In vitro methods for the production of milk-like products
The bioreactor system with a membrane insert and lactation media effectively produces a milk-like product with the desired molecular profile, addressing low output and environmental concerns, and replicating the taste, texture, and nutritional value of whole milk.
Patent Information
- Application Number
- PCT/CA2025/051735
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-23
- Filing Date
- 2025-12-22
- Publication Date
- 2026-07-02
AI Technical Summary
Existing methods for producing milk-like products in vitro have low output and do not replicate the molecular profile, taste, texture, and nutritional value of whole milk, while also posing environmental and animal welfare concerns.
A bioreactor system with a membrane insert divides a culture vessel into apical and basal compartments, using mammary-derived cells adhered to the apical surface, and employs lactation media with inhibitors and pulsatile flow to produce a milk-like product, optionally with genetic modifications and shear stress.
The method achieves high output of a milk-like product with a molecular profile mirroring traditional milk, offering similar taste, texture, and nutritional value, while reducing environmental impact and animal welfare concerns.
Smart Images

Figure CA2025051735_02072026_PF_FP_ABST
Abstract
Description
[0001] IN VITRO METHODS FOR THE PRODUCTION OF MILK-LIKE PRODUCTS
[0002] SEQUENCE LISTING
[0003] The instant application contains a sequence listing which has been submitted electronically in xml format and is hereby incorporated by reference in its entirety. Said xml copy, created on December 18, 2025 and is 11,000 bytes in size.
[0004] FIELD OF THE INVENTION
[0005] The present invention pertains to the field of in vitro methods for the production of milklike products.
[0006] BACKGROUND OF THE INVENTION
[0007] Milk from domesticated animals and products manufactured therefrom is a staple of the human diet. Milk and dairy products are nutritionally dense foods that can be an affordable source of energy, protein and micronutrients including calcium, magnesium, selenium, riboflavin, vitamins B5 and B12.
[0008] The value of the dairy market worldwide in 2022 was estimated to be about 893 billion USD and is expected to grow to over a trillion USD by 2028. The majority of milk and milk products sold are cow’s milk products however milk from buffaloes, goats, sheep and camels are also sold.
[0009] Industrial scale production of milk is heavily reliant on natural resources including land and water and has a large environmental footprint, accounting for an estimated 2.9 percent of total human-induced greenhouse gas emissions. For example, cows produce methane, a greenhouse gas that damages the ozone layer and contributes to climate change. Methane has a much shorter atmospheric lifespan than CO2(around 12 years compared to centuries for CO2), but it is much more harmful. The Intergovernmental Panel on Climate Change (IPCC) quantifies the global warming potential (GWP) of methane between 84 and 87 when considering its impact over a period of 20 years (GWP20) and between 28 and 36 when they consider its impact over a period of 100 years (GWP100). This means that one tonne of methane can be considered equivalent to 28 to 36 tonnes of CO2if one considers its impact over 100years (IEA, 2021). In 2013, there were over a billion cows, occupying 1 / 3 of the ice-free land on the planet (Time). Deforestation combined with overgrazing of these lands can harm soil health and lead to loss of biodiversity (UC Davis, 2019). According to Sultana et al. (2014), producing 1 L of milk requires 1,466 L of green water (rainwater), 121 L of blue water (drinking water) and 106 L of gray water (wastewater). Blue water with the highest environmental impact.
[0010] In an effort to mitigate the consequences of traditional dairy production, some companies have developed plant- and nut-based alternatives, however existing options do not offer the same taste, performance, or nutritional value as real milk. This makes them unattractive in the eyes of many consumers. To overcome this problem, companies have started using the process of precision fermentation to produce individual recombinant milk proteins like beta-lactoglobulin for example (See AU2023278078A1). This process, using genetically modified microorganisms, has been used for decades to produce recombinant proteins and molecules like insulin, artificial flavors and vitamins, and chymosin (renin), which is used in 80% of global cheese production to curdle milk. Additionally, in the last few years, the process of molecular farming, where genetically modified plants, like soy, produce a protein, like kappa-casein, within the plant which can be isolated from the plant and sold as an ingredient for dairy products (See US10947552B1). Until now, precision fermentation and molecular farming technologies have only been used to make unique milk proteins (e.g. beta-lactoglobulin). However, a milk protein by itself does not reproduce the complexity of whole milk and therefore the taste, texture, and nutritional value of whole milk.
[0011] There are also significant animal welfare concerns with respect to industrial scale production of milk.
[0012] In vitro methods of producing milk-like products or milk constituents including fermentation-based methods and mammalian cell culture-based methods have been developed. Fermentation-based methods rely on genetically engineered microbes to produce individual milk components. Mammalian cell culture-based methods produce a milk-like product that has a molecular profile that more closely mirrors that of milk. These methods however have low outputs.There exists a need for a high output in vitro method of producing a milk-like product that has a molecular profile that mirrors that of traditionally produced milk.
[0013] This background information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art against the present invention.
[0014] SUMMARY OF THE INVENTION
[0015] An object of the present invention is to provide in vitro methods for the production of milk-like products. In accordance with an aspect of the present invention, there is provided a method of producing a milk-like product in vitro, the method comprising: (a) providing a bioreactor, the bioreactor comprising a culture vessel and a membrane insert, wherein the membrane insert divides the culture vessel into an apical compartment and a basal compartment and wherein a confluent layer of mammary-derived cells, optionally mammosphere-derived cells, is adhered to the apical facing surface of the membrane; (b) providing lactation media to the basal compartment, optionally the lactation media comprises TGFb inhibitor, ROCK inhibitor, RHO-ROCK-non-muscle myosin II pathway inhibitor, and / or prolactin, optionally the lactation medium is pumped through the basal compartment and optionally has a pulsatile flow; and (c) isolating the milk-like product from the apical compartment wherein optionally a priming treatment is added to growth media of the hyperconfluent cell monolayer before switching to lactation.
[0016] In accordance with another aspect of the present invention, there is provided a method of producing a milk-like product in vitro, the method comprising (a) providing a bioreactor, the bioreactor comprising a culture vessel and a stiff porous membrane insert for two dimensional cell culture, wherein the membrane insert divides the culture vessel into an apical compartment and a basal compartment and wherein a hyperconfluent monolayer of mammary-derived cells is adhered to the apical facing surface of the membrane, wherein growth media is in the basal compartment and optionally the apical compartment; (b) adding a priming treatment to the growth media; (c) replacing the growth media in the basal compartment with lactation media comprising a TGFb inhibitor, an inhibitor of intracellular actomyosin contractility, optionally a RHO-ROCK-non-muscle myosin II pathway inhibitor including a ROCKinhibitor or a myosin II inhibitor, and prolactin and optionally one or more of hydrocortisone, insulin, selenite, transferrin, ethanolamine (HITSX); and (d) isolating the milk-like product from the apical compartment.
[0017] In certain embodiments, the RHO-ROCK-non-muscle myosin II pathway inhibitor is a non-muscle myosin II inhibitor, optionally Blebbistatin.
[0018] In certain embodiments, the priming treatment comprises low concentrations of prolactin optionally less than 50 ng / mL and ROCK inhibitor, optionally 10 pM and optionally one or more of Vitamin C and Retinoic Acid Receptor inhibitor (RARi).
[0019] In certain embodiments, the harvest buffer comprises Simulated Milk Ultra-Filtrate, PBS and / or distilled water.
[0020] In certain embodiments, the mammary-derived cells are derived from mammary tissue of a lactating cow, optionally the mammary tissue is from parenchyma proximal to base of udder.
[0021] In certain embodiments, the membrane is a polyethylene terephthalate (PET) membrane, optionally wherein the PET membrane has a 0.4 pm pore size and 2E6 (2 x 106) pores I cm2. In certain embodiments, the membrane is a polycarbonate (PC) membrane, optionally wherein the PC membrane has a pore size of about 0.1 pm to about 8 pm and 1E6 (1 x 106) pores I cm2to and 100E6 (100 x 106) pores I cm2. In certain embodiments, the membrane is a Teflon®, optionally wherein the Teflon® membrane has a pore size of about 0.1 pm to about 8 pm and 1E6 (1 x 106) pores I cm2to and 100E6 (100 x 106) pores I cm2. The membrane may be pre-treated with gamma radiation and / or coated with extracellular matrix (ECM) and / or ECM mimetic.
[0022] In certain embodiments of the method, in step (b), the apical compartment is free of media. In other embodiments of the method, in step (b), the apical compartment comprises harvest buffer, the harvest buffer may comprise Simulated Milk UltraFiltrate, PBS and / or distilled water. Optionally, the harvest buffer is provided for a limited period of time, optionally until a layer of secreted milk is covering the surface of the mammary-derived cells.In certain embodiments, the mammary-derived cells are genetically modified. In specific embodiments the mammary-derived cells are genetically modified to express TGFb inhibitor, ROCK inhibitor (or RHO-ROCK-non-muscle myosin II pathway inhibitor) and / or prolactin.
[0023] Appropriate TGFb, ROCK and RHO-ROCK-non-muscle mysosin II pathway inhibitors are known in the art
[0024] In certain embodiments, the membrane insert includes micropatterns. In specific embodiments, the micropatterns are a plurality of microwells.
[0025] In certain embodiments of the method, during step (b) and / or step (c) the bioreactor is shaken or during step (b) and / or step (c) the cells are subjected to shear stress such as fluid shear stress.
[0026] In accordance with another aspect of the invention, there is provided a milk or milk-like product produced by the methods of the invention. In certain embodiments, the proteins in the milk or milk-like product are phosphorylated.
[0027] In accordance with another aspect of the invention, there is provided a bioreactor for producing a milk-like product in vitro, the bioreactor comprising: a culture vessel having a membrane insert, wherein the membrane insert divides the culture vessel into an apical compartment and a basal compartment; the apical compartment comprising at least one milk-like product output, wherein a confluent layer of mammary-derived cells, optionally mammosphere-derived cells, is adhered to the apical facing surface of the membrane; the basal compartment having at least one fluid input and at least one fluid output operatively connected to a fluidic system configured to pump lactation media through the basal compartment, and wherein the fluidic system is configured to generate a pulsatile or oscillating flow of the lactation medium.
[0028] In certain embodiments of the bioreactor, the fluidic system comprises a pump operatively connected to the at least one fluid input and configured to generate a pulsatile or oscillating flow of a lactation medium through the basal compartment.In certain embodiments of the bioreactor, the at least one milk-like product output is configured to harvest the at least one milk-like product at intervals.
[0029] In certain embodiments of the bioreactor, wherein the membrane includes a micropattern.
[0030] In certain embodiments of the bioreactor, the bioreactor is modular and / or scalable. In specific embodiments of the bioreactor, the bioreactor comprises a plurality of culture vessels, each having a membrane insert that divides the culture vessel into an apical compartment and a basal compartment. In more specific embodiments of the bioreactor, the plurality of culture vessels are stacked.
[0031] BRIEF DESCRIPTION OF THE FIGURES
[0032] These and other features of the invention will become more apparent in the following detailed description in which reference is made to the appended drawings.
[0033] FIG. 1 shows mammosphere lines derived from continuous culture of pMGEOs grow as hollow mammospheres in suspension culture. (A) Flow cytometry of dissociated pMGEOs and 03 / 23-12 mammosphere line, stained for EpCAM and CD49f. Gates were determined using isotype controls. (B) Image of mammospheres on Day 2 postseeding and and Day 7 post-seeding. (C) Images and (D) histogram of CD49f staining of mammospheres propagated from CD49f+ and CD49f- MACS sorted cells.
[0034] FIG. 2 shows continuous culture in suspension results in long-lived mammosphere lines with sustained luminal marker expression. (A) qPCR for CSN3, ELF5, GAT A3, and PRLR of 02 / 23-05 (parental) and 03 / 23-12 (immortalized) mammosphere lines up to passage 32. (B) qPCR for CSN3 and ELF5 in 2D propagated cell lines P2-E10 and P3-E4. (C) Doubling time of mammosphere lines 02 / 23-05 and 03 / 23-12. (D) qPCR for cowTERT in parental 02 / 23-05 and transduced 03 / 23-12 mammosphere lines; N.D. = not detectable. (E) Genomic Cleavage Detection Assay of CDKN2A Exon 1 in the 03 / 23-12 mammosphere line and a control.
[0035] FIG. 3 shows mammosphere lines respond to lactation induction with prolactin, and is enhanced with CLMV1 media supplement and estrogen. (A) Nile red staining of mammospheres induced after prolactin treatment. (B) qPCR for genes related tocaseins, whey proteins, lipid production, and secretion. Western blots demonstrating the increased milk protein production upon treatment with (C) prolactin (i.e. lactation induction) and (D) 2.5 ug / mL estradiol (E2). (E) Flow cytometry of Prl treated mammospheres stained for EpCAM and CD49f.
