Capsid-modified adeno-associated virus, preparation therefor and use thereof
Patent Information
- Application Number
- PCT/CN2025/141126
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-23
- Filing Date
- 2025-12-09
- Publication Date
- 2026-07-02
Smart Images

Figure CN2025141126_02072026_PF_FP_ABST
Abstract
Description
A capsid-modified adeno-associated virus, its preparation and application
[0001] Related applications
[0002] This disclosure claims priority to Chinese Patent Application No. 2024119069498, filed on December 23, 2024, the entire contents of which are incorporated herein by reference for all purposes. Technical Field
[0003] This disclosure relates to the fields of biotechnology and virology, specifically to a capsid-modified adeno-associated virus (AAV) and its preparation and application. The disclosure provides an AAV capsid protein variant, a method for preparing recombinant AAV viral particles containing said variant capsid protein, and an AAV virus exhibiting increased infectivity and gene product expression in target cells (e.g., retinal cells) compared to an AAV virus containing unmodified parental AAV capsid protein. Background Technology
[0004] Gene therapy vectors can be broadly classified into two categories: viral vectors and non-viral vectors. Among viral vectors, the most commonly used include adenoviruses, lentiviruses, adeno-associated viruses, and retroviruses.
[0005] Adeno-associated virus (AAV) belongs to the family Parvoviridae and the genus Dependovirus. The virion consists of a 25 nm icosahedral capsid containing a 4.7 kb single-stranded DNA genome with two open reading frames: Rep and Cap. The non-structural Rep gene encodes four regulatory proteins essential for viral replication, while Cap encodes three structural proteins (VP1, VP2, and VP3) that assemble into the 60-subunit capsid. This viral capsid mediates the AAV vector's ability to overcome numerous biological barriers to viral transduction, including cell surface receptor binding, endocytosis, intracellular transport, and unpacking in the nucleus.
[0006] AAV (autologous adenosine transduction) is widely used in gene transduction, gene therapy, vaccination, and oncolytic therapy, among other fields. It possesses numerous advantages, including low pathogenicity, broad tissue infectivity, a wide range of host cells (it can infect and express in both proliferating and non-proliferating cells), low immunogenicity, long-term expression of exogenous genes in vivo, and no integration into the host cell genome. It is widely used in experimental and clinical research. Since 2012, the U.S. Food and Drug Administration (FDA) has approved eight gene therapy drugs based on AAV vectors, such as Glybera, Luxturna, and Zolgensma. Luxturna, approved in 2017, is an AAV2 subtype drug for treating the rare inherited eye disease Leber congenital amaurosis. Patients underwent a single subretinal administration of the drug, and its expression was observed continuously for over four years. According to incomplete statistics, more than 40 AAV gene therapy drugs have been approved for clinical trials in China, fully demonstrating the broad prospects of AAV therapeutics.
[0007] In addition to the advantages mentioned above, the application of AAV viruses still faces some challenges, such as how to improve the tissue and cell targeting and transduction efficiency of the vector, how to avoid inhibition by neutralizing antibodies in vivo, and how to improve the packaging efficiency of specific vectors to adapt to industrial production.
[0008] Currently, most AAV viral variants involved in ophthalmic gene therapy are derived from AAV2 serotypes through insertion mutations or single / multi-point mutations, such as AAV2.7m8. These AAV2-based variant serotypes still suffer from various problems, including low viral yield, high empty shell rate, poor stability, and difficulty in commercial preparation.
[0009] Therefore, the development of ophthalmic gene therapy products urgently requires a viral capsid that has highly efficient transduction activity in ocular tissues, especially the outer retina, and also possesses excellent properties such as high viral yield, high stability, and low immunogenicity.
[0010] Public Overview
[0011] This disclosure provides an AAV capsid protein variant, a method for preparing recombinant AAV virus particles containing the variant capsid protein, and an AAV virus that exhibits increased infectivity and gene product expression in target cells (e.g., retinal cells) compared to AAV viruses containing unmodified parental AAV capsid protein.
[0012] One technical solution provided in this disclosure is: an adeno-associated virus (AAV) capsid protein variant, wherein the VP1 of the capsid protein variant contains a polypeptide substitution of about 5-16 amino acids compared to the parental AAV capsid protein VP1, and the AAV containing the variant capsid protein has enhanced retinal cell infectivity compared to AAV containing the corresponding parental AAV capsid protein, wherein the polypeptide containing about 5-16 amino acids includes those selected from SEQ ID NO:3 or SEQ ID NO:4; and the substitution position is at amino acid position 587-592 of the parental AAV8 or the corresponding position of other serotype capsid proteins.
[0013] Preferably, the AAV serotype is selected from any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV DJ, AAVrh10 and their variants, and preferably, the AAV serotype is AAV8.
