shows an Agilent Bioanalyzer trace showing the assembly of the 1.995 nucleotide ModD gene from a strain of Neisseria meningitidis containing seven 5’ACCGA-3’ tandem repeats in accordance with the methods illustrated in FIGS. 1A-1E, FIG. 8, and described supra.Attorney Docket No. 206161-0084-00WO91 monomers (fragments) were assembled in a one-pot experiment in quantities sufficient for subsequent PCR amplification. The Agilent Bioanalyzer trace was obtained after PCR amplification with forward and reverse primers. The main peak indicated with the black triangle has the correct size of about 1995 base pairs. PCR converts ssDNA to dsDNA, indicating also the capability of the method to synthesize dsDNA.
[0209] Example 2: Sequences
[0210] M13 (SEQ ID NO: 1)AATGCTACTACTATTAGTAGAATTGATGCCACCTTTTCAGCTCGCGCCCCAAATGAA AATATAGCTAAACAGGTTATTGACCATTTGCGAAATGTATCTAATGGTCAAACTAAA TCTACTCGTTCGCAGAATTGGGAATCAACTGTTATATGGAATGAAACTTCCAGACAC CGTACTTTAGTTGCATATTTAAAACATGTTGAGCTACAGCATTATATTCAGCAATTA AGCTCTAAGCCATCCGCAAAAATGACCTCTTATCAAAAGGAGCAATTAAAGGTACT CTCTAATCCTGACCTGTTGGAGTTTGCTTCCGGTCTGGTTCGCTTTGAAGCTCGAATT AAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCT TTGCTTCTGACTATAATAGTCAGGGTAAAGACCTGATTTTTGATTTATGGTCATTCTC GTTTTCTGAACTGTTTAAAGCATTTGAGGGGGATTCAATGAATATTTATGACGATTC CGCAGTATTGGACGCTATCCAGTCTAAACATTTTACTATTACCCCCTCTGGCAAAAC TTCTTTTGCAAAAGCCTCTCGCTATTTTGGTTTTTATCGTCGTCTGGTAAACGAGGGT TATGATAGTGTTGCTCTTACTATGCCTCGTAATTCCTTTTGGCGTTATGTATCTGCATT AGTTGAATGTGGTATTCCTAAATCTCAACTGATGAATCTTTCTACCTGTAATAATGTT GTTCCGTTAGTTCGTTTTATTAACGTAGATTTTTCTTCCCAACGTCCTGACTGGTATA ATGAGCCAGTTCTTAAAATCGCATAAGGTAATTCACAATGATTAAAGTTGAAATTAA ACCATCTCAAGCCCAATTTACTACTCGTTCTGGTGTTTCTCGTCAGGGCAAGCCTTAT TCACTGAATGAGCAGCTTTGTTACGTTGATTTGGGTAATGAATATCCGGTTCTTGTCA AGATTACTCTTGATGAAGGTCAGCCAGCCTATGCGCCTGGTCTGTACACCGTTCATC TGTCCTCTTTCAAAGTTGGTCAGTTCGGTTCCCTTATGATTGACCGTCTGCGCCTCGT TCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGATG ATACAAATCTCCGTTGTACTTTGTTTCGCGCTTGGTATAATCGCTGGGGGTCAAAGA TGAGTGTTTTAGTGTATTCTTTTGCCTCTTTCGTTTTAGGTTGGTGCCTTCGTAGTGGCAttorney Docket No. 206161-0084-00WGATTACGTATTTTACCCGTTTAATGGAAACTTCCTCATGAAAAAGTCTTTAGTCCTCAAAGCCTCTGTAGCCGTTGCTACCCTCGTTCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAAATTCACCTCGAAAGCAAGCTGATAAACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAATTCCTTTAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTGAAAGTTGTTTAGCAAAATCCCATACAGAAAATTCATTTACTAACGTCTGGAAAGACGACAAAACTTTAGATCGTTACGCTAACTATGAGGGCTGTCTGTGGAATGCTACAGGCGTTGTAGTTTGTACTGGTGACGAAACTCAGTGTTACGGTACATGGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTCCTGAGTACGGTGATACACCTATTCCGGGCTATACTTATATCAACCCTCTCGACGGCACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCCTTCTCTTGAGGAGTCTCAGCCTCTTAATACTTTCATGTTTCAGAATAATAGGTTCCGAAATAGGCAGGGGGCATTAACTGTTTATACGGGCACTGTTACTCAAGGCACTGACCCCGTTAAAACTTATTACCAGTACACTCCTGTATCATCAAAAGCCATGTATGACGCTTACTGGAACGGTAAATTCAGAGACTGCGCTTTCCATTCTGGCTTTAATGAGGATTTATTTGTTTGTGAATATCAAGGCCAATCGTCTGACCTGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGTGATTTTGATTATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTGGCGCTGGTAAACCATATGAATTTTCTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGGTATTCCGTTATTATTGCGTTTCCTCGGTTTCCTTCTGGTAACTTTGTTCGGCTATCTAttorney Docket No. 206161-0084-00WGGCTCTTATTATTGGGCTTAACTCAATTCTTGTGGGTTATCTCTCTGATATTAGCGCTCAATTACCCTCTGACTTTGTTCAGGGTGTTCAGTTAATTCTCCCGTCTAATGCGCTTCCCTGTTTTTATGTTATTCTCTCTGTAAAGGCTGCTATTTTCATTTTTGACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAATATGGCTGTTTATTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCAAAATAGCAACTAATCTTGATTTAAGGCTTCAAAACCTCCCGCAAGTCGGGAGGTTCGCTAAAACGCCTCGCGTTCTTAGAATACCGGATAAGCCTTCTATATCTGATTTGCTTGCTATTGGGCGCGGTAATGATTCCTACGATGAAAATAAAAACGGCTTGCTTGTTCTCGATGAGTGCGGTACTTGGTTTAATACCCGTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTCTGCATTAGCTGAACATGTTGTTTATTGTCGTCGTCTGGACAGAATTACTTTACCTTTTGTCGGTACTTTATATTCTCTTATTACTGGCTCGAAAATGCCTCTGCCTAAATTACATGTTGGCGTTGTTAAATATGGCGATTCTCAATTAAGCCCTACTGTTGAGCGTTGGCTTTATACTGGTAAGAATTTGTATAACGCATATGATACTAAACAGGCTTTTTCTAGTAATTATGATTCCGGTGTTTATTCTTATTTAACGCCTTATTTATCACACGGTCGGTATTTCAAACCATTAAATTTAGGTCAGAAGATGAAATTAACTAAAATATATTTGAAAAAGTTTTCTCGCGTTCTTTGTCTTGCGATTGGATTTGCATCAGCATTTACATATAGTTATATAACCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGACCTATGATTTTGATAAATTCACTATTGACTCTTCTCAGCGTCTTAATCTAAGCTATCGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCGACGATTTACAGAAGCAAGGTTATTCACTCACATATATTGATTTATGTACTGTTTCCATTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAATTTTGTTTTCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAGGTAATTGAAATGAATAATTCGCCTCTGCGCGATTTTGTAACTTGGTATTCAAAGCAATCAGGCGAATCCGTTATTGTTTCTCCCGATGTAAAAGGTACTGTTACTGTATATTCATCTGACGTTAAACCTGAAAATCTACGCAATTTCTTTATTTCTGTTTTACGTGCAAATAATTTTGATATGGTAGGTTCTAACCCTTCCATTATTCAGAAGTATAATCCAAACAATCAGGATTATATTGATGAATTGCCATCATCTGATAATCAGGAATATGATGATAATTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCAAAATGATAATGTTACTCAAACTTTTAAAATTAATAACGTTCGGGCAAAGGATTTAATACAttorney Docket No. 