[0036] FIG. 4 shows mammosphere-derived cells respond to lactation in 2D insert culture, and requires TGFb and ROCK inhibition, which is accelerated by nutrient-free apical culture. (A) Diagram of membrane insert culture, with air-liquid interface variant. (B) Nile Red staining of insert lactation with and without 10 uM ROCKi, scale bar = 200 urn. (C) qPCR of CSN1S1, LALBA, and PAEP after lactation induction in insert culture ± ROCKi ± RepSox. (D) Images of lipid droplet accumulation on Day 3 of lactation induction with CLMV1 + ROCKi + SB431543 + 1 ug / mL bovPrl in ALI, Low / High Electrolyte, and apical SMUF formats. (E) qPCR of CSN1S1, LALBA, and PAEP after 6d lactation induction in ALI, Low / High Electrolyte, and apical SMUF formats.
[0037] FIG. 5 shows lactation induction of insert cultures results in milk protein and lipid secretion. Only apical-fluid culture systems produce mature b-Casein. (A) Heatmap of proteins identified in commercial milk and if they were identified in the apical harvests of ALI and apical SMUF induced cells on Day 6 of lactation by mass spectrometry. (B) Images of lipid droplets floating in apical harvests from ALI and apical SMUF culture conditions. (C) Western blot for b-CSN in the apical harvests of ALI vs apical-fluid lactation induction on inserts. (D). Western blots for b-casein (b-CSN) and a-lactalbumin (a-LA) of secretions from cells with apical SMUF with single, 3-day, and daily apical harvest starting on Day 6 where applicable, and (E) Western blots for b-casein (b-CSN) and a-lactalbumin (a-LA) of secretions from cells seeded on increasing concentrations of recombinant porcine Col-I, 40 ug / cm2bovine Col-Ill, 40 ug / cm2Col-V, or 40 ug / cm2recombinant porcine Col-I with Lam-111 on top as the 2D ECM.
[0038] FIG. 6. Modulating components of CLMV1 and adding a priming phase prior to lactation induction improved secretion of milk proteins and lipids. (A) TAG quantification and Western blot for milk proteins with (B) CLMV1 prepared with lower Na Acetate and replacing oleic with palmitic acid, or (C) CLMV1 prepared with reduced glucose and IPAA and additional DHA. Western blot of milk proteins secreted with (D) the addition of Vitamin C to lactation media and a priming treatment of 50 ng / mL Prl, 10 uM Y-27532, 100 ug / mL Vitamin C or (E) addition of 50 ng / mL Prl to 2D Growthmedia forthe entire length of the 2D Growth Media. (F) qPCR of CSN1S1, LALBA, and PAEP after lactation induction in 3D mammospheres or optimized 2D induction with GD9-14 priming and 100 ug / mL Vitamin C during lactation (G) Lipid droplets from raw milk and secreted in vitro from cells induced with CLMV4.
[0039] FIG. 7 shows a Holstein-derived cell line was generated using protocols described in sections 1.1 - 1.4 and made to lactate. (A) Holstein-derived mammosphere growth from Day 2 to Day 7. (B) Western blot for milk proteins and (C) lipid droplets secreted from Jersey and Holstein-derived cells primed with 10 uM ROCKi + 50 ng / mL Prl + 100 ug / mL Vitamin C + 1 uM Vitamin D2 and induced with CLMV4 + 1 uM Vitamin D2 + 1 ug / mL endo bovPrl.
[0040] FIG. 8 shows scalability considerations for the developed lactation model: lactation induction of insert cultures of various sizes produce similar secreted product, and may last as long as 30 days. (A) Western blot of proteins secreted over 24 days in 4.5 cm2and 100 cm2membranes sizes induced to lactate under identical conditions. Butter was made by (B) combining the lipid secretions and intracellular lipid from the 100 cm2culture, (C) centrifuging the harvest, (D) removing the aqueous layer, and (E) vortexing until the milk fat solids separated. (F) Western blot of apical harvests from cells on 0.3 cm2and 4.5 cm2membranes.
[0041] FIG. 9 shows scalability considerations forthe developed lactation model: longevity of milk secretion. (A) Secreted protein in apical SMUF and ALI lactation inductions. Western blots of milk proteins secreted (B) up to day 30 of lactation induction with apical SMUF. (C) Intracellular lipid droplet secretion on lactation days 6, 9, and 12, and (D) milk protein secretion of cells induced with lower Na Acetate and palmitic acid in place of oleic acid. Western blots for bCSN and aLA of apical harvests every three days from (E) cells that were harvested with and without air exposure of the cell monolayer.
[0042] FIG 10 shows scalability considerations for the developed lactation model: Low-cost alternatives for cost-driving components support mammosphere growth and downstream lactation. (A) Mammospheres grown in 10% (v / v) 1% alginate hydrogel functionalized with RGD-Peptite via L-DOPA in 3D Growth Media. Western blots of harvests from (B) cells derived from mammospheres grown in 2% Matrigel or 10%RGD functionalized alginate as the 3D ECM, (C) cells grown in 3D and 2D with B27 alternatives of hydrocortisone (HCort), Retionic Acid (RA), or BSA. (D) Fold-expansion of cells after mammosphere growth in 3D growth media with either B27, retinoic acid (RA) + BSA, or RA + HP-beta-cyclodextrin (HPBC). Western blots of harvests from cells induced with (E) recombinant human growth hormone (humGH) or (F) recombinant pseudo-phosphorylated prolactin mutant S179D as the lactogenic treatment. (G) Image of confluent cell monolayer on membrane without ECM coating but treated with 50 ng / mL endogenous bovine prolactin and 10 uM ROCKi throughout 2D growth. (H) Comparison of ROCKi vs non-muscle myosin II inhibition wherein 25 uM Blebbistatin can replace 10 uM ROCKi during 6 Day ALI lactation induction as both condition #1 (10 uM ROCKi) and #2 (25 uM Blebbistatin) resulted in similar induction.
[0043] FIG. 11 shows low passage and high passage mammosphere-derived cells respond differently to lactation induction. (A) Representative images of lipid droplet accumulation on Day 4 of lactation induction and (B) Western blot and (C) qPCR after 6 days of lactation induction in the low passage (02 / 23-05 mammosphere-derived cells) and high passage (03 / 23-12 mammosphere-derived cells) grown in inserts in either COM-LC, COM-LC + TGFa, or Simple Growth Media (-TGFa in low passage and +TGFa in high passage) for 14 days followed by ALI lactation. N.D. = not detected.
[0044] (D) qPCR of high passage (P47) cells treated with GNE-7883, EHMT2-IN-1, Revumenib, Tazemetostat in Simple Growth Media + TGFa and CLMV1 lactation medias, P8 grown in COM-LC data added as a control. RQ values are calculated relative to P47 cells grown in Simple Growth Media + TGFa and induced with CLMV1.
[0045] DETAILED DESCRIPTION OF THE INVENTION
[0046] Definitions
[0047] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0048] As used herein, “apical surface” means the surface that faces an external environment or toward a cavity or chamber. With respect to mammary epithelial cells, the apical surface is the surface from which the cultured milk-like product is secreted.As used herein, “basal surface” means the surface that is opposite to the “apical surface”.
[0049] As used herein, “bioreactor” means a device or system that supports a biologically active environment that enables the production of a culture milk-like product described herein from mammary cells described herein.
[0050] As used herein, “2D culture” and variations thereof refers to monolayer cell culture where cells grow on a flat surface in a single layer.
[0051] As used herein, “3D culture” and variations thereof refers to cultures where cells grow in three dimensions as spheroids, clusters organoids, or within a scaffold.
[0052] Milk is the nutrient rich food produced by the mammary glands of mammals. It includes proteins, calcium, milk sugars including lactose, metabolites and saturated fats. Multi-omics analysis of milk of different species reveals species’ specific composition (Q. Li et al., Food Chem. 2024, ol. 457, 140028, https: / / doi.orq / 10.1016Zi.foodchem.2024.140028). Variation in milk composition can be observed between breeds of the same species (M. Pazzola et al., J. Dairy Sci.
[0053] 102:3947-3955).
[0054] Provided herein are methods of producing a milk-like product using isolated mammary derived cells. In some embodiments of the method, the milk-like product produced substantially mirrors the milk produced by lactating mammary glands. In such embodiments, the milk produced by the methods has the compositional complexity of whole milk and thus a substantially similar taste, texture, and nutritional value of whole milk.
[0055] In alternative, embodiments, the methods produce a milk-like product designed to meet specific nutritional or composition requirements. For example, in some embodiments, the milk-like product is enriched in protein. In an exemplary embodiment, the cells used in the method having been modified to increase the level of casein in the milk. In alternative embodiments, non-human mammary cells are modified to produce human milk proteins.In some embodiments, the milk-like product is a derived product that is reduced in milk fat.
[0056] Cells:
[0057] The mammary cells used in the methods are mammary epithelial cells derived from a mammary gland, optionally lactating, by means known in the art. In some embodiments, the mammary epithelial cells are derived from mammary gland stem cells isolated from mammary gland epithelial organoids produced using methods known in the art.
[0058] Cells derived from mammary gland epithelial organoids may be propagated in vitro as mammospheres in suspension culture. Optionally, the mammosphere derived cell lines are immortalized.
[0059] Alternative sources of mammary gland stem cells are known in the art and include milk-derived stem cells.
[0060] Optionally, mammary stem cells can be isolated using flow cytometry sorting as is known in the art.
[0061] The mammary cells used in the methods can be isolated from any mammal including a primate (e.g., chimpanzee, orangutan, gorilla, monkey (e.g., Old World, New World), lemur, human), a canine including dog or wolf, a feline including cat, a rabbit, rodents including a mouse or a rat, equine including horse or donkey, a cow, a goat, a sheep, an ox (e.g., Bos spp.), a pig, a deer, a musk deer, a bovid, a whale, a dolphin, a hippopotamus, an elephant, a rhinoceros, a giraffe, a zebra, a lion, a cheetah, a tiger, a panda, a red panda, bison and an otter. In some embodiments, the mammary cells are from an endangered species, e.g., an endangered mammal. In some embodiments, the mammary cells are from a human. In some embodiments, the mammary cells are from a bovid (e.g., a cow or water buffalo).
[0062] Optionally, the mammary cells may be isolated from specific mammals that are proven producers of large quantities of milk and / or produce milk that has specific characteristics. For example, it is known in the art, that the type of p-casein protein inthe milk of a cow is dependent on cow’s genetics, wherein A1 and A2 types differ in amino acid histidine or proline, respectively, at position 67 of the protein. Evidence suggests that A2 milk is more easily digestible than A1 protein. Accordingly, in some embodiments, the mammary cells are isolated from a mammal that produces milk with specific properties.
[0063] In some embodiments, the mammary cells are genetically modified. Optionally, such cells are isolated from transgenic livestock including transgenic cows or are modified in vitro. Methods of genetically modifying livestock or cells derived therefrom are known in the art. Genetic modifications include knock-outs, knock-ins, point mutations, deletion mutations, substitutions and insertion of transgenes. Methods of genetically modifying cells are well known in the art and include gene targeting using homologous recombination, Zinc finger nuclease (ZFN), Transcription activator-like effector nucleases (TALENs), Homing endonucleases or meganucleases, and CRISPR gene editing.
[0064] In some embodiments, the mammary cells are modified to facilitate the production of milk. For example, in some embodiments, the mammary cells have been modified to express a prolactin receptor agonist including prolactin. In some embodiments, the mammary cells have been genetically modified to express a constitutively active prolactin receptor. Expression of the constitutively active prolactin receptor or prolactin may be under the control of an inducible promoter or a constitutively active promoter.
[0065] In some embodiments, the mammary cells are modified to express a ROCK inhibitor and or TGFb inhibitor. Appropriate ROCK inhibitors are known in the art and include a dominant negative ROCK having N-terminal deletion of amino acids 1-77 or RBPH(TT), amino acid 941-1388 C-terminal fragment only of ROCK2 with N1036T & K1037T point mutations to abolish Rho-binding) expression. Appropriate TGFb inhibitors are known in the art and include dominant negative TGFBR-II (deleted cytoplasmic domain) expression. In some embodiments, these inhibitors are under the control of an inducible promoter such that expression occurs at the start of lactation. In some embodiments, the promoter is a prolactin-inducible mammary specific promoter.In some embodiments, the mammary cells are modified to overexpress one or more milk proteins such as one or more whey proteins such as one or more of a-lactalbumin, [3-lactoglobulin or serum albumin. In some embodiments, the genes encoding the proteins is under the control of an inducible protein such that expression occurs at the start of lactation. In some embodiments, the promoter is a prolactin-inducible mammary specific promoter.
[0066] In some embodiments, the mammary cells are modified to express one or more proteins not typically found in milk.
[0067] In some embodiments, the mammary cells are modified to express one or more alternate version of a milk protein or reduce or eliminate expression of specific milk proteins. For example, a hypoallergic cow’s milk is produced from mammary cells with a bi-allelic knockout of the gene encoding p-lactoglobulin.
[0068] Methods of Producing Milk-like Products
[0069] Disclosed herein, in certain embodiments, are methods of making milk-like products. In some embodiments, the method comprises culturing a monolayer of mammary derived cells as disclosed herein in a bioreactor comprising a membrane insert that divides a culture vessel into a basal compartment and an apical compartment, wherein the basal compartment comprises media and the mammary cells are adhered to the apical facing surface of the membrane.