[0014] Another technical solution provided in this disclosure is: a polynucleotide encoding the AAV capsid protein variant described in this disclosure.
[0015] Another technical solution provided in this disclosure is: a carrier containing the polynucleotides described in this disclosure.
[0016] Another technical solution provided by this disclosure is: a cell containing the vector described in this disclosure, or having polynucleotides as described in this disclosure integrated into its genome.
[0017] Another technical solution provided in this disclosure is: an AAV vector system, which includes a viral packaging plasmid, a target gene expression plasmid, and an auxiliary plasmid, wherein the packaging plasmid contains the vector described in this disclosure.
[0018] Another technical solution provided in this disclosure is: an AAV virus particle containing the AAV variant capsid protein described in this disclosure.
[0019] Another technical solution provided in this disclosure is: a method for preparing a virus, comprising the steps of: culturing the cells described in this disclosure under suitable conditions to obtain AAV virus particles.
[0020] Another technical solution provided in this disclosure is: a recombinant adeno-associated virus (rAAV) particle, comprising:
[0021] (i) The capsid protein variants described in this disclosure
[0022] (ii) The target nucleic acid packaged in a capsid.
[0023] Preferably, the target nucleic acid includes the nucleic acid encoding an EGFP gene, an ophthalmic disease-related gene, and / or a protein used to treat ophthalmic diseases. Preferably, the protein is a VEGF antagonist, including aflibercept, ranibizumab, and bevacizumab.
[0024] Preferably, the transduction efficiency of the rAAV particles to target cells is 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 times or more than that of AAV particles containing parental AAV capsid protein.
[0025] Preferably, compared with AAV virus particles containing AAV8-KH128 capsid protein (SEQ ID NO:2), the rAAV virus particles of this disclosure (such as rAAV virus particles containing QL8-20) have a transduction efficiency of more than 2 times higher for target cells (such as ARPE19).
[0026] Another technical solution provided in this disclosure is: a pharmaceutical composition comprising the AAV virus particles or the recombinant adeno-associated virus (rAAV) particles described in this disclosure, and a pharmaceutically acceptable carrier or excipient.
[0027] Another technical solution provided in this disclosure is the use of the adeno-associated virus (AAV) capsid protein variant, the polynucleotide, the vector, the cell, the AAV vector system, the AAV virus particle, the recombinant adeno-associated virus (rAAV) particle, or the pharmaceutical composition described in this disclosure in the preparation of a medicament for the prevention and / or treatment of diseases.
[0028] Preferably, the disease is an ophthalmic disease;
[0029] And / or, the drug is a vitreous delivery drug;
[0030] And / or, the drug is a subretinal drug;
[0031] And / or, the drug is a suprachoroidal drug;
[0032] And / or, the target of the drug is retinal cells, preferably retinal pigment epithelial cells.
[0033] Preferably, the ophthalmic disease is selected from one or more of age-related macular degeneration, diabetic macular edema, diabetic retinopathy, retinitis pigmentosa, Stargardt's disease, crystalline retinopathy, or glaucoma.
[0034] Another technical solution provided in this disclosure is: a method for preventing and / or treating a disease, comprising administering to a subject the adeno-associated virus (AAV) capsid protein variant, the polynucleotide, the vector, the cell, the AAV vector system, the AAV virus particle, the recombinant adeno-associated virus (rAAV) particle, or the pharmaceutical composition described in this disclosure.
[0035] Preferably, the disease is an ophthalmic disease;
[0036] And / or, the method is administered via vitreous humor;
[0037] And / or, the method is administered subretinal;
[0038] And / or, the method is administered via the suprachoroidal space;
[0039] And / or, the target of the drug is retinal cells, preferably retinal pigment epithelial cells.
[0040] Preferably, the ophthalmic disease is selected from one or more of age-related macular degeneration, diabetic macular edema, diabetic retinopathy, retinitis pigmentosa, Stargardt's disease, crystalline retinopathy, or glaucoma.
[0041] Another technical solution provided in this disclosure is the use of the adeno-associated virus (AAV) capsid protein variant, the polynucleotide, the vector, the cell, the AAV vector system, the AAV virus particle, the recombinant adeno-associated virus (rAAV) particle, or the pharmaceutical composition described in this disclosure in the prevention and / or treatment of diseases.
[0042] Preferably, the disease is an ophthalmic disease;
[0043] And / or, the drug is a vitreous delivery drug;
[0044] And / or, the drug is a subretinal drug;
[0045] And / or, the drug is a suprachoroidal drug;
[0046] And / or, the target of the drug is retinal cells, preferably retinal pigment epithelial cells.
[0047] Preferably, the ophthalmic disease is selected from one or more of age-related macular degeneration, diabetic macular edema, diabetic retinopathy, retinitis pigmentosa, Stargardt's disease, crystalline retinopathy, or glaucoma.
