Pxgstd2 or mutant thereof, and use thereof

Abstract

The present invention relates to the field of biotechnology, and specifically relates to PxGSTD2 or a mutant thereof, and the use thereof. More specifically, provided is a PxGSTD2 protein mutant comprising a mutation (F205) of a phenylalanine (F) residue at position 205 on the amino acid sequence as shown in SEQ ID NO. 3. Further provided is the use of PxGSTD2 or a mutant thereof in the aspects such as catalyzing the conjugation of a pesticide or Fusarium toxin, such as vomitoxin, with reduced glutathione (GSH), providing a target organism with tolerance to a Fusarium toxin such as vomitoxin, providing a food crop with tolerance or resistance to Fusarium-related diseases or other diseases, improving the yield or quality of a food crop, and improving the tolerance of a non-target organism to pesticides.

Description

PxGSTD2 or its mutants and their uses Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to PxGSTD2 or its mutants and their uses. Background Technology

[0002] Wheat, rice, corn, oats, and barley are important global cereal crops, and their yield and quality are crucial to global food security and socio-economic stability. Fusarium fungi are major pathogens of cereal crops such as wheat, causing a variety of serious fungal diseases, including wheat scab, wheat stem rot, rice bakanae disease, rice damping-off, rice ear rot, corn ear rot, and corn stem rot, resulting in severe yield reductions. Furthermore, Fusarium fungi, such as *Fusarium graminearum*, produce various toxins when causing damage, including vomitoxin (DON), zearalenone, fumonisin, and T2-toxin. These toxins are chemically stable and can ascend the food chain, being widely present in processed foods made from grains such as wheat (e.g., flour, beer) and animal feed products, leading to their presence in animal-derived foods such as meat, eggs, and dairy products. The Food and Agriculture Organization of the United Nations and the World Health Organization have identified vomitoxin as the most dangerous naturally occurring food contaminant, posing a serious threat to human and animal health and food safety.

[0003] Furthermore, Fusarium toxins, represented by vomitoxin, have been proven to be important pathogenic factors of Fusarium and essential substances for the spread of Fusarium diseases (Bai & Shaner, 2004, Annual Review of Phytopathology, 42:135-161). Therefore, Fusarium toxin degradation genes are also a type of gene for resistance to Fusarium diseases such as Fusarium head blight. Currently reported Fusarium toxin degrading enzymes mainly consist of alcohol dehydrogenase, aldehyde-ketone reductase, and glutathione S-transferases (GSTs) (He et al., 2020, Food Chemistry, 321:126703; Wang et al., 2020, Science, 368:eaba5435; Hao et al., 2020, Trends in Plant Science, 25:1-3). GSTs are broad-spectrum detoxification enzymes widely present in organisms, capable of detoxifying and metabolizing various endogenous or exogenous toxic compounds, while also enhancing the organism's resistance to adverse conditions. Taking Fhb7, derived from *Thinopyrum elongatum*, as an example, this plant-derived GST can effectively catalyze the conjugation of vomitoxin and GSH, forming a low-toxicity, easily excreted vomitoxin-GSH conjugated product. Transferring the Fhb series genes into wheat can significantly reduce the vomitoxin content in wheat grains and significantly improve the broad-spectrum resistance of wheat to various Fusarium diseases such as Fusarium head blight and stem rot (Wang et al., 2020, Science, 368:eaba5435). Therefore, Fusarium toxin degradation genes, represented by GSTs, have significant application potential in improving plant resistance to Fusarium diseases and controlling food safety.

[0004] In summary, reducing the harm to humans caused by the cascading effects of Fusarium toxins, such as vomitoxin, and ensuring food safety and human health has always been a key issue in this field. Therefore, there is an urgent need for effective methods to reduce Fusarium toxins in grains.

[0005] On the other hand, pesticides play a crucial role in global food security and the prevention and control of human diseases. With the long-term and extensive use of pesticides, they have become a significant source of agricultural pollution, posing an increasingly prominent threat to the ecological environment and human health. Pesticides cause harm primarily through two pathways: first, their acute toxicity is high, causing harm to organisms within a short period; second, they accumulate in environmental media through residues and bioaccumulation, eventually causing harm.

[0006] The harm caused by pesticide residues is persistent and irreversible. Environmental pollution (water, air, soil, etc.), reduced biodiversity, and various human diseases (deformity, cancer, infertility, neurological disorders, etc.) are all closely related to pesticide residues. Take bees as an example: bees play a crucial role in pollinating three-quarters of food crops and only 90% of flowering plants; however, bee populations, especially wild bees, are declining rapidly. The disappearance of bees will disrupt the entire ecosystem, affecting not only plants but also wildlife that depend on them for food and habitat. Agricultural production will also be severely impacted. A recent study indicates that the extensive use of pesticides, especially insecticides, is the main cause of the bee population decline. Common insecticides such as neonicotinoids, diamides, pyrethroids, organophosphates, and oxadiazons are highly toxic to bees; long-term exposure can cause colony collapse disorder, death, slowed growth and development, and weakened immunity in bees.

[0007] To reduce the harm of pesticides to the ecological environment and non-target organisms, the discovery and application of broad-spectrum detoxification enzymes is an effective approach. As an important detoxification enzyme in organisms, glutathione S-transferase (GST) can effectively cope with acute or long-term stress from pesticides and other harmful substances. GST catalyzes the conjugation of reduced glutathione (GSH) with pesticides and other harmful substances or their metabolites, forming products with low toxicity and easy excretion, effectively reducing the harm of pesticides and other harmful substances to organisms. This is one of the key reasons why pests and weeds develop broad-spectrum resistance to pesticides. Therefore, GST is a promising broad-spectrum detoxification enzyme for reducing pesticide residues in the environment and improving the pesticide tolerance of non-target organisms. Summary of the Invention

[0008] To address the problems existing in the prior art, the inventors conducted repeated research and discovered that the detoxification enzyme PxGSTD2 from the diamondback moth and its mutants can directly catalyze the conjugation of Fusarium toxins and GSH, forming adducts with low toxicity, high water solubility, and easy excretion by organisms. This achieves the detoxification and metabolism of Fusarium toxins such as vomitoxin, significantly improving the yield, quality, tolerance to Fusarium toxins, and resistance to Fusarium-related diseases or other diseases in grain crops such as wheat, corn, and rice. Compared with wild-type PxGSTD2, the PxGSTD2 mutant provided by this invention also exhibits superior performance in catalyzing the conjugation of GSH and vomitoxin, improving the yield, quality, tolerance to Fusarium toxins, and resistance to Fusarium-related diseases or other diseases in grain crops.

[0009] On the other hand, the inventors also discovered that the wild-type and mutant PxGSTD2 protein exhibited excellent catalytic activity in the conjugation of various pesticides, such as oxadiazons, neonicotinoids, and pyrethroids, with GSH, significantly reducing pesticide biotoxicity and enhancing the tolerance of non-target organisms to pesticides. Furthermore, compared to the wild-type PxGSTD2 protein, the PxGSTD2 mutant provided by this invention demonstrates superior performance in catalyzing the conjugation of GSH with pesticides and enhancing the tolerance of non-target organisms to pesticides.

[0010] Therefore, in a first aspect, the present invention provides a PxGSTD2 protein mutant, wherein the PxGSTD2 protein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3, and the mutant contains a mutation in phenylalanine (F) at residue 205 of the amino acid sequence shown in SEQ ID NO.3.

[0011] In a second aspect, the present invention provides an isolated gene that encodes a mutant of the first aspect.

[0012] In a third aspect, the present invention provides an expression vector comprising the isolated gene from the second aspect.

[0013] In a fourth aspect, the present invention provides an expression cell comprising the isolated gene of the second aspect or the expression vector of the third aspect.

[0014] In a fifth aspect, the present invention provides the use of the PxGSTD2 protein, the gene encoding said PxGSTD2 protein, a mutant of the first aspect, an isolated gene of the second aspect, an expression vector of the third aspect, or an expression cell of the fourth aspect in the following aspects:

[0015] a) Catalyze the conjugation of Fusarium toxins such as vomitoxin with reduced glutathione (GSH) in vitro;

[0016] b) Conferring tolerance to Fusarium toxins such as vomitoxin on target organisms;

[0017] c) Conferring tolerance or resistance to Fusarium-related diseases or other diseases to a target organism, wherein the target organism is a food crop;

[0018] d) Increase the yield or quality of the target organism, wherein the target organism is a food crop;

[0019] e) Catalyzing the conjugation of pesticides with reduced glutathione (GSH) in vitro or in non-target organisms; or

[0020] f) Improve the tolerance of non-target organisms to pesticides;

[0021] The PxGSTD2 protein therein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3.

[0022] The beneficial effects of the present invention are one or more of the following:

[0023] 1) By ligating the PxGSTD2 gene or its mutant gene provided by this invention into an expression vector and transforming it into an Escherichia coli expression strain, a PxGSTD2 protein or its mutant gene with good catalytic activity can be prepared.

[0024] 2) The PxGSTD2 protein and its mutants involved in this invention are new gene resources for breeding against Fusarium diseases such as Fusarium head blight. They can simultaneously improve the resistance of grain crops such as wheat, corn, and rice to Fusarium diseases and reduce Fusarium toxins in grain grains, thus safeguarding the improvement of grain yield and quality.

[0025] 3) The PxGSTD2 protein and its mutants provided by this invention can directly catalyze the conjugation of pesticides with different structures, such as oxadiazines, neonicotinoids, and pyrethroids, with GSH, thereby improving the water solubility of pesticides and forming adducts that are easily excreted from the body, thus reducing the biotoxicity of pesticides.

[0026] 4) Transforming the PxGSTD2 gene or its mutant gene provided by this invention into non-target organisms can significantly improve the tolerance of non-target organisms to pesticides; and

[0027] 5) Compared with wild-type PxGSTD2 protein, the PxGSTD2 mutant provided by this invention has superior performance in catalyzing the conjugation coupling of pesticides and GSH and improving the tolerance of non-target organisms to pesticides. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below. It will be apparent to those skilled in the art that the drawings described below are merely some specific embodiments of the present invention, and other embodiments can be obtained based on these drawings without any creative effort.

[0029] Figure 1. Neutral loss scanning chromatogram of PxGSTD2 protein and its mutant catalyzing the coupling of GSH with vomitoxin. In the figure, CK is the control group, representing the sample treated with PxGSTD2 protein or its mutant after 1 h of high-temperature inactivation.

[0030] Figure 2. Mass spectrum of neutral loss scanning characteristic peak (retention time 3.4 min) catalyzed by PxGSTD2 protein and its mutant in the coupling of GSH and vomitoxin. CK in the figure is the control group, representing the sample treated with PxGSTD2 protein or its mutant after 1 h of high-temperature inactivation.

[0031] Figure 3. Product ion scanning mass spectrum of the 604.1 m / z precursor ion of the conjugated product of GSH and vomitoxin catalyzed by PxGSTD2 protein.

[0032] Figure 4. Product ion scanning mass spectrum of the 604.1 m / z precursor ion of the GSH-vomitoxin conjugate catalyzed by mutant PxGSTD2F205A.

