Synthesis of lipid-conjugated oligonucleotides
By linking a nucleoside lipid derivative to a solid support using a labile linker, the synthesis of ligand-conjugated oligonucleotides is streamlined, addressing the inefficiencies of existing methods and improving yield and cost-effectiveness.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- ARTHEX BIOTECH SL
- Filing Date
- 2025-12-23
- Publication Date
- 2026-07-02
AI Technical Summary
Existing methods for synthesizing ligand-conjugated oligonucleotides, such as those with lipid molecules, require multiple purification steps, leading to low yields and increased costs due to the need for HPLC purifications, which decrease the final product yield and increase preparation time.
A method involving linking a nucleoside lipid derivative to a solid support using a linker molecule with a base labile or photo-labile function, allowing the conjugated ligand to be introduced early in the synthesis process, reducing the need for multiple purifications and improving yield and cost-efficiency.
This approach simplifies the synthesis of ligand-conjugated oligonucleotides by minimizing purification steps, enhancing yield, and reducing overall costs while maintaining high purity.
Smart Images

Figure EP2025088945_02072026_PF_FP_ABST
Abstract
Description
[0001] SYNTHESIS OF LIPID-CONJUGATED OLIGONUCLEOTIDES TECHNICAL FIELD OF THE INVENTION
[0002] The present application refers to a new method of preparing nucleoside-lipid derivatives, its coupling to solid support, and its use in the synthesis of oligonucleotides conjugated with a lipid molecule.
[0003] BACKGROUND
[0004] Therapeutic oligonucleotide conjugates are hybrid molecules that combine the potential therapeutic properties of oligonucleotides with the delivery properties of a ligand or the enhancement of the therapeutic effect of a drug carrier. For example, conjugation of an oligonucleotide with a fatty acid may increase the plasma protein binding affinity of the oligonucleotide, such as in the case of albumin, enhancing thus its ability to cross the endothelial barrier and improving its functional uptake into muscles, thereby increasing the oligonucleotide potency in vivo.
[0005] In addition of facilitating said cellular uptake of therapeutic oligonucleotides, the presence of the conjugated ligand may also increase other properties of the oligonucleotide, such as stability to nucleases, contribute to binding to plasma proteins to avoid renal excretion, contribute to endosomal escape and / or increase the affinity to RNA targets.
[0006] A large chemical diversity of conjugated ligands has been described to enhance the therapeutic properties of oligonucleotides, including carbohydrates such as N-acetylgalactosamine; lipids such as cholesterol and fatty acids; peptides such as cell penetrating peptides; and small molecules such as folic acid and others. The attachment sites of the ligands are usually the 5’ and / or the 3’-end of the oligonucleotide chain, although in some cases, the ligand has also been attached to the nucleobase, the 2’-OH of the ribose or to the internucleotide phosphate bond.
[0007] The incorporation of the ligands into the oligonucleotides is normally achieved by a postsynthetic conjugation, wherein a reactive group such as a primary alkylamino group or a thiol alkyl group or an azido alkyl or alkene / alkyno group is introduced in the oligonucleotide and after the assembly of the desired oligonucleotide, the ligand is introduced by reaction of the reactive group with the ligand carrying the appropriate groups such as; carboxylic acid, maleimido, bromoacetamido, azido or diene or alkyne groups.
[0008] Document WO2023227622 (Arthex own publication) recently disclosed an oligonucleotide complementary to a particular microRNA and carrying an oleic acid derivative at the 3’-end for the treatment of myotonic dystrophy type 1 (DM1). The preparation of this compound wasmade by said post-synthetic conjugation of oleic acid to a 3’-aminohexyl-oligonucleotide that was prepared by solid phase assembly of the oligonucleotide on a solid support functionalized with a phthalimido linker. Although this methodology provides the desired conjugate, the final yield of the conjugated oligonucleotide is however relatively low due to the need of several HPLC purifications required throughout the preparation process and once the oligonucleotide has been cleaved from the solid phase.
[0009] Those multiple oligonucleotide purification steps decrease the yield of the desired final product, while the overall preparation costs and preparation time increases. Hence, there is a need for a simplified synthesis procedure of ligand-conjugated oligonucleotides, that allows reducing the purification steps, and thus the synthesis costs, and helps obtaining the final ligand-conjugated oligonucleotide in a more straightforward manner.
[0010] SUMMARY OF THE INVENTION
[0011] The present invention overcomes the limitations by providing a new method for linking a nucleoside lipid derivative to a solid support and a new method for preparing ligand-conjugated oligonucleotides, in particular wherein the conjugated ligand is derived from a lipophilic starting material.
[0012] Hence, in one aspect of the invention, a method of manufacturing an oligonucleotide is provided comprising a step a) of linking a nucleoside lipid derivative to a solid support using a method comprising the steps of:
[0013] a1. providing a nucleoside lipid derivative of formula (I):
[0014]
[0015] Formula (I)
[0016] wherein• Y is O, S, CH2, CHF, CF2or -CH=CH-;
[0017] • PG is a 5' or 6’ protecting group;
[0018] • Ri is H, halogen, OZ1 , or NRsRg; R2is H, halogen, or OZ2; or Ri together with R2forms a bridge; wherein
[0019] o Z1 is H, C1-C4 alkyl, C1-C4 alkyl-oxy-C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, or a protecting group;
[0020] o Rs and Rg are independently from each other H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, carbonyl- C1-C4 alkyl, carbonyl-C2-C4 alkenyl, carbonyl-C2-C4 alkynyl, carbonylamino-C1-C4 alkyl, carbonylamino-(C1-C4 alkyl)2, or a protecting group; and
[0021] o Z2 is H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, or a protecting group; • Nb is a nucleobase;
[0022] • Q is a spacer molecule selected from the group consisting of linear or branched C1-C8 alkyl, linear or branched C2-C8 alkenyl, linear or branched C2-C8 alkynyl, or (C1-C3 alkyl)-O-(C1-C3 alkyl), (C1-C3 alkyl)-S-(C1-C3 alkyl), or (C1-C8 alkyl)-S-S-(C1-C8 alkyl);
[0023] • X is selected from the group consisting of -O-, -S-, -NH-, -N=, or a direct bond;
[0024] • Lipid is a lipophilic residue selected from the group consisting of fatty acid residues, fatty alcohol residues, fatty aldehyde residues, fatty amine residues, sterol residues, diglyceride residues or phospholipid residues;
[0025] • G is O, S, NH, or N-SO2CH3;
[0026] • LG is NR3R4, SR5 or ORe,
[0027] • wherein R3 and R4, independently from one another, is H, methyl, ethyl, linear or branched C3-C6 alkyl, or R3 and R4 together form a C2-C5 ring structure; and • wherein Rs and Rs, independently from one another, is H, methyl, ethyl, cyanoethyl, linear or branched C3-C6 alkyl or a negative charge;
[0028] • m is 1 or 2; and
[0029] • n is 0 or 1;
[0030] a2. replacing the LG group of the nucleoside lipid derivative of formula (I) with at least one linker molecule suited for coupling the nucleoside lipid derivative via its 3’ position to a solid support, said at least one linker molecule comprising a base labile function or a photo-labile function; and
[0031] a3. coupling the nucleoside lipid derivative via the at least one linker molecule introduced in step a2. to a solid support.
[0032] Preferred aspects are described below and in the depending claims.In another aspect of the invention, a method for linking a nucleoside lipid derivative to a solid support is provided, comprising the steps of
[0033] a. providing a nucleoside lipid derivative of Formula (I):
[0034]
[0035] Formula (I)
[0036] wherein
[0037] • Y is O, S, CH2, CHF, CF2or -CH=CH-;
[0038] • PG is a 5' or 6’ protecting group;
[0039] • Ri is H, halogen, OZ1, or NRsRg; R2is H, halogen, OZ2; or Ri together with R2form a bridge; wherein
[0040] o Z1 is H, C1-C4 alkyl, C1-C4 alkyl-oxy-C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, or a protecting group;
[0041] o Z2 is H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, or a protecting group; o Rs and Rg are independently from each other H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, carbonyl-C1-C4 alkyl, carbonyl-C2-C4 alkenyl, carbonyl-C2-C4 alkynyl, carbonylamino-C1-C4 alkyl, carbonylamino-(C1-C4 alkyl)2, or a protecting group;
[0042] • Nb is a nucleobase;
[0043] • Q is a spacer molecule selected from the group consisting of linear or branched C1-C8 alkyl, linear or branched C2-C8 alkenyl, linear or branched C2-C8 alkynyl, or (C1-C3 alkyl)-O-(C1-C3 alkyl), (C1-C3 alkyl)-S-(C1-C3 alkyl), or (C1-C8 alkyl)-S-S-(C1-C8 alkyl);
[0044] • X is selected from the group consisting of -O-, -S-, -NH-, -N=, or a direct bond;
[0045] • Lipid is a lipophilic residue selected from the group consisting of fatty acid residues, fatty alcohol residues, fatty aldehyde residues, fatty amine residues, sterol residues, diglyceride residues or phospholipid residues;
[0046] • G is O, S, NH, or N-SO2CH3;
[0047] • LG is NR3R4, SR5 or ORe,• wherein R3 and R4, independently from one another, is H, methyl, ethyl, linear or branched C3-C6 alkyl, or R3 and R4 together form a C2-C5 ring structure; and • wherein Rs and Rs, independently from one another, is H, methyl, ethyl, linear or branched C3-C6 alkyl or a negative charge;
[0048] • m is 1 or 2; and
[0049] • n is 0 or 1;
[0050] b. replacing the LG group of the nucleoside lipid derivative of formula (I) with at least one linker molecule suited for coupling the nucleoside lipid derivative via its 3’ position to a solid support, said at least one linker molecule comprising a base labile function or photo-labile function; and
[0051] c. coupling the nucleoside lipid derivative via the at least one linker molecule introduced in step b) to a solid support.
[0052] In an embodiment, in formula (I)
[0053] • Q is selected from the group consisting of (CH2)2, (CH2)3, (CH2)4, (CH2)s, (CH2)s, (CH2)7, (CH2)8, CH2-O-CH2, (CH2)2-O-(CH2)2, (CH2)3-O-(CH2)3, (CH2)2-S-(CH2)2, (CH2)3-S-S-(CH2)3, or (CH2)6-S-S-(CH2)6;
[0054] • X is selected from the group of -O-, -NH-, -N=, or a direct bond; and • Lipid is a lipophilic residue selected from the group consisting of oleic acid residue, palmitic acid residue, myristic acid residue, stearic acid residue, lauric acid residue, elaidic acid residue, myristoleic acid residue, palmitoleic acid residue, linoleic acid residue, a-linolenic acid residue, y-li nolenic acid residue, vaccenicacid residue, arachidonic acid residue, docosahexaenoic acid residue, oleyl alcohol residue, stearyl alcohol residue, palmitoleyl alcohol residue, cetyl alcohol residue, myristyl alcohol residue, lauryl alcohol residue, decyl alcohol residue, capryl alcohol residue, octanal residue, decanal residue, dodecanal residue, perfluorooctylpropyl residue, perfluorooctylethyl residue, perfluorooctylmethyl residue, perfluorohexylpropyl residue, perfluorohexylethyl residue, perfluorohexylmethyl residue, tert-butyl residue, adamantyl residue or cholesteryl residue.