[0048] It should be understood that, within the scope of this disclosure, the above-described technical features and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. These will not be elaborated upon further here.
[0049] This disclosure has the following beneficial effects:
[0050] This disclosure identifies a series of AAV capsid protein variants and AAV viruses assembled from them, which, compared to AAV viruses containing unmodified parental AAV capsid proteins, exhibit increased infectivity and gene product expression in target cells (e.g., retinal cells). Attached Figure Description
[0051] Figure 1 shows the AAV8-wt capsid plasmid map of the wild-type AAV8 capsid protein.
[0052] Figure 2 shows the capsid plasmid map of the AAV8 capsid protein mutant QL8-19.
[0053] Figure 3 shows the capsid plasmid map of the AAV8 capsid protein mutant QL8-20.
[0054] Figure 4 shows the AAV8 capsid protein control AAV8-KH128 capsid plasmid map.
[0055] Figure 5 shows the EGFP fluorescence signal of AAV8 mutant virus cultured in HEK293 cells.
[0056] Figure 6 shows the statistical count of EGFP-positive cells in HEK293 cells after infection with AAV8 mutant virus by flow cytometry.
[0057] Figure 7 shows an image of the EGFP fluorescence signal of AAV8 mutant virus cultured in ARPE19 cells.
[0058] Figure 8 shows the statistical count of EGFP-positive cells after ARPE19 cells were infected with AAV8 mutant virus by flow cytometry.
[0059] Figure 9 shows the detection of aflibercept protein expression levels after the AAV8 mutant capsid was used to package aflibercept molecules. Figure 9a shows the comparison of expression levels after AAV8-wt normalization, and Figure 9b shows the comparison of expression levels after AAV8-KH128 normalization.
[0060] Public details
[0061] the term
[0062] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference to the extent that each publication, patent or patent application has been specifically and individually indicated to be incorporated herein by reference.
[0063] Before this disclosure is described in detail below, it should be understood that this disclosure is not limited to the specific methodologies, procedures, and reagents described herein, as these can vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of this disclosure. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
[0064] Some embodiments disclosed herein include numerical ranges, and certain aspects of this disclosure may be described using ranges. Unless otherwise stated, it should be understood that numerical ranges or descriptions using ranges are for purposes of brevity and convenience only and should not be considered as a strict limitation of the scope of this disclosure. Therefore, descriptions using ranges should be considered as specifically disclosing all possible subranges and all possible specific numerical points within those ranges, as these subranges and numerical points have been explicitly stated herein. The above principles apply equally regardless of the breadth of the numerical values described. When a range description is used, the range includes the endpoints of the range.
[0065] When referring to measurable values such as quantities, temporary durations, etc., the term “about” means a variation of ±20%, or in some cases ±10%, or in some cases ±5%, or in some cases ±1%, or in some cases ±0.1% of the specified value.
[0066] Adeno-associated virus (AAV) belongs to the family Parvoviridae, genus Dependent Virus. It is currently the simplest single-stranded DNA defective virus discovered, requiring a helper virus (such as adenovirus) to replicate. AAV is present in a variety of vertebrates, including humans and non-human primates (NHPs). The current consensus is that AAV does not cause any human disease.
[0067] AAV consists of an icosahedral protein capsid approximately 26 nm in diameter and a ~4.7 kb single-stranded DNA genome. The capsid contains three types of subunits, VP1, VP2, and VP3, totaling 60 copies in a 1:1:10 ratio (VP1:VP2:VP3). At both ends of the AAV genome are two inverted terminal repeats (ITRs), which play a crucial role in viral replication and packaging. Between the two ITRs are the Cap and Rep genes. The Rep gene encodes four proteins required for viral replication: Rep78, Rep68, Rep52, and Rep40. The Cap gene encodes capsid proteins: through alternative splicing and translation from different start codons, it encodes the three capsid subunits VP1, VP2, and VP3.
[0068] Recombinant adeno-associated virus vectors (rAAVs) are derived from non-pathogenic wild-type adeno-associated viruses. Due to their good safety profile, broad host cell range (dividing and non-dividing cells), low immunogenicity, and long in vivo expression time of exogenous genes, they are considered one of the most promising gene transfer vectors and are widely used in gene therapy and vaccine research worldwide. In medical research, rAAVs are used for gene therapy research on various diseases (including in vivo and in vitro experiments). Simultaneously, as a distinctive gene transfer vector, they are also widely used in gene function research, disease model construction, and gene knockout mouse creation.