206161-0084-00WGTGACGGCTCTAATCTATTAGTTGTTAGTGCTCCTAAAGATATTTTAGATAACCTTCCTCAATTCCTTTCAACTGTTGATTTGCCAACTGACCAGATATTGATTGAGGGTTTGATATTTGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGTTGCAGGCGGTGTTAATACTGACCGCCTCACCTCTGTTTTATCTTCTGCTGGTGGTTCGTTCGGTATTTTTAATGGCGATGTTTTAGGGCTATCAGTTCGCGCATTAAAGACTAATAGCCATTCAAAAATATTGTCTGTGCCACGTATTCTTACGCTTTCAGGTCAGAAGGGTTCTATCTCTGTTGGCCAGAATGTCCCTTTTATTACTGGTCGTGTGACTGGTGAATCTGCCAATGTAAATAATCCATTTCAGACGATTGAGCGTCAAAATGTAGGTATTTCCATGAGCGTTTTTCCTGTTGCAATGGCTGGCGGTAATATTGTTCTGGATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGAAGTATTGCTACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTCACTGATTATAAAAACACTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCTCCTGTTTAGCTCCCGCTCTGATTCTAACGAGGAAAGCACGTTATACGTGCTCGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAAttorney Docket No. 206161-0084-00WOCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAATGCGAATTTTAACAAAATATTAACGTTTACAATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGGGTACATATGATTGACATGCTAGTTTTACGATTACCGTTCATCGATTCTCTTGTTTGCTCCAGACTCTCAGGCAATGACCTGATAGCCTTTGTAGATCTCTCAAAAATAGCTACCCTCTCCGGCATTAATTTATCAGCTAGAACGGTTGAATATCATATTGATGGTGATTTGACTGTCTCCGGCCTTTCTCACCCTTTTGAATCTTTACCTACACATTACTCAGGCATTGCATTTAAAATATATGAGGGTTCTAAAAATTTTTATCCTTGCGTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGATTTAGCTTTATGCTCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGATT TATTGGATGTT
[0211] Adaptor 0 (SEQ ID NO: 2)TCCTCATTAAAGCCAGAATGGTTTTTTTTTTCCGGGAGCTGC
[0212] Adaptor 1 (SEQ ID NO: 3)TGATATTCACAAACAAATAAAATGTGTCAGAGGCTGTTTGTA
[0213] Adaptor 2 (SEQ ID NO: 4)GGCAGGTCAGACGATTGGCCTGATATGATCGTATGTATAGAA
[0214] Adaptor 3 (SEQ ID NO: 5)CCAGCATTGACAGGAGGTTGATAACCTAAAGACTCTACCGGA
[0215] Adaptor 4 (SEQ ID NO: 6)GAACCACCACCAGAGCCGCCGAACTTTTAGAGCTGATAAATG
[0216] Adaptor 5 (SEQ ID NO: 7)Attorney Docket No. 206161-0084-00WOCCACCCTCAGAGCCGCCACCAAATTCAGTAAAGTTGCAGAAT
[0217] Adaptor 6 (SEQ ID NO: 8)GAACCGCCACCCTCAGAGCCAGCAAAATTATGTTAGTCTGTT
[0218] Adaptor 7 (SEQ ID NO: 9)CCCTCAGAGCCGCCACCCTCATTCACACTGCTGATAAAGACA
[0219] Adaptor 8 (SEQ ID NO: 10)GAGCCACCACCGGAACCGCCTTACCCAAGACTGGGAAGAAAA
[0220] Adaptor 9 (SEQ ID NO: 11)TAATCAAAATCACCGGAACCAAGAGGTATAATTGGACTTACA
[0221] Adaptor 10 (SEQ ID NO: 12)TTAGCGTTTGCCATCTTTTCAGTTCCACGTGGCTGGGGAGGA
[0222] Adaptor 11 (SEQ ID NO: 13)TTTTCGGTCATAGCCCCCTTACTTAGAATCATGGTGGGAGGC
[0223] Adaptor 12 (SEQ ID NO: 14)TGTAGCGCGTTTTCATCGGCAAAAAGGTCCTTCTTACACGGC
[0224] Adaptor 13 (SEQ ID NO: 15)AGTTTGCCTTTAGCGTCAGACGGCAGCAAGAGAAACTTTAAC
[0225] Adaptor 14 (SEQ ID NO: 16)TAATCAGTAGCGACAGAATCATTTCTGATATCTTCTAAGAGG
[0226] Adaptor 15 (SEQ ID NO: 17)AAACCATCGATAGCAGCACCGCAGATTTAGAAACCTCTTCCT
[0227] Adaptor 16 (SEQ ID NO: 18)AGGCCGGAAACGTCACCAATGGGAGAAAGCCACAGCCTCCAGAttorney Docket No. 206161-0084-00WO