[0033] Figure 5. Product ion scanning mass spectrum of the 604.1 m / z precursor ion of the GSH-vomitoxin conjugate catalyzed by mutant PxGSTD2F205C.

[0034] Figure 6. Product ion scanning mass spectrum of the 604.1 m / z precursor ion of the GSH-vomitoxin conjugate catalyzed by mutant PxGSTD2F205H.

[0035] Figure 7. Product ion scanning mass spectrum of the 604.1 m / z precursor ion of the GSH-vomitoxin conjugate catalyzed by mutant PxGSTD2F205V.

[0036] Figure 8. Whole genome PCR detection of PxGSTD2 transgenic Drosophila melanogaster homozygous strain. In the figure, IN represents the inserted fragment, WT represents non-transgenic Drosophila, and M represents the DNA Marker.

[0037] Figure 9. Whole genome PCR detection of the PxGSTD2F205A transgenic Drosophila melanogaster strain. In the figure, KI represents the inserted fragment, WT represents the non-transgenic Drosophila, and M represents the DNA Marker.

[0038] Figure 10. Illustration of the construction process of PxGSTD2F205C wheat, from left to right: co-culture, restoration, screening, differentiation, seedling screening and rooting.

[0039] Figure 11. Comparison of ear disease symptoms between wild-type and PxGSTD2F205C transgenic wheat after Fusarium graminearum inoculation. Fielder represents wild-type wheat and PxGSTD2F205C represents PxGSTD2F205C transgenic wheat.

[0040] Figure 12. Comparison of mature grains of wild-type and PxGSTD2F205C transgenic wheat after inoculation with Fusarium graminearum on a single flower. Fielder represents wild-type wheat, and PxGSTD2F205C represents PxGSTD2F205C transgenic wheat.

[0041] Figure 13. Detection results of DON toxin content in wild-type wheat grains 21 days after inoculation with Fusarium graminearum.

[0042] Figure 14. Detection results of DON toxin content in wheat grains 21 days after inoculation with Fusarium graminearum using PxGSTD2F205C wheat.

[0043] Figure 15. Comparison of DON toxin content in grains of wild-type and PxGSTD2F205C transgenic wheat 21 days after inoculation with Fusarium graminearum. Fielder represents wild-type wheat, GSTD F205C represents PxGSTD2F205C transgenic wheat, and * indicates significant difference.

[0044] Figure 16. Detection of DON toxin content in mature grains of wild-type wheat after inoculation with Fusarium graminearum.

[0045] Figure 17. Detection results of DON toxin content in mature grains of PxGSTD2F205C wheat after inoculation with Fusarium graminearum.

[0046] Figure 18. Comparison of DON toxin content in mature grains of wild-type and PxGSTD2F205C transgenic wheat after inoculation with Fusarium graminearum. Fielder represents wild-type wheat, GSTD F205C represents PxGSTD2F205C transgenic wheat, and * indicates significant difference.

[0047] Figure 19. Neutral loss scanning chromatogram of PxGSTD2 protein catalyzing the conjugation of GSH with indoxacarb.

[0048] Figure 20. Mass spectrum of the characteristic peak of neutral loss scanning (retention time 7.5 min) catalyzed by PxGSTD2 protein in the conjugated coupling of GSH and indoxacarb.

[0049] Figure 21. Product ion scanning mass spectrum of the precursor ion of GSH and indoxacarb conjugated by PxGSTD2 protein.

[0050] Figure 22. Comparison of neutral loss scanning chromatograms of PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V catalyzing the conjugation of GSH with indoxacarb.

[0051] Figure 23. Neutral loss scanning characteristic peak (retention time 7.5 min) of PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V catalyzing the conjugation of GSH with indoxacarb.

[0052] Figure 24. Product ion scanning mass spectra of the 833.9 m / z precursor ion of the conjugated GSH and indoxacarb product catalyzed by PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V.

[0053] Figure 25. Neutral loss scanning chromatogram of PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V catalyzing the conjugation of GSH with lambda-cyhalothrin. In the figure, CK represents the control, which is the sample treated with PxGSTD2 or its mutant protein after high temperature inactivation for 1 h.

[0054] Figure 26. Mass spectra of neutral loss scanning characteristic peaks (retention time 6.9 min) of PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V catalyzing the conjugation of GSH with lambda-cyhalothrin. In the figure, CK represents the control, which is the sample treated with PxGSTD2 or its mutant protein after high temperature inactivation for 1 h.

[0055] Figure 27. Mass spectra of neutral loss scanning characteristic peaks (retention time 8.9 min) of PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V catalyzing the conjugation of GSH with lambda-cyhalothrin. In the figure, CK represents the control, which is the sample treated with PxGSTD2 or its mutant protein after high temperature inactivation for 1 h.

[0056] Figure 28. Product ion scanning mass spectra of the 515 m / z precursor ions of the conjugated GSH and lambda-cyhalothrin product catalyzed by PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V.

[0057] Figure 29. Product ion scanning mass spectra of the 757.5 m / z precursor ions of the conjugated GSH product of PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V catalyzed by PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V.

[0058] Figure 30. Neutral loss scanning characteristic peak (retention time 7.3 min) of PxGSTD2 protein and its mutant PxGSTD2F205A catalyzing the conjugation of GSH with fipronil. In the figure, CK represents the control, which is the sample treated with PxGSTD2 or PxGSTD2F205A after 1 h of high temperature inactivation.

[0059] Figure 31. Product ion scanning mass spectra of the 509.7 m / z precursor ion of the conjugated GSH and fipronil product catalyzed by PxGSTD2 protein and its mutant PxGSTD2F205A.

[0060] Figure 32. Neutral loss scanning characteristic peak (retention time 10.1 min) of PxGSTD2 protein and its mutant PxGSTD2F205A catalyzing the conjugation of GSH with acetamiprid. In the figure, CK represents the control, which is the sample treated with PxGSTD2 or PxGSTD2F205A after 1 h of high temperature inactivation.

[0061] Figure 33. Product ion scanning mass spectra of the 530.1 m / z precursor ion of the conjugated GSH and acetamiprid product catalyzed by PxGSTD2 protein and its mutant PxGSTD2F205A. Detailed Implementation

[0062] The present invention will be described in detail below. It should be understood that the following description is merely illustrative and is not intended to limit the scope of the invention; the scope of protection of the invention is defined by the appended claims. Furthermore, those skilled in the art will understand that modifications can be made to the technical solutions of the present invention without departing from its spirit and intent. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0063] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter pertains. Before a detailed description of the invention, the following definitions are provided to better understand it.

[0064] In the context of this invention, many embodiments use the expressions "comprising," "including," or "basically / mainly composed of...". The expressions "comprising," "including," or "basically / mainly composed of..." are generally understood as open-ended expressions, indicating that they include not only the elements, components, parts, or method steps specifically listed after the expression, but also other elements, components, parts, or method steps. Additionally, in this document, the expressions "comprising," "including," or "basically / mainly composed of..." can also be understood as closed-ended expressions in certain circumstances, indicating that they include only the elements, components, parts, or method steps specifically listed after the expression, and exclude any other elements, components, parts, or method steps. Furthermore, in the context of this invention, many embodiments use the expression "composed of...", which should be understood as a closed-ended expression, indicating that it includes only the elements, components, parts, or method steps specifically listed after the expression, and excludes any other elements, components, parts, or method steps.

[0065] As used herein and in the appended claims, unless the context clearly specifies otherwise, the indefinite articles (“a”, “an”) and definite articles (“the”) in the singular form include the plural referent. Similarly, the terms indefinite articles (“a”, “an”), “one or more”, and “at least one” are used interchangeably herein.

[0066] In this invention, amino acids are generally represented by single-letter or three-letter abbreviations known in the art. For example, alanine can be represented by Ala or A, glycine by Gly or G, valine by Val or V, leucine by Leu or L, isoleucine by Ile or I, proline by Pro or P, phenylalanine by Phe or F, tyrosine by Tyr or Y, tryptophan by Trp or W, serine by Ser or S, threonine by Thr or T, cysteine ​​by Cys or C, methionine by Met or M, asparagine by Asn or N, glutamine by Gln or Q, aspartic acid by Asp or D, glutamic acid by Glu or E, lysine by Lys or K, arginine by Arg or R, and histidine by His or H.

[0067] Similarly, in this invention, nucleotides or bases are represented by single-letter abbreviations, for example, adenine is represented by A, guanine by G, cytosine by C, and thymine by T.

[0068] The PxGSTD2 protein is a typical Delta-type insect glutathione S-transferase (GST) from the diamondback moth. The inventors first discovered that the PxGSTD2 protein can directly catalyze the conjugation of various types of pesticides, including oxadiazons, neonicotinoids, and pyrethroids, with GST, forming adducts with increased water solubility, reduced toxicity, and easier excretion from the organism, thereby reducing pesticide biotoxicity and achieving pesticide detoxification and metabolism. Building on this, the inventors conducted repeated studies and further discovered that the PxGSTD2 protein also exhibits good catalytic activity towards the conjugation of Fusarium toxins, such as vomitoxin, with GST, forming adducts with increased water solubility, reduced toxicity, and easier excretion from the organism.

[0069] Furthermore, the PxGSTD2 protein has two main functional regions: a G site (the GSH binding site) and an H site (the substrate binding site). The 205th residue (phenylalanine, F) in the PxGSTD2 protein amino acid sequence (SEQ ID NO.3) is located at the H site. The inventors discovered that this amino acid residue might have modification potential, and therefore performed site-directed mutagenesis at this site. The results showed that after site-directed mutagenesis, this site retained the activity of the PxGSTD2 protein in catalyzing the conjugation of pesticides or fusarium toxins with GSH, and in some aspects, the activity was even higher. Thus, this invention was completed.

[0070] Therefore, in a first aspect, the present invention provides a PxGSTD2 protein mutant, wherein the PxGSTD2 protein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3, and the mutant contains a mutation (F205) in phenylalanine (F) at residue 205 of the amino acid sequence shown in SEQ ID NO.3.

[0071] The term "precursor protein" refers to the precursor molecule of a mature protein; in this article, it refers to a protein with a signal peptide at its N-terminus. The term "signal peptide" refers to a short peptide segment that guides the translocation of newly synthesized proteins into the secretory pathway; it is typically cleaved by a signal peptidase after guiding the protein to a specific site.

[0072] In a preferred embodiment, the signal peptide has an amino acid sequence as shown in SEQ ID NO.53.

[0073] In one embodiment, the mutant may be a mutant containing only the F205 mutation of the amino acid sequence shown in SEQ ID NO.3.

[0074] It is understood that, in addition to the aforementioned F205 mutation, the mutant may also contain other mutations that do not affect the function of the PxGSTD2 protein, such as the insertion, deletion, and / or substitution of one or more amino acids. In this document, the term "PxGSTD2 protein function" refers at least to the function of the PxGSTD2 protein in catalyzing the conjugation of various types of pesticides or Fusarium toxins with GSH to form adducts with increased water solubility, reduced toxicity, and easier excretion from the organism.