[0055] In another embodiment, the at least one linker molecule of step b) comprises a base labile function selected from the group consisting of a diethylsulfonyl group, a 2-nitrophenylethyl group, a fluorenylmethyl (Fm) group, or a 4-((2-hydroxyethyl)sulfonyl)benzamide group.In still another embodiment, step b) is carried out by reacting in solution the compound of Formula (I) with a diethylsulfonyl group resulting in the compound of Formula (II):
[0056]
[0057] Formula (II)
[0058] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined as above; and G1 and G2 are, independently from each other, O or S.
[0059] In another embodiment, in step b) the compound of Formula (II) is reacted with a succinyl group, providing the compound of Formula (III):
[0060]
[0061] wherein Y, PG, R1, R2, Nb, Q, X, Lipid, m and n are defined as above; and G1 and G2 are, independently from each other, O or S.In another embodiment, in step c) the compound of Formula (III) is coupled to a solid support, providing a compound of Formula (IV):
[0062]
[0063] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined as above; G1 and G2 are, independently from each other, O or S; and wherein SP stands for solid phase and represents a solid support.
[0064] In another embodiment, step b) is carried out by reacting in solution the compound of Formula (I) with a Nitro-benzoate derivative resulting in the compound of Formula (V):
[0065]
[0066] Formula (V)
[0067] wherein Y, PG, R1, R2, Nb, Q, X, Lipid, m and n are defined as above; G1 and G2 are, independently from each other, O or S; and wherein R? is H, methyl or ethyl.In another embodiment, in step c) the compound of Formula (V) is coupled to a solid support, providing a compound of Formula (VI):
[0068]
[0069] Formula (VI)
[0070] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined as above; G1 and G2 are, independently from each other, O or S; and wherein SP stands for solid phase and represents a solid support.
[0071] In another embodiment, the nucleoside lipid derivative of Formula (I) is prepared, and / or obtainable, from (A) a compound of Formula (VII)
[0072]
[0073] Formula (VII)
[0074] wherein Y, PG, R1, R2, Nb, and m are defined as above, and (B) a compound of Formula (VIII) Lipid
[0075]
[0076] Formula (VIII)
[0077] wherein Q, X, Lipid, and n are defined as above.
[0078] Another aspect of the invention provides a method of manufacturing an oligonucleotide comprising in position 3’ a lipophilic residue selected from the group consisting of fatty acid residues, fatty alcohol residues, fatty aldehyde residues, fatty amine residues, sterol residues, diglyceride residues or phospholipid residues, said method comprising the steps of:
[0079] a. Carrying out the method for linking a nucleoside lipid derivative to a solid support described above; and
[0080] b. Assembling an oligonucleotide using the nucleoside lipid derivative of formula (I) coupled to a solid support as the 3’-oligonucleotide starting point.
[0081] Optionally, the method further comprises the steps of:
[0082] c. once the oligonucleotide sequence is complete, removing all protecting groups; d. cleavage of the assembled oligonucleotide from the solid support; and e. optionally, purification of the oligonucleotide.
[0083] Still another aspect of the invention refers to a composition comprising a compound of formula (IX):
[0084]
[0085] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined as above; G1 and G2 are independently form each other O or S; and L is at least one linker molecule suited for coupling the nucleoside lipid derivative via its 3’ position to a solid support, said at least one linker molecule comprising a base labile function.Preferably, the compound of formula (IX) is selected from the group consisting of compounds of formula (II), compounds of formula (III), or compounds of formula (V).
[0086] Still another aspect of the invention refers to an in vitro use of said composition in a method for linking a nucleoside lipid derivative to a solid support.
[0087] Still another aspect of the invention provides a nucleoside lipid derivative selected from the group consisting of a compound of Formula (II)
[0088]
[0089] Formula (II);
[0090] a compound of Formula (III)
[0091]
[0092] a compound of formula (V)
[0093]
[0094] Formula (V);
[0095] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, G1, G2, R7, m and n are defined as above.
[0096] A further aspect of the invention refers to the use of a nucleoside lipid derivative of Formula (II), of Formula (III) or of Formula (V) for the preparation of an oligonucleotide comprising in 3’ position a lipophilic residue.
[0097] A further aspect of the invention refers to a kit for oligonucleotide synthesis comprising a nucleoside lipid derivative of Formula (II), of Formula (III) or of Formula (V).
[0098] DESCRIPTION OF THE FIGURES
[0099] Figure 1. HPLC chromatograms of oleyl-oligonucleotide 5’-T7-3’-(6-oleamidohexyl) prepared according to example 10 - obtained after the coupling of the phosphodiester obtained using A) double coupling at 40 °C (2x 1 hr), or B) one coupling at room temperature for 5 days.
[0100] Figure 2. Mass spectrometry (MALDI-TOF) analysis of the oleyl-oligonucleotide 5’-T7-3’-(6-oleamidohexyl) of example 10 - obtained after the coupling of the phosphodiester obtained using A) double coupling at 40 °C (2x 1 hr), or B) one coupling at room temperature for 5 days.
[0101] Figure 3. HPLC chromatograms of oleyl-oligonucleotides prepared according to example 16:
[0102] A) sequence 5’-T7-3’-(6-oleamidohexyl) and B) sequence 5’-GTACGCT-3’-(6-oleamidohexyl).
[0103] Figure 4. Mass spectrometry (MALDI-TOF) analysis of the oleyl-oligonucleotides prepared according to example 16: A) sequence 5’-T7-3’-(6-oleamidohexyl) and B) sequence 5’-GTACGCT-3’-(6-oleamidohexyl).Figure 5. HPLC chromatogram and mass spectrometry (MALDI-TOF) analysis of oligonucleotide 5’-GTACGCTT-3’-(2-palmitamidoethoxy)ethyl prepared according to example 29. A) HPLC chromatogram; B) mass spectrometry (MALDI-TOF): expected 2805; found 2804.
[0104] Figure 6. HPLC chromatogram and mass spectrometry (MALDI-TOF) analysis of oligonucleotide 5’-GTACGCTA-3’-myristoyl assembled according to example 29, using the (ethylsulfonyl)ethyl (ESE) linker. A) HPLC chromatogram; B) mass spectrometry (MALDI-TOF): expected 2685; found 2685.
[0105] Figure 7. HPLC chromatogram and mass spectrometry (MALDI-TOF) analysis of oligonucleotide 5’-GTACGCTA-3’-myristoyl assembled according to example 29 using the 3-nitro-4-(2-ethyl)benzoyl (NPE) linker. A) HPLC chromatogram; B) mass spectrometry (MALDI-TOF): expected 2685; found 2685.
[0106] Figure 8. HPLC chromatogram of oligonucleotide 5’-d[TGATGAATGGTGGGTGAGAGGTTTT]-3’-(6-oleamidohexyl) assembled according to example 30.
[0107] Figure 9. HPLC chromatogram of oligonucleotide 5’-Oleyl-6-aminohexyl-d[TGATGAATGGTGGGTGAGAGGTTTT]-3’-(6-oleamidohexyl) assembled according to example 30.
[0108] DETAILED DESCRIPTION OF THE INVENTION
[0109] As used herein, the singular forms "a", "an", and "the", include plural references unless the context clearly indicates otherwise. Further, unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. The term “about” when referring to a given amount or quantity indicates that a number can vary between ± 20 % around its indicated value. Preferably "about" means ± 10 % around its value, more preferably "about" means ± 10, 8, 6, 5, 4, 3, 2 % around its value, or even "about" means ± 1 % around its value, in that order of preference. As used herein, the conjunctive term "and / or" between multiple recited elements is understood as encompassing both individual and combined options. For instance, where two elements are conjoined by "and / or", a first option refers to the applicability of the first element without the second. A second option refers to the applicability of the second element without the first. A third option refers to the applicability of the first and second elements together. Any one of these options is understood to fall within the meaning, and therefore satisfy the requirement of the term "and / or" as used herein.Concurrent applicability of more than one of the options is also understood to fall within the meaning, and therefore satisfy the requirement of the term "and / or."
[0110] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein, the term "comprising" can be substituted with the term "containing" or "including" or sometimes when used herein with the term "having". Any of the aforementioned terms (comprising, containing, including, having), whenever used herein in the context of an aspect or embodiment of the present invention may be substituted with the term "consisting of", though less preferred.
[0111] When used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim element. When used herein, "consisting essentially of” does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.
[0112] By “oligonucleotide,” as referred herein is meant any short segment of DNA, RNA, or DNA / RNA, including both natural and synthetic nucleotides. As used in this invention, the term "oligonucleotide" includes both oligonucleotides as such, as well as the "oligonucleotide analogues". "Oligonucleotide analogues" are the molecules derived therefrom that incorporate some chemical modification in at least one of the nucleotide units that form them, either in the phosphate group, the pentose, the hexose or one of the nitrogenous bases; the modifications consisting in the addition of non-nucleotide groups at the 6’, 5' and / or 3' ends are also included as well as phosphorodiamidate morpholino oligomers, peptide nucleic acids (PNAs; mimics of DNA in which the deoxyribose phosphate backbone is replaced by a pseudopeptide polymer to which the nucleobases are linked), and the like. “Oligonucleotides” may comprise, for example, antimiRNAs oligonucleotides, miRNA mimics oligonucleotides, antisense oligonucleotides, small interference RNAs and gapmers, or aptamers. “Oligonucleotides” may be also any sequence prepared from 2 to 100 nucleobases and including from 2 to 200 nucleobases.
[0113] The oligonucleotides may include so-called “bridged nucleic acids (BNA)” or “locked nucleic acids (LNA)” that refer to a modified RNA nucleotide, wherein a bridge connects the 2’ position of the sugar ring with the 4’ position.