[0228] Adaptor 17 (SEQ ID NO: 19)GTAGCACCATTACCATTAGCACTGTTCTTGTTCTACACATTC
[0229] Adaptor 18 (SEQ ID NO: 20)TTAGAGCCAGCAAAATCACCAAGGCATGGACCCTTGCCACAG
[0230] Adaptor 19 (SEQ ID NO: 21)CCGACTTGAGCCATTTGGGAACCTCTCAAGGATTCACACTTC
[0231] Adaptor 20 (SEQ ID NO: 22)AAAGGTGAATTATCACCGTCAACACTGGCAGAGCACTCTCTC
[0232] Adaptor 21 (SEQ ID NO: 23)TATTGACGGAAATTATTCATTACTCCTCCTGGAGATACTGGC
[0233] Adaptor 22 (SEQ ID NO: 24)GATTGAGGGAGGGAAGGTAAATCCTTCTTGACCTGCAGGCAG
[0234] Adaptor 23 (SEQ ID NO: 25)ACAAAAGGGCGACATTCAACCAGCACCAGAACCATGTAAAAA
[0235] Adaptor 24 (SEQ ID NO: 26)TATGGTTTACCAGCGCCAAAGTGTGACTCAGGCAACTCACAG
[0236] Adaptor 25 (SEQ ID NO: 27)TCACAATCAATAGAAAATTCAATAAGCAAAGACCTCCAGGCA
[0237] Adaptor 26 (SEQ ID NO: 28)CCACGGAATAAGTTTATTTTGGAGCACCAGAAAGTCAATCAA
[0238] Adaptor 27 (SEQ ID NO: 29)TATAAAAGAAACGCAAAGACAGAACCATGCAAAAATGTGACT
[0239] Adaptor 28 (SEQ ID NO: 30)Attorney Docket No. 206161-0084-00WOACATACATAAAGGTGGCAACACAAGCAACTCAGAGTTAGGCA
[0240] Adaptor 29 (SEQ ID NO: 31)ATGTTAGCAAACGTAGAAAATAAGAAACTCACCAAACGTGGC
[0241] Adaptor 30 (SEQ ID NO: 32)TAAGACTCCTTATTACGCAGTTTGCCAGCCCTTTTTTTTTTT
[0242] Monomer 0 (SEQ ID NO: 33)TCTGACACATGCAGCTCCCGG
[0243] Monomer 1 (SEQ ID NO: 34)CTTTAGGTTATTCTATACATA
[0244] Monomer 2 (SEQ ID NO: 35)CTTTAGGTTATTCTATACATA
[0245] Monomer 3 (SEQ ID NO: 36)TCTAAAAGTTTCCGGTAGAGT
[0246] Monomer 4 (SEQ ID NO: 37)TTACTGAATTCATTTATCAGC
[0247] Monomer 5 (SEQ ID NO: 38)ATAATTTTGCATTCTGCAACT
[0248] Monomer 6 (SEQ ID NO: 39)GCAGTGTGAAAACAGACTAAC
[0249] Monomer 7 (SEQ ID NO: 40)GTCTTGGGTATGTCTTTATCA
[0250] Monomer 8 (SEQ ID NO: 41)TTATACCTCTTTTTCTTCCCAAttorney Docket No. 206161-0084-00WO
[0251] Monomer 9 (SEQ ID NO: 42)CACGTGGAACTGTAAGTCCAA
[0252] Monomer 10 (SEQ ID NO: 43)TGATTCTAAGTCCTCCCCAGC
[0253] Monomer 11 (SEQ ID NO: 44)AGGACCTTTTGCCTCCCACCA
[0254] Monomer 12 (SEQ ID NO: 45)TCTTGCTGCCGCCGTGTAAGA
[0255] Monomer 13 (SEQ ID NO: 46)ATATCAGAAAGTTAAAGTTTC
[0256] Monomer 14 (SEQ ID NO: 47)TCTAAATCTGCCTCTTAGAAG
[0257] Monomer 15 (SEQ ID NO: 48)GGCTTTCTCCAGGAAGAGGTT
[0258] Monomer 16 (SEQ ID NO: 49)ACAAGAACAGCTGGAGGCTGT
[0259] Monomer 17 (SEQ ID NO: 50)GTCCATGCCTGAATGTGTAGA
[0260] Monomer 18 (SEQ ID NO: 51)CCTTGAGAGGCTGTGGCAAGG
[0261] Monomer 19 (SEQ ID NO: 52)CTGCCAGTGTGAAGTGTGAAT
[0262] Monomer 20 (SEQ ID NO: 53)Attorney Docket No. 206161-0084-00WOCAGGAGGAGTGAGAGAGTGCT
[0263] Monomer 21 (SEQ ID NO: 54)TCAAGAAGGAGCCAGTATCTC
[0264] Monomer 22 (SEQ ID NO: 55)TTCTGGTGCTCTGCCTGCAGG
[0265] Monomer 23 (SEQ ID NO: 56)CTGAGTCACATTTTTACATGG
[0266] Monomer 24 (SEQ ID NO: 57)CTTTGCTTATCTGTGAGTTGC
[0267] Monomer 25 (SEQ ID NO: 58)TCTGGTGCTCTGCCTGGAGGT