[0070] In some embodiments, the membrane is a Polyethylene terephthalate (PET) membrane, polycarbonate membrane or Teflon® having a pore size between 0.1-8 pm and pore density of 1 x106to 100 x106pores I cm. In some embodiments, the membrane has a micropattern. Optionally in some embodiments, the membrane is coated or pre-treated, for example with extracellular matrix (ECM) and / or ECM mimetic. ECM mimetic include ECM mimetic peptide coatings (Laminin = RKRLQVQLSIRT, IKVAV, RQVFQVAYIIIKA, YIGSR, KAFDITYVRLKF - Collagen-I = GFPGER, GFOGER, GPAGKDGEAGAQG - Collagen-IV = GEFYFDLRLKGDK, TAGSCLRKFSTM, TAIPSCPEGTVPLYS). Accordingly, the method may include a pre-treatment step.The method comprises culturing the mammary derived cells to a substantially confluent monolayer prior to inducing lactation. In some embodiments, the monolayer of mammary cells is cultured to at least 70% confluent, at least 80% confluent, at least 90% confluent, at least 95% confluent, at least 99% confluent, or 100% confluent prior to inducing lactation.
[0071] During the growth phase, the apical compartment optionally comprises media.
[0072] Appropriate growth media is known in the art and include a basal media comprising a carbon source and buffer supplemented with various factors. In one embodiment, the growth media is DMEM / F12 supplemented with various factors, for example, 10-50 ng / mL TGFa, 10 ng / mL TNFa, 50 ng / mL IL-4, 50 ng / mL IL-13, and / or 50 ng / mL EREG, 50 ng / mL AREG.
[0073] Appropriate growth conditions are known in the art and include appropriate temperature, CO2concentration and humidity. In some embodiments, the cells are cultured at a temperature of about 35°C to about 39°C (or any value or range therein). In some embodiments, the culturing and / or cultivating is carried out at a temperature of about 37° C. Selection of appropriate temperature may be based on the mammal from which the cells originate. Appropriate CO2concentration includes a concentration that is substantially equivalent to atmospheric concentration of C02of about 4% to about 6%, e.g., an atmospheric concentration of C02of about 4%, 4.25%, 4.5%, 4.75%, 5%, 5.25%, 5.5%, 5.75%, or 6% or any value or range therein, e.g., about 4% to about 5.5%, about 4.5% to about 6%, about 4.5% to about 5.5%, or about 5% to about 6%). In some embodiments, the culturing and / or cultivating is carried out at an atmospheric concentration of CO2of about 5%.
[0074] Culture media is exchanged or refreshed as is known in the art.
[0075] Prior to inducing lactation, any media in the apical compartment is removed and the apical compartment is optionally washed with PBS, milk ultra-filtrate or simulated milk ultra-filtrate (SMUF).
[0076] To induce lactation, the cells are either maintained in an air-liquid interface format wherein the apical compartment is liquid-free, or the apical compartment is filled witha harvest buffer of PBS, milk ultra-filtrate, or simulated milk ultra-filtrate (SMUF) for a period of time and the media in the basal compartment is switched to lactation media. In some embodiments, the period of time is 1, 2, 3, 4 or more days.
[0077] In some embodiments, lactation media comprises prolactin or an alternative hormonal equivalent capable of activating the prolactin receptor (i.e. bovine pituitary extract or human growth hormone). Appropriate sources of prolactin are known in the art and include bovine prolactin and recombinant prolactin including pseudo-phosphorylated prolactin. If the mammary cells have been engineered to constitutively express prolactin or express constitutively active prolactin receptor, addition of prolactin is not necessary. If the cells have been engineered to induce prolactin expression, the inducer of prolactin expression is added to the lactation media.
[0078] The lactation media may further include other factors to promote lactation including hormones such as estradiol and / or ROCK inhibitors and / or TGFb inhibitors.
[0079] RHO-ROCK-non-muscle myosin II pathway and TGFb inhibitors may be required for lactation when the cells are on some substrates or in 2D cultures. In particular, RHO-ROCK-non-muscle myosin II pathway inhibitors including inhibitors of intracellular actomyosin contractility such as ROCK inhibitors including Y-27632 or myosin II inhibitors including Blebbistatin, and TGFb inhibitors are required for lactation in 2D cultures when the cells are adhered to a rigid or stiff substrate such PET, PES, PVDF and PC membranes.
[0080] The use of inhibitors of intracellular actomyosin contractility may allow the mammary cells in vitro on the stiffer substrates used in 2D cultures to respond to lactation signals in a manner that is more in line with mammary cells in the mammary gland.
[0081] The milk-like product is secreted into the apical compartment. In some embodiments, collection of secreted milk-like product is promoted by washing the induced cells with PBS, milk ultra-filtrate or simulated milk ultra-filtrate (SMUF) and collecting the secreted product.
[0082] In alternative embodiments, secretion of the milk-like product is promoted by inducing a shear stress in the lactating cells. Optionally, the shear stress is a fluid shear stress.Methods of producing shear stress are known in the art and includes generating a pulsatile or oscillating flow of the lactation medium
[0083] Secreted milk-like product is collected continuously or at intervals through, for example, output in the apical compartment of the culture vessel. Optionally a vacuum is applied to the output to facilitate collection of the milk-like product.
[0084] In some embodiments, the method further comprises post-production processing. Post-production processing includes but is not limited to freezing and / or lyophilizing the milk-like product and / or spray drying and / or ultrafiltration.
[0085] In some embodiments, the method further comprises extracting one or more components from the milk-like product. Non-limiting examples of components from the milk-like product include milk proteins, lipids, carbohydrates, vitamins, and / or mineral contents. Methods of extracting these components are known in the art.
[0086] Milk-like Products
[0087] Disclosed herein, in certain embodiments, are milk-like products produced by any method disclosed herein. Also disclosed herein are isolated components of the milklike products including proteins, sugars and fats. Optionally, the milk-like products are produced from genetically modified cells.
[0088] Bioreactors and Systems:
[0089] The present invention further provides bioreactors and systems comprising one or more bioreactors for producing a milk or milk-like product in vitro.
[0090] In certain embodiments of the present invention, the bioreactor comprises one or more culture vessel(s). Accordingly, in certain embodiments, the bioreactor is modular and / or scalable. In some embodiments of the bioreactor comprising a plurality of culture vessels, the culture vessels are stacked.
[0091] Each culture vessel comprises a membrane insert which divides the culture vessel into an apical compartment and a basal compartment. A confluent layer of mammary-derived cells, optionally mammosphere-derived cells, of the present invention is adhered to the apical facing surface of the membrane(s). The apical compartment of each culture vessel comprises at least one milk-like product output. The basal compartment of each culture vessel comprises at least one fluid input optionally configured to operatively connect to a fluidic system and at least one fluid output optionally configured to connect to a fluidic system. In certain embodiments, the fluid input and output are separate structures and in alternative embodiments, the fluid input and output is a single structure.
[0092] The membrane insert comprises a microporous membrane. Such microporous membranes for use in cell culture are known in the art and commercially available. The microporous membranes may be constructed from a variety of materials including but not limited to polyethylene terephthalate, polycarbonate, Polyvinylidene fluoride (PVDF), Polyethersulfone (PES) or Teflon® (Polytetrafluoroethylene (PTFE)). In certain embodiments, the microporous membrane is a polyethylene terephthalate (PET) membrane. In specific embodiments, the PET membrane has a 0.4 pm pore size and 2E6 (2 x 106) pores I cm2. In certain embodiments, the microporous membrane is a polycarbonate (PC) membrane. In specific embodiments, the PC membrane has a pore size of about 0.1 pm to about 8 pm and 1E6 (1 x 106) pores / cm2to and 100E6 (100 x 106) pores I cm2. In certain embodiments, the membrane is a Teflon® (Polytetrafluoroethylene (PTFE)) membrane. In specific embodiments, the Teflon® membrane has a pore size of about 0.1 pm to about 8 pm and 1E6 (1 x 106) pores I cm2to and 100E6 (100 x 106) pores I cm2.
[0093] In certain embodiments, the membrane is pre-treated. Pre-treatment of the membrane may alter the membrane’s physical properties which may result in improved rate of cell adhesion. In specific embodiments, the membrane is pre-treated with gamma radiation.
[0094] In certain embodiments, the membrane includes micropatterns. Such micropatterns may increase the culture surface area. For example, the micropatterns may comprise a plurality of microwells. In specific embodiments, the membranes are dimpled to mimic the alveolar structure of a mammary gland.In certain embodiments, the membrane is coated with an extracellular matrix (ECM) and / or ECM mimetic. In certain embodiments, the ECM coating comprises one or more collagen proteins including but not limited to Collagen III, Collagen IV, Collagen V and Collagen I proteins and / or one or more Laminin proteins, including but not limited to Laminin 111 and Laminin 521. In some embodiments, the coating comprises any combination of ECM components with each component being provided in an amount of 0.00004 - 1000 ug / cm2. In specific embodiments, the coating comprises any combination of 40 ug / cm2, Collagen-IV and / or 40 ug / cm2Collagen-I and / or 10 ug / cm2Laminin-111 and / or 10 ug / cm2Laminin-521. In certain embodiments, the ECM coating is a Matrigel coating. In specific embodiments, the coating is a 1:100 dilution of Matrigel (~65 ug / cm2ECM protein). Alternatively, ECM mimetic peptide coatings may be used instead of full length ECM proteins. Non-limiting exemplary peptides include the following: Laminin peptides: RKRLQVQLSIRT, IKVAV, RQVFQVAYIIIKA, YIGSR, KAFDITYVRLKF; Collagen-I peptide: GFPGER, GFOGER, GPAGKDGEAGAQG; Collagen-IV peptides: GEFYFDLRLKGDK, TAGSCLRKFSTM, TAIPSCPEGTVPLYS. Still further recombinant partial proteins may be used instead of full length proteins including but not limited to the triple helical domain of various collagens including the triple helical domain of Col-I.
[0095] In certain embodiments of the present invention, there is provided a system of producing a milk-like product in vitro, the system comprising: one or more of the bioreactors of the present invention; a fluidic system configured to input lactation medium into, and optionally output lactation medium out of, the basal compartment of each culture vessel; and a milk-like product output system operatively connected to the apical compartment of each culture vessel, optionally wherein the at least one milklike product output is configured to harvest the at least one milk-like product at intervals.
[0096] The fluidic system is configured to pump lactation media through the basal compartment and optionally generate a pulsatile or oscillating flow of the lactation medium. In certain embodiments, the fluidic system comprises a pump operatively connected to a bioreactor and a supply of lactation medium. In certain embodiments the fluidic system is configured to generate a pulsatile or oscillating flow of a lactation medium through the basal compartment of each culture vessel.A worker skilled in the art would readily appreciate that cell cultures should be maintained at specific temperatures and CO2. Accordingly, in certain embodiments, the system further comprises environmental systems for temperature control and CO2control. In addition, in certain embodiments, the system further comprises a control system which allows for the automation of the methods of the present invention.
[0097] Milk-like product output system is configured to connect to the apical compartment and optionally comprises an output or port configured to output the milk-like product. In some embodiments, the milk-like product output system comprises a vacuum operably connected to the output or port to facilitate collection of the milk-like product.
[0098] Scalability considerations: alternatives for cost-driving reagents
[0099] In some embodiments for commercial production, a number of cost saving measures may be employed to keep costs low including but not limited to 3D ECM alternatives.
[0100] As described above, cells are captured in a hydrogel to facilitate mammosphere formation and keep the cells in suspension. When first developed, the hydrogel was made of 2% (v / v) Matrigel, a chemically undefined basement membrane harvested from Engelbreth-Holm-Swarm mouse tumours. Chemically defined and cost effective alternatives include but are not limited to:
[0101] o Hydrogels composed of alginate, a polymer extracted from seaweed, which may be functionalized with Laminin, Collagen-I, and Collagen-IV ECM mimicking peptides previously described above (R. Curvello, et al. Adv.Sci. 2021 , 8,
[0102] 2002135. https: / / doi.org / 10.1002 / advs.202002135) .
[0103] o Synthetic I natural hydrogel based microcarriers which may be functionalized with Laminin, Collagen-I, and Collagen-IV ECM mimicking peptides previously described above or functionalized with plant-derived proteins with ECM mimicking properties (e.g pumpkin seed protein extract), see Yan Kong, et al., Food Research International, olume 168, 2023, 112750, ISSN 0963- 9969, https: / / doi.Org / 10.1016 / j.foodres.2023.112750.
[0104] o Thermoresponsive poly(N-isopropylacrylamide)-co-poly(ethylene glycol) (PNIPAAm-PEG) hydrogel (Lei Y, et al.. Proc Natl Acad Sci U SA. 2013 Dec 24;110(52):E5039-48. doi: 10.1073 / pnas.1309408110. Epub 2013 Nov 18. PMID: 24248365; PMCID: PMC3876251.), which may be functionalized with Laminin, Collagen-I, and Collagen-IV ECM mimicking peptides previously described above.