[0114] The term "3' end", as used herein, designates the end of a nucleotide strand that has the hydroxyl group of the third carbon in the sugar-ring at its terminus. The term "5' end" or “6’ end”, as used herein, designates the end of a nucleotide strand that has the fifth carbon orsixth carbon in the sugar-ring at its terminus. Likewise, the term “2’ position”, “3’ position”, “4’ position”, “5’ position”, and “6’ position” refer to the corresponding carbon atom in the sugar ring, meaning that “2’ position” is the second carbon in the sugar ring, “3’ position” is the third carbon in the sugar ring, “4’ position” is the fourth carbon in the sugar ring, “5’ position” is the fifth carbon in the sugar ring, and “6’ position” is the sixth carbon in the sugar ring.
[0115] In the context of the present specification, the term "base labile” or “base labile function” refers to a chemical group or part of a molecule, that reacts under basic conditions, i.e. where the pH is > 7; whereas the term “acid labile” or “acid labile function” refers to a chemical group or part of a molecule, that reacts under neutral to acid conditions, i.e. where the pH is < 7. And the term “photo-labile” or “photo-labile function” refers to a chemical group or part of a molecule, that reacts when applying a specific irradiation or wavelength. In general, an orthogonal oligonucleotide synthesis is chosen, wherein “base labile”, “acid labile” and “photo-labile” groups are conveniently combined to allow assembling an oligonucleotide on the solid phase while necessary protecting group on individual oligonucleotides, the linkage to the solid phase and conjugates are maintained, until the oligonucleotide has been cleaved off the solid phase. These labile groups allow, for example, the use of protecting groups or the cleavage of an oligonucleotide from the solid support.
[0116] Throughout the specification, the term “protective group” refers to any group that is temporarily used to protect specific chemical functions, such as hydroxy functions, amino functions, and similar, before, during and after the oligonucleotide assembly on the solid phase. The individual protective groups are preferably chosen in a way to allow for an orthogonal oligonucleotide synthesis. Depending on what is required from the protecting groups, they may be, among others, acid labile, base labile and / or photo labile.
[0117] Throughout the specification, the term “solid support” refers to “solid phase” on which the oligonucleotide assembly takes place. The solid support may be a solid material, such as controlled pore glass or a polymer, but it includes also materials in a semi-solid state or that may be liquid under acidic and neutral pH conditions, and precipitate under basic pH conditions.
[0118] In the context of the specification, the term “linker” is used for functional groups that allow the attachment of a nucleotide or oligonucleotide to the solid support, preferably via its 3’ end, and that are stable under the conditions of the oligonucleotide synthesis. The “linker” is however designed in a manner that the oligonucleotide, once it has been assembled, may be easily cleaved off the solid support under specific conditions.In the context of the specification, the term “spacer” is used for functional groups that are used in any other position of a nucleotide or oligonucleotide to bind a specific conjugate, or molecule or functionality, but not in the position that is attached to or will be attached to the solid support. Depending on the conjugate, molecule or functionality that is introduced into the nucleotide or oligonucleotide, the spacer’s length can be adapted to provide the necessary flexibility that is required and can be further designed to be cleavable under specific conditions, if the subsequent application of the nucleotide or oligonucleotide so requires.
[0119] The term “conjugate” refers to hybrid molecules that combine the potential therapeutic properties of oligonucleotides with the delivery properties of a ligand or the enhancement of the therapeutic effect of a drug carrier. The presence of the conjugated ligand may also increase other properties of the oligonucleotide, such as stability to nucleases, contribute to binding to plasma proteins to avoid renal excretion, contribute to endosomal escape and / or increase the affinity to RNA targets.
[0120] The term “lipophilic” or “lipid residue” refers to molecules or functional groups that include a non-polar residue that may show better tendency to dissolve in non-polar solvents and prefer non-polar environments. For example, molecules or residues with medium to long carbon hydrogen chains would be classified as lipophilic.
[0121] In the context of the present specification, several reactions are carried our using a “coupling agent” or an “activation agent” to facilitate these reactions. Coupling agents are generally known and activation of chemical functionalities to improve the subsequent reaction with another molecule are well-known to the skilled person. The coupling agents and / or activation agents will be chosen depending on the chemical group that requires activation.
[0122] Throughout this specification, the terms “alkyl”, “alkenyl” and / or “alkynyl” refer to carbon hydrogen groups that may be linear, branched, acyclic, cyclic and / or adequately substituted with chemical groups, such as halogen, hydroxyl, amino, thiol, cyanide, sulfone, sulfoxide, carboxylic acid, and more. In the case of “alkenyl”, at least one C-C double bond is included; and in the case of “alkynyl”, at least on C-C triple bond is included.
[0123] In the context of the present specification, the term “kit” refers to the standard reagents and / or equipment necessary in oligonucleotide synthesis plus products of the present invention. For example, a kit may include a solid phase, the standard nucleotides, capping and cleaving agents, protective agents, one or two linker molecules and a lipid-conjugated nucleotide of the invention to allow for the solid phase synthesis of new oligonucleotides that includes a lipid-conjugated nucleotide.It is one object of the invention to provide a new method for preparing ligand-conjugated oligonucleotides that allows for a simple procedure for obtaining said oligonucleotides in good to excellent yields and at reasonable to low costs. Preferably, the invention has the objective to provide oligonucleotides that have been conjugated with lipophilic residues that can subsequently be used in therapeutic applications.
[0124] The prior art procedure for manufacturing ligand-conjugated oligonucleotides assembles first the desired oligonucleotide structure on a solid support. Once assembled, the oligonucleotide is cleaved from the solid support and then conjugated with a ligand that is able to provide the desired properties to the oligonucleotide. However, before the ligand can be conjugated, the oligonucleotide must first be purified and separated from any by-products and / or impurities that might remain from the oligonucleotide synthesis, such as failure sequences, or truncated oligonucleotides. Also, the purification is needed to avoid any degradation of the assembled oligonucleotide, to allow for a clean conjugation reaction and to allow for analytical measurements. This purification is normally done by HPLC technique which requires the necessary equipment, time and comes with the trade-off of losing some of the assembled oligonucleotide, which decreases the overall yield. After the purified oligonucleotide has then been reacted with the ligand and the ligand-conjugated oligonucleotide has been obtained, a second purification step is required to remove all the by-products from the conjugation reaction, non-conjugated oligonucleotides and due to any regulatory requirements, that require obtaining a pure product free of any impurities that might trigger adverse effects. Again, HPLC technique is used with the before-described disadvantages. Most importantly, the yield is further decreased which renders this preparation method eventually costly and undesired. The present inventors have now surprisingly found that the whole process of preparing a ligand-conjugated oligonucleotide can be carried out in a way that allows reducing the purification steps, while at the same time increasing yield and cost-efficiency of the resulting ligand-conjugated oligonucleotide.
[0125] While the prior art conjugates the ligand in the final step of the preparation, the present inventors have found that it is advantageous to use the first nucleoside of the desired oligonucleotide and introduce the ligand, then couple the resulting nucleoside ligand derivative to a solid support and then assemble the desired oligonucleotide. Once, the assembly on solid support is done, the ligand-conjugated oligonucleotide can be cleaved off the solid support and requires only one single purification step and can then be further used for its therapeutic applications. This new approach reduces manufacturing steps, purification steps while costefficiency and yield are improved.A category of preferred ligand-conjugated oligonucleotides are lipid-conjugated nucleotides. Here, a lipophilic molecule based on fatty acids, fatty alcohols, fatty aldehydes, fatty amines, sterols, diglycerides or phospholipids is conjugated to an oligonucleotide to allow for better cellular uptake, better stability or even better bioavailability of the oligonucleotide.
[0126] Hence, in one aspect of the invention, a new method for linking a nucleoside lipid derivative to a solid support is provided. The solid support is one that is suitable for manual or automated solid support oligonucleotide synthesis. For example, non-swellable or low-swellable solid supports may be used. For example, the solid support may be controlled pore glass (CPG) that is adequately functionalised with chemical groups that allow for coupling of a nucleoside to the solid support in 3’ position. Any pore size may be employed and may be selected depending on the size of the oligonucleotide that has to be prepared. Alternatively, polystyrene resins, such as microporous polystyrene (MPPS), that are adequately functionalised with chemical groups that allow for coupling of a nucleoside to the solid support in 3’ position can be used. Other possible solid supports may be polystyrene-divinylbenzene solid supports, silica gel solid supports, polyethylene glycol solid supports or polyamide solid supports, or even copolymers thereof, all of which are adequately functionalised with chemical groups that allow for coupling of a nucleoside to the solid support in 3’ position.
[0127] Preferably, the adequate functionalisation of the solid support is carried out with molecules having an amino function. For example, solid supports can be functionalised with aminopropyl or aminomethyl groups. However, other functionalisation may be used, provided it is suited for coupling a nucleoside in 3’ position.
[0128] Most preferably, the solid support is an amino-functionalised solid support. And even more preferably, the solid support is an amino-functionalised CPG solid support.
[0129] The present inventors have found that it is advantageous that the first nucleoside, that will be coupled to the solid support, has the lipid ligand already conjugated thereto and represents thus a nucleoside lipid derivative.
[0130] Preferably, this nucleoside lipid derivative has the structure of formula (I):
[0131]
[0132] In formula (I), the lipid residue has been introduced in 3’ position, whereas the 5’ position (when m = 1) or 6’ position (when m = 2) is protected with a protecting group PG. This 5’ or 6’ protecting group is chosen to allow for a standard orthogonal oligonucleotide synthesis approach and, preferably, is an acid labile protecting group. Possible 5’ or 6’ protecting groups are selected from the group consisting of a trityl group, a 4-methoxytrityl group, a 4,4’-dimethoxytrityl group, a 2-(dibromomethyl(benzoyl (Dbmb) group, a 2-(isopropyl-thiomethoxymethyl)-benzoyl (Ptmt) group, or a pixyl (Px) group. More preferably, PG is a 4,4’-dimethoxytrityl (DMT) group that can be removed during the oligonucleotide synthesis using an acid, such as trichloroacetic acid (TCA) or dichloroacetic acid (DCA). Alternatively, also photolabile protecting groups may be used in 5’ or 6’ position, such as alpha-methyl-o-nitropiperonyloxycarbonyl (MeNPOC), 2-nitrophenylpropoxycarbonyl (NPPOC), benzoyl-2-(2-nitrophenyl)propoxycarbonyl (Bz-NPPOC), thiophenyl-2-(2-nitrophenyl)propoxycarbonyl (SPh-NPPOC), 2-nitrophenylethoxycarbonyl (NPEOC), 3’,5’-dimethoxybenzoinoxycarbonyl (DM BOG), or a 5’-aryloxycarbonate group.