[0268] Monomer 26 (SEQ ID NO: 59)TGCATGGTTCTTGATTGACTT
[0269] Monomer 27 (SEQ ID NO: 60)GAGTTGCTTGAGTCACATTTT
[0270] Monomer 28 (SEQ ID NO: 61)TGAGTTTCTTTGCCTAACTCT
[0271] Monomer 29 (SEQ ID NO: 62)GGGCTGGCAAGCCACGTTTGG
[0272] Adaptor 0 Scaffold Binding Region (SEQ ID NO: 63)TCCTCATTAAAGCCAGAATGG
[0273] Adaptor 1 Scaffold Binding Region (SEQ ID NO: 64)TGATATTCACAAACAAATAAAAttorney Docket No. 206161-0084-00WO
[0274] Adaptor 2 Scaffold Binding Region (SEQ ID NO: 65)GGCAGGTCAGACGATTGGCCT
[0275] Adaptor 3 Scaffold Binding Region (SEQ ID NO: 66)CCAGCATTGACAGGAGGTTGA
[0276] Adaptor 4 Scaffold Binding Region (SEQ ID NO: 67)GAACCACCACCAGAGCCGCCG
[0277] Adaptor 5 Scaffold Binding Region (SEQ ID NO: 68)CCACCCTCAGAGCCGCCACCA
[0278] Adaptor 6 Scaffold Binding Region (SEQ ID NO: 69)GAACCGCCACCCTCAGAGCCA
[0279] Adaptor 7 Scaffold Binding Region (SEQ ID NO: 70)CCCTCAGAGCCGCCACCCTCA
[0280] Adaptor 8 Scaffold Binding Region (SEQ ID NO: 71)GAGCCACCACCGGAACCGCCT
[0281] Adaptor 9 Scaffold Binding Region (SEQ ID NO: 72)TAATCAAAATCACCGGAACCA
[0282] Adaptor 10 Scaffold Binding Region (SEQ ID NO: 73)TTAGCGTTTGCCATCTTTTCA
[0283] Adaptor 11 Scaffold Binding Region (SEQ ID NO: 74)TTTTCGGTCATAGCCCCCTTA
[0284] Adaptor 12 Scaffold Binding Region (SEQ ID NO: 75)TGTAGCGCGTTTTCATCGGCA
[0285] Adaptor 13 Scaffold Binding Region (SEQ ID NO: 76)Attorney Docket No. 206161-0084-00WOAGTTTGCCTTTAGCGTCAGAC
[0286] Adaptor 14 Scaffold Binding Region (SEQ ID NO: 77)TAATCAGTAGCGACAGAATCA
[0287] Adaptor 15 Scaffold Binding Region (SEQ ID NO: 78)AAACCATCGATAGCAGCACCG
[0288] Adaptor 16 Scaffold Binding Region (SEQ ID NO: 79)AGGCCGGAAACGTCACCAATG
[0289] Adaptor 17 Scaffold Binding Region (SEQ ID NO: 80)GTAGCACCATTACCATTAGCA
[0290] Adaptor 18 Scaffold Binding Region (SEQ ID NO: 81)TTAGAGCCAGCAAAATCACCA
[0291] Adaptor 19 Scaffold Binding Region (SEQ ID NO: 82)CCGACTTGAGCCATTTGGGAA
[0292] Adaptor 20 Scaffold Binding Region (SEQ ID NO: 83)AAAGGTGAATTATCACCGTCA
[0293] Adaptor 21 Scaffold Binding Region (SEQ ID NO: 84)TATTGACGGAAATTATTCATT
[0294] Adaptor 22 Scaffold Binding Region (SEQ ID NO: 85)GATTGAGGGAGGGAAGGTAAA
[0295] Adaptor 23 Scaffold Binding Region (SEQ ID NO: 86)ACAAAAGGGCGACATTCAACC
[0296] Adaptor 24 Scaffold Binding Region (SEQ ID NO: 87)TATGGTTTACCAGCGCCAAAGAttorney Docket No. 206161-0084-00WO
[0297] Adaptor 25 Scaffold Binding Region (SEQ ID NO: 88)TCACAATCAATAGAAAATTCA
[0298] Adaptor 26 Scaffold Binding Region (SEQ ID NO: 89)CCACGGAATAAGTTTATTTTG
[0299] Adaptor 27 Scaffold Binding Region (SEQ ID NO: 90)TATAAAAGAAACGCAAAGACA