[0105] o Polyisocyanide (PIC) hydrogel (.J.A.P.M. Wijnakker,et al., Proc. Natl.
[0106] Acad. Sci. U.S.A. 122 (42) e2507500122, https: / / doi.org / 10.1073 / pnas.2507500122 (2025), which may be functionalized with Laminin, Collagen-I, and Collagen-IV ECM mimicking peptides previously described above.
[0107] o Fully defined QGel CN99 PEG based hydrogel (Fredrik Bergenheim, et al. Biomaterials. 2020 Dec;262: 120248. doi: 10.1016 / j. biomaterials.2020.120248. Epub 2020 Aug 19. PMID: 32891909).
[0108] o Nanocellulose based hydrogel which may be functionalized with Laminin, Collagen-I, and Collagen-IV ECM mimicking peptides previously described above (R. Curvello, et al. Growth. Adv. Sci. 2021, 8, 2002135. https: / / doi.orq / 10.1002 / advs.202002135) o Invasin protein may be used to functionalize a hydrogel or other culture surface (i.e. in 2D) in place of traditional ECM proteins such as collagen or laminin (J. J. Wijnakker,G.J. et al., Proc. Natl. Acad. Sci. U.S.A. 122 (1) e2420595121, https: / / doi.org / 10.1073 / pnas.2420595121 (2025). o Treatment with an integrin-activating antibody as described in de Lau et al. Nat Biotechnol (2025) may also allow growth in the absence of peptide functionalization of a hydrogel as described above
[0109] In some embodiments, 2D ECM alternatives may be used. Adding low concentrations of lactogenic treatment to 2D growth media for cell seeding growth throughout the 2D growth phase may replace the need for 2D ECM, as a confluent monolayer was able to grow in absence of 2D ECM with this addition to 2D Growth Media (Figure 10G). Endogenous prolactin or an equivalent lactogenic treatment such as human Growth Hormone (hGH) or recombinant mutant prolactin S179D may be used as the lactogenic treatment. Alternatively, treatment with an integrin-activating antibody as described in de Lau et al. (2025) may also allow growth in the absence of 2D ECM.In some embodiments, genetic engineering may be used to introduce inducible recombinant genes and / or gene silencing / knockouts that mimic the effect of prolactin, as well as small molecule inhibitors targeting TGFb and ROCK that in some embodiments are necessary for lactation. This may include establishment of cell lines with permanent knockouts of ROCK, TGFb, or any downstream genes that facilitate their respective signaling pathways.
[0110] To gain a better understanding of the invention described herein, the following examples are set forth. It will be understood that these examples are intended to describe illustrative embodiments of the invention and are not intended to limit the scope of the invention in any way.
[0111] EXAMPLES:
[0112] Retrieval and cryogenic preservation of Lactating Mammary Gland Tissue Jersey cow tissue samples were taken from the youngest available lactating cow on the day of slaughter. The tissue samples were from the upper parenchymal region of the mammary gland (i.e. near the base of the udder, farthest away from the teets). For the medium and large tissue samples that were used to establish the cell lines, tissue was taken from deeper below the exterior surface of the mammary gland. The large sized tissue samples were submerged in 250 mL HBSS + 1x Antibiotic Antimycotic (A.A.) in sterile 500 mL glass bottles and medium sized tissue samples were submerged in 10 mL HBSS + 1x Antibiotic Antimycotic (A.A.) in sterile 50 mL falcon tubes, and transported on ice. The large tissue samples were stored overnight at 4°C submerged in HBSS + 1 x A.A OR PBS + 10x A.A.
[0113] Holstein cow, tissue samples were obtained by a needle biopsy. The needle biopsy was performed on a cow on her second lactation at peak lactation to retrieve ~700 mg of tissue. This tissue was processed immediately for cell line establishment.
[0114] Isolation of Epithelial Organoids from Lactating Mammary Gland Tissue Methods are based on Chapter 14 of Martignani, E., Accornero, P., Miretti, S., Baratta, M. (2018). Bovine Mammary Organoids: A Model to Study Epithelial Mammary Cells. In: Baratta, M. (eds) Epithelial Cell Culture. Methods in Molecular Biology, vol 1817.Humana Press, New York, NY. https: / / doi.org / 10.1007 / 978-1-4939-8600-2 14. In particular, the tissue was minced in a sterile 10 cm dish with HBSS + 1X A.A into ~3 mm3pieces and washed repeatedly with 10 mL volumes of HBSS + 1X A.A or PBS + 1X A.A. to remove residual milk. When necessary, spun minced tissue at 200 xg for 2 min. The minced tissue was digested using Tissue Digestion Solution (DMEM / F12 + 2% BSA + 100 U / mL Hyaluronidase + 590 U / mL Collagenase type II) overnight in a 37°C 5% CO2incubator on an orbital shaker at 60 rpm. The overnight digests were collected and centrifuged at 80 xg for 30 s at 4°C. The supernatant containing the non-epithelial organoid fraction was removed, and the pellet was washed with DMEM / F12 + 1X A.A. and centrifuged as before. The supernatant containing the non-epithelial organoid fraction was removed. The final pellet contained partially digested pMGEOs that were either used immediately for cell line derivation or cryogenically preserved in a mixture of 50% FBS + 40% DMEM / F12 + 10% DMSO.
[0115] Establishing Mammosphere Line
[0116] Detailed below are four methods of establishing a mammosphere line.
[0117] 1. Matrigel slab embedding
[0118] Cryogenically preserved partially digested pMGEOs were thawed, diluted in phenol-DMEM / F12 and centrifuged at 200 xg for 2 min. Supernatant was removed, pMGEOs were resuspended in 100% Matrigel using pre-chilled 1 mL tip and seeded into a 24 well plate pre-coated with an pMGEO-free 100% Matrigel layer (polymerized for 1 hour at 37°C) to prevent 2D adherent culture beneath the pMGEO containing Matrigel slab. The slab was allowed to polymerize for 1 hour at 37°C before feeding with Recovery Media (Phenol-free DMEM / F12 containing HEPES and Glutamine + Recovery Supplement, see Table 1).
[0119] Table 1. Recovery Media Supplement (recipe based on Chatterjee, S., Basak, P., Buchel, E. etal. A robust cell culture system for large scale feeder cell-free expansion of human breast epithelial progenitors. Stem Cell Res Ther9, 264 (2018). https: / / doi.Org / 10.1186 / S13287-018-0994-y)
[0120]
[0121]
[0122] Embedded organoids were cultured for two weeks, changing media every 2-3 days. After two weeks, pMGEOs were recovered from the Matrigel slab by aspirating the media and disrupting the gel by pipetting vigorously with cold PBS and transferred into a 15 mL tube. pMGEOs were pelleted at 250 xg for 5 min (OR 2X 2 min 200 x g spins) and washed with PBS. pMGEOs were then resuspended in Tissue Digestion Solution and incubated for 3h at 37°C in a 6-well plate on an orbital shaker at 60-90 rpm, manually pipetting the well every hour to ensure complete dissociation. The digested organoids were spun 2x at 80 xg for 30 sec to selectively pellet the organoids and the supernatant containing non-organoid single cells was removed, organoid pellet was resuspended in phenol-free DMEM / F12 containing HEPES Wash for 2nd 30 sec 80x spin. To dissociate into single cells, fully digested pMGEOs were resuspended in 2 mL AccuMAX or TrypLE:AccuMAX (1:1) and incubated in 37°C water bath for 30 minutes to 1 hour in 15 mLtube, triturating with 1 mL pipette tip every 10-15 minutes to enhance dissociation. Cells were pelleted at 450 xg for 5 min and the was supernatant discarded. Cells were then seeded for continuous culture as described below. Alternatively, COM-LC may be used instead of Recovery media as an FBS-free method.
[0123] 2. Digestion and 2% matrigel recovery
[0124] Thawed partially digested pMGEOs were immediately digested with Tissue Digestion Solution (according to method above) without embedding in Matrigel, then transferred to COM media, and incubated at 37°C. After 3 days of no noticeable expansion, the intact organoids were spun down and resuspended in COM + 2% Matrigel for further 1-2 week recovery. Cells were then seeded in COM-LC + 2% Matrigel for continuous culture as described below.
[0125] 3. Full dissociation and mammosphere cultureThawed partially digested pMGEOs were immediately dissociated into single cells by incubating in 1:1 mixture of Trypl_E:Accumax at 37°C for 1.5 hours, triturating every 10-15 minutes, or until aggregates were no longer visible. Cell suspension was seeded in COM-LC + 2% Matrigel as described below.
[0126] 4. Digestion, full dissociation and mammosphere culture
[0127] Thawed partially digested pMGEOs were immediately digested with Tissue Digestion Solution (according to method above) without embedding in Matrigel, dissociated into single cells by incubating in 1:1 mixture of Trypl_E:Accumax at 37°C for 1.5 hours, triturating every 10-15 minutes, or until aggregates were no longer visible. Cell suspension was seeded in COM-LC + 2% Matrigel as described below.
[0128] 3D Culture Method for Mammosphere Lines
[0129] Mammospheres were collected from culture by aspirating with a 2.5% BSA coated P1000 tip and pooled into a tube. Mammospheres were spun twice at 200 xg for 2 min. Discard the supernatant. The mammosphere pellet was resuspended in a 1:1 mixture of TrypLE:Accumaxand incubated at 37°C for 45 -60 min, triturating with a 2.5% BSA coated P1000 tip every 10-15 min or until no aggregates were visible. The single cell suspension was spun at 450 xg for 5 minutes and the supernatant was discarded. The cells are resuspended in complex organoid medium (COM) growth media (in-house Advanced DMEM / F12 + COM supplements, see Table 2) and counted.
[0130] Static Culture Propagation:
[0131] Cells are added at 50-250K cells / mL density into ice cold COM + 2% Matrigel and seeded into non-TC treated anti-adherence coated (0.1% Pluronic F-108) 12-well plates (2 mL / well), and incubated at 37°C, 5% CO2(2% matrigel culture method inspired by Wrenn et al. 2020. J Mammary Gland Biol Neoplasia 25, 337-350). The mammospheres are grown undisturbed for 1 week without feeding, though the growth phase length can be extended beyond 1 week to 10-12 days by gently adding 1.5 mL / well fresh COM (no media removal OR additional Matrigel required).
[0132] Semi Adherent Culture
[0133] Cells are added at 50-250K cells / mL density into ice cold COM + 2% Matrigel and seeded into non-TC treated without anti-adherence coating, and incubated at 37°C, 5% CO2(2% matrigel culture method inspired by Wrenn etal. 2020. J Mammary GlandBiol Neoplasia 25, 337-350). The mammospheres are grown undisturbed for 1 week without feeding, though the growth phase length can be extended beyond 1 week to 10-12 days by gently adding 1.5 mL / well fresh COM (no media removal OR additional Matrigel required).
[0134] Dynamic Culture Propagation:
[0135] For dynamic culture, the culture vessel with an internal stirring mechanism (i.e. a spinner flask, stir tank bioreactor) were pre-chilled and briefly coated with ice cold 25% (w / v) Pluronic F-127 and immediately washed with ice cold PBS. The ECM / hydrogel was pre-polymerized with the growth media, the cell suspension was added to the flask for a final density of 200,000 cells / mL. Culture was carried out for two weeks with spinning at 80 rpm, feeding every 3-4 days to maintain a lactate concentration <7 mM.
[0136] For Matrigel based ECM / hydrogel, pre-polymerization was achieved by incubating 10% (v / v) Matrigel in growth media for a minimum of 30 minutes at 37°C, 5% CO2 without stirring.
[0137] If it is necessary to reduce lactate concentration, dynamically grown mammospheres may be centrifuged twice at 200 xg for 2 min and the spent media removed.
[0138] Beyond passage 3, cells were propagated in lower cost variant of COM (COM-LC, inhouse Advanced DMEM / F12 + COM-LC supplements, see Table 3), and beyond passage 9, 40 ng / mL bovine FGF2 was added to the growth media
[0139] Table 2. In-house Advanced DMEM / F12 + Complex Organoid Medium (COM) Supplement Recipe (inspired by Sachs et al. 2018, Cell, Volume 172, Issues 1-2, Pages 373-386. e10,)
[0140]
[0141]
[0142] Table 3. In-house Advanced DMEM / F12 + Lower Cost Variant of Complex Organoid Medium (COM-LC) Supplement Recipe
[0143]
[0144]
[0145] Media Modifications’.
[0146] It was found that BovEGF may be omitted from COM-LC without negative impact on growth or lactation. RSPO1, DMH1, FGF7 and / or FGF10 may be removed from the 3D and 2D growth medium without negative impact on downstream growth or lactation.
[0147] In place of B27 in COM-LC, 50 nM Retinoic Acid and BSA to a final concentration of 2.9 mg / mL may be added. Similarly, HP-beta-cyclodextrin may be used in place of BSA.
[0148] BMEM base media, a media formulation based on basal medium Eagle’s designed for hiPSC culture (Lyra-Leite et al. (2023), Stem Cell Reports, Volume 18, Issue 6, 2023, Pages 1371-1387,) to be used as the base media instead of DMEM / F12.