[0133] The nucleobases Nb may be selected from any natural or unnatural nucleobases. Preferably, the nucleobases are selected from the group consisting of adenine, guanine, thymine, uracil, cytosine, hypoxanthine, xanthine, 7-methylguanine, 2,6-diaminopurine, 2-aminopurine, 6-thioguanine, 5,6-dihydrouracil, 5-methylcytosine, 5-hydroxymethylcytosine, or derivatives thereof. More preferably, the nucleobases are selected from the group consisting of adenine, guanine, thymine, uracil, cytosine, or derivatives thereof. The nucleobases may bear adequate protecting groups where the therapeutic application or the oligonucleotide synthesis requires it so.
[0134] The 5-membered ring structure and the 2’ and 4’ position may be modified according to the desired use or application. For example, in the position Y in the 5-membered ring may be O, S, CH2, CHF, CF2 or may even be -CH=CH- and thus form a 6-membered ring. Preferably, Y is O.The 2’ and 4’ position may have different substituents depending on the intended use. Substituents in 2’ and 4’ position may be chosen in a way to enhance stability, binding affinity or resistance of the nucleosides against undesired conditions. For example, in 2’ position is a substituent Ri, while in 4’ position there is substituent R2.
[0135] Substituent R1 may be H, halogen, OZ1, or NRsRg; wherein Z1 may be H, C1-C4 alkyl, C1-C4 alkyl-oxy-C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl or a protecting group; and wherein Rs and R9 may be independently from each other H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, carbonyl- C1-C4 alkyl, carbonyl-C2-C4 alkenyl, carbonyl-C2-C4 alkynyl, carbonylamino-C1-C4 alkyl, carbonylamino-(C1-C4 alkyl)2 or a protecting group. Preferably, substituent R1 may be H, fluor, OZ1; wherein Z1 may be H, methyl, ethyl, methyloxymethyl, methyloxyethyl, ethyloxymethyl, ethyloxyethyl, vinyl, allyl, propargyl, or a silyl or acyl protecting group.
[0136] Substituent R2 may be H, halogen, or OZ2; wherein Z2 may be H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl or a protecting group. Preferably, substituent R2 may be H, or OZ2; wherein Z2 may be H, methyl, ethyl, or a benzoyl or acetyl protecting group.
[0137] Alternatively, R1 and R2 together may form a bridge. Such nucleosides are also known as bridged nucleic acids (BNA) or locked nucleic acids (LNA). Preferably, R1 and R2 form a bridge between the 4’ carbon and the 2’ oxygen or 2’ nitrogen. More preferably, R1 and R2 form a bridge in the form of R1-R2 = O-CH2, wherein the 4’ carbon is connected to a 2’ oxygen via a methylene group, or a bridge in the form of R1-R2 = NR8R9-CH2, wherein the 4’ carbon is connected to the 2’ nitrogen via a methylene group and Rs and R9 are defined as above. In 3’ position is the phosphate building block when G is O, or the phosphorothioate building block when G is S, or the phosphoramidate linkage when G es NH, or the mesyl phosphoramidate linkage when G es N-SO2CH3. This phosphate or phosphorothioate or phosphororamidate or mesyl phosphoramidite bears a leaving group LG that may be NR3R4, SRs or ORs. When said leaving group is NR3R4 then R3 and R4, independently from one another, may be H, methyl, ethyl, linear or branched C3-C6 alkyl, or R3 and R4 together may form a C2-C5 ring structure. When said leaving group is SRs or ORs, then Rs and Rs, independently from one another, may be H, methyl, ethyl, 2-cyanoethyl, linear or branched C3-C6 alkyl or a negative charge. Preferably, LG is SRs or ORs. More preferably, LG is ORs. Even more preferably, LG is ORs, wherein Rs is H, methyl, ethyl, 2-cyanoethyl, ora negative charge. In formula (I), the 3’ phosphate or phosphorothioate group has been conjugated with the lipophilic ligand “Lipid”. This lipid ligand “Lipid” is a lipophilic residue of a fatty acid, a fatty alcohol, a fatty aldehyde, a fatty amine, a sterol, a diglyceride or a phospholipid. Preferably, the “Lipid” is a lipophilic residue selected from the group consisting of oleic acid residue,palmitic acid residue, myristic acid residue, stearic acid residue, lauric acid residue, elaidic acid residue, myristoleic acid residue, palmitoleic acid residue, linoleic acid residue, a-linolenic acid residue, y-linolenic acid residue, vaccenic acid residue, arachidonic acid residue, docosahexaenoic acid residue, oleyl alcohol residue, stearyl alcohol residue, palmitoleyl alcohol residue, cetyl alcohol residue, myristyl alcohol residue, lauryl alcohol residue, decyl alcohol residue, capryl alcohol residue, octanal residue, decanal residue, dodecanal residue, perfluorooctylpropyl residue, perfluorooctylethyl residue, perfluorooctylmethyl residue, perfluorohexylpropyl residue, perfluorohexylethyl residue, perfluorohexylmethyl residue, tertbutyl residue, adamantyl residue, tert-butyl residue or cholesteryl residue. More preferably, the “Lipid” is a lipophilic residue selected from the group consisting of oleic acid residue, palmitic acid residue, myristic acid residue, stearic acid residue, lauric acid residue, myristoleic acid residue, palmitoleic acid residue, linoleic acid residue, a-linolenic acid residue, y-linolenic acid residue, vaccenic acid residue, arachidonic acid residue, docosahexaenoic acid residue, oleyl alcohol residue, stearyl alcohol residue, palmitoleyl alcohol residue, cetyl alcohol residue, myristyl alcohol residue, lauryl alcohol residue, decyl alcohol residue, capryl alcohol residue, octanal residue, decanal residue, dodecanal residue, perfluorooctylpropyl residue, perfluorooctylethyl residue, perfluorooctylmethyl residue, perfluorohexylpropyl residue, perfluorohexylethyl residue, perfluorohexylmethyl residue, tert-butyl residue, adamantyl residue or cholesteryl residue.
[0138] The ’’Lipid” may be bound directly the phosphate or phosphorothioate oxygen (n = 0) or may be bound to the phosphate or phosphorothioate via a spacer molecule Q (n = 1). This may depend on the size of the “Lipid”, its conformational flexibility and its steric needs, since this might influence the outcome of the coupling to the solid support. If a spacer molecule is used, the spacer molecule Q may be selected from the group consisting of linear or branched C1-C8 alkyl, linear or branched C2-C8 alkenyl, linear or branched C2-C8 alkynyl, (C1-C3 alkyl)-O-(C1-C3 alkyl), (C1-C3 alkyl)-S-(C1-C3 alkyl), or (C1-C8 alkyl)-S-S-(C1-C8 alkyl). Preferably, Q may be selected from the group consisting of (CH2)2, (ChLh, (CH2)4, (ChLjs, (CH2)e, (ChL)?, (CH2)8, CH2-O-CH2, (CH2)2-O-(CH2)2, (CH2)3-O-(CH2)3, (CH2)2-S-(CH2)2, (CH2)3-S-S-(CH2)3, or (CH2)6-S-S-(CH2)e. These spacers Q may provide the necessary flexibility for the lipid residues and reduce steric hindrance. The spacers Q based on ethers, thioesters and disulfides may additionally improve solubility in water and improve PEGylation. These spacers may offer better compatibility with PEG chains, facilitating conjugation and extending the drug’s stability and half-life in the body. Additionally, the chemical flexibility and degradability of these spacers may allow for controlled release, further optimizing therapeutic efficacy. Additionally, disulfide-based spacers may be reductively cleaved within a cell to deliver the oligonucleotide free from the lipid residue. This connecting unit X between spacer molecule Q and “Lipid” may beselected from the group consisting of -O-, -S-, -NH-, -N=, or a direct bond. Preferably, X is selected from the group consisting of from the group consisting of -O-, -NH-, -N=, or a direct bond.
[0139] The nucleoside lipid derivative is prepared from common starting materials. For the nucleoside part, a nucleoside phosphoramidite may be chosen. The nucleoside phosphoramidite is provided first with adequate protecting groups in 5’ position, in 2’ position if required, and in the nucleobase where necessary. Then, the nucleoside phosphoramidite is reacted with a lipophilic molecule selected from the group of fatty acids, fatty alcohols, fatty aldehydes, fatty amines, sterols, diglycerides or phospholipids, so that the corresponding lipophilic residue is introduced into the 3’ position of the nucleoside phosphoramidite. The lipophilic residue may be directly connected to the 3’ phosphorous group or the lipophilic residue may be connected via a spacer molecule situated between the lipophilic residue and the 3’ phosphorous group. In one embodiment, the lipophilic molecule may be used directly or in an activated form to facilitate the reaction with the phosphorous atom and conjugate the nucleoside directly with a lipophilic molecule without using a spacer molecule. This provides a more compact structure, enhances the hydrophobic properties and represents an easier way to obtain said lipid-conjugated oligonucleotides.
[0140] In another embodiment, the lipophilic molecule may first be reacted with a spacer molecule, and the lipophilic residue is then conjugated to the phosphoramidite via the spacer moiety. Alternatively, the nucleoside phosphoramidite may be first reacted with the spacer molecule, and then in a subsequent, separate reaction, the lipophilic molecule is reacted with the conjugated spacer molecule to obtain the desired lipid-conjugated nucleoside. The use of the spacer may improve solubility in water, allow for additional biological interactions, including cellular uptake, and enhance the conformational flexibility. A spacer may also provide additional stability against metabolic degradation.
[0141] For these reaction, coupling agents, activation agents, and corresponding catalysts, such as diisopropylcarbodiimide (DCI), dicyclohexylcarbodiimide (DCC), carbonyldiimidazole (GDI), ethyl-(N’,N’-dimethylamino)propylcarbodiimide hydrochloride (EDC), benzotriazol-1-yl-oxytris(pyrrolidino)phosphonium hexafluorophosphate (PyBOP), O-(Benzotriazol-l-yl)-N,N,N’,N’-tetramethyluronium tetrafluoroborate (TBTLI), O-(Benzotriazol-1-yl)-N,N,N’,N’-tetramethyluronium hexafluorophosphate (HBTLI), tetrazole, hydroxybenzotriazole (HOBt), 4-(N,N-dimethylamino)pyridine (DMAP), and similar may be used. These coupling agents are used mostly to improve the yield and avoid undesired by-products.Preferably, the nucleoside lipid derivative is prepared, and / or obtainable, by reacting (A) a nucleoside phosphoramidite of formula (VII):
[0142]
[0143] Formula (VII)
[0144] with (B) a compound of formula (VIII):
[0145] Lipid
[0146] "
[0147]
[0148] Formula (VIII)
[0149] wherein Y, PG, Ri, R2, Nb, and m, and Q, X, Lipid, and n are defined as described above. The conjugation of the nucleoside phosphoramidite with the lipophilic molecule is followed directly by the oxidation or the sulfurisation of the 3’ phosphorous atom to convert phosphorous(lll) into phosphorous(V) to obtain a phosphate or a phosphorothioate. In one embodiment, this reaction is performed using a one-pot-approach, wherein the lipid-conjugated phosphoramidite is not isolated before oxidation or sulfurisation.