[0075] Therefore, the mutant can be a mutant that has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity with the PxGSTD2 protein and retains the function of the PxGSTD2 protein.

[0076] Regarding the choice of mutation direction, the inventors chose to mutate the 205th residue phenylalanine (F) into alanine (A), valine (V), histidine (H), cysteine ​​(C), leucine (L), glycine (G), isoleucine (I), proline (P), and threonine (T).

[0077] Therefore, in one embodiment, the mutant comprises any one of the mutations F205A, F205V, F205H, F205C, F205L, F205G, F205I, F205P, and F205T. In this document, for example, the expression "F205A" may refer to either a mutation from phenylalanine (F) to alanine (A) at position 205, or it may refer to a mutant protein containing this mutation, depending on the context.

[0078] In a preferred embodiment, the mutant comprises any one of the mutants F205A, F205V, F205H, F205C, and F205L.

[0079] In a more preferred embodiment, the mutant comprises mutant F205A or F205C.

[0080] In one embodiment, the mutant has any amino acid sequence as shown in SEQ ID NO. 8, 9, 14, 15, 18, 19, 22, 23, 28, 29, 34, 35, 39, 40, 45, 46, 51 or 52.

[0081] In a preferred embodiment, the mutant has any of the amino acid sequences shown in SEQ ID NO. 8, 9, 14, 15, 18, 19, 22, 23, 28 or 29.

[0082] In a more preferred embodiment, the mutant has an amino acid sequence as shown in SEQ ID NO. 8, 9, 22 or 23.

[0083] In a second aspect, the present invention provides an isolated gene that encodes a mutant of the first aspect.

[0084] In one embodiment, the isolated gene has a nucleic acid sequence or a degenerate sequence thereof as shown in any one of SEQ ID NOs.4-7, 10-13, 16-17, 20-21, 24-27, 30-33, 36-38, 41-44 and 47-50.

[0085] As used herein, the term “degenerate sequence” refers to the phenomenon that the same amino acid is encoded by two or more codons, which includes all possible sequences of different base sequences encoding a single amino acid.

[0086] In a third aspect, the present invention provides an expression vector comprising the isolated gene from the second aspect.

[0087] In one implementation, the expression vector is a plasmid.

[0088] In a preferred embodiment, the expression vector is a pET vector such as pET-30a, a pBAD vector such as pBAD / HisC, a pGEX vector such as pGEX-6P-1, a pUAST vector, an Agrobacterium vector, a YIP vector, a YEp vector, a YCp vector, a pPIC series vector such as pPICZαA, a pGAP series vector such as pGAPZB, a pcDNA series vector such as pcDNA3.1, a pSV series vector, a baculovirus vector, a retroviral vector, a lentiviral vector, or an adenovirus vector.

[0089] In a fourth aspect, the present invention provides an expression cell comprising the isolated gene of the second aspect or the expression vector of the third aspect.

[0090] In one embodiment, the expressing cells are prokaryotic cells such as Escherichia coli cells, Bacillus cells, and Streptomyces cells.

[0091] In one embodiment, the expressing cells are Escherichia coli DE3 competent cells.

[0092] In one embodiment, the expressing cell is a eukaryotic cell, such as an animal cell, plant cell, or yeast cell; the animal cell includes cells from bees, earthworms, spiders, fruit flies, fall armyworms, white armyworms, silkworms, clawed frogs, Chinese hamsters, small hamsters, mice, humans, etc.; the plant cell includes cells from Arabidopsis thaliana, wheat, corn, rice, oats, and barley.

[0093] In a fifth aspect, the present invention provides the use of the PxGSTD2 protein, the gene encoding said PxGSTD2 protein, a mutant of the first aspect, an isolated gene of the second aspect, an expression vector of the third aspect, or an expression cell of the fourth aspect in the following aspects:

[0094] a) Catalyze the conjugation of Fusarium toxins such as vomitoxin with reduced glutathione (GSH) in vitro;

[0095] b) Conferring tolerance to Fusarium toxins such as vomitoxin on target organisms;

[0096] c) Conferring tolerance or resistance to Fusarium-related diseases or other diseases to a target organism, wherein the target organism is a food crop;

[0097] d) Increase the yield or quality of the target organism, wherein the target organism is a food crop;

[0098] e) Catalyzing the conjugation of pesticides with reduced glutathione (GSH) in vitro or in non-target organisms; or

[0099] f) Improve the tolerance of non-target organisms to pesticides;

[0100] The PxGSTD2 protein therein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3.

[0101] In this paper, the expression "conferring tolerance to Fusarium toxins such as vomitoxin" refers to the PxGSTD2 protein or its mutants catalyzing the conjugation of Fusarium toxins with reduced glutathione (GSH) to form adducts with increased water solubility, reduced toxicity, and easy excretion from the organism, thereby conferring tolerance to Fusarium toxins on the target organism.

[0102] In this paper, the expression "conferring tolerance or resistance to Fusarium-related diseases on target organisms" refers to the PxGSTD2 protein or its mutants catalyzing the conjugation of Fusarium toxins with reduced glutathione (GSH) to form adducts with increased water solubility, reduced toxicity, and easy excretion from the organism, thereby conferring tolerance or resistance to Fusarium-related diseases on target organisms.

[0103] In this paper, the expression "conferring tolerance or resistance to other diseases on a target organism" refers to enhancing the organism's stress resistance by overexpressing the PxGSTD2 protein or its mutant in plants, thereby conferring tolerance or resistance to other diseases on the target organism.

[0104] In one embodiment, the signal peptide has an amino acid sequence as shown in SEQ ID NO.53.

[0105] Furthermore, the inventors expressed the PxGSTD2 protein or its mutants in target organisms to reduce the content of Fusarium toxins such as vomitoxin within the target organisms, thereby conferring tolerance to Fusarium toxins such as vomitoxin. When the target organism is a plant, it can also confer tolerance or resistance to Fusarium-related diseases such as Fusarium head blight, stem base rot, stem rot, ear rot, and bakanae disease.

[0106] In this invention, the non-target organism refers to the organisms covered in the series of standards (NY / T2882.1~NY / T2882.7) of the "Guidelines for Environmental Risk Assessment of Pesticide Registration" issued by the Ministry of Agriculture of the People's Republic of China. Transferring the wild-type or mutant PxGSTD2 gene involved in this invention into non-target organisms can significantly improve their tolerance to pesticides.

[0107] In one implementation, the non-target organisms include: all arthropod species that are not pests, such as bees, silkworms, parasitic wasps, ladybugs, spiders, predatory mites, etc.; birds such as small grain-eating birds, small insectivorous birds, large herbivorous birds, small omnivorous birds, etc.; soil organisms such as earthworms, etc.; and aquatic organisms such as fish, daphnia, algae, predatory amphibians, large crustaceans, etc.

[0108] In this article, pesticides refer to a chemically synthesized substance or a mixture of several substances and their preparations used to prevent and control diseases, insects, weeds, rodents and other harmful organisms that harm agriculture and forestry, as well as to purposefully regulate the growth of plants and insects. More specifically, pesticides can refer to the following categories: (i) prevention and control of diseases, insects (including insects, ticks, mites), weeds, rodents, mollusks and other harmful organisms that harm agriculture and forestry; (ii) prevention and control of diseases, insects, rodents and other harmful organisms in storage and processing sites; (iii) regulation of plant and insect growth; (iv) preservation or freshness of agricultural and forestry products; (v) prevention and control of mosquitoes, flies, cockroaches, rodents and other harmful organisms; and (vi) prevention and control of harmful organisms that harm river embankments, railways, docks, airports, buildings and other places.

[0109] In one embodiment, the pesticide includes insecticides, acaricides, herbicides, fungicides, and nematicides.

[0110] In this article, insecticides refer to pesticides used to control harmful insects in the living environment of humans or animals and in the natural environment. They can be classified into categories (i), (ii), (v), and (vi) of pesticides mentioned in the previous paragraph. Insecticides are diverse and can be classified according to their source into inorganic and mineral insecticides such as lead arsenate, calcium arsenate, sodium fluorosilicate, and mineral oil emulsions; plant-based insecticides such as pyrethroids, rotenone, and nicotine; organic synthetic insecticides such as organochlorines, organophosphates, and pyrethroids; and insect hormone insecticides such as juvenile hormones and sex pheromone analogs.

[0111] In this article, acaricides refer to chemical substances used to control harmful species of arachnids, such as mites and their eggs.

[0112] In this article, herbicides refer to chemical substances used to control weeds in farmland.

[0113] In this article, fungicides refer to chemical substances used to control plant pathogenic microorganisms.

[0114] In this article, nematicides refer to chemical substances used to control plant pathogenic nematodes.

[0115] In a preferred embodiment, the pesticide is an insecticide or an acaricide.

[0116] In a more preferred embodiment, the pesticide is an insecticide selected from one or more of oxadiazine, neonicotinoid, and pyrethroid insecticides.

[0117] In a more preferred embodiment, the oxadiazine insecticide is indoxacarb, the pyrethroid insecticide is lambda-cyhalothrin, and the neonicotinoid insecticide is dinotefuran and acetamiprid.

[0118] In one embodiment, the use is achieved by using genetic engineering techniques to express the PxGSTD2 protein or a mutant of the first aspect in the target organism or the non-target organism.

[0119] In one embodiment, the genetic engineering method includes transferring an expression vector or a third-party expression vector containing a gene encoding the PxGSTD2 protein into the cells of the target organism or the non-target organism, and stably expressing these genes in the target organism or the non-target organism. Conventional techniques in the art can be used to insert the gene into a plasmid, and then transfer the expression plasmid into the target organism or the non-target organism to stably express the PxGSTD2 protein or its mutants in the target organism or the non-target organism, thereby catalyzing the conjugation of pesticides or fusarium toxins such as vomitoxin with GSH.

[0120] In one implementation, the target organism includes plants, animals, or microorganisms.

[0121] In one embodiment, the target organism is a plant, such as Arabidopsis thaliana, food crops such as wheat, maize, rice, oats, barley, or other crops. Therefore, in some aspects, by overexpressing the PxGSTD2 protein or a mutant thereof in plants, it is possible to catalyze the conjugation of Fusarium toxins such as vomitoxin with GSH within the plant, thereby reducing the content of Fusarium toxins such as vomitoxin in the plant, enhancing the plant's tolerance or resistance to Fusarium-related diseases or other diseases, and improving crop yield or crop quality.

[0122] In one implementation, the Fusarium-related diseases are plant diseases caused by infection with Fusarium pathogens.

[0123] In one implementation, the other diseases include stripe rust or rice blast.

[0124] In a preferred embodiment, the Fusarium-related diseases include Fusarium head blight, stem base rot, stem rot, seedling blight, ear rot, or damping-off.

[0125] In a more preferred embodiment, the Fusarium includes Fusarium graminearum, Fusarium pseudograminearum, Fusarium verticillatum, Fusarium pseudoverticillatum, Fusarium lamellae, or Fusarium moniliforme.

[0126] In one implementation, the target organism is an animal, such as an insect like a fruit fly, poultry, or livestock, to prevent the accumulation of Fusarium toxins, such as vomitoxin, in the ecosystem.