[0069] The term "rAAV" refers to recombinant adeno-associated virus, also known as recombinant adeno-associated virus particles or recombinant AAV. rAAV consists of the same capsid sequence and structure found in wild-type AAV. Unlike wild-type AAV, the rAAV packaging genome has all AAV protein-coding sequences deleted and a target gene expression cassette added, retaining only the ITR sequences necessary for genome replication and packaging. This removal of viral coding sequences improves the packaging capacity of rAAV (~4.7 kb) and reduces the immunogenicity and cytotoxicity of the virus during in vivo delivery, thus improving viral safety.
[0070] The term "capsid protein" refers to the proteins that make up the viral capsid. The AAV capsid protein comprises three protein subunits: VP1, VP2, and VP3. These three capsid proteins, which constitute the complete capsid, are translated from the same nucleic acid sequence and share the same C-terminus; however, differences in translation length result in different protein subunits. The amino acid positions provided herein are determined with reference to the amino acid positions of AAV8 VP1 shown in SEQ ID NO:1. Those skilled in the art can easily determine the positions of the same amino acids within the AAV VP2 and / or VP3 capsid proteins, as well as the corresponding positions of amino acids in different serotypes. The "capsid proteins" described herein include serotypes such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-DJ, or AAVrh10.
[0071] The term "capsid protein variant" refers to a capsid protein that has at least one mutation (e.g., substitution, deletion, or insertion) compared to the parent capsid protein.
[0072] In this document, amino acid mutations can be amino acid substitutions, deletions, or insertions. Any combination of substitutions, deletions, or insertions can be performed to obtain optimized variants with desired properties. Amino acid deletions and insertions include deletions and insertions at the amino and / or carboxyl ends of the polypeptide sequence, as well as deletions and insertions within the polypeptide sequence. In some embodiments, amino acid mutations are amino acid substitutions, such as single amino acid substitutions, or combinations of several amino acid substitutions. In some embodiments, amino acid mutations are insertions, such as the insertion of several amino acid segments. The inserted amino acid can simply be inserted between two given amino acids of the capsid protein. Amino acid insertions can also be performed in conjunction with the deletion of a given amino acid of the capsid protein at the insertion site.
[0073] In this paper, when referring to the amino acid position of the capsid protein to be mutated, it is determined by referring to the amino acid sequence shown in SEQ ID NO:1. The corresponding amino acid position on a hybrid protein or polypeptide with other amino acid sequences can be identified by comparing the amino acid sequence with SEQ ID NO:1.
[0074] The term "retinal cell" in this article may refer to any type of retinal cell, such as retinal ganglion cells, amacrine cells, horizontal cells, bipolar cells, rod cells, cone cells, Müller cells, and retinal pigment epithelial cells.
[0075] The terms “transduction” or “infection” refer to the introduction of nucleic acids or genes into target cells via viral vectors.
[0076] The terms "transduction efficiency" or "infection efficiency" refer to the percentage of cells expressing the target gene after incubation or culture with a predetermined number of viral vectors containing the target gene. Methods for determining transduction efficiency or infection efficiency include fluorescence-activated cell analysis of cells transduced with a fluorescent reporter gene (such as EGFP) and PCR detection of the target nucleic acid expression level.
[0077] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides or their analogues. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogues, and may be interrupted by non-nucleotide components. As used herein, the term polynucleotide may refer alternately to both double-stranded and single-stranded molecules.
[0078] The term "target gene" refers to a gene to be transduced via rAAV viral particles that encodes, for example, preventive or therapeutic proteins, particularly proteins used to prevent or treat eye diseases, such as aflibercept, antibodies, and antibody analogs. Detailed Implementation
[0079] This disclosure is further described in detail through the following examples.
[0080] The following specific embodiments are provided to illustrate this disclosure; however, it should be understood that these embodiments are provided only for illustrative purposes and not for limiting the scope of this disclosure.
[0081] Materials and reagents:
[0082] Unless otherwise specified, the experimental methods described in these embodiments are all conventional methods.
[0083] Unless otherwise specified, all experimental materials used in the embodiments were purchased from conventional biochemical reagent companies.
[0084] Example 1: AAV Capsule Variant Design
[0085] Several polypeptide sequences ranging from 5 to 16 amino acids in length were obtained through computer simulation and random mutation design. Primers were designed based on the inserted polypeptide sequences, and the polypeptide sequences were inserted into the AAV8-wt capsid sequence (SEQ ID NO:1) using DNA homologous recombination to generate AAV8 variant capsids. After experimental screening, the following two variants with the best experimental results were finally obtained. These variants contain a polypeptide substitution located at amino acids Q587 to A592 of the parental AAV8, and the sequence information is shown in Table 1. The control group AAV8-KH128 capsid protein sequence is shown in SEQ ID NO:2.