[0150] The resulting compound of this reaction is the nucleoside lipid derivative of formula (la):
[0151]
[0152] Formula (la),wherein LG is 2-cyanoethyl. This compound may be used directly for the subsequent reaction steps necessary to attach the nucleoside lipid derivative to a solid support. Alternatively, the 2-cyanoethyl group may be replaced by another leaving group LG selected from the group consisting of NR3R4, SRs or ORe, wherein R3 and R4, independently from one another, is H, methyl, ethyl, linear or branched C3-C6 alkyl, or R3 and R4 together form a C2-C5 ring structure; and wherein Rs and Rs, independently from one another, is H, methyl, ethyl, linear or branched C3-C6 alkyl or a negative charge.
[0153] Preferably, compound of formula (la) is treated under basic conditions to eliminate the 2-cyanoethyl group and obtain the nucleoside lipid derivative of formula (lb):
[0154]
[0155] wherein LG is a negative charge. The elimination of the 2-cyanoethyl group is carried out under basic conditions using for example triethylamine (TEA), or diazabicycloundecene (DBU), or 1,4-diazabicyclo[2.2.2]octane (DABCO), diazabicyclononene (DBN), or N,N-diisopropylethylamine (DI PEA). Preferably, DBU is used because it provides complete conversion from the compound of formula (la) to compound of formula (lb) in less time. In the course of the reaction, the base is protonated and then forms the positively charged counterion for the compound of formula (lb).
[0156] The compound of formula (I) can then be coupled to the solid support for the subsequent oligonucleotide synthesis in two different ways. Preferably, compound of formula (lb) is used for the attachment to the solid support.
[0157] One way of attachment to a solid support: Compound of formula (I) is coupled directly to a linker-functionalised solid support, wherein the linker comprises a base labile group ora photo-labile group for the later cleavage of the assembled oligonucleotide from the solid support. The attachment of nucleosides to a solid support is carried out using standard techniques, wherein the compound of formula (I) is first activated before it is coupled via its phosphorous group to the solid support. Activating agents may be, for example, triisopropylsilyl chloride and N-methylimidazole. But also any of diisopropylcarbodiimide (DCI), dicyclohexylcarbodiimide (DCC), carbonyldiimidazole (CDI), ethyl-(N’,N’-dimethylamino)propylcarbodiimide hydrochloride (EDC), benzotriazol-1-yl-oxytris(pyrrolidino)phosphonium hexafluorophosphate (PyBOP), O-(Benzotriazol-l-yl)- N,N,N’,N’-tetramethyluronium tetrafluoroborate (TBTLI), O-(Benzotriazol-1-yl)-N,N,N’,N’-tetramethyluronium hexafluorophosphate (HBTLI), tetrazole, hydroxybenzotriazole (HOBt), or 4-(N,N-dimethylamino)pyridine (DMAP) may be used.
[0158] This method allows the attachment of the nucleoside lipid derivative of formula (I) to the solid support, but only in very low yields. Even after a double coupling step, that is repeating the coupling reaction with fresh reagents to load more nucleoside lipid derivative on the solid support, the yields obtained are in the range of about 5%. Without being bound to any theory, the inventors believe that there may be an effect of steric impediment between the lipid residue on the nucleoside lipid derivative and the linker attached to the solid support that impedes the bonding of the nucleoside lipid derivative to the solid support.
[0159] Hence, preferably another way of attachment to the solid support is used. In this case, the compound of formula (I), preferably the compound for formula (lb), is further modified in solution with at least one linker molecule suited for coupling the nucleoside lipid derivative via its 3’ position to a solid support, said at least one linker molecule comprising a base labile function or a photo-labile function. Preferably, the at least one linker molecule comprises a base labile function. That means that in formula (I), the group LG is replaced by said at least one linker molecule, wherein said at least one linker molecule may be any linker that is suited for coupling a nucleoside via its 3’ position to a solid phase and can later be cleaved under basic conditions to allow for an orthogonal oligonucleotide synthesis approach. In one embodiment, only one linker molecule is used. In another embodiment, two or more linker molecules are used. In still another embodiment, the linker molecule may be built up consecutively in two or more subsequent steps.
[0160] Hence, the at least one linker may be introduced into the nucleoside lipid derivative of formula (I) in one reaction step, or, in two or more steps where the linker is based on two or more starting materials or where two or more linker are used together as a bigger linker unit. For example, the base-labile 2,2’-sulfonyl diethanol linker is normally reacted with succinic acid to obtain some distance of the linker from the solid support. Hence, this sulfonyl linker may be introduced into the nucleoside lipid derivative of formula (I) either in one step, or in two steps, where first the sulfonyl part is introduced and then in the second step the succinic residue. This way allows to convert the nucleoside lipid derivative of formula (I) into the compound of formula (IX):
[0161]
[0162] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined as described above; G1 and G2 are independently form each other O or S; and L is a linker molecule suited for coupling the nucleoside lipid derivative via its 3’ position to a solid support, said linker molecule comprising a base labile function.
[0163] Preferably, the linker molecule L is selected from the group consisting of 2’-ethylsulfone-2-ethyl hemisuccinate, 3-nitro-4-(2-hydroxyethyl)methylbenzoate, fluorenylmethyl (Fm), or4-((2-hydroxyethyl)sulfonyl)benzamide. More preferably, the linker molecule L is selected from the group consisting of 2’-ethylsulfone-2-ethyl hemisuccinate, or 3-nitro-4-(2-hydroxyethyl)methylbenzoate.
[0164] The advantage of introducing the at least one linker molecule into the nucleoside lipid derivative of formula (I) is that the at least one linker molecule as such is a small molecule and the steric impediment with the lipophilic residue is avoided. Hence, better yields up to 40% can be achieved. Moreover, the at least one linker molecule can be tailored specifically to match the size of the lipophilic residue allowing thus a better attachment to the solid support.
[0165] In a preferred embodiment, the nucleoside lipid derivative of formula (IX) is selected from the group consisting of compounds of formula (II), compounds of formula (III), or compounds of formula (V):
[0166]
[0167] Formula (V);1
[0168] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, G1, G2, m and n are defined as described above, and wherein R? is H, methyl or ethyl.
[0169] Any of the compounds of formula (IX), (II), (III) or (V) may be used as single oligonucleotide building blocks. These compounds may be used in in vitro oligonucleotide synthesis in order to assemble lipid conjugated oligonucleotides. These compounds may be used as such or they may be provided in compositions comprising either one of compounds of formula (IX), (II), (III) or (V), and then the compositions comprising these compounds may be used in in vitro oligonucleotide synthesis to assemble lipid conjugated oligonucleotides.
[0170] The compounds of formula (IX), (II), (III) or (V) are then coupled to the solid support using standard techniques that comprise activating either the solid support or the linker molecule in the compound of formula (IX), (II), (III) or (V). Standard techniques may involve the coupling of a compound of formula (IX) to the solid support in the presence of dithiobis(nitropyridine) (DTNP) and triphenylphosphate (TPP), and once the coupling reaction has finished, the solid support is treated with one or more capping solutions that contain a capping agent suitable to block all the remaining functional groups of the solid support that did not react with the compound of formula (IX).
[0171] Hence, the method of linking the nucleoside lipid derivative to the solid support comprises the following steps:
[0172] a. providing a nucleoside lipid derivative of formula (I); b. reacting the nucleoside lipid derivative of formula (I) with at least one linker molecule suited for coupling the resulting compound via its 3’ position to a solid support, said at least one linker molecule comprising a base labile function; and c. coupling the resulting compound of step b) to a solid support.
[0173] Preferably, steps a) and b) are carried out in solution.
[0174] Once the nucleoside lipid derivative has been attached to the solid support, the desired lipid-conjugated oligonucleotide can be assembled on solid support using standard technology. In the present invention, the method of manufacturing an oligonucleotide comprising in position 3’ a lipophilic residue selected from the group consisting of fatty acid residues, fatty alcohol residues, fatty aldehyde residues, fatty amine residues, sterol residues, diglyceride residues or phospholipid residues, comprises the steps of:
[0175] a. carrying out the method of linking a nucleoside lipid derivative of formula (I) to a solid support as described above; and b. assembling an oligonucleotide using the nucleoside lipid derivative of formula (I) coupled to a solid support as the 3’-oligonucleotide starting point.Said method of manufacturing an oligonucleotide comprising in position 3’ a lipophilic residue may further comprise the steps of:
[0176] c. once the oligonucleotide sequence is complete, removing all protecting groups; d. cleavage of the assembled oligonucleotide from the solid support; and e. optionally, purification of the oligonucleotide.
[0177] Oligonucleotide synthesis is a common technology nowadays, and they are manufactured almost exclusively using automated solid-phase methods. Solid-phase synthesis is widely used in peptide synthesis, oligonucleotide synthesis, oligosaccharide synthesis and combinatorial chemistry. Solid-phase synthesis is carried out on a solid support held between filters, in columns that enable all reagents and solvents to pass through freely. Solid-phase synthesis has a number of advantages over solution synthesis, such as the use of large excesses of solution-phase reagents to drive reactions quickly to completion, washing away impurities and excess reagents so that no purification is required after each step, or having the possibility to automate the process on computer-controlled solid-phase synthesizers.
[0178] Solid supports (also called resins) are the insoluble particles, typically 50-200 pm in diameter, to which the oligonucleotide is bound during synthesis. The solid supports useful in the present invention have been mentioned above, and may comprise controlled pore glass (CPG), polystyrene resins, such as microporous polystyrene (MPPS), polystyrene-divinylbenzene solid supports, silica gel solid supports, polyethylene glycol solid supports or polyamide solid supports, or even copolymers thereof.
[0179] Several methods of solution-phase oligonucleotide synthesis have been devised over the years, of which the phosphoramidite method, pioneered by Marvin Caruthers in the early 1980s, and enhanced by the application of solid-phase technology and automation, is now firmly established as the method of choice. Phosphoramidite oligo synthesis proceeds in the 3'- to 5'-direction (opposite to the 5'- to 3'-direction of DNA biosynthesis in DNA replication). One nucleotide is added per synthesis cycle. The phosphoramidite DNA synthesis cycle consists of a series of steps, such as detritylation, activation and coupling, capping, oxidation, detritylation to start a new cycle. When the final oligonucleotide has been assembled, the oligonucleotide can be cleaved after detritylation from the support and then deprotected to provide all functional groups for their further use. A general description for the phosphoramidite DNA synthesis cycle is outlined below in order to provide an example.