[0300] Adaptor 28 Scaffold Binding Region (SEQ ID NO: 91)ACATACATAAAGGTGGCAACA
[0301] Adaptor 29 Scaffold Binding Region (SEQ ID NO: 92)ATGTTAGCAAACGTAGAAAAT
[0302] Adaptor 30 Scaffold Binding Region (SEQ ID NO: 93)TAAGACTCCTTATTACGCAGT
[0303] Without further elaboration, it is believed that one skilled in the art can, using the description herein, utilize the present disclosure to its fullest extent. The embodiments described herein are to be construed as illustrative and not as constraining the remainder of the disclosure in any way whatsoever. While the embodiments have been shown and described, many variations and modifications thereof can be made by one skilled in the art without departing from the spirit and teachings of the invention. Accordingly, the scope of protection is not limited by the description set out above, but is only limited by the claims, including all equivalents of the subject matter of the claims. The disclosures of all patents, patent applications and publications cited herein are hereby incorporated herein by reference, to the extent that they provide procedural or other details consistent with and supplementary to those set forth herein.
Claims
Attorney Docket No. 206161-0084-00WOWHAT IS CLAIMED IS:
1. A mixture comprising: a scaffold polynucleotide comprising a scaffold nucleotide sequence; a first adaptor oligonucleotide comprising a first scaffold binding nucleotide sequence and a first fragment binding nucleotide sequence, wherein the first scaffold binding nucleotide sequence is complementary to a first portion of the scaffold nucleotide sequence; a second adaptor oligonucleotide comprising a second scaffold binding nucleotide sequence and a second fragment binding nucleotide sequence, wherein the second scaffold binding nucleotide sequence is complementary to a second portion of the scaffold nucleotide sequence; a first fragment oligonucleotide comprising a first adaptor binding nucleotide sequence that is complementary to a first portion of the first fragment binding nucleotide sequence, and a second adaptor binding nucleotide sequence that is complementary to a first portion of the second fragment binding nucleotide sequence; and a second fragment oligonucleotide comprising a third adaptor binding nucleotide sequence that is complementary to a second portion of the first fragment binding nucleotide sequence.
2. The mixture of claim 1, further comprising a third fragment oligonucleotide comprising a fourth adaptor binding nucleotide sequence that is complementary to a second portion of the second fragment binding nucleotide sequence.