[0086] Table 1
[0087] Example 2: Construction of capsid plasmids of QL8-19, QL8-20 and AAV8-KH128 variants
[0088] (1) Linearization of AAV8-wt vector
[0089] The AAV8-wt plasmid (purchased from Taisto Biotechnology Co., Ltd.) was extracted and used as a template. A 7318 bp linearized vector was obtained by polymerase chain reaction (PCR) using the 5' end amplification primer primer-RC8-F: cctcaaattggaactgtcaaca (SEQ ID NO: 7) and the 3' end amplification primer primer-RC8-R: caagttatctgccacgataccgt (SEQ ID NO: 8). The amplification product was digested with the restriction endonuclease DpnI, followed by agarose gel electrophoresis, and the target band was recovered to obtain the AAV8-wt linearized vector.
[0090] (2) Insertion fragment synthesis
[0091] Based on the principle of homologous recombination primer design, primers were designed and synthesized for the inserted polypeptide in Example 1. Exemplary synthetic primer sequences are shown in Table 2. The primers contain homologous arms that overlap with the linearized vector at both ends.
[0092] Table 2
[0093] (3) Homologous recombination and transformation
[0094] Each pair of single-stranded primers designed above was mixed and paired to form a double-stranded nucleic acid fragment. Then, AAV8-wt linearization vector and homologous recombinase were added, and the mixture was incubated at 50°C for 20 min for homologous recombination. The recombinant product was transformed into DH5α competent cells, and incubated in antibiotic-free LB medium at 37°C and 220 rpm for 1 hour. The bacterial culture was then plated to screen for ampicillin-resistant positive colonies.
[0095] (4) Screening for positive colonies
[0096] Several colonies were selected and colony PCR was performed using the 5' end amplification primer TB-8-primer-F: gacaotgcggattacagcg (SEQ ID NO: 15) and the 3' end amplification primer TB-8-primer-R: cggagacgggtggaagtt (SEQ ID NO: 16). Colonies with PCR amplification bands of approximately 264 bp were selected for sequencing by agarose gel electrophoresis. The sequencing primers were: CX-Cap8-F1: catcatatcatgggaaaggtgc (SEQ ID NO: 17); CX-Cap8-R1: agctctggctgtgggcgta (SEQ ID NO: 18); CX-Cap8-F2: cggctacctaacactcaacaa (SEQ ID NO: 19); CX-Cap8-R2: aatacccagcgtgaccaca (SEQ ID NO: 20). The sequencing results were compared with the QL8-19 capsid nucleic acid sequence, QL8-20 capsid nucleic acid sequence, and AAV8-KH128 capsid nucleic acid sequence. Colonies with correct sequences were screened, and plasmids were extracted for virus packaging. An exemplary AAV8-wt capsid plasmid is shown in Figure 1; a QL8-19 capsid mutant plasmid is shown in Figure 2; a QL8-20 capsid mutant plasmid is shown in Figure 3; and an AAV8-KH128 capsid plasmid is shown in Figure 4.
[0097] Example 3: Preparation of QL8-19, QL8-20, AAV8-KH128 and AAV8-wt viruses expressing EGFP (green fluorescent protein)
[0098] Viral packaging was generated by co-transfection of HEK293 cells with three plasmids: an expression plasmid (pAAV-CAG-EGFP) containing an expression cassette of the target gene flanked by the viral packaging ITR; a capsid mutant plasmid encoding the Rep / Cap gene constructed in Example 2 (AAV8-wt uses the unmodified original pAAV2 / 8 plasmid); and an auxiliary plasmid containing adenovirus helper genes.
[0099] In the packaging process of QL8-19, QL8-20, AAV8-KH128, and AAV8-wt viruses, except for the capsid mutant plasmid used as its respective plasmid vector, the other expression plasmids (pAAV-CAG-EGFP), helper plasmids, and packaging preparation methods are the same as follows:
[0100] 1. Plasmid preparation: The bacterial strains that were correctly sequenced in Example 2, namely QL8-19, QL8-20, AAV8-KH128 capsid mutant, AAV8-wt capsid, and the target gene expression plasmid (pAAV-CAG-EGFP) and helper plasmid required for viral packaging, were inoculated. The bacterial culture was incubated overnight at 37℃ and 220rpm. The bacterial culture was then centrifuged to collect the bacterial pellet, and plasmids were extracted using a commercial large-scale plasmid extraction kit. After extraction, the plasmid concentration and A260 / A280 ratio were measured to confirm that the plasmids met the requirements for use.
[0101] 2. Suspension HEK293 cell culture: Resuscitate HEK293 cells into shake flasks and allow the cell density to grow to ≥3×10⁻⁶. 6 Cells were passaged at a density of 2 × 10⁶ cells / ml. Once the cells reached stable growth after three passages and cell viability was above 95%, the cell density was adjusted to 2 × 10⁶ cells / ml. 6 Cell transfection was performed using cells / ml.