[0180] At the beginning of oligonucleotide synthesis, the first protected nucleoside is pre-attached to the resin and the operator selects an A, G, C or T synthesis column depending on the nucleoside at the 3'-end of the desired oligonucleotide. The support-bound nucleoside hasnormally a 5'-DMT protecting group (DMT = 4,4'-dimethoxytrityl), the role of which is to prevent polymerization during resin functionalization, and this protecting group must be removed (detritylation) from the support-bound nucleoside before oligonucleotide synthesis can proceed.
[0181] Following detritylation, the support-bound nucleoside is ready to react with the next base, which is added in the form of a nucleoside phosphoramidite monomer. A large excess of the appropriate nucleoside phosphoramidite is mixed with an activator (tetrazole or any of those mentioned above), both of which are dissolved in acetonitrile (a good solvent for nucleophilic displacement reactions). The diisopropylamino group of the nucleoside phosphoramidite is protonated by the activator and is thereby converted to a good leaving group. It is rapidly displaced by attack of the 5'-hydroxyl group of the support-bound nucleoside on its neighbouring phosphorus atom, and a new phosphorus-oxygen bond is formed, creating a support-bound phosphite triester.
[0182] It is not unreasonable to expect a yield of 99.5% during each coupling step, but even with the most efficient chemistry and the purest reagents it is not possible to achieve 100% reaction of the support-bound nucleoside with the incoming phosphoramidite. This means that there will be a few unreacted 5'-hydroxyl groups on the resin-bound nucleotide; if left unchecked, these 5'-hydroxyl groups would be available to partake in the next coupling step, reacting with the new incoming phosphoramidite. The resulting oligonucleotide would lack one base and would correspond to a deletion mutation of the desired oligo. If such deletion mutations were left unchecked, they would accumulate with each successive cycle, and the final product would be a complex mixture of oligonucleotides, most of which would carry incorrect genetic information, and which would be difficult to purify. This would ruin any subsequent biochemical experiment. Hence, a "capping" step is introduced after the coupling reaction, to block the unreacted 5'-hydroxyl groups. Two capping solutions are used on the synthesizer: acetic anhydride and N-methylimidazole (NMI). These two reagents (dissolved in tetra hydrofuran with the addition of a small quantity of pyridine) are mixed on the DNA synthesizer prior to delivery to the synthesis column. The electrophilic mixture rapidly acetylates alcohols, and the pyridine ensures that the pH remains basic to prevent detritylation of the nucleoside phosphoramidite by the acetic acid formed by reaction of acetic anhydride with NMI. Acetylation of the 5'-hydroxyl groups renders them inert to subsequent reactions.
[0183] The phosphite-triester (P(lll)) formed in the coupling step is unstable to acid and must be converted to a stable (P(V)) species prior to the next TCA detritylation step. This is achieved by iodine oxidation in the presence of water and pyridine. The resultant phosphotriester is effectively a DNA backbone protected with a 2-cyanoethyl group. The cyanoethyl groupprevents undesirable reactions at phosphorus during subsequent synthesis cycles. On some DNA synthesizers there is a second capping step after iodine oxidation. The purpose of this is to dry the resin, as residual water from the oxidation mixture can persist and inhibit the next coupling reaction. The excess water reacts with the acylating agent to form acetic acid which is washed away in the THF / pyridine solvent mixture.
[0184] After phosphoramidite coupling, capping and oxidation, the DMT protecting group at the 5'-end of the resin-bound DNA chain must be removed so that the primary hydroxyl group can react with the next nucleotide phosphoramidite. Deprotection with trichloroacetic acid in dichloromethane is rapid and quantitative. An orange colour is produced by cleaved DMT carbocation, which absorbs in the visible region at 495 nm. The intensity of this absorbance is used to determine the coupling efficiency. Most commercially available DNA synthesizers have hardware to measure and record the trityl yield for each cycle so that the efficiency of synthesis can be monitored in real time. The cycle is repeated, once for each base, to produce the required oligonucleotide.
[0185] The linker is the chemical entity that attaches the 3’-end of the oligonucleotide to the solid support. It must be stable to all the reagents used in solid-phase oligonucleotide assembly, but cleavable under specific conditions at the end of the synthesis. The linker used most frequently in oligonucleotide synthesis is the succinyl linker. This is readily cleaved by treatment with concentrated ammonium hydroxide at room temperature for one hour. But other base-labile or photolabile linker may be used as well.
[0186] The cleavage reaction is carried out automatically on some synthesizers, and the ammoniacal solution containing the oligonucleotide is delivered to a glass vial. Alternatively, the cleavage can be carried out manually by taking the column off the synthesizer and washing it with syringes containing ammonium hydroxide.
[0187] Finally, the oligonucleotide, now dissolved in concentrated aqueous ammonia, is heated to remove the protecting groups from the heterocyclic bases and phosphodiester backbone. The aqueous solution is then removed by evaporation and the oligonucleotide is ready for purification.
[0188] In one embodiment of the present invention, solid supports are provided that have been functionalised with a lipid-conjugated oligonucleotide based on formula (I).
[0189] In one preferred embodiment, the functionalised solid support is a compound of formula (IV):
[0190]
[0191] wherein Y, PG, R1, R2, Nb, Q, X, Lipid, m and n are defined as described above, G1 and G2 are independently from each other O or S, and wherein SP stands for solid phase and represents a solid support, such as controlled pore glass (CPG), polystyrene resins, such as microporous polystyrene (MPPS), polystyrene-divinylbenzene solid supports, silica gel solid supports, polyethylene glycol solid supports or polyamide solid supports, or even copolymers thereof.
[0192] In another preferred embodiment, the functionalised solid support is a compound of formula (VI):
[0193]
[0194] Formula (VI),
[0195] wherein Y, PG, R1, R2, Nb, Q, X, Lipid, m and n are defined as described above, G1 and G2 are independently from each other O or S, and wherein SP stands for solid phase andrepresents a solid support, such as controlled pore glass (CPG), polystyrene resins, such as microporous polystyrene (MPPS), polystyrene-divinylbenzene solid supports, silica gel solid supports, polyethylene glycol solid supports or polyamide solid supports, or even copolymers thereof.
[0196] The present invention also provides kits for the oligonucleotide synthesis that comprise one or more of the compounds of formula (II), formula (III), formula (IV), formula (V), and / or formula (VI), together with the necessary reagents and solutions for assembling a lipid-conjugated oligonucleotide. The necessary reagents may include one or more of any solid phase suitable for oligonucleotide synthesis, linker molecules to attach a nucleotide via its 3’ end to the solid phase and start the oligonucleotide assembly, suitable capping and cleaving agents, protective groups for the oligonucleotide synthesis, coupling and / or activation agents, natural and / or unnatural nucleotides, such as adenine, guanine, thymine, uracil, cytosine, hypoxanthine, xanthine, 7-methylguanine, 2,6-diaminopurine, 2-aminopurine, 6-thioguanine, 5,6-dihydrouracil, 5-methylcytosine, 5-hydroxymethylcytosine, or derivatives thereof, and any else reagent that may be required during oligonucleotide assembly. In some cases, the kit may also include the lipid ligand and, if required, a corresponding spacer molecule to prepare a lipid-conjugated nucleotide from scratch. In other cases, the kit may include a solid phase that has already been loaded with a starting nucleotide. In still another cases, the kit may include a solid phase that has already been loaded with a starting nucleotide conjugated with a lipid ligand, such as compounds of formula (IV) or (VI).
[0197] The present invention covers all possible combinations of general, particular and preferred embodiments described herein.
[0198] The following non-limiting examples will further illustrate specific embodiments of the invention. They are, however, not intended to be limiting the scope of the present invention in any way.
[0199] EXAMPLES
[0200] Equipment and methods
[0201] NMR spectroscopy
[0202] NMR spectra (1H,13C and31P) were measured on a Varian Mercury-400 (1H, 400 MHz;31P, 161 MHz;13C, 101 MHz). Chemical shifts for1H- and13C-NMR are given in parts per million (ppm) from tetramethylsilane and J values are given in Hertz (Hz). All the spectra were internally referenced to CDCh (6H 7.24, be 77.0).Mass spectroscopy
[0203] Mass Spectroscopy MS-(MALDI-TOF) was recorded on a MALDI Voyager DE RP time-of-flight (TOF) spectrometer (Applied Biosystems) using a matrix of 2’,4’,6’-trihydroxyacetophenone monohydrate (THAP) and ammonium citrate dibasic.
[0204] Mass spectroscopy (electrospray) was recorded on a UPLC-QTOF. Samples were dissolved in acetonitrile to a 1 mg / ml concentration and were injected directly to the mass spectrometer with a 50% acetonitrile / water solution.
[0205] HPLC analysis
[0206] HPLC analysis was performed on a Waters 2695 Separations Module from Waters, equipped with a Waters 2998 Photodiode Array Detector. Analytical HPLC was performed on reversed-phase columns: XBridge OST C182.5 pm column and a Nucleosil 120 C18 column (25 x 0.4 cm). The solvents used in the XBridge and Nucleosil columns were prepared with triethylammonium acetate (TEAAc) and acetonitrile as the mobile phase. Buffer A: 5% ACN in 0.1 M (TEEAc) and buffer B: 70% ACN in 0.1 M (TEEAc). A linear gradient of 5-80% B in 25 min was used.
[0207] Oligonucleotide synthesis
[0208] Oligonucleotides were synthesized on an H-8 DNA synthesizer (K&A Laboratories, Germany) using standard phosphoramidites and ancillary reagents. The 5’-O-DMT-protected 2-cyanoethyl phosphoramidites of the natural 2’-deoxynucleosides were protected in the nucleobases as follows: Benzoyl (Bz) group for protection of dA and dC; and isobutyryl (ibu) or formamidino group for the protection of dG. 5-benzylthio-1H-tetrazole (BTT) was used as coupling agent (0.3 M in acetonitrile).
[0209] Abbreviations:
[0210] - 5’-DMT-T: 5'-O-(4,4'-Dimethoxytrityl)thymidine
[0211] - 5’-DMT-LNA ABz: 5'-O-(4,4'-Dimethoxytrityl) 2'-O,4'-C-methylene (N- benzoyl)adenosine
[0212] - 5’-DMT-dABz: 5'-O-(4,4'-Dimethoxytrityl) (N-benzoyl)deoxyadenosine
[0213] - AL: LNA-A
[0214] Ancillary reagents:
[0215] Capping solution A: tetrahydrofuran / pyridine / acetic anhydride (8:1:1 v / v).