[0127] In one implementation, the target organism is a microorganism such as gut microbiota. Adding genetically modified gut microbiota to animal feed helps ensure the safety of livestock and poultry products and reduce the harm of Fusarium toxins such as vomitoxin to livestock, poultry and humans.

[0128] In a sixth aspect, the present invention also provides a method for conferring tolerance to Fusarium toxins such as vomitoxin on a target organism, comprising the step of expressing wild-type PxGSTD2 protein or a mutant of the first aspect in the target organism by means of genetic engineering.

[0129] In a seventh aspect, the present invention also provides a method for conferring tolerance or resistance to Fusarium-related diseases or other diseases on a target organism, comprising the step of expressing wild-type PxGSTD2 protein or a mutant of the first aspect in the target organism by genetic engineering means, wherein the target organism is a food crop.

[0130] In an eighth aspect, the present invention also provides a method for increasing the yield or quality of a target organism, comprising the step of expressing wild-type PxGSTD2 protein or a mutant of the first aspect in the target organism by means of genetic engineering, wherein the target organism is a food crop.

[0131] In a ninth aspect, the present invention also provides a method for improving the pesticide tolerance of non-target organisms, comprising a method for expressing wild-type PxGSTD2 protein or a mutant of the first aspect in the non-target organisms by means of genetic engineering.

[0132] In a tenth aspect, the present invention also provides a plant cell comprising a gene encoding a PxGSTD2 protein, a gene isolated in the second aspect, an expression vector comprising a gene encoding a PxGSTD2 protein, or an expression vector in the third aspect, wherein the PxGSTD2 protein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3.

[0133] In an eleventh aspect, the present invention also provides a plant tissue comprising a gene encoding a PxGSTD2 protein, a second aspect of isolated genes, an expression vector comprising a gene encoding a PxGSTD2 protein, a third aspect of expression vector, an expression cell comprising a gene encoding a PxGSTD2 protein, or a fourth aspect of expression cell, wherein the PxGSTD2 protein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3.

[0134] In some implementations, the plant tissue includes the roots, stems, leaves, flowers, fruits, or seeds of a plant.

[0135] In a twelfth aspect, the present invention also provides a transgenic plant comprising a gene encoding a PxGSTD2 protein, a second aspect of the isolated gene, an expression vector comprising a gene encoding a PxGSTD2 protein, a third aspect of the expression vector, an expression cell comprising a gene encoding a PxGSTD2 protein, or a fourth aspect of the expression cell, wherein the PxGSTD2 protein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3.

[0136] It is understood that, since the transgenic plant has a gene encoding the PxGSTD2 protein or the mutant of the first aspect with an amino acid sequence as shown in SEQ ID NO.3, the transgenic plant can express the PxGSTD2 protein or the mutant of the first aspect, thereby avoiding the damage caused by pesticide application, Fusarium toxins such as vomitoxin, or Fusarium-related diseases or other diseases.

[0137] In one implementation, the plant is a crop, such as wheat, corn, rice, oats, or barley.

[0138] It is understood that the plant cells of aspect ten and the plant tissues of aspect eleven of the present invention can develop into complete plants under suitable conditions. Furthermore, whether the plants are derived from plant cells or plant tissues or are transgenic plants, because they possess the gene encoding the PxGSTD2 protein with the amino acid sequence shown in SEQ ID NO.3 or a mutant of the first aspect, they can express the PxGSTD2 protein or its mutants, thereby exhibiting tolerance or resistance to Fusarium-related diseases or other diseases.

[0139] In a thirteenth aspect, the present invention also provides a transgenic animal comprising a gene encoding a PxGSTD2 protein, a second aspect of isolated genes, an expression vector comprising a gene encoding a PxGSTD2 protein, a third aspect of expression vector, an expression cell comprising a gene encoding a PxGSTD2 protein, or a fourth aspect of expression cell.

[0140] It is understandable that, since the transgenic animal has a gene encoding the PxGSTD2 protein or the mutant of the first aspect with an amino acid sequence as shown in SEQ ID NO.3, the transgenic animal can express the PxGSTD2 protein or the mutant of the first aspect, thereby avoiding the harm caused by pesticide application.

[0141] In one implementation, the transgenic animal is any non-pest arthropod species that has been genetically engineered, such as transgenic bees, silkworms, parasitic wasps, ladybugs, spiders, predatory mites, etc.; transgenic birds such as transgenic small grain-eating birds, small insectivorous birds, large herbivorous birds, small omnivorous birds, etc.; transgenic soil organisms such as transgenic earthworms, etc.; and transgenic aquatic organisms such as transgenic fish, daphnia, algae, predatory amphibians, large crustaceans, etc.

[0142] It should be noted that the relevant descriptions in aspects one through five of this invention also apply to aspects six through thirteen. Therefore, for the sake of brevity, they will not be repeated here.

[0143] Example

[0144] The embodiments of the present invention will be described in detail below with reference to examples. Those skilled in the art will understand that the following examples are merely illustrative and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the examples, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0145] Example 1: Cloning of the PxGSTD2 gene and preparation of the protein

[0146] Experimental Methods: Total RNA was extracted from third-instar larvae of the diamondback moth and cDNA was prepared using reverse transcription. Then, using the prepared diamondback moth cDNA as a template, the ORF sequence of the PxGSTD2 gene was cloned using PCR and confirmed by sequencing. The cloned PxGSTD2 gene was ligated into the pET-30a(+) vector, transformed into E. coli DE3 competent cells, and prokaryotic expression of PxGSTD2 was induced by low temperature. The prokaryotically expressed PxGSTD2 protein was purified using affinity chromatography. The original sequence of the PxGSTD2 gene is shown in SEQ ID NO.1, the amino acid sequence encoded by the ORF of the PxGSTD2 gene is shown in SEQ ID NO.2, and the amino acid sequence of the mature PxGSTD2 protein after removing the signal peptide is shown in SEQ ID NO.3.

[0147] Results: The PxGSTD2 gene sequence was successfully cloned using reverse transcription and PCR techniques, and the recombinant PxGSTD2 protein was prepared using prokaryotic expression and affinity chromatography.

[0148] Example 2: Preparation of PxGSTD2 protein mutant

[0149] Experimental Methods: PxGSTD2 protein mutants were prepared by site-directed mutagenesis, where residue 205 (phenylalanine, F) was sequentially mutated to alanine (A), valine (V), histidine (H), cysteine ​​(C), leucine (L), glycine (G), isoleucine (I), proline (P), and threonine (T). The mutants were then prepared using the method described in Example 1. The gene sequences, ORF-encoded amino acid sequences, and corresponding amino acid sequences of the mature protein (with signal peptide removed) of the multiple mutants obtained through site-directed mutagenesis are shown in SEQ ID NOs. 4-52.

[0150] Results: Mutant PxGSTD2 genes, including PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205C, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, and PxGSTD2F205T, were successfully obtained using site-directed mutagenesis. The corresponding PxGSTD2 protein mutants were then prepared using prokaryotic expression and affinity chromatography techniques.

[0151] Example 3: Catalytic activity of PxGSTD2 protein and its mutants on the conjugated coupling of vomitoxin and GSH.

[0152] Experimental Methods: 4 mM glutathione (GSH), 100 μM vomitoxin, and 2 U of recombinant PxGSTD2 protein were mixed and dissolved in PBS buffer (10 mM, pH 7.2) to a total volume of 500 μL, and incubated at 30 °C for 1 h. The control group was treated with an equal volume of inactivated protein instead of PxGSTD2 protein, also for 1 h. Then, an equal volume of acetonitrile (HPLC grade) was added, and the reaction was terminated by incubation at 4 °C for 1 h. The experiment was independently repeated three times. Samples were centrifuged at 4 °C and 10,000 rpm for 15 min using a low-temperature centrifuge. The precipitate was discarded, and the supernatant was filtered through a 0.22 μm organic nylon membrane before being transferred to sample vials.

[0153] The product obtained by the conjugation of PxGSTD2 recombinant protein with vomitoxin and GSH was detected using an AB Sciex Qtrap 5500 triple quadrupole liquid chromatography-mass spectrometry system (AB, USA). Gradient elution was performed with 0.1% formic acid aqueous solution and acetonitrile according to the program in Table 1, with a total elution time of 18 min and a flow rate of 0.2 mL / min. The ionization source was positive electrode electrospray (ES), with a collision energy of 30 eV. The detection mode was neutral loss scanning, with a loss fragment size of 129 amu and a scan range of 300–630 m / z. The precursor ions obtained from the neutral loss scanning were then scanned for product ions at a collision energy of 25 eV, with a scan range of 100–606 m / z.

[0154] Table 1. LC-HRMS ( / MS) elution program

[0155] Results: Neutral loss scanning chromatograms showed that, compared with the control group (CK), the PxGSTD2-treated sample exhibited a significant peak accumulation at 3.4 min (Figure 1). Mass spectrometry analysis revealed that the characteristic peak at 3.4 min contained a precursor ion of 604.1 m / z (Figure 2). Subsequently, we performed product ion scanning on the 604.1 m / z precursor ion to obtain its structural information. The product ion mass spectrum showed that the 604.1 m / z precursor ion produced daughter ions of 474.2 m / z and 456.2 m / z, indicating that this precursor ion had neutral losses of 129 amu (pyroglutamic acid) and 147 amu (ammoniated pyroglutamic acid), consistent with the neutral fragment loss characteristics of GSH adducts (Figure 3). This result indicates that the 604.1 m / z precursor ion is an adduct of GSH and vomitoxin.

[0156] The catalytic activity of four randomly selected PxGSTD2 protein mutants (PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205H, and PxGSTD2F205V) on the conjugated coupling of vomitoxin and GSH was detected using the same method. The neutral loss scanning chromatogram results are shown in Figure 1. All samples treated with the mutants PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205H, and PxGSTD2F205V showed significant peak accumulation at 3.4 min. Among them, the peak area of ​​the characteristic peak in the PxGSTD2F205C-treated sample increased the most, followed by PxGSTD2F205A; the peak areas of both were significantly higher than those of the wild-type PxGSTD2 protein. The peak area increases in the samples treated with the other two mutants, PxGSTD2F205H and PxGSTD2F205V, were basically consistent with those of the wild-type PxGSTD2 protein. Further mass spectrometry analysis showed that the characteristic peak at 3.4 min contained a precursor ion of 604.1 m / z, and the relative abundance of this precursor ion in the samples treated with wild-type PxGSTD2 protein and its mutants PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205H, and PxGSTD2F205V also corresponded to the peak area changes observed in neutral loss scans (Figure 2). Product ion scanning of the 604.1 m / z precursor ion revealed that it produced daughter ions at 474.2 m / z and 456.2 m / z, indicating that the precursor ion exhibited neutral losses of 129 amu (pyroglutamic acid) and 147 amu (ammoniated pyroglutamic acid), consistent with the neutral fragment loss characteristics of GSH adducts (Figures 4-7).