[0102] 3. Cell Transfection: PEI was used as the transfection reagent. Before use, it was diluted with fresh culture medium to obtain a PEI dilution. The three viral packaging plasmids were mixed in a specific molar ratio (helper plasmid: capsid plasmid: EGFP expression plasmid = 1:1:1) and diluted with fresh culture medium to obtain a plasmid DNA dilution. The PEI dilution was added to the plasmid DNA dilution (volume ratio 1:1), and the mixture was gently blown around in the test tube or pipette until well combined to form a transfection complex. After incubating the transfection complex at room temperature for approximately 15 minutes, it was added to the cell line at a density of 2 × 10⁶ cells / year. 6 After the operation, the shake flasks were placed in a shaker and cultured at 37°C, 115 rpm, and 8% CO2.
[0103] 4. Virus harvest: Three days after transfection, lysis buffer was added to the cell culture medium to lyse the cells. At the same time, nuclease with a final concentration of 50 U / mL was added. The cells were lysed and digested at 37°C for 3 hours. After lysis, the supernatant was collected by centrifugation and the supernatant was used as the virus harvest solution.
[0104] 5. Virus Purification: The virus harvested fluid was filtered to remove cell debris, and then the virus was captured by AAVX affinity chromatography. Finally, AEX separation yielded QL8-19, QL8-20, AAV8-KH128, and AAV8-wt virus samples expressing EGFP (green fluorescent protein). The viral titers of the QL8-19, QL8-20, AAV8-KH128, and AAV8-wt virus samples expressing EGFP were determined by qPCR and used for further processing.
[0105] Example 4: Preparation of QL8-19, QL8-20, AAV8-KH128 and AAV8-wt viruses expressing aflibercept protein
[0106] Viral packaging was generated by co-transfection of HEK293 cells with three plasmids: an expression plasmid (pAAV-CAG-Trap) containing an expression cassette of the target gene flanked by the viral packaging ITR; a capsid mutant plasmid encoding the Rep / Cap gene constructed in Example 2 (AAV8-wt uses the unmodified original pAAV2 / 8 plasmid); and an auxiliary plasmid containing adenovirus helper genes.
[0107] In the packaging process of QL8-19, QL8-20, AAV8-KH128, and AAV8-wt viruses expressing aflibercept protein, except for the capsid mutant plasmid used as its respective plasmid vector, the other expression plasmids (pAAV-CAG-Trap), helper plasmids, and packaging preparation methods are the same as follows:
[0108] 1. Plasmid preparation: The bacterial strains that were correctly sequenced in Case 2, including QL8-19, QL8-20, AAV8-KH128 capsid mutant, AAV8-wt capsid, and the target gene expression plasmid (pAAV-CAG-Trap) and helper plasmid required for viral packaging, were inoculated. The bacterial culture was incubated overnight at 37℃ and 220rpm. The bacterial culture was then centrifuged to collect the bacterial pellet, and plasmids were extracted using a commercially available large-scale plasmid extraction kit. After extraction, the plasmid concentration and A260 / A280 ratio were measured to confirm that the plasmids met the requirements for use.
[0109] 2. Suspension HEK293 cell culture: Resuscitate HEK293 cells into shake flasks and allow the cell density to grow to ≥3×10⁻⁶. 6 Cells were passaged at a density of 2 × 10⁶ cells / ml. Once the cells reached stable growth after three passages and cell viability was above 95%, the cell density was adjusted to 2 × 10⁶ cells / ml. 6 Cell transfection was performed using cells / ml.
[0110] 3. Cell Transfection: PEI was used as the transfection reagent. Before use, it was diluted with fresh culture medium to obtain a PEI dilution. The three viral packaging plasmids were mixed in a specific molar ratio (helper plasmid: capsid plasmid: trap expression plasmid = 1:1:1) and diluted with fresh culture medium to obtain a plasmid DNA dilution. The PEI dilution was added to the plasmid DNA dilution (volume ratio 1:1), and the mixture was gently stirred by inverting the test tube or using a pipette until well combined to form a transfection complex. After incubating the transfection complex at room temperature for approximately 15 minutes, it was added to the cell line at a density of 2 × 10⁶ cells / year. 6After the operation, the shake flasks were placed in a shaker and cultured at 37°C, 115 rpm, and 8% CO2.
[0111] 4. Virus harvest: Three days after transfection, lysis buffer was added to the cell culture medium to lyse the cells. At the same time, nuclease with a final concentration of 50 U / mL was added. The cells were lysed and digested at 37°C for 3 hours. After lysis, the supernatant was collected by centrifugation and the supernatant was used as the virus harvest solution.