[0216] Capping solution B: 10% N-methylimidazole in tetra hydrofuran.
[0217] Oxidizer: 0.02 M iodine solution in tetrahydrofuran / pyridine / water, (89.6:0.4; 10 v / v).Detritylation: 3% trichloroacetic solution in dichloromethane.
[0218] Cleavage: The phosphate and base-protecting groups and the oligonucleotide-solid support link were removed by treatment of the support with concentrated ammonia at 55 °C for more than 6 hours.
[0219] Purification by NAP-10 columns: NAP-10 columns are typically small volume columns (1 mL) used for removing salts. NAP-10 columns contain Sephadex G-25, which is a dextran-based gel filtration medium that is designed for size exclusion chromatography. It consists of crosslinked dextran, which forms a porous structure allowing small molecules to pass through while retaining larger molecules.
[0220] Determination of oligonucleotide amount after purification: The oligonucleotide solutions obtained after purification were measured in a LIV-VIS spectrometer at 260 nm and the measured absorption allowed to determine the optical density (O.D.) of the sample. As a standard, one O.D, is the amount of oligonucleotide in 1 mL of solution that exhibits an A260 of 1.0 in a light pathlength of 1.0 cm.
[0221]
[0222] oleate 1
[0223] 4-nitrophenol (1.39 g, 10 mmol) was dissolved in 20 mL of dichloromethane and 5.6 mL of triethylamine (40 mmol) were added. The solution was cooled with an ice bath and then 3.3 mL of oleyl chloride were added dropwise in a period of 5 minutes. At the end of the addition, the reaction was removed from the ice bath and stirred at room temperature for 1 hour. A large precipitate of triethylammonium hydrochloride formed. The mixture was diluted with dichloromethane and the organic phase was washed with brine (3 x 30 mL), saturated sodium bicarbonate in water (3 x 30 mL) and again with brine (2 x 30 mL). The organic phase was dried (MgSCL) and concentrated to dryness. An oil was obtained (3.24 gr, 81%), which was used without further purification.
[0224] p-Nitrophenyl oleate (1)1H-NMR (CDCI3, 400 MHz) 5 = 8.2 (d, 2H, HAr), 7.2 (d, 2H, HAr), 5.2 (m, 2H, CH=CH), 2.5 (t, 2H, CH2-CO), 2.0 (m, 4H, CH2-alkene), 1.7 (t, 2H, CH2-CH2-CO), 1.3-1.2 (22H, m, alkyl chain), 0.8 (3H, t, CH3).13C NMR (101 MHz, CDCh) 6 = 171.3 (CO), 155.5 (Ar-O), 145.3 (Ar-NO2), 130.1-129.7 (CH=CH), 125.2 (Ar), 122.4 (Ar), 34.3 (CH2-CO), 31.92 (CH2-alkene), 29.8, 29.7, 29.5, 29.3, 29.2, 29.1, 29.0, 27.2, 27.2, 27.1, 24.7, 22.7 (CH2-alkene), 14.1 (CH3).
[0225] MS (MALDI-TOF): Exp 403; Found 503. 5 (M+ Et3N).Example 2 - Preparation of N-hydoxysuccinimidyl oleate 2
[0226] N-hydroxysuccinimide (1.15 g, 10 mmol) was dissolved in 20 mL of dichloromethane and 5.6 mL of triethylamine (40 mmol) were added. The solution was cooled with an ice bath and then 3.3 mL of oleyl chloride were added dropwise in a period of 5 minutes. At the end of the addition, the reaction was removed from the ice bath and stirred at room temperature for 1 hour. A large precipitate of triethylammonium hydrochloride formed. The mixture was diluted with dichloromethane and the organic phase was washed with brine (3 x 30 mL), saturated sodium bicarbonate in water (3 x 30 mL) and again with (2 x 30 mL). The organic phase was dried (MgSCL) and concentrated to dryness. An oil was obtained (3.70 gr, 98%) with a small amount of triethylamine that was used without further purification.
[0227] N-Hydroxysuccinimidyl oleate (2):1H-NMR (CDCI3, 400 MHz) 5 = 5.3 (m, 2H, CH=CH), 2.8 (s, 4H, CH2succinimide, 1.91 (m, 4H, CH2-alkene), 1.3-1.2 (22H, m, alkyl chain, CH2), 0.8 (3H, t, CH3).13C NMR (101 MHz, CDCI3) 6 = 169.3 (CO), 168.7 (CO), 130.0-129.7 (CH=CH), 31.9 (CH2-CO), 30.9 (CH2-alkene), 29.8, 29.7, 29.6, 29.5, 29.4, 29.3, 28.9, 28.8, 27.2, 27.1, 25.6, 24.6, 22.7 (CH2-alkene), 14.1 (CH3).
[0228] Example 3 - Preparation of 6-hydroxyhexyloleylamide 3. Method a) by using 1
[0229] 6-Aminohexanol (0.47 g, 4 mmol) was dissolved in 20 mL of dioxane and triethylamine (2.2 mL, 16 mmol) and 4-nitrophenyl oleate (1) (3.24 g, 8 mmol) were added. The reaction was stirred overnight at room temperature and 3 hours at 45 °C. The reaction mixture was concentrated to dryness, yielding a yellow solid. The solid was dissolved in 50 mL of dichloromethane and the organic phase was washed with 60 mL 0.1 N NaOH solution. A large precipitate formed in the aqueous phase. The phases separated over time and the organic phase was collected. The aqueous phase was washed twice with dichloromethane. The combined organic phases were washed with a saturated sodium bicarbonate solution and brine. The organic phase was dried (MgSCL) and concentrated to dryness, obtaining 1.24 g (3.25 mmol, yield 81%) of 6-hydroxyhexyloleylamide. TLC (5% methanol / dichloromethane) Rf 0.3 (iodine positive spot). Silica gel purification was performed using a 0-20% methanol gradient in dichloromethane. The compound 6-hydroxyhexyloleylamide (3) eluted at 4% methanol / dichloromethane obtaining 0.51 g (1.34 mmol, yield 33%).
[0230] 6-Hydroxyhexyloleylamide (3):1H-NMR (CDCI3, 400 MHz) 5 = 5.4 (m, 2H, CH=CH), 3.7 (m, CH2), 2.6 (m, CH2), 2.0 (m, CH2), 1.6-1.5 (m, CH2), 1.3-1.2 (m, CH2), 0.9 (t, 3H, CH3).13C-NMR (101 MHz, CDCI3) 5 = 173.2 (CO), 171.3 (CO), 130.1-129.7 (CH=CH), 125.2, 122.4, 67.1, 62.7, 58.5, 39.3, 36.9, 34.3, 32.5, 31.9, 30.9, 29.8, 29.7, 29.6, 29.5, 29.4, 29.3, 28.9, 28.8, 27.2,27.1, 25.6, 24.6, 22.7, 18.4 (CH2-alkene), 14.1 (CH3). MS (MALDI-TOF): Exp 381; Found 382.4 (M+H+), 404.3 (M+Na+).
[0231] Example 4 - Preparation of 6-hydroxyhexyloleylamide 3. Method b), by using 2
[0232] 6-Aminohexanol (0.586 g, 5 mmol) was dissolved in 20 mL of dioxane and triethylamine (2.8 mL, 20 mmol) and / V-hydoxysuccinimidyl oleate (2) (10 mmol) were added. The reaction was stirred 1 hour at room temperature and 5 hours at 45 °C. The reaction mixture was concentrated to dryness, yielding a yellow solid. The solid was dissolved in 50 mL of dichloromethane and the organic phase was washed with brine (3 x 30 mL), saturated sodium bicarbonate in water (3 x 30 mL) and again with brine (2 x 30 mL). The organic phase was dried (MgSCL) and concentrated to dryness, obtaining 4.15 g of an oily residue. TLC (5% methanol / dichloromethane) Rf 0.3 (iodine positive spot). Silica gel purification was performed using a 0-20% methanol gradient in dichloromethane. The compound 6-hydroxyhexyloleylamide (3) eluted at 4% methanol / dichloromethane obtaining 1.9 g (yield 99%).
[0233] 1H-NMR, and13C-NMR as described above. MS (electrospray): Expected forC24H4?NO2381.4; Found 382.4 (M+H+), 404.3 (M+Na+).
[0234] Example 5 - Preparation of 5’-DMT-T-3’-(2-cyanoethyl) (6-oleamidohexyl) phosphate 4
[0235] In a 50 mL round bottom flask 6-hydroxyhexyloleylamide (3) (381 mg, 1 mmol, 1 eq.) was dried by co-evaporation with dry acetonitrile (2x). The residue was maintained in nitrogen atmosphere and dissolved with 4 mL of dry dichloromethane. Then, 4,5-dicyanoimidazole (DCI, 177 mg, 1.5 mmol, 1.5 eq.) was dissolved in 3 mL dry acetonitrile and added to 3 together with a solution of 5’-DMT-T-3’-(2-cyanoethyl)- / V, / \ / -diisopropylphosphoramidite (1.11 g, 1.5 mmol, 1.5 eq) dissolved in dry acetonitrile. After 1 hour of magnetic stirring 0.964 mL offBuOOH 70% solution in water (7.5 mmol) were added. The resulting mixture was stirred 25 min at room temperature and concentrated to dryness. The residue was dissolved in dichloromethane (40 mL) and washed with 5% sodium bicarbonate and brine. The organic phase was dried (MgSCL) and concentrated to dryness. TLC (5% methanol / dichloromethane) Rf 0.42 (iodine and DMT positive spot). Silica gel purification was performed using a 0-20% methanol gradient in dichloromethane. The desired compound eluted at 4% methanol / dichloromethane obtaining 1.0 g of cyanoethyl phosphate 4 (0.97 mmol, yield 97%). Some small impurities such as 6-hydroxyhexyloleylamide were observed by TLC and mass spectrometry.