[0149] 3D ECM Variations:
[0150] Functionalized alginate based hydrogels: Alginate is pre-formed, mechanically sheared into a slurry, and functionalized prior to cell seeding. Alginate may be functionalized with the active peptide sequence of ECM proteins (i.e. RGD for fibronectin, IKVAV for Laminin-111, GFOGER for Col) or whole larger recombinant ECM proteins (Col-I, Lam-111). To form functionalized alginate ECM:
[0151] Prepare alginate solution by dissolving alginate to 2.5% (w / v) in Process buffer (170 mM NaCI + 10 mM HEPES, pH 7.4) with gentle warming / stirring. Sequentially sterile filter 2.5% (w / v) alginate solution through a 0.45 urn filter followed by 0.2 urn filter. Dilute to 1.5% in DMEM / F12.Prepare 21 mM CaS04 slurry, by preparing a sterile slurry of 150 mM CaSO4, then diluting to 21 mM in DMEM / F12.
[0152] To form the hydrogel, combine 1.5% sodium alginate (Sigma, W201502) in with 21 mM CaSO4 slurry in a 2:1 ratio fora final concentration of 1% alginate + 7 mM CaSO4. Incubate for ~2h at 37°C.
[0153] To shear the hydrogel, dilute with an equal volume of DMEM / F12 and vortex for 1 min at max speed (~3000 rpm or higher). Keep on ice.
[0154] To further homogenize hydrogel into a slurry, homogenize with tissue homogenizer at highest setting for ~ 1 min
[0155] To functionalize via L-DOPA, centrifuge alginate slurry at 1000 xg for 2 min and remove 50% of the supernatant. Add 6 volumes of 2 mg / mL L-DOPA in 10 mM Tris (pH 10). Incubate overnight on a rotator at 4°C. Centrifuge at 3000 xg for 2 min and remove 75% of the supernatant (supernatant will be black). Wash 5x by resuspending the pellet in water and centrifuging as above (final wash should be clear). Resuspend final pellet in solution of ECM protein in DMEM / F12 (i.e. 50 ug / mL RGD) at 8x volume of 1% alginate originally prepared (i.e. 3.6 mL for 450 uL of 1% alginate hydrogel prepared), and incubate overnight on a rotator at 4°C. Centrifuge at 3000 xg for 5 min, remove 80% of supernatant, and resuspend in 3D Growth Media at 8x volume of 1% alginate originally prepared. Centrifuge at 3000 xg for 5 min, then remove supernatant to a final volume equivalent to the volume of 1% alginate initially prepared. Store at 4°C until use.
[0156] To use as 3D ECM, dilute functionalized alginate to 10 - 50 % (v / v) in 3D Growth Media For alginate concentrations higher than 25%, concentrated 3D Growth Media may be used to suspend the functionalized alginate hydrogel in order to achieve a final concentration of 1X 3D growth media. Incubation of the suspension prior to cell addition may be performed to allow the media to permeate the hydrogel.
[0157] Viral transduction of exogenous cowTERT
[0158] Lentivirus carrying the cowTERT gene downstream of an EFS promoter was purchased from VectorBuilder (LVM-VB220811-1240xvu). cowTERT lentivirus to anMOI = 30 for 100,000 and 5 mg / mL polybrene were added to COM-LC media to a total of 1 mL and incubated on ice for 6 hours. Mammospheres at passage 5 were dissociated as described above. 100,000 cells were seeded using the lentivirus / polybrene / COM-LC mix as the media. Cells were incubated overnight at 37°C, 5% CO2, and the following day the media was removed and replaced with fresh COM-LC media to continue mammosphere growth until the next passage.
[0159] While only one method of cowTERT expression was attempted, other methods of cowTERT expression are possible. Exogenous expression may also be achieved using non-integrating episomal vectors, targeted locus insertion in genome safe harbour sites and / or within regions of highly transcribed genes, or long-lived circular RNA (Shim, Hong Seok et al. Cell, Volume 187, Issue 15, 4030 - 4042. e13). Also, endogenous TERT activation may be achieved with small molecules such as TERT activating compound (TAC) (Shim, Hong Seok et al. Cell, Volume 187, Issue 15, 4030 - 4042. e13), or targeted epigenetic activation with a Cas9-fusion protein (Nunez, James K. et al. Cell, Volume 184, Issue 9, 2503 - 2519.e17).
[0160] Cas9-mediated knockout of CDKN2A
[0161] cowTERT transduced cells were dissociated after 7 days of growth as discussed above. Cas9 RNPs carrying gRNA targeting CDKN2A (GAATCGCGCTTCGACCGTAA) were prepared using Lipofectamine CRISPRMAX Cas9 Transfection Reagent as per the manufacturer's instructions. In brief, 1250 ng Cas9 + 12 pmol crRNA:tracrRNA gRNA duplex + 2.5 uL Cas9 Plus reagent topped up to 50 uL with OptiMEM was added to 3 uL CRISPRMAX reagent in 50 uL of OptiMEM, and incubated at room temperature for 15 min. 120,000 of the dissociated cells were resuspended in 1 mL COM-LC + 2% Matrigel. 100 uL of the RNP transfection mix was added to the cell suspension, then plated into an anti-adherence coated non-TC treated 12-well plate. Cells were incubated at 37°C, 5% CO2 for 2 days. 1 mL COM-LC media was added to the culture and incubation continued at 37°C, 5% CO2 until next passage.
[0162] Lactation Induction of Mammospheres in 3D Culture
[0163] After one week of growth in 3D culture as described in the section entitled 3D Culture Method for Mammosphere Lines, growth media was carefully removed from the well without disturbing the mammospheres, and replaced with an equal volume of Lactationmedia also called 3D Lactation media) (phenol-free DMEM / F12 + CLMV1 supplement (see Table 4) + 2.5 ug / mL E2 + 1 ug / mL endogenous bovPRL. Lactation media was refreshed every 2-3 days until harvest. To harvest milk, mammospheres were harvested and lysed hypotonically by a series of freeze-thaws in water.
[0164] Optional variations of lactation induction of mammospheres in 3D culture include:
[0165] • HITSX: DMEM / F12 supplemented with 1 ug / mL hydrocortisone + 5 ug / mL insulin + 5.5 ug / mL transferrin + 6.7 ug / mL sodium selenite + 32.7 uM ethanolamine + 1 ug / mL endogenous bovine prolactin
[0166] • Complex Lactation Media, Version 1 (CLMV1) (Table 4): phenol-free DMEM / F12 + CLMV1 supplement (see Table 4) + 2.5 ug / mL E2 + 1 ug / mL endogenous bovPrl
[0167] • Supplementation of the lactation media with some or all of the components of CLMV1 supplement and / or
[0168] • Use of a lactation media having a lower concentration of prolactin, a recombinant source of prolactin, or an alternative hormonal equivalent (i.e. bovine pituitary extract or human growth hormone).
[0169] Table 4. Composition of CLMV1 media supplement
[0170]
[0171]
[0172] 2D Insert Culture of Mammosphere-derived cells
[0173] Mammospheres were dissociated into single cells as per section entitled Establishing Mammosphere Line, yielding mammosphere-derived cells. For 2D insert culture, mammosphere-derived cells were seeded onto membrane inserts which divide the culture vessel into an apical and basal compartment. The membrane is coated on the apical side with a 2D ECM (see variations below) to facilitate cell adhesion, monolayer growth, and downstream lactation. Both the apical and basal compartments are filled with 2D Growth Media:
[0174] o For 0.3 cm2membranes (i.e. 24 wpl format), apical volume is 400 uL, basal volume is 1 mL
[0175] o For 4.5 cm2membranes (i.e. 6 wpl format), apical volume is 2 mL, basal volume is 3 mL
[0176] Cells are grown to hyperconfluence and maintained in 2D Growth Media at hyperconfluence for several days in a 37°C, 5% CO2 incubator, typically 2 weeks. Growth phase length may vary so long as the cells achieve hyperconfluence and are kept in growth media at hyperconfluence for a substantial period of time
[0177] Once the cell monolayer has achieved hyper confluence, cells are optionally primed by adding Priming Supplements (see below) to 2D Growth Media for the last 4 -10 days of growth
[0178] Membranes were made of PET, with a 0.4 urn pore size and 2e6 pores / cm2density. Alternatively, membranes may be made of PES, PVDF, PC or TEFLON, with pore size of 0.1 - 10 urn and pore density of 1e6 to 100e6 pores / cm2or between 1% to 99% Alternatively, membranes may be pre-treated with gamma radiation to alter membranes physical properties resulting in improved rate of cell adhesion to membranes. Alternatively, membranes may be dimpled to mimic the alveolar shape and increase the culture surface area. Insert membranes are coated overnight with anECM that may consist of any combination of 40 ug / cm2Col-IV and / or 40 ug / cm2Col-I and / or 10 ug / cm2Lam-111 and / or 10 ug / cm2Lam-521, or 1:100 dilution of Matrigel (~65 ug / cm2ECM protein). Laminin coatings may be diluted in polymerization buffer (20 mM sodium acetate, 1 mM CaCI2, pH 4.0 buffer), 3X PBS washed following overnight coating, and may be followed by a subsequent coating of 40 ug / cm2 Col-IV.
[0179] Alternatively, following Laminin dilution in polymerization buffer the solution may be incubated at 37°C for 30 min, spun down at 2000 xg for 10 min, discarding supernatant and resuspending polymerized Laminin pellet in phenol- DMEM / F12, distilled H2O, or PBS for use as coating solution.
[0180] Alternatively, ECM mimetic peptide coatings (Laminin = RKRLQVQLSIRT, IKVAV, RQVFQVAYIIIKA, YIGSR, KAFDITYVRLKF - Collagen-I = GFPGER, GFOGER, GPAGKDGEAGAQG - Collagen-IV = GEFYFDLRLKGDK, TAGSCLRKFSTM, TAIPSCPEGTVPLYS) may be used instead of full length ECM proteins. Recombinant partial proteins may be used instead of full length proteins including the triple helical domain of various collagens including the triple helical domain of Col-I.
[0181] Alternatively, overexpressing a constitutively active form of mutant of Rac1 (G12V) could be used in place of Lam-111 coating to activate integrin signalling as described by Akhtar J Cell Biol. 2006 Jun 5;173(5):781-93. doi: 10.1083 / jcb.200601059. PMID: 16754961; PMCID: PMC2063893..
[0182] 2D ECM may deposited by applying a solution of the proteins to the apical compartment and either:
[0183] ■ incubating 6-24 h at 37°C in a humidified 5% CO2 incubator to allow the proteins to settle by gravity. Remaining solution is removed at the end of the incubation period
[0184] ■ incubating overnight at room temperature in a ventilated environment (i.e. a biosafety cabinet) until the solvent has evaporated.
[0185] The cells were seeded in 2D Growth Media and 2D Growth Media was added to the basal compartment of the culture vessel. ROCKi (Y-27632) is removed from the growth media in both the apical and basal compartments on day 3 post seeding. Cells weregrown to hyperconfluence for several days before proceeding to 2D lactation induction in a 37°C, 5% CO2 incubator.
[0186] 2D Growth Media which may comprise:
[0187] • A basal media of DMEM / F12 (Advanced DMEM / F12 + COM-LC supplements);
[0188] • 10 - 50 ng / mL TGFa may be included for some or all of the growth phase • Growth media may be supplemented with some or all of the components of COM-LC supplement;
[0189] ■ ROCKi (Y-27632) in COM-LC is not required for 2D growth. If the seeding media used includes ROCKi, this may be removed from the media 3 days post seeding to facilitate monolayer formation
[0190] ■ bovEGF may be omitted from this recipe without negative impact on growth or lactation
[0191] ■ B27 may be replaced with 50 nM Retinoic Acid and 2.9 mg / mL BSA ;
[0192] • Simple Growth Media specifically is detailed in Table 5;
[0193] • Simple Growth Media supplemented with select COM-LC components, 10-50 ng / mL TGFa, 10 ng / mL TNFa, 50 ng / mL IL-4, 50 ng / mL IL-13, 50 ng / mL EREG, 50 ng / mL AREG. 0.5 ug / mL hydrocortisone may be added to 2D growth media. Low levels of prolactin (<50 ng / mL) or an equivalent lactogenic treatment may be added to 2D growth media (apical and / or basal side). If prolactin is added to 2D growth media, ROCKi (as described above) is also added. 10 - 50 ng / mL TGFa may be included for some or all of the growth phase.