[0112] 5. Virus Purification: The virus harvested fluid was filtered to remove cell debris, and then the virus was captured by AAVX affinity chromatography. Finally, AEX separation yielded QL8-19, QL8-20, AAV8-KH128, and AAV8-wt viral samples expressing aflibercept protein. The viral titers of the QL8-19, QL8-20, AAV8-KH128, and AAV8-wt viral samples expressing aflibercept protein were determined by qPCR, followed by aflibercept protein expression detection.
[0113] Example 5: In vitro cell transduction activity assay of AAV8 variant virus expressing EGFP green fluorescent protein
[0114] 1. After diluting HEK293 suspension cells, seed them into 6-well plates at a cell density of 1×10⁻⁶ cells per well. 6 cells / ml, 3ml per well.
[0115] 2. The AAV8-wt, AAV8-KH128, QL8-19 and QL8-20 viruses expressing EGFP green fluorescent protein prepared in Example 3 were diluted with fresh HEK293 cell culture medium according to the experimental MOI.
[0116] 3. Viral Infection: After confirming good cell growth, slowly add the prepared virus dilution solution along the well wall according to the different MOIs to infect the cells. Then, fix the plate in a shaker-humidified box. Shaker operating conditions: 37℃, 5% CO2;
[0117] 4. 48 hours after infection, the cell infection status was recorded using a fluorescence microscope. As shown in Figure 5, the fluorescence intensity of the variant virus was significantly higher than that of the control group.
[0118] 5. Cells were collected and measured using a BD flow cytometer with the FITC channel selected. The total cell count was set to 100,000, and the number of EGFP-positive cells was counted. The results are shown in Figure 6. Under different MOI conditions, compared with the AAV8-wt and AAV8-KH128 control groups, the infection efficiency of variant viruses QL8-19 and QL8-20 on HEK293 cells was significantly improved.
[0119] Example 6: In vitro ARPE19 cell infection experiment with AAV8 variant virus expressing EGFP target gene
[0120] 1. The day before the experiment, ARPE-19 cells were seeded in 24-well plates at a density of 1 × 10⁶ cells per well. 5 Cells were allowed to adhere overnight using a complete culture medium containing 10% FBS, so that they could be infected the following day.
[0121] 2. The AAV8-wt, AAV8-KH128, QL8-19 and QL8-20 viruses expressing EGFP green fluorescent protein prepared in Example 3 were diluted according to the experimental MOI using fresh ARPE19 cell culture medium without FBS.
[0122] 3. Viral Infection: After confirming good cell growth, aspirate the culture medium from the cell wells, wash once with PBS, and then slowly add 250 μL of the prepared virus dilution solution along the well wall according to the different MOIs. Four hours after adding the virus dilution solution, add 250 μL of fresh ARPE19 cell culture medium containing 20% FBS to bring the total medium to 10% FBS.
[0123] 4. Sixteen hours after infection, remove the culture medium from the well and replace it with fresh 10% FBS complete culture medium to continue culturing.
[0124] 5. Continue culturing for 48 hours, and use a fluorescence microscope to capture EGFP fluorescence signals to observe the expression of the fluorescent protein. The infection status of ARPE19 cells after 48 hours is shown in Figure 7. The fluorescence intensity of the variant virus is significantly higher than that of the control group.
[0125] 6. Simultaneously, flow cytometry was used to count EGFP-positive cells. Cells were digested with trypsin until the cell edges became rounded, then digestion was stopped. Cells were collected by centrifugation and resuspended in 300 μL of sterile PBS. A BD flow cytometer was used with the FITC channel selected, and the total cell count was set to 100,000 to analyze the proportion of EGFP-positive cells. The results are shown in Figure 8. Under different MOI conditions, compared with the AAV8-wt and AAV8-KH128 control groups, the infection efficiency of variant viruses QL8-19 and QL8-20 on ARPE19 cells was significantly improved.
[0126] Example 7: AAV8 variant virus infection of APRE cells protein expression experiment
[0127] 1. The day before the experiment, ARPE-19 cells were seeded in 24-well plates at a density of 1 × 10⁶ cells per well. 5Cells / wells were incubated overnight in complete medium containing 10% FBS for infection the following day.
[0128] 2. The AAV8, AAV8-KH128, QL8-19, and QL8-20 viruses expressing aflibercept protein prepared in Example 4 were diluted with fresh FBS-free medium at an MOI of 1E5 vg / cell.
[0129] 3. Viral Infection: After confirming that ARPE19 cells are in good growth condition, the culture medium in the cell wells is aspirated, and the cells are washed once with PBS. Then, 250 μL of the prepared virus dilution is slowly added to the wells along the cell wall. Four hours after adding the virus dilution, 250 μL of fresh ARPE19 cell culture medium containing 20% FBS is added to bring the total culture medium to 10% FBS.
[0130] 4. Sixteen hours after infection, remove the culture medium from the well and replace it with fresh 10% FBS complete culture medium to continue culturing.