[0157] Conclusion: The PxGSTD2 protein and its mutants PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205H, and PxGSTD2F205V involved in this invention can all directly catalyze the conjugation of vomitoxin and GSH. Among them, the mutants PxGSTD2F205C and PxGSTD2F205A exhibit superior catalytic activity for the conjugation of vomitoxin and GSH compared to the wild-type PxGSTD2 protein. Based on the function of the GST Fhb7, we hypothesize that transferring PxGSTD2 or its mutant genes into grain crops such as wheat and rice can enhance the crops' resistance to various Fusarium diseases, including Fusarium head blight and stem rot.

[0158] Example 4: Construction of transgenic Drosophila melanogaster

[0159] Experimental Methods: The target gene PxGSTD2 was cloned into the Not I / Xba I site of the pJFRC28-10XUAS-IVS-GFP-p10 vector (Addgene, USA), and then transformed into DH5α competent cells (Transgen, China). After confirmation by PCR and sequencing, the plasmid was extracted to obtain the recombinant plasmid UAS-PxGSTD2 containing the target gene fragment. The extracted recombinant plasmid was diluted to 500 ng / μL with ddH2O, and then 30 μL of the sample was used for microinjection.

[0160] The Drosophila strain attP40 (Fungene, China) was reared on a large scale. Adult Drosophila were collected using collection cages, with 400 adults per cage, and their eggs were laid on agar coated with yeast. Fresh eggs collected within 60 minutes were rinsed onto coverslips. Embryos were arranged neatly on coverslips, tails facing outwards. Transgenic plasmids were injected under an Olympus CKX3-SLP microscope (Olympus, Japan) using an Eppendorf FemtoJet4i injector (Eppendorf, Germany), injecting a total of 200 embryos. The injected eggs were then inserted into the feed and placed in an artificial temperature and humidity incubator. They were reared to adulthood at 25°C, 60%-70% relative humidity, and a light-dark ratio of 12:12, and this generation was designated P0.

[0161] P0 adults were hybridized with wild-type fruit flies w1118, with two P0 adults per hybridization tube, and cultured in an incubator at 25℃. Red-eyed positive fruit flies were selected from the F1 generation adults, and each was individually hybridized with a Bc / CyO fruit fly. After successful hybridization, molecular identification was performed on the F2 generation red-eyed fruit flies, confirming that UAS-PxGSTD2 had been inserted into the fruit fly chromosome. Red-eyed / CyO phenotyped male and female fruit flies were selected from the F2 generation adults and self-crossed to create stable genetic lines and homozygous lines.

[0162] Male UAS transgenic fruit flies constructed in the previous step were crossed with Sp / CyO;TM2 / TM6B virgin fruit flies. From the offspring, the desired genotype (UAS-PxGSTD2 / CyO;+ / TM6B) was selected and crossed with laboratory-preserved Sp / CyO;tub-gal14,tub-gal80ts fruit flies. After the offspring emerged, based on the red-eyed phenotype, the desired UAS-PxGSTD2 / CyO;tub-gal4,tub-gal80ts / TM6B red-eyed fruit flies were selected for self-pollination to construct stable lines. Further, by removing the balancer through self-pollination, a temperature-controlled overexpression homozygous UAS-PxGSTD2 transgenic line was constructed: UAS-PxGSTD2;tub-gal4,tub-gal80ts. The genome of Drosophila was extracted and confirmed by PCR using HSP-F (AAGTAACCAGCAACCAAGTA(SEQ ID NO.54)) and P10-R (GCCACTAGCTCGCTATACACT(SEQ ID NO.55)) as upstream and downstream primers.

[0163] Using the same method, genes such as PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205C, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, or PxGSTD2F205T were transferred into Drosophila to construct a temperature-controlled transgenic homozygous strain that overexpresses the PxGSTD2 mutant.

[0164] Results: PCR results of the whole genome of *Drosophila melanogaster* transgenic with the PxGSTD2 and PxGSTD2F205A genes both showed a band of approximately 1100 bp, which matched the size of the inserted fragment (results are shown in Figures 8 and 9). Further sequencing results showed that the gene sequence corresponding to this band was completely identical to the inserted fragment sequence.

[0165] Conclusion: A transgenic temperature-controlled overexpression homozygous Drosophila strain stably expressing PxGSTD2 protein or its mutants was successfully constructed, demonstrating the feasibility of transferring the PxGSTD2 gene or its mutants derived from the diamondback moth into other species. Therefore, theoretically, it is also feasible to use the PxGSTD2 gene or its mutants in non-target organisms such as bees and silkworms, or in transgenic breeding of grain crops such as wheat, rice, and corn.

[0166] Example 5: Construction of wheat transgenic with PxGSTD2 or its mutant gene

[0167] Experimental Methods: Ti plasmids containing the target gene PxGSTD2 or its mutants were transformed into EHA105 Agrobacterium competent cells using electroporation and cultured in LB medium with shaking for 30 min (30℃, 180 min). The activated Agrobacterium culture was then inoculated onto LB solid medium and incubated in the dark at 30℃ for 48 h. Single colonies were picked, and PCR was used to detect whether the target gene had been successfully transformed into Agrobacterium.

[0168] Fielder wheat seedlings that had undergone vernalization were transplanted into planting pots and placed in a plant growth chamber. 10-14 days after the wheat spikelets flowered, immature wheat grains were collected, sterilized with mercuric chloride, and the embryos were extracted using a scalpel to serve as explants. Activated Agrobacterium carrying the target gene plasmid was added to the infection solution, and the absorbance of the bacterial solution was adjusted to 0.1-0.2 using a spectrophotometer.

[0169] The immature embryos were inoculated with the prepared bacterial solution. The infection solution was discarded and the explants were dried. The explants were then placed on a co-culture medium and cultured at 25°C in the dark for 3 days. After co-culture, the explants were placed on a selection medium to induce resistant callus. Explants with resistant callus were selected and placed on a new selection medium, with the medium changed every 15-20 days. Resistant callus was then selected and placed on a new differentiation medium, with the medium changed every 15-20 days. During differentiation, when the seedlings reached 2-3 cm in length, they were placed on a rooting medium with the corresponding resistance for 10-15 days to root. Finally, the genome was extracted using the CTAB method for PCR detection. Positive seedlings were selected as transgenic wheat.

[0170] Results: Figure 10 illustrates the construction process of transgenic wheat line PxGSTD2F205C. PCR analysis revealed a band of approximately 1100 bp in the whole genome of the transgenic wheat line PxGSTD2F205C, which matched the size of the inserted fragment. Further sequencing results showed that the gene sequence corresponding to this band was completely identical to the inserted fragment sequence. These results demonstrate that this invention successfully constructed a homozygous transgenic wheat line containing the PxGSTD2F205C gene. Similarly, the coding gene for the wild-type PxGSTD2 protein or its mutants was also successfully transferred into wheat and effectively expressed.

[0171] Example 6: Construction of maize transgenic PxGSTD2 or its mutant gene

[0172] Experimental methods: Using maize as the target transgenic organism, maize transgenic PxGTSD2 or its mutants (e.g., PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P or PxGSTD2F205T, etc.) were constructed using methods similar to those in Example 5.

[0173] Example 7: Construction of rice transgenic PxGSTD2 or its mutant gene

[0174] Experimental methods: Rice was used as the target transgenic organism, and transgenic rice with the PxGTSD2 gene or its mutants (such as PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P or PxGSTD2F205T, etc.) was constructed using a method similar to that in Example 5.

[0175] Example 8: Detection of resistance to Fusarium head blight in PxGSTD2F205C transgenic wheat

[0176] Experimental Methods: The resistance of PxGSTD2F205C transgenic wheat to Fusarium head blight was evaluated using a single-flower inoculation method. At inoculation, the concentration of Fusarium graminearum spores was adjusted to 1×10⁻⁶. 5 The inoculation rate was 10 μL per floret. The florets were bagged for 72 h after inoculation, and the number of diseased spikelets was assessed 21 days later. Wild-type wheat was treated with the same Fusarium graminearum inoculation as a control.

[0177] Results: The experimental results showed that the PxGSTD2F205C wheat line exhibited significant resistance to Fusarium graminearum. As shown in Figure 11, after single-flower injection inoculation, the spikelet disease symptoms of the transgenic line were significantly reduced, with the infection limited to the inoculated spikelet and only slightly infected rachis; while the control non-transgenic plants (Fielder variety) showed severe infection around the inoculated spikelet rachis. Furthermore, as shown in Figure 12, the transgenic wheat grains remained plump and healthy after infection, while the grains of the control Fielder variety appeared shriveled or even blackened.

[0178] Conclusion: The PxGSTD2F205C wheat line can effectively inhibit the spread and damage of Fusarium graminearum, and significantly reduce the impact of the disease on the ears and grains.

[0179] Example 9: Detection of resistance to stem rot in wheat transgenic PxGSTD2 or its mutant genes.

[0180] Experimental method: Select plump wheat seeds of uniform size, disinfect them with 75% alcohol and rinse them with sterile water, then germinate them in petri dishes at 25℃ for 2-3 days. When the seeds have sprouted to about 5mm, soak them in a suspension of spores of Fusarium pseudograminearum, the pathogen of wheat stem rot, for 1 minute, and then transplant them into seedling trays containing sand. Twenty individual plants were inoculated into each type of wheat (wild-type wheat, PxGSTD2 transgenic wheat, and wheat with PxGSTD2 mutant genes (e.g., PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, or PxGSTD2F205T, etc.) and cultured in a greenhouse under natural light. When the control group showed severe disease, the disease incidence of each type of wheat was investigated.

[0181] The inventors anticipate that by introducing a gene encoding wild-type or mutant PxGSTD2 into wheat seeds, wheat will express wild-type or mutant PxGSTD2 protein during its growth. This PxGSTD2 protein will catalyze the conjugation of Fusarium toxins such as vomitoxin with reduced glutathione (GSH), thereby increasing the water solubility of Fusarium toxins, reducing their toxicity, and forming adducts that are easily excreted by the organism, thus endowing wheat with the ability to resist stem rot.

[0182] Example 10: Detection of resistance to stripe rust in wheat transgenic PxGSTD2 or its mutant genes

[0183] Experimental Method: An appropriate amount of stripe rust fungus (Puccinia striiformis f.sp. tritici) spores were added to a 0.05% Tween solution and mixed thoroughly to prepare a spore suspension. At the three-leaf stage of wheat (wild-type wheat, PxGSTD2 transgenic wheat, and PxGSTD2 mutant gene transgenic wheat (e.g., PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, or PxGSTD2F205T, etc.), the spore suspension was evenly sprayed onto the surface of individual leaves and treated in the dark for 12 hours at 21℃ and 100% relative humidity. Afterward, the inoculated seedlings were transferred to an environment with a temperature of 25℃, relative humidity of 70%, and light-dark ratio of 12h:12h for 14 days, and the leaf disease incidence was recorded.

[0184] The inventors anticipate that by introducing a gene encoding wild-type or mutant PxGSTD2 into wheat, the wheat will overexpress the wild-type or mutant PxGSTD2 protein during its growth. Since GST overexpression enhances an organism's stress resistance, wheat with the wild-type or mutant PxGSTD2 gene may acquire resistance to stripe rust.