[0194] Table 5. Composition of Simple Growth Media
[0195]
[0196]
[0197] Priming Supplement Variations:
[0198] Priming of the culture prior to lactation induction may be performed. After mammosphere-derived cells have achieved 100% confluence for several days, the cell monolayer is treated on both the apical and basal side (unless otherwise stated) with 2D Growth Media supplemented with any combination of the following:
[0199] • Low concentrations of prolactin (<50 ng / mL) or equivalent lactogenic treatment added to the basal side only)
[0200] • W uM ROCKi
[0201] • 100 ug / mL Vitamin C
[0202] • Replacing Retinoic Acid (RA) in the 2D Growth media with a Retinoic Acid Receptor inhibitor (RARi)
[0203] Lactation Induction of Mammosphere-derived cells in 2D Culture
[0204] After mammosphere-derived cells have achieved 100% confluence for several days, cells are induced to lactate at 37°C, 5% CO2. Briefly, media is completely removed from the apical compartment and replaced with a harvest buffer. Media in the basal compartment is replaced with a low glucose variant of DMEM / F12 supplemented with ideal profile amino acids (IPAA, as described in Dong et al. Journal of Dairy Science Volume 101, Issue 2, February 2018, Pages 1708-1718) and CLMV4 and 1 ug / mL endogenous bovine prolactin. Culture is continued with lactation media in the basal compartment for 6 days before harvest for assessment, changing media every 3 days. To harvest the secreted milk-like product, the harvest buffer is collected and replaced with fresh harvest buffer for continued lactation.
[0205] Optional variations of lactation induction of mammospheres in 2D culture include:
[0206] • Mammosphere-derived cells may be passaged once in 2D insert culture format before lactation induction.
[0207] • Incubation temperature may be increased to 39°C at the initiation of lactation induction.
[0208] • Lactation media may use a combination of DMEM / F12:RPMI:NCTC at a ratio of 5:3:2, DMEM / F12:NCTC at a ratio of 8:2, or solely RPMI as the base media.• Lactation media may be supplemented with some or all of the components of 2D CLMV4 supplementation. For example, sodium acetate concentrations may be decreased as low as 1.2 mM.
[0209] • Lactation media may use palmitic acid in place of oleic acid.
[0210] • Lactation media may use a lower concentration of prolactin, a recombinant source of prolactin, or an alternative hormonal equivalent (i.e. bovine pituitary extract, human growth hormone).
[0211] • Inducible constitutively active PRLR expression at onset of lactation induction to eliminate requirement of animal derived endogenous bovine PRL (for example, 1-178 N-terminal deletion see Lee et al. 1999 Journal of Biological Chemistry, Volume 274, Issue 15, 10024 - 10034)
[0212] • Inducible dominant negative ROCK including N-terminal deletion of amino acids 1-77 (Leung T, Chen XQ, Manser E, Lim L. The p160 RhoA-binding kinase ROK alpha is a member of a kinase family and is involved in the reorganization of the cytoskeleton. Mol Cell Biol. 1996 Oct; 16(10):5313-27. doi: 10.1128 / MCB.16.10.5313. PMID: 8816443; PMCID: PMC231530) t or RBPH(TT) = aa 941-1388 C-terminal fragment only of ROCK2 with N1036T & K1037T point mutations to abolish Rho-binding) expression at onset of lactation induction to replace the use of Y-27632-mediated ROCK inhibition.
[0213] • Inducible dominant negative TGFBR-II (deleted cytoplasmic domain) expression at onset of lactation induction to replace the use of RepSox (or other TGFB inhibitor) mediated TGFB inhibition.
[0214] • Lactation media may use an alternative TGFb inhibitor such as SB431542, LY2109761 , A83-01 , or a combination thereof.
[0215] • The apical compartment may contain lactation media that is of the same composition as the basal media.
[0216] • A low electrolyte variation of the basal media, which is comprised of 0.833X Low Electrolyte Media (Diluted from 2X Low Electrolyte Media, see Table 6) + CLMV1 (Table 4) + 174.6 mM D-Mannitol + 10 ug / mL L-Ascorbic acid 2- phosphate Trisodium Salt, topped up with UltraPure ddH2O and adjusted to pH = 7.0.
[0217] • The apical compartment may contain a nutrient free buffered solution comprising of the ionic composition of the low electrolyte media described above or the ionic composition of milk (i.e. simulated milk ultra-filtrate (SMUF), see Table 7) at pH 6.8 (based on Dumpier, J., et al., International Dairy Journal,Volume 68, 2017, Pages 60-69, https: / / doi.org / 10.1016 / jJdairyj.2016.12.009), osmotically balanced with D-Mannitol, Urea, or another organic compound deemed inert.
[0218] • The apical compartment may be kept free of liquid in an air-liquid interface (ALI) format. If ALI lactation induction is performed, milk is harvested by washing with PBS and collected. Alternatively, apical washes may be performed with SMUF. Alternatively, the harvest buffer is collected and replaced with fresh harvest buffer for continued lactation.
[0219] Table 6.2X Low Elec Basal Media Recipe (slightly modified from Schmidt CR, Carlin RW, Sargeant JM, Schultz BD. Neurotransmitter-stimulated ion transport across cultured bovine mammary epithelial cell monolayers. J Dairy Sci. 2001 Dec;84(12):2622-31. doi: 10.3168 / jds.S0022-0302(01)74716-9. PMID: 11814018. / Rebecca R. Quesnell, Jamie Erickson, and Bruce D. Schultz American Journal of Physiology-Cell Physiology 2007292:1 , C305-C318)
[0220]
[0221]
[0222] *Use ultrapure ddH2O to top up to final target volume and filter steri ize
[0223] Table 7. Composition of Simulated Milk Ultra-Filtrate (SMUF)
[0224]
[0225] Dynamic 2D Insert Culture
[0226] Mammosphere-derived cells seeded in 2D insert culture as per Section entitled 2D Insert Culture of Mammosphere-derived cells were allowed to adhere overnight. The plate was then placed on a Belly Button Orbital Shaker (IBI Scientific, Cat. #BBUAAUV1S) set to 100 rpm in a 37°C, 5% CO2 incubator for the remaining 13 days of growth and 6 days of lactation induction, as per Sections 1.7 and 1.8 respectively (induction of shear stress via orbital shaker inspired by Ferrell N, Cheng J, Miao S, Roy S, Fissell WH. Orbital Shear Stress Regulates Differentiation and Barrier Function of Primary Renal Tubular Epithelial Cells. ASAIO J. 2018 Nov / Dec;64(6):766-772. doi: 10.1097 / MAT.0000000000000723. PMID: 29240625; PMCID: PMC5995603.).
[0227] Alternatively, the length of the growth phase may be changed, so long as the cells achieve hyperconfluence and are kept in growth media at hyperconfluence for a substantial period of time. Alternatively, the length of lactation induction may be lengthened with continuous harvest of the secreted protein. Alternatively, higher or lower rpm may be used, or a cyclical modulation of rpm to optimize secretion. Alternatively, a lateral flow system that exerts an equivalent amount of shear stress to the basal and apical sides of the membrane may be used.
[0228] RESULTS
[0229] Long-lived mammosphere lines isolated from lactating mammary tissue retain luminal markers and proliferative capacity up to passage 50
[0230] Mammosphere lines were generated from continuous culture of primary mammary gland epithelial organoids (pMGEOs) isolated from lactating bovine mammary tissue from Jersey and Holstein breeds, and may be applied to other breeds of cattle. The majority of data contained herein was generated with cells derived from the Jersey breed.
[0231] The isolated mammosphere lines were enriched for the EpCAM-neg population observed in pMGEOs after multiple passages (FIG. 1A).
[0232] Mammosphere lines were cultured as 3D organoids suspended in 2% Matrigel in COM-LC + FGF2, which is FBS free. The polymerization of the Matrigel upon incubation at 37°C entraps the cells as mammospheres within a network of ECM hydrogel. The culture is suspended when seeded into non-TC treated anti-adherence coated wells, or settled and semi-adherent to the culture surface when the antiadherence coating is omitted. Semi-adherent cultured mammospheres can be dislodged with either scraping or vigorous pipetting. Using this culture method,mammospheres can be propagated continuously with a doubling time of 3 - 6 days, developing a hollow morphology as they expand in size (FIG. 1B). FGF2 is a key component of COM-LC, and is required for cells to retain their proliferative capacity. Adding 40 ng / mL FGF2 to COM-LC rescued the increasing doubling time of 02 / 23-05 mammosphere line at passage 9, and was included in mammosphere growth media (data not shown). Due to the delicate nature of the floating 2% matrigel construct, static culture is limited to non-TC treated 12 well plate format or smaller (e.g 96 well or 384 well plate format).
[0233] 2% Matrigel provides a low elastic modulus hydrogel scaffold required to keep mammospheres in suspension and a network of basement membrane ECM proteins and growth factors that support mammosphere propagation and maintenance of luminal alveolar progenitor phenotype.
[0234] The source of Matrigel is important to mammosphere proliferation. 2% Corning sourced Matrigel could not be replaced with 2% Engelbreth-Holm-Swarm derived ECM from Sigma, which yielded smaller mammospheres that did not develop a hollow morphology and did not respond to lactation induction (Opalia Exp 05 / 23-15, data not shown). Using 10% Sigma sourced ECM rescued this phenotype, suggesting a critical minimal concentration of ECM required for mammosphere culture.
[0235] Many options are available to replace Matrigel with a chemically defined ECM that facilitates a scalable process and are yet to be tested with the mammosphere lines. These include, but are not limited to:
[0236] o Synthetic I natural hydrogel based microcarriers which may be functionalized with Laminin, Collagen-I, and Collagen-IV ECM mimicking peptides previously described above OR functionalized with plant-derived proteins with ECM mimicking properties (e.g pumpkin seed protein extract)
[0237] o Thermoresponsive poly(N-isopropylacrylamide)-co-poly(ethylene glycol) (PNIPAAm-PEG) hydrogel (Lei Y, Schaffer DV. A fully defined and scalable 3D culture system for human pluripotent stem cell expansion and differentiation. Proc Natl Acad Sci U S A. 2013 Dec 24; 110(52):E5039-48. doi: 10.1073 / pnas.1309408110. Epub 2013 Nov 18. PMID: 24248365; PMCID: PMC3876251.), which may be functionalized with Laminin, Collagen-I, and Collagen-IV ECM mimicking peptides previously described aboveo Fully defined QGel CN99 PEG based hydrogel (Fredrik Bergenheim, Giulia Fregni, Cara Field Buchanan, Lene Buhl Riis, Mathieu Heulot, Jeremy Touati, Jakob Benedict Seidelin, Simone Carlo Rizzi, Ole Haagen Nielsen, A fully defined 3D matrix for ex vivo expansion of human colonic organoids from biopsy tissue, Biomaterials, Volume 262, 2020, 120248, ISSN 0142-9612, https: / / doi.Org / 10.1016 / j. biomaterials.2020.120248.)
[0238] 0 Nanocellulose based hydrogel which may be functionalized with Laminin, Collagen-I, and Collagen-IV ECM mimicking peptides previously described above (R. Curvello, G. Kerr, D. J. Micati, W. H. Chan, V. S. Raghuwanshi, J. Rosenbluh, H. E. Abud, G. Garnier, Engineered Plant-Based Nanocellulose Hydrogel for Small Intestinal Organoid Growth. Adv. Sci. 2021, 8, 2002135. https: / / doi.Org / 10.1002 / advs.202002135).
[0239] It is suspected that the CD49f+ subpopulation is responsible for the continued propagation of the mammospheres. Using magnet-assisted cell separation (MACS) with antibodies against CD49f, dissociated mammospheres were separated into CD49f- and CD49f+ subpopulations. The CD49f+ subpopulation generated exclusively large hollow mammospheres, while the CD49f- subpopulation had fewer mammospheres and cell aggregates (FIG. 1C). Furthermore, only the CD49f+ subpopulation was capable of producing cells with CD49fmed expression (FIG. 1D)
[0240] Mammosphere lines isolated from lactating mammary tissue retain high expression of luminal markers ELF5, PRLR, CSN3, and GATA3 (FIG. 2A). Retention of luminal marker expression is likely due to mammosphere suspension culture. Multiple adherent cell lines were generated by continuous culture of dissociated pMGEOs in 2D adherent format and assessed for luminal markers by qPCR. dCq values for ELF5 and CSN3 were much higher in these 2D cultured lines compared to suspension cultured mammospheres (FIG. 2B), indicating lower levels of expression. Furthermore, while transcript levels are stable in mammosphere lines cultured in suspension up to passage 32, adherent cell line dCq values for these genes were steadily increasing before passage 10.
[0241] Immortalization was attempted in mammosphere line 02 / 23-05 by re-expressing bovine telomerase (cowTERT) though lentiviral transduction and knocking out the gene CDKN2A with Cas9 using gDNA targeting the first exon of CDKN2A, yielding the03 / 23-12 line, which was cultured up to passage 50 in suspension, with little variation in doubling time (FIG. 2C). In contrast, the parental line increased in doubling time as early as passage 10, and began exhibiting lactation failure as early as passage 15. cowTERT expression may be responsible for the long-lived nature of the 03 / 23-12 line, as cowTERT expression was detected, but CDKN2A KO by genomic cleavage detection assay was not (FIG. 2D-E).