[0131] 5. After 72 hours, cells and cell supernatant were collected. Cells were completely lysed by repeated freeze-thaw cycles in liquid nitrogen three times. Cell debris was removed by centrifugation to obtain the lysate supernatant. The expression level of Trap protein in the lysate supernatant was measured using ELISA. The results are shown in Figures 9a and 9b. Compared with the AAV8-wt control group, the expression levels of aflibercept proteins in QL8-19 and QL8-20 increased by 24-fold and 28-fold, respectively; compared with the AAV8-KH128 control group, the expression levels of aflibercept proteins in QL8-19 and QL8-20 increased by 1.3-fold and 1.5-fold, respectively.
[0132] The embodiments described above are merely illustrative of several implementations of this disclosure, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of this patent disclosure. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this disclosure, and these all fall within the protection scope of this disclosure. Therefore, the protection scope of this patent disclosure should be determined by the appended claims.
[0133] References
[0134] [1]Dan Wang,Phillip W.L.Tai&Guangping Gao.Adeno-associated virus vector as a platform for gene therapy delivery.Nature Reviews Drug Discovery.2019 May;18(5):358–378.
[0135] [2]Büning H,Srivastava A.Capsid Modifications for Targeting and Improving the Efficacy of AAV Vectors.Mol Ther Methods Clin Dev.2019 Jan 26;12:248-265.
[0136] [3]Li C,Samulski RJ.Engineering adeno-associated virus vectors for gene therapy.Nat Rev Genet.2020 Apr;21(4):255-272.
Claims
1. An adeno-associated virus (AAV) capsid protein variant, characterized in that, The VP1 variant of the capsid protein contains a polypeptide with 5-16 amino acids as a substitute for the parental AAV capsid protein VP1, and the AAV containing the variant capsid protein has enhanced retinal cell infectivity compared to the AAV containing the corresponding parental AAV capsid protein, wherein the polypeptide with 5-16 amino acids is selected from SEQ ID NO:3 or SEQ ID NO:4; the substitution is at amino acid position 587-592 of the parental AAV8 or the corresponding position of other serum type capsid proteins.
2. The capsid protein variant according to any one of claims 1 characterized in that, The AAV serotype is selected from any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV DJ, AAVrh10 and their variants, preferably, the AAV serotype is AAV8.
3. A polynucleotide, comprising, The polynucleotide encodes a variant of the AAV capsid protein as described in any one of claims 1-2.
4. A vector, characterized by, The carrier contains the polynucleotide as described in claim 3.
5. A cell, comprising: The cell contains the vector as described in claim 4, or its genome is integrated with the polynucleotide as described in claim 3.
6. An AAV vector system characterized in that, The AAV vector system comprises a viral packaging plasmid, a target gene expression plasmid, and an auxiliary plasmid, wherein the packaging plasmid comprises the vector described in claim 4.
7. An AAV viral particle, characterized in that, The AAV virus particle contains the AAV variant capsid protein as described in any one of claims 1-2.
8. A method of producing a virus, characterized by, The procedure includes: culturing the cells as described in claim 5 under suitable conditions to obtain AAV virus particles.
9. A recombinant adeno-associated viral (rAAV) particle, characterized in that: Include: (i) the capsid protein variant according to any one of claims 1-2 (ii) The target nucleic acid packaged in a capsid.
10. The granule of claim 9, wherein: The target nucleic acid includes the nucleic acid encoding an EGFP gene, an ophthalmic disease-related gene, and / or a protein used to treat ophthalmic diseases. Preferably, the protein is a VEGF antagonist, including aflibercept, ranibizumab, and bevacizumab.
11. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises the AAV virus particles of claim 7 or the recombinant adeno-associated virus (rAAV) particles of any one of claims 9-10, and a pharmaceutically acceptable carrier or excipient.
12. Use of the adeno-associated virus (AAV) capsid protein variant of any one of claims 1-2, the polynucleotide of claim 3, the vector of claim 4, the cell of claim 5, the AAV vector system of claim 6, the AAV virus particle of claim 7, the recombinant adeno-associated virus (rAAV) particle of claims 9-10, or the pharmaceutical composition of claim 11 in the preparation of a medicament for the prevention and / or treatment of a disease.
13. Use according to claim 12, characterized in that, The disease in question is an ophthalmological disease. And / or, the drug is a vitreous delivery drug; And / or, the drug is a subretinal drug; And / or, the drug is a suprachoroidal drug; And / or, the target of the drug is retinal cells, preferably retinal pigment epithelial cells.
14. Use according to claim 13, characterized in that, The ophthalmic disease is selected from one or several of age-related macular degeneration, diabetic macular edema, diabetic retinopathy, retinitis pigmentosa, Stargardt disease, crystalline retinal degeneration or glaucoma.