3. The mixture of claim 1, further comprising a ligase.
4. The mixture of claim 1, wherein the concentration of the first and second adaptor oligonucleotides is greater than the concentration of the scaffold polynucleotide.Attorney Docket No. 206161-0084-00WO5. The mixture of claim 1, wherein the concentration of the first and second fragment oligonucleotides is greater than the concentration of the scaffold polynucleotide.
6. The mixture of claim 1, wherein the first portion of the scaffold nucleotide sequence is immediately followed by the second portion of the scaffold nucleotide sequence.
7. The mixture of claim 1, wherein each of the first and second adaptor binding nucleotide sequences are shorter than each of the first and second scaffold binding nucleotide sequences.
8. The mixture of claim 1, wherein the first portion of the first fragment binding sequence is immediately followed by the second portion of the first fragment binding sequence.
9. The mixture of claim 1, wherein the first fragment oligonucleotide comprises a spacer nucleotide sequence positioned between the first and second adaptor binding nucleotide sequences.
10. The mixture of claim 1, wherein the first scaffold binding nucleotide sequence is immediately followed by the first fragment binding nucleotide sequence.
11. The mixture of claim 1, wherein the scaffold polynucleotide is selected from the group consisting of: DNA, RNA, single-stranded DNAs, double-stranded DNA, partially doublestranded DNA, DNA origami, a plasmid, a single-stranded plasmid, a phage, an M13 phage, or combinations thereof.
12. The mixture of claim 1, wherein the scaffold polynucleotide comprises an M13 phagemid DNA.Attorney Docket No. 206161-0084-00WO13. The mixture of claim 1, wherein the first fragment oligonucleotide comprises a modified nucleotide.
14. The mixture of claim 1, wherein the first fragment oligonucleotide is configured to bind to the first and second adaptor oligonucleotides via cooperative binding.
15. A method for synthesizing a target polynucleotide comprising the steps of: providing the mixture of claim 1 at a first temperature; adding a ligase to the mixture; and cooling the mixture to a ligase temperature.
16. The method of claim 15, further comprising the step of cooling the mixture from the first temperature to a second temperature prior to the step of cooling the mixture to the ligase temperature.
17. The method of claim 15, wherein the first temperature is about 90 °C.
18. The method of claim 16, wherein the second temperature is about 50 °C.
19. The method of claim 15, wherein the ligase temperature is about 37 °C.
20. The method of claim 15, wherein the cooling the mixture to a ligase temperature comprises gradual cooling for a duration of at least 1 hour.Attorney Docket No. 206161-0084-00WO21. The method of claim 15, further comprising the step of retrieving one or more polynucleotides from the mixture.
22. A method of synthesizing a polynucleotide, said method comprising: associating a polynucleotide scaffold with a plurality of adaptor oligonucleotides and a plurality of fragment oligonucleotides to form a mixture, wherein each of the adaptor oligonucleotides comprises an adaptor binding region that hybridizes with the polynucleotide scaffold and a fragment binding region that hybridizes with one or more fragment oligonucleotides to form a complex comprising the polynucleotide scaffold, at least one adaptor oligonucleotide, and at least one fragment oligonucleotide; and adding a ligase to the mixture, wherein the ligase ligates adjacent fragment oligonucleotides of the complex to form a target polynucleotide.
23. The method of claim 22, further comprising a step of purifying the target polynucleotide24. The method of claim 23, wherein the purifying comprises separating the target polynucleotide from other mixture components and extracting the separated target polynucleotide.
25. The method of claim 24, wherein the separating occurs by agarose gel electrophoresis.Attorney Docket No. 206161-0084-00WO26. The method of claim 22, wherein the hybridization of the fragment binding region with one or more fragment oligonucleotides occurs through cooperative binding, wherein the cooperative binding comprises the binding of a first portion of a fragment oligonucleotide to a first adaptor oligonucleotide, and a binding of a second portion of the fragment oligonucleotide to a second adaptor oligonucleotide.
27. The method of claim 22, wherein the adaptor oligonucleotides and fragment oligonucleotides are in excess concentration over the polynucleotide scaffold.