[0242] While only one method of cowTERT expression was attempted, other methods of cowTERT expression are possible. Exogenous expression may also be achieved using non-integrating episomal vectors, targeted locus insertion in genome safe harbour sites and / or within regions of highly transcribed genes, or long-lived circular RNA (Chen, R., Wang, S.K., Belk, J.A. et al. Engineering circular RNA for enhanced protein production. Nat Biotechnol 41, 262-272 (2023). https: / / doi.Org / 10.1038 / S41587-022-01393-0). Endogenous TERT activation may be achieved with small molecules such as TERT activating compound (TAC) (Shim, Hong Seok et al. Cell, Volume 187, Issue 15, 4030 - 4042. e13), or targeted epigenetic activation with a Cas9-fusion protein (Nunez, James K. et al., Cell, Volume 184, Issue 9, 2503 - 2519. e17).
[0243] While only one method of CDKN2A KO was attempted with CRISPR-Cas9 technology, other methods of repressing CDKN2A (p16INK4a) expression are possible. TERT activating molecule (i.e. TAC) as described above has also been shown to silence CDKN2A via promoter methylation ((Shim, Hong Seok et al. Cell, Volume 187, Issue 15, 4030 - 4042. e13)); Cas9-fusion proteins to epigenetically turn off CDKN2A expression (Nunez, James K. et al., Cell, Volume 184, Issue 9, 2503 - 2519.e17); Inframe knock in of a protein degrading signalling peptide to p16 (dTAG system in Bekes, M., Langley, D.R. & Crews, C.M. PROTAC targeted protein degraders: the past is prologue. Nat Rev Drug Discov 21, 181-200 (2022). https: / / doi.Org / 10.1038 / S41573-021-00371-6) and Targeted CDKN2A RNA degradation by Cas13 or RNATAC (Song, Yan et al. Cell Chemical Biology, Volume 31 , Issue 6, 1101 - 1117).
[0244] Cultured mammospheres are responsive to lactation induction with high levels of milk gene transcript, rapid lipid droplet formation, and accumulation of milk proteinMammospheres are induced to lactate by switching them to a media containing hydrocortisone, insulin, selenite, transferrin, ethanolamine (HITSX), and up to 1 ug / mL prolactin and continuing incubation for up to 20 days in lactation media, changing the media every 3 days.
[0245] Mammosphere lines are responsive to lactation induction, as characterized by high levels of milk protein transcript, accumulation of lipid droplets, and accumulation of intracellular b-casein and b-Lg (FIG. 3A-C).
[0246] Lactation media can be additionally supplemented with CLMV1 supplement, a combination of compounds that were individually reported to enhance lactation, which further enhances the lactation response described above (FIG. 3B).
[0247] Lactation media can be additionally supplemented with 2.5 ug / mL estradiol (E2), which increases protein production of bLg (FIG. 3D).
[0248] Lactation induction in mammospheres for 15 days with CLMV1 + 2.5 ug / mL E2 + 1 ug / mL Prl was measured to have the following production rates, based on intracellular accumulation of the following milk components: 40.6 ug triglycerides / million cells, 54 ug bCSN / million cells and 0.24 ug bLg / million cells.
[0249] Intracellularly accumulated milk lipids and proteins were tasted and described to have a similar mouthfeel and flavour to traditional cow’s milk.
[0250] Upon lactation induction, the CD49f+ subpopulation is lost (FIG. 3E), in agreement with findings from Finot L, Chanat E, Dessauge F. Mammary Epithelial Cell Lineage Changes During Cow's Life. J Mammary Gland Biol Neoplasia. 2019 Jun;24(2):185-197. doi: 10.1007 / sl 0911-019-09427-1. Epub 2019 Feb 13. PMID: 30758700., where the CD49fiOw / med CD24- populations correlated strongly with b-CSN and k-CSN expression.
[0251] Lactation induction of mammosphere-derived cells in 2D insert culture requires ROCK and TGFb inhibition, and is improved with a nutrient-free apical compartmentLactation induction in 2D is performed in insert culture, where the culture vessel is divided into apical and basal compartments by a porous membrane mounted on an insert onto which mammosphere-derived cells are grown in a monolayer (FIG. 4A).
[0252] Mammosphere-derived cells (i.e. fully dissociated mammospheres) are seeded onto an ECM-coated membrane, grown to hyperconfluence for several days, then induced to lactate by changing the apical and basal media to lactation media. A minimum amount of ECM (10 ug / cmA2 Col-IV) is required for mammosphere-derived cells to achieve a hyperconfluent monolayer. Media used in the 2D growth phase is referred to a 2D Growth Media, and may consist of some or all of the components of COM-LC, or a simplified variant. If the seeding media used includes ROCKi, this may be removed from the media 3 days post seeding to facilitate monolayer formation. Lactation induction in 2D requires the addition of ROCK inhibition (ROCK inhibition is achieved with 10 uM Y-27632) (FIG. 4B-C, inspired by Du JY, Chen MC, Hsu TC, Wang JH, Brackenbury L, Lin TH, Wu YY, Yang Z, Streuli CH, Lee YJ. The RhoA-Rok-myosin II pathway is involved in extracellular matrix-mediated regulation of prolactin signaling in mammary epithelial cells. J Cell Physiol. 2012 Apr;227(4):1553-60. doi: 10.1002 / jcp.22886. PMID: 21678418; PMCID: PMC3675639.) and TGFb inhibition (TGFb inhibition is achieved with 10 uM RepSox )(FIG. 4C) in order to yield similar results to 3D lactation induction.
[0253] Like 3D cultures, 2D insert culture lactation induction response is characterized by high levels of milk protein transcript, accumulation of lipid droplets, and accumulation of intracellular b-casein, b-Lg, a-LA.
[0254] Mammosphere-derived cells in 2D respond more rapidly to lactation induction when the apical compartment is nutrient-free. This achieved with either air-liquid interface (ALI) format, which is performed by removing all liquid from the apical compartment and only applying lactation media to the basal compartment, or by filling the apical compartment with simulated milk ultrafiltrate (SMUF), a buffered solution that mimics the ionic composition of cow’s milk without the proteins or lipid. Induction of milk transcript is higher in these nutrient-free apical conditions compared to nutrientcontaining apical conditions such as low-electrolyte media (FIG. 4D and E).ALI Lactation induction in inserts results in secretion of milk proteins and lipids into the apical compartment, while lactation with consistent apical fluid results in mature b-casein production and secretion
[0255] Secretion is achieved in insert culture in both ALI and apical-fluid formats. In ALI conditions, secreted protein is harvested by washing the apical compartment with either distilled water, PBS, or SMUF. When there is apical fluid throughout lactation, the apical fluid is harvested.
[0256] Secreted proteins include all the major proteins found in cow’s milk, including the aS1-aS2- b- and k- casein isoforms, as well as whey proteins a-lactalbumin, b-lactoglobulin, and lactoferrin, as detected by mass spectrometry (FIG. 5A).
[0257] Lipid droplets are secreted and visualized with Nile Red staining of the apical harvest, as observed under the microscope (FIG. 5B). Increased lipid droplet secretion was observed with apical SMUF.
[0258] Mature casein, characterized by phosphorylation and identified by mass spectrometry or on a Western blot by a higher molecular weight, is only observed in conditions with apical fluid (either low electrolyte media or SMUF) throughout induction (FIG. 5C). b-Casein phosphorylation is mediated by the kinase FAM20C, localized to the Golgi body in the cell, and has been reported to be upregulated during lactation (Cui J, Xiao J, Tagliabracci VS, Wen J, Rahdar M, Dixon JE. A secretory kinase complex regulates extracellular protein phosphorylation. Elife. 2015 Mar 19;4:e06120. doi: 10.7554 / eLife.06120. PMID: 25789606; PMCID: PMC4421793.). It is hypothesized that the apical fluids tested (low electrolyte and SMUF) facilitate the upregulation or activation (i.e. by providing a key cofactor of FAM20C such as Mg2+ Vincent S. Tagliabracci et al., Secreted Kinase Phosphorylates Extracellular Proteins That Regulate Biomineralization. Science 336, 1150-1153(2012). DOI:10.1126 / science.1217817). Supplementing the apical and / or basal compartment with more potent cofactors such as Mn2+ or Co2+ may improve this effect. This is to be tested in ALI vs SMUF lactation induction, and by using variations of SMUF that do not include Mg2+.
[0259] The effect of apical liquid on mature casein is reliant on the form factor. Cells induced with apical SMUF in a 6-wpl insert produce a lower proportion of mature b-caseincompared to cells induced in a 24-wpl format (FIG. 5D). This may be due to the relative volumes of apical SMUF and basal lactation media to the amount of cells cultured, which is higher in 24-wpl format. Research is ongoing to determine how to scale up the effect observed in 24-wpl format.
[0260] The more frequent the harvest of cells induced with apical SMUF results in higher proportion of secreted mature bCSN (FIG. 5D). This may suggest dephosphorylation post secretion with extended incubation at 37°C, and maintaining the phosphorylation state of bCSN is actively being researched. Secretion was observed on multiple 2D ECM compositions (FIG. 5E). Secretion was observed from cells seeded on 40 ug / cm2 porcine Col-I, 40 ug / cm2 bovine Col-Ill, and 40 ug / cm2 bovine Col-V. The optimal concentration range of recombinant Col-I has been tested to be 2.5 - 133 ug / cm2, with secretion inhibition observed with 333 ug / cm2 recombinant Col-I. Adding a coating of Lam-111 to the 40 ug / cm2 porcine Col-I base coating resulted in exclusively mature bCSN secretion.
[0261] Using apical SMUF instead of ALI for lactation induction results in higher levels of secreted bLg.
[0262] Mammosphere lines respond differently to lactation induction at low vs high passage
[0263] For the purposes of this section, experiments performed in low passage (i.e. <10) refer to the 02 / 23-05 mammosphere line and experiments in high passage refer to the 03 / 23-12 mammosphere line. 02 / 23-05 is the parental line used to generate 03 / 23-12 after attempted CDKN2A knock-out and cowTERT expression. These treatments were required to retain a steady doubling time. It is currently unknown if this reduced response to lactation induction is inevitable after prolonged culture, or if the conditions of mammosphere culture as described above apply for a selective pressure that promotes the changes observed below.
[0264] High passage (> passage 45) cells have a reduced lactation response compared to low passage (< passage 10) cells when 2D growth and lactation are performed in COM-LC and CLMV1 media respectively, characterized by a lower rate of lipogenesis,lower transcript levels of BHLHA15 (Misti), LALBA, and PAEP (bl_g), and lower levels of milk protein production.
[0265] Reduction in lipid accumulation in high passage cells is partially rescued by the addition of TGFa to the 2D growth media and stripping the 2D growth media to a simpler composition. Interestingly, applying these modifications to 2D growth media for low passage cells has a negative effect on downstream lactation.
[0266] Reduction in transcript induction at high passage of LALBA and PAEP was rescued with the addition of small molecules to both the 2D growth and lactation medias. These molecules had a synergistic effect when co-treated. The effect of the combination of these small molecule treatments and TGFa inclusion suggests a change in the mammosphere line epigenetically and growth promoting signalling pathways:
[0267] o GNE-7883: inhibitor of TEAD, inhibits YAP / TAZ activation via Hippo Pathway o EHMT2-IN-1: inhibitor of EHMT, a histone methyltransferase, responsible for repressive mark H3K9 methylation
[0268] o Revumenib: inhibitor of Menin-MLL, a protein complex that is a transcription factor and epigenetic regulator
[0269] o Tazemetostat: inhibitor of EZH2, a histone methyltransferase, responsible for repressive mark H3K27Me3.
[0270] Secretion of milk protein is only observed when performed in low passage cells grown in COM-LC or high passage cells grown in simplified growth media. This may be due to the induction of BHLHA15 (Misti) transcript levels observed exclusively in low passage cells, as Misti is believed to be a transcriptional regulator of secretory activation.
[0271] Optimizing 2D Lactation Media (CLMV4) and addition of a priming treatment improves the quantity and maturity of milk components secreted
[0272] To improve secretion rates in 2D insert culture, the composition of CLMV1 was optimized and a priming phase prior to lactation induction was added.
[0273] The following changes to lactation media from the base CLMV1 supplement recipe previously described, yielding CLMV4 (Table 7):o reducing the concentration of sodium acetate 10-fold to 1.2 mM and replacing oleic acid with palmitic acid increased longevity of lactation without compromising lipid secretion (FIG. 6A-B)
[0274] o Adding DHAto lactation media Increased bCSN secretion (FIG. 7C) o Replacing the base media formulation from 5:3:2 DMEM / F12:RPMI:NCTC to a modified DMEM / F12 with 4.4 mM glucose and adding ideal profile amino acids (IPAA, as described in X. Dong, et al., Journal of Dairy Science, Volume 101, Issue 2, 2018, Pages 1708- 1718, https: / / doi.Org / 10.3168 / jds.2017-13351.) increased bl_g secretion (FIG. 6C)
[0275] o Increased bl_g secretion was observed when adding Vitamin C to Lactation media (FIG. 6D)
[0276] Priming may take place as early as growth day 9, as long as the cell monolayer has reached confluence. 2D insert cultures are primed for lactation by feeding the hyperconfluent monolayer with COM-LC supplemented with select components of lactation media. This includes but is not limited to:
[0277] o 50 ng / mL Prl and 10 uM ROCKi; with ROCKi required for the effect of prolactin. Prolactin is only added to the basal compartment. A lactogenic equivalent to prolactin may be used in place of Prl o 100 - 250 ug / mL Vitamin C
[0278] o a TGFb inhibitor (i.e. RepSox)
[0279] Specifically, priming with 50 ng / mL Prl, 10 mM ROCKi and 100 ug / mL Vitamin C and adding Vitamin C to lactation increased bCSN and bLg secretion as observed on Western blotFIG. 6D. Low doses of lactogenic treatment (50 ng / mL Prl or equivalent) may also be included in the 2D growth media throughout the 2D growth phase to increase bCSN secretion (FIG. 6E).