[0185] Example 11: Effect of PxGSTD2F205C gene transfection on Fusarium toxin content in wheat grains

[0186] Experimental Methods: During the wheat flowering stage, transgenic PxGSTD2F205C wheat was inoculated with Fusarium graminearum using a single-flower inoculation method, as described in Example 8. Spikeletons were collected 21 days after inoculation, and mature grains were collected several days after inoculation. The samples were flash-frozen in liquid nitrogen and ground into powder. The vomitoxin content in each sample was detected using an AB Sciex Qtrap 5500 triple quadrupole liquid chromatography-mass spectrometry system (AB, USA). Wild-type wheat (Fielder variety) was treated with the same Fusarium graminearum inoculation as a control.

[0187] Results: The DON toxin content in wild-type wheat and PxGSTD2F205C transgenic wheat grains was detected and statistically analyzed using liquid chromatography-mass spectrometry.

[0188] Figures 13 and 14 show the detection results of DON toxin in the seeds of the two groups 21 days after inoculation. Statistical analysis (Figure 15) shows that the accumulation of DON toxin in the transgenic line was significantly lower than that in the wild type. Similarly, the detection results of mature seeds are shown in Figures 16 and 17. Related statistical analysis (Figure 18) further confirms that the DON toxin content in the mature transgenic seeds was also significantly lower than that in the wild-type control.

[0189] Conclusion: PxGSTD2F205C-transgenic wheat can significantly reduce the DON toxin content in wheat grains.

[0190] Example 12: Detection of resistance to stalk rot in maize transgenic PxGSTD2 or its mutant genes.

[0191] Experimental Methods: Healthy maize seedlings (wild-type maize, PxGSTD2 transgenic maize, or PxGSTD2 mutant gene transgenic maize (e.g., PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, or PxGSTD2F205T, etc.)) were selected and transplanted into sterilized soil. A suspension of spores of *Fusarium verticillioides* or *Fusarium graminearum*, the pathogen causing maize stalk rot, was injected into the stems of the maize plants (usually at the base or inside the stem). The temperature was controlled between 25-30℃, and the stems and soil were kept moist. When the control group experienced severe disease, the disease incidence of each variety of tested maize seedlings was investigated.

[0192] The inventors anticipate that by introducing a gene encoding wild-type or mutant PxGSTD2 into maize, the maize will express wild-type or mutant PxGSTD2 protein during its growth. This PxGSTD2 protein will catalyze the conjugation of Fusarium toxins such as vomitoxin with reduced glutathione (GSH), thereby increasing the water solubility of Fusarium toxins, reducing their toxicity, and forming adducts that are easily excreted by the organism, thus endowing maize with the ability to resist stalk rot.

[0193] Example 13: Detection of resistance to ear rot in maize transgenic PxGSTD2 or its mutant genes.

[0194] Experimental Methods: Healthy maize plants (wild-type maize, PxGSTD2 transgenic maize, or PxGSTD2 mutant gene transgenic maize (e.g., PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, or PxGSTD2F205T, etc.)) were selected. 15-17 days after pollination, a suspension of Fusarium verticillioides (Fv) or Fusarium graminearum spores was inoculated into the maize ear (usually at the base of the stem or inside the stalk) using the needle-pricking method. The inoculation point was then sealed with paper tape. When the control group was severely affected, the disease incidence in the ears of each tested maize variety was investigated.

[0195] The inventors anticipate that by introducing a gene encoding wild-type or mutant PxGSTD2 into maize, the maize will express wild-type or mutant PxGSTD2 protein during its growth. This PxGSTD2 protein will catalyze the conjugation of Fusarium toxins such as vomitoxin with reduced glutathione (GSH), thereby increasing the water solubility of Fusarium toxins, reducing their toxicity, and forming adducts that are easily excreted by the organism, thus endowing maize with the ability to resist ear rot.

[0196] Example 14: Detection of resistance to root rot in maize transgenic PxGSTD2 or its mutant gene

[0197] Experimental Methods: Healthy maize seedlings (wild-type maize, PxGSTD2 transgenic maize, and PxGSTD2 mutant gene transgenic maize (e.g., PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, or PxGSTD2F205T, etc.)) were selected and transplanted into sterilized soil inoculated with Fusarium graminearum, the root rot pathogen of maize. When the control group showed severe disease, the disease incidence on the roots of each variety of maize was investigated.

[0198] The inventors anticipate that by introducing a gene encoding wild-type or mutant PxGSTD2 into maize, the maize will express wild-type or mutant PxGSTD2 protein during its growth. This PxGSTD2 protein will catalyze the conjugation of Fusarium toxins such as vomitoxin with reduced glutathione (GSH), thereby increasing the water solubility of Fusarium toxins, reducing their toxicity, and forming adducts that are easily excreted by the organism, thus endowing maize with the ability to resist root rot.

[0199] Example 15: Effect of PxGSTD2 or its mutant gene on the content of Fusarium toxins in maize kernels

[0200] Experimental Methods: Healthy maize plants (wild-type maize, PxGSTD2 transgenic maize, or PxGSTD2 mutant gene transgenic maize (e.g., PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, or PxGSTD2F205T, etc.)) were selected. 15-17 days after pollination, a suspension of Fusarium verticillioides (Fv) or Fusarium graminearum spores was inoculated into the maize ear (usually at the base of the stem or inside the stalk) using the needle-pricking method. The inoculation point was then sealed with paper tape. After the kernels matured, inoculated maize ears were collected, and the kernel samples were flash-frozen in liquid nitrogen and ground into powder. The contents of Fusarium toxins and their GSH adducts in various tested maize kernels were detected using an AB Sciex Qtrap 5500 triple quadrupole liquid chromatography-mass spectrometry system (AB, USA).

[0201] The inventors anticipate that genetically modified corn will overexpress wild-type or mutant PxGSTD2 protein, which will catalyze the conjugation of Fusarium toxins such as vomitoxin with reduced glutathione (GSH), thereby increasing the water solubility of Fusarium toxins, reducing their toxicity, and forming adducts that are easily excreted by organisms. Therefore, the accumulation of Fusarium toxins will be significantly lower than that of wild-type corn.

[0202] Example 16: Detection of resistance to bakanae disease in rice transgenic PxGSTD2 or its mutant genes.

[0203] Experimental Methods: Rice seeds (wild-type rice, PxGSTD2 transgenic rice, and PxGSTD2 mutant genes (e.g., PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, or PxGSTD2F205T, etc.)) were soaked in a suspension of Fusarium moniliforme spores for 3 hours and then air-dried. The resulting infected rice seeds were germinated at 30℃ for 48 hours, maintaining moisture throughout the germination process. After germination, the seeds were sown and cultured in a plant incubator (32℃, 12h:12h light-dark ratio) with the soil kept moist. Disease incidence was assessed in seedlings at the three-leaf stage.

[0204] The inventors anticipate that by introducing a gene encoding wild-type or mutant PxGSTD2 into rice, the rice will express wild-type or mutant PxGSTD2 protein during its growth. This PxGSTD2 protein will catalyze the conjugation of Fusarium toxins, such as vomitoxin, with reduced glutathione (GSH), thereby increasing the water solubility of Fusarium toxins, reducing their toxicity, and forming adducts that are easily excreted by the organism, thus endowing rice with the ability to resist bakanae disease.

[0205] Example 17: Detection of resistance to panicle rot in rice transgenic PxGSTD2 or its mutant gene

[0206] Experimental Methods: The tested rice seeds (wild-type rice, PxGSTD2 transgenic rice, and PxGSTD2 mutant genes (e.g., PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, or PxGSTD2F205T, etc.)) were aseptically treated and then germinated at 30℃ for 48 hours, maintaining moisture during the germination process. After germination, the seeds were sown and cultured in a plant incubator (32℃, light-dark ratio 12h:12h), keeping the soil moist. After 3 weeks of cultivation, the seedlings were transferred to an outdoor netted indoor area. At the beginning of the heading stage of rice, Fusarium proliferatum was injected into the middle and lower part of the rice panicle. The disease incidence was counted 2 weeks later, and the diseased grain rate was counted 30 days later.

[0207] The inventors anticipate that by introducing a gene encoding wild-type or mutant PxGSTD2 into rice, the rice will express wild-type or mutant PxGSTD2 protein during its growth. This PxGSTD2 protein will catalyze the conjugation of Fusarium toxins such as vomitoxin with reduced glutathione (GSH), thereby increasing the water solubility of Fusarium toxins, reducing their toxicity, and forming adducts that are easily excreted by the organism, thus endowing rice with the ability to resist panicle rot.

[0208] Example 18: Detection of resistance to rice blast in rice transgenic PxGSTD2 or its mutant gene

[0209] Experimental Methods: The tested rice seeds (wild-type rice, PxGSTD2 transgenic rice, and PxGSTD2 mutant genes (e.g., PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, or PxGSTD2F205T, etc.)) were aseptically treated and then germinated at 30℃ for 48 hours, maintaining moisture during the germination process. After germination, the seeds were sown and cultured in a plant incubator (32℃, light-dark ratio 12h:12h), keeping the soil moist. After 3 weeks of cultivation, the prepared Magnaphalthegrisea spore suspension (spore content approximately 1×10⁵ spores / mL) was evenly sprayed onto the rice seedlings, ensuring that all rice leaves were covered with the bacterial solution. The seedlings were then treated in the dark for 24 hours in a high-humidity environment. Afterward, the inoculated rice seedlings were further cultured at 32℃ with a light-dark ratio of 12h:12h, maintaining a high-humidity environment. The disease incidence was observed in the rice seedlings after 5 days.

[0210] The inventors anticipate that by introducing the gene encoding wild-type or mutant PxGSTD2 into rice seeds, rice will overexpress the wild-type or mutant PxGSTD2 protein during its growth. Since GST overexpression enhances an organism's stress resistance, rice plants transfected with the wild-type or mutant PxGSTD2 gene may acquire resistance to rice blast.

[0211] Example 19: Effect of PxGSTD2 or its mutant gene on Fusarium toxin content in rice grains

[0212] Experimental method: At the initial heading stage of rice, a suspension of Fusarium moniliforme was injected into the lower part of the rice panicle. Inoculated rice panicles were collected at 48h, 72h and 96h after inoculation, and the samples were flash-frozen in liquid nitrogen and ground into powder. The contents of vomitoxin and vomitoxin-GSH adducts in various tested rice samples (wild-type rice, PxGSTD2 transgenic rice, and PxGSTD2 mutant gene (e.g., PxGSTD2F205C, PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, or PxGSTD2F205T, etc.) were detected using an AB Sciex Qtrap 5500 triple quadrupole liquid chromatography-mass spectrometry system (AB, USA).

[0213] The inventors anticipate that transgenic rice will overexpress wild-type or mutant PxGSTD2 protein, which will catalyze the conjugation of Fusarium toxins such as vomitoxin with reduced glutathione (GSH), thereby increasing the water solubility of Fusarium toxins, reducing their toxicity, and forming adducts that are easily excreted by organisms. Therefore, the accumulation of Fusarium toxins will be significantly lower than that of wild-type rice.