28. The method of claim 22, wherein the associating comprises heating and then cooling the mixture.
29. The method of claim 28, wherein the heating occurs for about 30 seconds to about 90 seconds at a temperature ranging from about 60 °C to about 90 °C.
30. The method of claim 28, wherein the cooling comprises reducing the mixture temperature after the heating step.
31. The method of claim 29, wherein the cooling comprises reducing the mixture temperature by at least 30 °C in less than about 30 minutes, and further reducing the mixture temperature by at least 30 °C in more than about 6 hours.
32. The method of claim 22, wherein the polynucleotide scaffold is selected from the group consisting of DNAs, RNAs, single-stranded DNAs, double-stranded DNAs, partially double-Attorney Docket No. 206161-0084-00WO stranded DNAs, DNA origamis, plasmids, single-stranded plasmids, phages, Ml 3 phages, or combinations thereof.
33. The method of claim 22, wherein the polynucleotide scaffold comprises an M13 phagemid DNA.
34. The method of claim 22, wherein the polynucleotide scaffold comprises at least 1,000 nucleotides.
35. The method of claim 22, wherein the polynucleotide scaffold comprises at least 2,500 nucleotides.
36. The method of claim 22, wherein the polynucleotide scaffold comprises at least 7,000 nucleotides.
37. The method of claim 22, wherein the adaptor oligonucleotides are selected from the group consisting of DNA-based nucleotides, RNA-based nucleotides, natural nucleotides, unnatural nucleotides, modified nucleotides, or combinations thereof.
38. The method of claim 22, wherein the adaptor oligonucleotides comprise at least 20 nucleotides.
39. The method of claim 22, wherein the adaptor oligonucleotides comprise at least 40 nucleotides.Attorney Docket No. 206161-0084-00WO40. The method of claim 22, wherein the adaptor oligonucleotides do not share complementary sequences with one another.
41. The method of claim 22, wherein the adaptor oligonucleotides do not hybridize to one another.
42. The method of claim 22, wherein the fragment oligonucleotides are selected from the group consisting of DNA-based nucleotides, RNA-based nucleotides, natural nucleotides, unnatural nucleotides, modified nucleotides, or combinations thereof.
43. The method of claim 22, wherein the fragment oligonucleotides comprise modified nucleotides.
44. The method of claim 43, wherein the modified nucleotides are modified with one or more molecules selected from the group consisting of methyl groups, amine groups, alkyne groups, thiol groups, azide groups, digoxigenin, cholesterol, triethylene glycerol (TEG), fluorophores, phosphorylated groups, quenchers, fluorescent dyes, biotin, cross-linking agents, spacers, molecules comprising covalent carbon-heteroatom bonds, molecules comprising phosphorothioate bonds, or combinations thereof.
45. The method of claim 22, wherein the fragment oligonucleotides comprise at least 10 nucleotides.Attorney Docket No. 206161-0084-00WO46. The method of claim 22, wherein the fragment oligonucleotides comprise at least 20 nucleotides.
47. The method of claim 22, wherein the fragment oligonucleotides do not share complementary sequences with one another.
48. The method of claim 22, wherein the fragment oligonucleotides do not hybridize to one another.
49. The method of claim 22, wherein the target polynucleotide comprises single-stranded polynucleotides, DNA, double-stranded polynucleotides, single-stranded DNA, double-stranded DNA, partially double-stranded DNAs, RNA, double-stranded RNA, single stranded RNA, modified nucleotides, or combinations thereof.
50. The method of claim 22, wherein the target polynucleotide comprises single-stranded DNA.
51. The method of claim 22, wherein the target polynucleotide comprises double-stranded DNA.
52. The method of claim 22, wherein the target polynucleotides comprise modified nucleotides.Attorney Docket No. 206161-0084-00WO53. The method of claim 52, wherein the modified nucleotides are modified with one or more molecules selected from the group consisting of methyl groups, amine groups, alkyne groups, thiol groups, azide groups, digoxigenin, cholesterol, triethylene glycerol (TEG), fluorophores, quenchers, fluorescent dyes, biotin, cross-linking agents, spacers, molecules comprising covalent carbon-heteroatom bonds, molecules comprising phosphorothioate bonds, or combinations thereof.