[0280] The qPCR results show that by including a 2D priming phase, the induction of milk genes surpasses that of 3D mammospheres (FIG. 6F).
[0281] Cell specific productivity of each major milk protein was approximated by performing Western blots of apical secretions and dilutions of commercial homogenized milk. Assuming 5 trillion lactocytes in the mammary gland of a Jersey cow with a daily yieldof 20 L, and 80% fully differentiated lactocytes in vitro, the following relative production rates were determined:
[0282] o Similar b-casein production to that of a cow
[0283] o aS1 -casein production to 57% of that of a cow
[0284] o aS2-casein, k-casein, and b-lactoglobulin production to 5% of that of a cow
[0285] o a-lactalbumin production to 0.5% of that of a cow Triacylglycerides were also measured by colorimetric assay and found to be within 10% production of that of a cow.
[0286] Under hemacytometer, the lipid droplets secreted in vitro were found to be of the same size as lipid droplets in raw milk (FIG. 6G).
[0287] Cell line generation protocol validation with tissue from another cattle breed: Establishment and lactation induction of a Holstein-derived cell line
[0288] The protocols described above were performed on a separate tissue biopsy of the mammary gland of a lactating Holstein cow, producing a mammosphere line of similar morphology as the Jersey line (FIG. 7A). Using the 2D Insert Culture and Lactation protocols described herein, lactation induction was successful with the Holstein-derived line, with secretion of milk fat, caseins, and whey protein (FIG. 7B and 7C). The increased concentration of milk protein and the lower concentration in milk fat is in agreement with known yields of Jersey vs Holstein breeds as described in Olthof LA, Domecq JJ, Bradford BJ. JDS Commun. 2023 Jul 21 ;4(5):344-348. doi: 10.3168 / jdsc.2023-0371. PMID: 37727232; PMCID: PMC 10505770.
[0289] An immortalized line from Holstein cows and other breeds and mammalian species using protocols described herein will be generated.
[0290] Scalability considerations: larger culture formats
[0291] To scale mammosphere culture, a dynamic culture method was is in development using baffled spinner flasks and pre-polymerized Matrigel. A similar 7-fold cell expansion rate and morphology was observed when growing mammospheres statically and dynamically in pre-polymerized 10% Matrigel for two weeks. Themaximum cell seeding density:3D ECM ratio is yet to be optimized, as increasing cell density exponentially decreases the fold-expansion rate. Maintaining a certain cell density:ECM ratio may improve cell capture efficiency, rescue expansion rate, and allow for higher density culture. For this approach to be cost effective, an alternative to Matrigel for 3D ECM is required. Similar levels of protein secretion was observed when inducing cells to lactate on 4.5 cm2and 100 cm2(FIG. 8A) with the following process:
[0292] o 18 Day growth phase in phenol- Thermofisher DF12 based COM-LC (minus Genorise bovEGF) + bovFGF2 (ProSpec) - ROCKi (no ROCKi during growth), feeding every 3 days
[0293] o 24 day lactation phase with apical SMUF (415 mOsm / kg), induced with CLMV4 + 1 ug / mL endo bovPRL, harvested every 6 days
[0294] Sufficient lipid was harvested extra- and intracellularly from the 100 cm2culture to process into butter. This was achieved by first concentrating the milk fat by centrifugation and removal of the aqueous phase, followed by vigorous agitation by vortexing until a solid mass formed (FIG. 8B-E)
[0295] While secretion trends are similar between 4.5 cm2to 100 cm2, differences were observed between 0.3 cm2and 4.5 cm2(FIG. 8F):
[0296] o Longevity of secretion from 18 days to 24 days
[0297] o Maturity status of bCSN, with higher proportions of mature bCSN in the 0.3 cm2format
[0298] o Higher secreted whey protein yield in the 0.3 cm2format
[0299] This is likely due to differences in the ratio of basal media to membrane surface area (3.33 mL / cm2for 0.3 cm2versus 0.67 mL / cm2for 4.5 cm2and 100 cm2). This is a restriction of commercially available well plate and insert sizes, and optimization of basal media to surface area ratio is ongoing.
[0300] Scalability considerations: longevity of secretion
[0301] After the initial harvest on Day 6 of lactation, subsequent harvests have been attempted on a daily or 3-day basis with limited success.
[0302] For ALI secretion:• Daily apical washing of ALI lactation with PBS or SMUF resulted in lactation failure by Day 12, as characterized by a loss of p-Stat5, loss of milk protein secretion, loss of TEER / cell monolayer integrity as observed by phenol from the basal media present in the apical SMUF, and cell death
[0303] • Apical washing every 3 days with distilled water or SMUF resulted in improved protein yield on Day 9, but had declining protein secretion compared to SMUF (FIG. 9A)
[0304] • The act of harvesting the secreted protein in ALI appears to accelerate lactation failure, as allowing ALI lactation to continue to Day 10 without harvesting shows no signs of lactation failure
[0305] Having a nutrient-free liquid such as SMUF in the apical compartment during lactation allows for harvest of mature casein up to day 30 of lactation, but reduces secreted milk protein levels. Leaking of basal media into the apical compartment was observed as early as lactation Day 21 (FIG. 9B)
[0306] • Leaking of basal media is indicative of a failure of cell-cell adhesion, as measured by transepithelial electrical resistance (TEER). The following compounds have been found to increase TEER by the end of 2D Growth: o Adding IL-4 and / or IL-13 to 2D Growth Media
[0307] o Adding DAPT, CHIR, and Forskolin to 2D Growth Media
[0308] • Notably, once lactation is initiated, TEER declines. While continuing IL-4 and IL-13 treatment into lactation did not improve TEER, further testing is required to determine if continuing the DAPT, CHIR, and Forskolin treatment in lactation helps maintain high TEER. The following treatments increased TEER during lactation compared to control:
[0309] • RB-3 and / or SB202190 during priming and / or lactation • Adding Forskolin + IBMX to lactation media for the first 3 days
[0310] • Adding Vitamin C to 2D Growth media
[0311] • Adding Vitamin D2 to lactation media
[0312] • Adding beta-carotene to priming treatment and lactation media
[0313] Regulating intracellular lipid droplet size is suspected to be a limiting factor to long term secretion. Slowing the rate of intracellular lipid droplet accumulation by replacing oleicacid with palmitic acid and reducing sodium acetate resulted in increased longevity of milk protein secretion. (FIG. 9C-D). Ensuring the cell monolayer is not exposed to air apically during harvest in the lactation phase increased longevity of secretion (FIG.
[0314] 9E).
[0315] Although the invention has been described with reference to certain specific embodiments, various modifications thereof will be apparent to those skilled in the art without departing from the spirit and scope of the invention. All such modifications as would be apparent to one skilled in the art are intended to be included within the scope of the following claims.
Claims
WE CLAIM:
1. A method of producing a milk-like product in vitro, the method comprising:(a) providing a bioreactor, the bioreactor comprising a culture vessel and a membrane insert, wherein the membrane insert divides the culture vessel into an apical compartment and a basal compartment and wherein a confluent layer of mammary-derived cells, optionally mammosphere-derived cells, is adhered to the apical facing surface of the membrane;(b) providing lactation media to the basal compartment; and(c) isolating the milk-like product from the apical compartment;wherein optionally a priming treatment is added to growth media of the hyperconfluent cell monolayer before switching to lactation.
2. A method of producing a milk-like product in vitro, the method comprising:(a) providing a bioreactor, the bioreactor comprising a culture vessel and a stiff porous membrane insert for two dimensional cell culture, wherein the membrane insert divides the culture vessel into an apical compartment and a basal compartment and wherein a hyperconfluent monolayer of mammary- derived cells is adhered to the apical facing surface of the membrane, wherein growth media is in the basal compartment and optionally the apical compartment;(b) adding a priming treatment to the growth media;(c) replacing the growth media in the basal compartment with lactation media comprising a TGFb inhibitor, an inhibitor of intracellular actomyosin contractility, optionally a ROCK inhibitor or a myosin II inhibitor, and prolactin and optionally one or more of hydrocortisone, insulin, selenite, transferrin, ethanolamine (HITSX); and(d) isolating the milk-like product from the apical compartment.
3. The method of claim 1 or 2, further comprising, if present, removing the growth media from the apical compartment.
4. The method of claim 2, further comprising adding harvest buffer to the apical compartment.
5. The method of claim 4, wherein the harvest buffer comprises Simulated Milk Ultra-Filtrate, PBS and / or distilled water.
6. The method of any one of claims 1 to 5, wherein the priming treatment comprises low concentrations of prolactin optionally less than 50 ng / mL and ROCK inhibitor, optionally 10 pM and optionally one or more of Vitamin C and Retinoic Acid Receptor inhibitor (RARi).
7. The method of any one of claims 1 to 6, wherein the mammary-derived cells are derived from mammary tissue of a lactating cow.
8. The method of claim 7, wherein the mammary tissue is from parenchyma proximal to base of udder.
9. The method of any one of claims 1 to 8, wherein the membrane is a polyethylene terephthalate (PET) membrane, optionally wherein the PET membrane has a pore size between 0.1 - 8.0 urn, preferably 0.4 pm pore size and 1e6 - 100e6 1 x 106pores to 100 x 106pores I cm2, preferably 2E6 (2 x 106) pores I cm2.
10. The method of any one of claims 1 to 9, wherein the membrane is a polycarbonate (PC) membrane, optionally wherein the PC membrane has a pore size of about 0.1 pm to about 8 pm and 1 E6 (1 x 106) pores I cm2to and 100E6 (100 x 106) pores I cm2.
11. The method of any one of claims 1 to 9, wherein the membrane is a PVDF, optionally wherein the PVDF membrane has a pore size of about 0.1 pm to about 8 pm and 1 E6 (1 x 106) pores I cm2to and 100E6 (100 x 106) pores I cm2.
12. The method of any one of claims 1 to 11 , wherein the membrane is pre-treated with gamma radiation.
13. The method of any one of claims 1 to 12, wherein the membrane is coated with extracellular matrix (ECM) and / or ECM mimetic.
14. The method of claim 4 or 5, wherein the harvest buffer is provided for a limited period of time, optionally until a layer of secreted milk is covering the surface of the mammary-derived cells.
15. The method of any one of claims 1 to 14, wherein the mammary-derived cells are genetically modified.
16. The method of claim 15, wherein the mammary-derived cells are genetically modified to express TGFb inhibitor, ROCK inhibitor and / or prolactin.
17. The method of any one of claims 1 to 16, wherein the membrane includes micropatterns.
18. The method of claim 17, wherein the micropatterns are a plurality of microwells.
19. The method of any one of claims 1 to 18, wherein the bioreactor is shaken during at least one step in said method.
20. The method of any one of claims 1 to 19, wherein the cells are subjected to shear stress during at least one step in said method.
21. The method of claim 20, wherein the shear stress is fluid shear stress.
22. The method of claim 21 , wherein the lactation medium is pumped through the basal compartment.
23. The method of claim 22, wherein the lactation medium has a pulsatile flow.
24. A milk-like product produced by the method of any one of claims 1 to 23.
25. The milk-like product of claim 24, wherein proteins in the milk-like product are phosphorylated.
26. The milk-like product of claim 24 or 25, wherein the milk-like product is further processed.
27. A bioreactor for producing a milk-like product in vitro, the bioreactor comprising: a culture vessel having a membrane insert, wherein the membrane insert divides the culture vessel into an apical compartment and a basal compartment;the apical compartment comprising at least one milk-like product output, wherein a confluent layer of mammary-derived cells, optionally mammosphere-derived cells, is adhered to the apical facing surface of the membrane;the basal compartment having at least one fluid input and at least one fluid output operatively connected to a fluidic system configured to pump lactation media through the basal compartment, andwherein the fluidic system is configured to generate a pulsatile or oscillating flow of the lactation medium.
28. The bioreactor of claim 26, wherein the fluidic system comprises a pump operatively connected to the at least one fluid input and configured to generate a pulsatile or oscillating flow of a lactation medium through the basal compartment.
29. The bioreactor of claim 27 or 28, wherein the at least one milk-like product output is configured to harvest the at least one milk-like product at intervals.
30. The bioreactor of any one of claims 27 to 29, wherein the membrane includes a micropattern.
31. The bioreactor of any one of claims 27 to 30, wherein the bioreactor is modular and / or scalable.
32. The bioreactor of claim 31, wherein comprises a plurality of culture vessels, each having a membrane insert that divides the culture vessel into an apical compartment and a basal compartment.
33. The bioreactor of claim 32, wherein the plurality of culture vessels are stacked.