[0214] Example 20: Catalytic activity of PxGSTD2 protein and its mutants on the conjugated coupling of indoxacarb and GSH

[0215] Experimental Methods: 4 mM glutathione (GSH), 100 μM indoxacarb, and 2 U of recombinant PxGSTD2 protein were mixed and dissolved in PBS buffer (10 mM, pH 7.2) to a total volume of 500 μL, and incubated at 30 °C for 0 h and 1 h. Three control groups were also set up: “4 mM GSH + 100 μM indoxacarb,” “4 mM GSH + 2 U PxGSTD2,” and “100 μM indoxacarb + 2 U PxGSTD2.” The control group reaction volume was also 500 μL, and incubated at 30 °C for 0 h and 1 h. Then, an equal volume of acetonitrile (HPLC grade) was added, and the reaction was terminated by incubation at 4 °C for 1 h. Both the treatment and control groups were replicated in triplicate. The samples were centrifuged at 4 °C and 10,000 rpm for 15 min using a low-temperature centrifuge. The supernatant was collected, purified with a 0.22 μm organic nylon membrane, and then placed into sample vials.

[0216] The product obtained by the conjugation of indoxacarb and GSH catalyzed by the PxGSTD2 recombinant protein was detected using an AB Sciex Qtrap 5500 triple quadrupole liquid chromatography-mass spectrometry system (AB, USA). Gradient elution was performed with 0.1% formic acid aqueous solution and acetonitrile according to the program in Table 1 (Example 3), with a total elution time of 18 min and a flow rate of 0.2 mL / min. The ionization source was positive electrode electrospray (ES), with a collision energy of 30 eV. The detection mode was neutral loss scanning, with the lost fragment size set to 129 amu and the scan range of 300–800 m / z. The precursor ions detected by the neutral loss scanning were then scanned for product ions, with a collision energy of 30 eV and a detection mode of product ion scanning, with a scan range of 100–760 m / z.

[0217] Results: Neutral loss scanning and mass spectrometry analysis showed that the sample treated with PxGSTD2 for 1 h accumulated a peak at 7.5 min (Figure 19), and this characteristic peak contained a precursor ion at 833.9 m / z (Figure 20). The mass spectrum of the product ion scan showed that the 833.9 m / z precursor ion had neutral losses of 75 amu (glycine), 129 amu (pyroglutamic acid), and 147 amu (ammoniated pyroglutamic acid) (Figure 21), which is consistent with the neutral fragment loss characteristics of GSH adducts, indicating that the 833.9 m / z precursor ion is an adduct of GSH and indoxacarb.

[0218] The catalytic activity of five randomly selected PxGSTD2 protein mutants (PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205C, and PxGSTD2F205L) on the conjugated coupling of indoxacarb and GSH was detected using the same method. The results are shown in Figures 22 and 23. It can be seen that treatment with PxGSTD2F205A significantly increased the characteristic peak area at 7.5 min, but the peak areas of the other four PxGSTD2 mutants were not significantly different from those of the wild-type PxGSTD2 (Figure 22). Furthermore, the characteristic peaks of the five PxGSTD2 mutants involved in this invention all contained an 833.9 m / z precursor ion (Figure 23), and this precursor ion exhibited the characteristic of loss of neutral fragments in the GSH adduct (Figure 24).

[0219] Conclusion: The PxGSTD2 protein and its mutants involved in this invention can directly catalyze the conjugation of indoxacarb with GSH, among which the PxGSTD2F205A mutant exhibits the strongest catalytic activity for the conjugation of indoxacarb with GSH.

[0220] Example 21: Catalytic activity of PxGSTD2 protein and its mutants on the conjugated coupling of lambda-cyhalothrin and GSH.

[0221] Experimental Methods: Similar to Example 20, the catalytic activity of PxGSTD2 and its mutants (PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205C, and PxGSTD2F205L) for the conjugated coupling of lambda-cyhalothrin and GSH was detected using a method similar to that in Example 20. During detection, the ionization source was positive electrode electrospray (ES), the collision energy was 30 eV, the detection method was neutral fragment loss scanning, the lost fragment size was set to 129 amu, and the scan range was 300-800 m / z. The precursor ions detected by the neutral fragment loss scanning were then scanned for product ions, with a collision energy of 30 eV and a detection method of product ion scanning, with a scan range of 100-760 m / z.

[0222] Results: The experimental results are shown in Figures 25-29. Neutral loss scanning and mass spectrometry analysis showed that peak accumulation occurred at 6.9 min and 8.9 min in both PxGSTD2 and its mutant treatments. Specifically, the peak areas of mutants PxGSTDF205A, PxGSTD2F205C, and PxGSTD2F205V were significantly higher than those of PxGSTD2, while the peak areas of mutants PxGSTD2F205H and PxGSTD2F205L were essentially the same as those of PxGSTD2 (Figure 25). Mass spectrometry analysis revealed that the characteristic peak at 6.9 min contained a precursor ion of 515 m / z, and the characteristic peak at 8.9 min contained a precursor ion of 757.5 m / z (Figures 26 and 27). The mass spectra of the product ions showed that the precursor ions at 515 m / z and 757.5 m / z both had neutral losses of 75 amu (glycine), 129 amu (pyroglutamic acid), and 147 amu (ammoniated pyroglutamic acid), which is consistent with the neutral fragment loss characteristics of GSH adducts (Figures 28 and 29).

[0223] Conclusion: The PxGSTD2 protein and its mutants involved in this invention can directly catalyze the conjugated coupling of lambda-cyhalothrin and GSH. Among them, the mutants PxGSTDF205A, PxGSTD2F205C and PxGSTD2F205V have significantly higher catalytic activity for the conjugated coupling of lambda-cyhalothrin and GSH than the wild-type PxGSTD2 protein.

[0224] Example 22: Catalytic activity of PxGSTD2 protein and its mutants on the conjugated coupling of fipronil and GSH

[0225] Experimental Methods: The detoxification metabolic activity of PxGSTD2 and its mutants against fipronil was detected using a method similar to that in Example 20. During detection, the ionization source was positive electrode electrospray (ES), the collision energy was 30 eV, the detection method was neutral fragment loss scanning, the lost fragment size was set to 129 amu, and the scan range was 300-600 m / z. The precursor ions detected by the neutral fragment loss scanning were then scanned for product ions, with a collision energy of 30 eV and a detection method of product ion scanning, with a scan range of 100-512 m / z.

[0226] Results: The experimental results are shown in Figures 30 and 31. No significant peak area changes were observed in the neutral loss scan chromatograms of PxGSTD2 and its mutant treatments. However, mass spectrometry analysis revealed an increase of 509.7 m / z precursor ions at 7.3 min in both the PxGSTD2 and PxGSTD2F205A treatments, with a higher abundance in the PxGSTD2F205A treatment (Figure 30). The product ion mass spectra showed neutral losses of 75 amu (glycine), 129 amu (pyroglutamic acid), and 147 amu (ammoniated pyroglutamic acid) in the 509.7 m / z precursor ions, consistent with the neutral fragment loss characteristics of GSH adducts (Figure 31).

[0227] Conclusion: The PxGSTD2 protein and its mutants involved in this invention can directly catalyze the conjugation of fipronil and GSH, and the catalytic activity of the PxGSTD2 mutant for the conjugation of fipronil and GSH is significantly higher than that of the wild-type PxGSTD2 protein.

[0228] Example 23: Catalytic activity of PxGSTD2 protein and its mutants on the conjugated coupling of acetamiprid and GSH

[0229] Experimental Methods: The catalytic activity of PxGSTD2 and its mutants for the conjugated coupling of acetamiprid and GSH was detected using a method similar to that in Example 20. During detection, the ionization source was positive electrode electrospray (ES), the collision energy was 30 eV, the detection method was neutral fragment loss scanning, the lost fragment size was set to 129 amu, and the scan range was 300-600 m / z. The precursor ions detected by the neutral fragment loss scanning were then scanned for product ions, with a collision energy of 30 eV and a detection method of product ion scanning, with a scan range of 100-532 m / z.

[0230] Results: The experimental results are shown in Figures 32 and 33. No significant peak area changes were observed in the neutral loss scan chromatograms of PxGSTD2 and its mutant treatments. However, mass spectrometry analysis revealed an increase of 530.1 m / z precursor ions at 10.1 min in both the PxGSTD2 and PxGSTD2F205A treatments, with a higher abundance in the PxGSTD2F205A treatment (Figure 32). The product ion mass spectra showed neutral losses of 75 amu (glycine), 129 amu (pyroglutamic acid), and 147 amu (ammoniated pyroglutamic acid) in the 530.1 m / z precursor ions, consistent with the neutral fragment loss characteristics of GSH adducts (Figure 33).

[0231] Conclusion: The PxGSTD2 protein and its mutants involved in this invention can directly catalyze the conjugation of acetamiprid with GSH, and the catalytic activity of the PxGSTD2 mutant for the conjugation of acetamiprid with GSH is significantly higher than that of the wild-type PxGSTD2 protein.

[0232] Example 24: Indoor toxicity determination of insecticides against different strains of Drosophila melanogaster

[0233] Experimental Methods: Using laboratory-raised non-transgenic strains, PxGSTD2 transgenic strains, and PxGSTD2 mutant strains of *Drosophila melanogaster* as test insects, the indoor toxicity of five insecticides—indoxacarb, lambda-cyhalothrin, acetamiprid, dinotefuran, and imidacloprid—to different strains of *Drosophila melanogaster* was determined using the pesticide film method. Acetone containing Tween 80 (2 drops of 0.1% Tween 80 per 50 mL of acetone) was used as the solvent to prepare a 200 mg / L stock solution of the test insecticide, which was then serially diluted to five concentrations. 5 mL of the solution was added to a 50 mL Erlenmeyer flask, slowly tilted, and rotated uniformly for two revolutions to form a uniform pesticide film on the inner wall. Excess solution was poured off. The pesticide film formed by the solvent served as a control. After the inner wall air-dried naturally, a thin slice of apple (15 mm × 15 mm × 5 mm) was placed in the Erlenmeyer flask for the test insects to feed on. Subsequently, transgenic fruit fly adults that had emerged 4 days prior were placed in conical flasks and sealed with gauze. Each treatment was repeated 3 times, with 30 test insects per replicate. The test insects were placed in an artificial climate chamber under the following conditions: temperature 25℃, relative humidity 60-70%, and light-dark ratio 12h:12h. Abdominal rollover and six-leg twitching were used as the criteria for determining mortality. Adult mortality was recorded after 48 hours of treatment, and the mortality rate and corrected mortality rate were calculated. The median lethal concentration (LC50) of the insecticide was calculated using the Probit method in SPSS software. 50 ) and 95% confidence interval.

[0234] Results: The results are summarized in Table 2. It can be seen that transferring the PxGSTD2 or PxGSTD2F205A gene into Drosophila significantly reduced the toxicity of the tested insecticides to Drosophila. Specifically, the toxicity of the tested insecticides to PxGSTD2F205A-transformed Drosophila was significantly lower than that to PxGSTD2-transformed Drosophila.

[0235] Table 2. Indoor toxicity of insecticides to different strains of Drosophila melanogaster Note: F205A is an abbreviation for the PxGSTD2F205A gene.

[0236] Conclusion: Overexpression of PxGSTD2 or its mutant gene significantly improved the tolerance of Drosophila to various pesticides. Overexpression of PxGSTD2F205A significantly enhanced pesticide tolerance in Drosophila than overexpression of PxGSTD2. This result indicates that transferring PxGSTD2 or its mutant gene into non-target organisms can improve the pesticide tolerance of target organisms.

[0237] The sequences used in this application:

[0238] The original sequence of the PxGSTD2 gene (SEQ ID NO.1)

[0239] The amino acid sequence encoded by the ORF of the PxGSTD2 gene (SEQ ID NO.2)

[0240] The amino acid sequence of the mature PxGSTD2 protein (SEQ ID NO.3)

[0241] The gene sequence of PxGSTD2F205A (SEQ ID NO.4)

[0242] The gene sequence of PxGSTD2F205A (SEQ ID NO.5)

[0243] The gene sequence of PxGSTD2F205A (SEQ ID NO.6)

[0244] The gene sequence of PxGSTD2F205A (SEQ ID NO.7)

[0245] The amino acid sequence encoded by the ORF of the PxGSTD2F205A gene (SEQ ID NO.8)

[0246] The amino acid sequence of the mature PxGSTD2F205A protein (SEQ ID NO.9)

[0247] The gene sequence of PxGSTD2F205V (SEQ ID NO.10)

[0248] The gene sequence of PxGSTD2F205V (SEQ ID NO.11)

[0249] The gene sequence of PxGSTD2F205V (SEQ ID NO.12)

[0250] The gene sequence of PxGSTD2F205V (SEQ ID NO.13)

[0251] The amino acid sequence encoded by the ORF of the PxGSTD2F205V gene (SEQ ID NO.14)

[0252] The amino acid sequence of the mature PxGSTD2F205V protein (SEQ ID NO.15)

[0253] The gene sequence of PxGSTD2F205H (SEQ ID NO.16)

[0254] The gene sequence of PxGSTD2F205H (SEQ ID NO.17)

[0255] The amino acid sequence encoded by the ORF of the PxGSTD2F205H gene (SEQ ID NO.18)

[0256] The amino acid sequence of the mature protein PxGSTD2F205H (SEQ ID NO.19)

[0257] The gene sequence of PxGSTD2F205C (SEQ ID NO.20)

[0258] The gene sequence of PxGSTD2F205C (SEQ ID NO.21)

[0259] The amino acid sequence encoded by the ORF of the PxGSTD2F205C gene (SEQ ID NO.22)

[0260] The amino acid sequence of the mature PxGSTD2F205C protein (SEQ ID NO.23)

[0261] The gene sequence of PxGSTD2F205L (SEQ ID NO.24)

[0262] The gene sequence of PxGSTD2F205L (SEQ ID NO.25)

[0263] The gene sequence of PxGSTD2F205L (SEQ ID NO.26)

[0264] The gene sequence of PxGSTD2F205L (SEQ ID NO.27)

[0265] The amino acid sequence encoded by the ORF of the PxGSTD2F205L gene (SEQ ID NO.28)

[0266] The amino acid sequence of the mature protein PxGSTD2F205L (SEQ ID NO.29)

[0267] The gene sequence of PxGSTD2F205G (SEQ ID NO.30)

[0268] The gene sequence of PxGSTD2F205G (SEQ ID NO.31)

[0269] The gene sequence of PxGSTD2F205G (SEQ ID NO.32)

[0270] The gene sequence of PxGSTD2F205G (SEQ ID NO.33)

[0271] The amino acid sequence encoded by the ORF of the PxGSTD2F205G gene (SEQ ID NO.34)

[0272] The amino acid sequence of the mature PxGSTD2F205G protein (SEQ ID NO.35)

[0273] The gene sequence of PxGSTD2F205I (SEQ ID NO.36)

[0274] The gene sequence of PxGSTD2F205I (SEQ ID NO.37)

[0275] The gene sequence of PxGSTD2F205I (SEQ ID NO.38)

[0276] The amino acid sequence encoded by the ORF of the PxGSTD2F205I gene (SEQ ID NO.39)

[0277] The amino acid sequence of the mature PxGSTD2F205I protein (SEQ ID NO.40)

[0278] The gene sequence of PxGSTD2F205P (SEQ ID NO.41)

[0279] The gene sequence of PxGSTD2F205P (SEQ ID NO.42)

[0280] The gene sequence of PxGSTD2F205P (SEQ ID NO.43)

[0281] The gene sequence of PxGSTD2F205P (SEQ ID NO.44)

[0282] The amino acid sequence encoded by the ORF of the PxGSTD2F205P gene (SEQ ID NO.45)

[0283] The amino acid sequence of the mature PxGSTD2F205P protein (SEQ ID NO.46)

[0284] The gene sequence of PxGSTD2F205T (SEQ ID NO.47)

[0285] The gene sequence of PxGSTD2F205T (SEQ ID NO.48)

[0286] The gene sequence of PxGSTD2F205T (SEQ ID NO.49)

[0287] The gene sequence of PxGSTD2F205T (SEQ ID NO.50)

[0288] The amino acid sequence encoded by the ORF of the PxGSTD2F205T gene (SEQ ID NO.51)

[0289] The amino acid sequence of the mature PxGSTD2F205T protein (SEQ ID NO.52)

[0290] Signal peptide sequence (SEQ ID NO.53)

[0291] HSP-F (SEQ ID NO.54)

[0292] P10-R (SEQ ID NO.55)

Claims

1. A PxGSTD2 protein mutant, wherein the PxGSTD2 protein is a mature protein with the amino acid sequence shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3, and the mutant comprises a mutation in phenylalanine (F) residue at position 205 of the amino acid sequence shown in SEQ ID NO.3; Preferably, the mutant has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity with the PxGSTD2 protein and retains the function of the PxGSTD2 protein; More preferably, the signal peptide has an amino acid sequence as shown in SEQ ID NO.

53.

2. The mutant according to claim 1, wherein the mutant comprises any one of the mutants F205A, F205V, F205H, F205C, F205L, F205G, F205I, F205P and F205T; preferably, the mutant comprises any one of the mutants F205A, F205V, F205H, F205C and F205L; more preferably, the mutant comprises the mutant F205A or F205C.

3. An isolated gene encoding a mutant according to any one of claims 1-2.

4. The isolated gene according to claim 3, wherein the isolated gene has a nucleic acid sequence or a degenerate sequence thereof as shown in any one of SEQ ID NOs. 4-7, 10-13, 16-17, 20-21, 24-27, 30-33, 36-38, 41-44 and 47-50.

5. An expression vector comprising the isolated gene as described in claim 3 or 4.

6. The expression vector according to claim 5, wherein the expression vector is a plasmid; preferably, the expression vector is a pET series vector such as pET-30a, a pBAD vector such as pBAD / HisC, a pGEX vector such as pGEX-6P-1, a pUAST vector, an Agrobacterium vector, a YIP vector, a YEp vector, a YCp vector, a pPIC series vector such as pPICZαA, a pGAP series vector such as pGAPZB, a pcDNA series vector such as pcDNA3.1, a pSV series vector, a baculovirus vector, a retroviral vector, a lentiviral vector, or an adenovirus vector.

7. An expression cell comprising the isolated gene as described in claim 3 or 4 or the expression vector as described in claim 5 or 6.

8. The expression cell according to claim 7, wherein the expression cell is a prokaryotic cell such as Escherichia coli cells, Bacillus cells, or Streptomyces cells, or a eukaryotic cell such as an animal cell, plant cell, or yeast cell; preferably, the animal cell includes cells from bees, earthworms, spiders, fruit flies, fall armyworms, white armyworms, silkworms, clawed frogs, Chinese hamsters, small hamsters, mice, and humans; preferably, the plant cell includes cells from Arabidopsis thaliana, wheat, corn, rice, oats, and barley.

9. Use of the PxGSTD2 protein, the gene encoding the PxGSTD2 protein, the mutant of claim 1 or 2, the isolated gene of claim 3 or 4, the expression vector of claim 5 or 6, or the expression cell of claim 7 or 8 in the following respects: a) Catalyze the conjugation of Fusarium toxins such as vomitoxin with reduced glutathione (GSH) in vitro; b) Conferring tolerance to Fusarium toxins such as vomitoxin on target organisms; c) Conferring tolerance or resistance to Fusarium-related diseases or other diseases to a target organism, wherein the target organism is a food crop; d) Increase the yield or quality of the target organism, wherein the target organism is a food crop; e) Catalyzing the conjugation of pesticides with reduced glutathione (GSH) in vitro or in non-target organisms; or f) Improve the tolerance of non-target organisms to pesticides; The PxGSTD2 protein therein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3; preferably, the signal peptide has an amino acid sequence as shown in SEQ ID NO.

53.

10. The use according to claim 9, wherein the non-target organism comprises: The pesticide includes all non-pest arthropod species, such as bees, silkworms, parasitic wasps, ladybugs, spiders, and predatory mites; birds such as small grain-eating birds, small insectivorous birds, large herbivorous birds, and small omnivorous birds; soil organisms such as earthworms; aquatic organisms such as fish, daphnia, algae, predatory amphibians, and large crustaceans; the pesticide includes insecticides, acaricides, herbicides, fungicides, and nematicides; preferably, the pesticide is an insecticide or an acaricide; more preferably, the pesticide is an insecticide; preferably, the insecticide is selected from one or more of oxadiazine, neonicotinoid, and pyrethroid insecticides; even more preferably, the insecticide is selected from one or more of oxadiazine insecticides such as indoxacarb, pyrethroid insecticides such as lambda-cyhalothrin, neonicotinoid insecticides such as dinotefuran and acetamiprid.

11. The use according to claim 9 or 10, wherein the use is achieved by using genetic engineering methods to express the PxGSTD2 protein or the mutant of claim 1 or 2 in the target organism or the non-target organism.

12. The use according to claim 11, wherein the genetic engineering means comprises transferring an expression vector containing a gene encoding the PxGSTD2 protein or the expression vector according to claim 5 or 6 into the cells of the target organism or the non-target organism, and stably expressing the gene in the target organism or the non-target organism.

13. The use according to any one of claims 9 or 11-12, wherein the target organism comprises: Plants, such as Arabidopsis thaliana, and food crops such as wheat, corn, rice, oats, and barley, with wheat, corn, and rice being preferred; Animals, such as insects like fruit flies, poultry, and livestock; or microorganisms such as gut microbiota.

14. The use according to any one of claims 9 or 11-13, wherein the Fusarium-related diseases are plant diseases caused by Fusarium pathogens, and the other diseases include stripe rust or rice blast; preferably, the Fusarium-related diseases include Fusarium head blight, stem base rot, stem rot, seedling blight, panicle rot, and damping-off; more preferably, the Fusarium includes Fusarium graminearum, Fusarium pseudograminearum, Fusarium verticillatum, Fusarium pseudoverticillatum, Fusarium moniliforme, or Fusarium moniliforme.

Images