[0236] (2R,3S,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) (6-oleamidohexyl) phosphate(4):31P-NMR (CDCh, 161 MHz) 6 = -2.4 ppm.1H- NMR (CDCh, 400 MHz) 6 = 2 diastereoisomers: 8.81 and 8.72 (wide s, 1H, NH), 7.55 and 7.51 (s, 1H, H-6), 7.3-7.1 (m, 9H, DMT), 6.7 (m, 4H, DMT), 6.2 (m, 1H, H-T), 5.28 (m, 2H, CH=CH), 4.25-4.0 (m, 5H, 4CH2, H-3’), 3.82 (m, 2H, CH2), 3.76 (m, 2H, CH2), 3.72 (s, 6H, DMT), 3.56 (m, 2H, CH2), 3.4-3.3 (m, 2H, H-5’), 3.17 ( m, 2H, CH2), 2.73 (m, 2H, CH2), 2.5-2.3 (m, 2H, H-2’), 2.08 (m, 3H), 1.94 (m, 6H), 1.85 (m, 4H), 1-7-1.1 (m, 40 H, CH2), 0.81 (m, 3H, CH3).13C-NMR (101 MHz, CDCh) 6 = 173.6 and 173.2 (CO), 163.7, 158.6, 150.4, 147.4, 139.5, 136.4, 130.0, 129.7, 129.1, 127.9, 127.8, 127,1, 113.2, 85.8, 81.4, 67.1, 62.6, 62.1, 62.0, 55.3, 39.3, 39.0, 38.7, 36.9, 32.5, 31.9, 29.9, 29.8, 29.7, 29.6, 29.5, 29.4, 29.3, 29.2, 28.8, 27.2, 27.1, 26.5, 26.0, 25.8, 25.3, 24.9, 22.7, 22.5, 19.8, 14.3, 12.6.
[0237] MS (electrospray): Expected for C58H81N4O11P 1040.6; Found 1063.6 (M+Na+), 1079.5 (M+K+), 763.7 (2M-H+ / 2); 785.77 (2M-Na+ / 2).
[0238] Example 6 - Preparation of 5’-DMT-LNA-ABz-3’-(2-cyanoethyl) (6-oleamidohexyl) phosphate 5 In a 50 mL round bottom flask, 6-hydroxyhexyloleylamide (3) (142 mg, 0.37 mmol, 1 eq.) was dried by co-evaporation with dry acetonitrile (2x) and dry dichloromethane (2x). The residue was maintained in nitrogen atmosphere and dissolved with 2 mL of dry dichloromethane. 4,5-dicyanoimidazole (DCI, 55.6 mg, 0.56 mmol, 1.5 eq.) was dissolved in 1 mL dry acetonitrile and added to 3 solution together with a solution of DMT-LNA-ABz-3’-(2-cyanoethyl)- / V, / \ / -diisopropylphosphoramidite (0.5 g, 0.56 mmol, 1.5 eq) dissolved in 3 mL of dry acetonitrile. After 1 hour of magnetic stirring 0.257 mL offBuOOH 70% solution in water were added. The mixture was stirred 25 min at room temperature and concentrated to dryness. The residue was dissolved in dichloromethane (40 mL) and washed with 5% sodium bicarbonate and brine. The organic phase was dried (MgSCL) and concentrated to dryness. TLC (5% methanol / dichloromethane) Rf 0.4 (iodine and DMT positive spot). Silica gel purification was performed using a 0-50% methanol gradient in dichloromethane. The compound eluted at 4% methanol / dichloromethane obtaining 0.34 g of the cyanoethyl phosphate 5 (0.28 mmol, yield 77%). (1R,3R,4R,7S)-3-(6-benzamido-9H-purin-9-yl)-1-((bis(4-methoxyphenyl)(phenyl)methoxy) methyl)-2,5-dioxabicyclo[2.2.1]heptan-7-yl (2-cyanoethyl) (6-oleamidohexyl) phosphate (5):
[0239] 31P-NMR (CDCh, 161 MHz) 5 = -2.3 ppm.1H- NMR (CDCh, 400 MHz) 5 = 8.8 (s, 1H, H2); 8.3 (s, 1H, H8), 8.0 (m, 2H, Bz), 7.4-7.6 (m, 3H, Bz), 7.3-6.8 (m, 9H, DMT), 6.21 (m, 1H, H-T), 5.4 (m, 2H, CH=CH), 5.2-4.9 (m, 4H, 2CH2), 4.2-3.9 (m, 9H, 4CH2, H-3’), 3.8 (s, 6H, DMT), 3.6-3.1 (m, 4H, H-5’, CH2), 2.8-2.6 (m, 2H, H-2’), 2.1-2.0 (m, 4H, CH2), 1.7-1.0 (m, 28H, CH2), 0.90 (m, 3H, CH3).
[0240] MS (MALDI-TOF): Exp 1181; Found 1182.6 (M+H+), 1204.6 (M+Na+), 902.3 ((M-DMT+Na+).Example 7 - Preparation of Type I Triethylammonium 5’-DMT-T-3’-(6-oleamidohexyl) phosphate 6
[0241] The cyanoethyl phosphate 4 (approx. 200 mg, 170 mmol) was treated with 1 mL of anhydrous triethylamine / anhydrous pyridine / anhydrous acetonitrile (1:1:1 v / v / v). After 6 hours, the mixture was divided in 10 eppendorf tubes (0.1 mL each) and 1 mL of ethyl ether / hexanes (1:1) was added in each tube. The mixture was centrifuged, and the supernatant was separated leaving an oil. The residual solvent was removed by vacuum. TLC analysis (10% methanol / dichloromethane) showed the conversion of the cyanoethyl phosphate to the triethylammonium salt (Rf salt: 0.5 with a long tail; Rf starting compound 0.8 (two spots)). At this point however, we still observed the presence of the starting cyanoethyl phosphate. A small aliquot (40 mg) was then treated with 0.3 mL of DBU / pyridine / acetonitrile (1:1:1) for 1 hour and the resulting mixture was treated with ethyl ether / hexanes (1:1) yielding an oily precipitate of the triethylammonium phosphate salt 6.
[0242] Triethylammonium (2R,3S,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl (6-oleamidohexyl) phosphate (6):31P-NMR (CDCI3, 161 MHz) 5 = -0.53 ppm. TLC analysis (10% methanol / dichloromethane) showed the total conversion of the cyanoethyl phosphate to the DBU salt. MS (MALDI-TOF): Exp 986; Found 986.3.
[0243] Example 8 - Preparation of Type I Triethylammonium 5’-DMT-LNA-ABz-3’-(6-oleamidohexyl) phosphate 7
[0244] The cyanoethyl phosphate 5 (approx. 200 mg, 170 mmol) was treated with 1 mL of anhydrous triethylamine / anhydrous pyridine / anhydrous acetonitrile (1:1:1 v / v / v). After 3 hours and 30 minutes the mixture was divided in 10 eppendorf tubes (0.1 mL each) and 1 mL of ethyl ether / hexanes (1 :1) was added in each tube. The mixture was centrifuged, and the supernatant was separated leaving an oil at the end of the tube. The residual solvent was removed by vacuum. TLC analysis (10% methanol / dichloromethane) showed the conversion of the cyanoethyl phosphate to the triethylammonium phosphate salt 7 (Rf salt: 0.5 with a long tail; Rf starting compound 0.8 (two spots)). However, we still observed the presence of some cyanoethyl phosphate.
[0245] Triethylammonium (1R,3R,4R,7S)-3-(6-benzamido-9H-purin-9-yl)-1-((bis(4-methoxyphenyl) (phenyl)methoxy)methyl)-2,5-dioxabicyclo[2.2.1]heptan-7-yl (6-oleamidohexyl) hydrogen phosphate (7): MS (MALDI-TOF): Exp 1129; Found 1127 (M-H+).Example 9 - Coupling of 6 and 7 to functionalized (2-hvdroxyethyl)sulfonylethyl-solid supports. Preparation of IV-CPG-6 and IV-CPG-7
[0246] Approx. 20 pmols of triethylammonium phosphate salt 6 or triethylammonium phosphate salt 7 were dried by co-evaporation with anhydrous pyridine (3 x 1 mL). 12.1 mg of triisopropylsulfonyl chloride (approx. 40 pmol) was dissolved in 1 mL of anhydrous pyridine and mixed with the corresponding 6 or 7 triethylammonium phosphate in nitrogen atmosphere together with 6.4 pL of / V-methylimidazole (80 pmol) and 93 mg of Phosphate-ON-CPG (approx. 9 pmol). The reaction was performed either at room temperature for 5 days or double coupling at 40 °C (2x, each time for 1 hour). Then, the solid support was filtered and washed with acetonitrile and dried. An aliquot of the resulting CPGs (2-3 mg) developed a light orange colour when treated with a 3% trichloroacetic acid solution in dichloromethane, indicating a coupling yield of 1-5% (0.7-0.9 pmol / g starting from a solid support with a degree of functionalization of 60 pmol / g). The resulting solid supports IV-CPG-6 or IV-CPG-7 were acetylated with a 1:1 mixture of capping A and B solutions for 1 min, washed with acetonitrile and dried.
[0247] 2-((2-(((((2R,3S,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl)oxy)((6-oleamidohexyl)oxy)phosphoryl)oxy)ethyl)sulfonyl)ethyl 4-(CPG-amino)-4-oxobutanoate (IV-CPG-6)
[0248] 2-((2-(((((1R,3R,4R,7S)-3-(6-benzamido-9H-purin-9-yl)-1-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-2,5-dioxabicyclo[2.2.1]heptan-7-yl)oxy)((6-oleamidohexyl)oxy)phosphoryl)oxy)ethyl)sulfonyl)ethyl 4-(CPG-amino)-4-oxobutanoate (IV-CPG-7)
[0249] Example 10 - Synthesis of lipid-oliqonucleotide 5’-T7-3’-(6-oleamidohexyl) Oligonucleotide sequence 5’-TTTTTT-3’ was assembled on the IV-CPG-6 solid support. After the assembly of the oligonucleotide, the solid support was treated with concentrated ammonia for 1 hour at room temperature. The resulting ammonia solution was separated from the solid support and was concentrated to dryness and desalted by NAP-10 columns (Sephadex G-25). The amount of oligonucleotide obtained after NAP-10 purification was around 0.7 O.D. units at 260 nm (0.023 mg, 24 nmols, 2%). Analysis by reversed-phase HPLC gave a major peak with a retention time of 3 minutes in DMT-on conditions (shorter deletion sequences) and a small peak at 24 minutes (5’-T7-3’-(6-oleoamidohexyl), Fig. 1).DNA, [5’-T-p-T-p-T-p-T-p-T-p-T-p-T-3’-p-O-(CH2)6-NH-CO-oleyl] sodium salt where -p-is phosphate (5’-T7-3’-(6-oleamidohexyl)): MS (Maldi-Tof, negative) expected 2509, found 2509 (Fig. 2).
[0250] Example 11 - Preparation of Type II 5’-DMT-T-3’-(6-oleamidohexyl) 8
[0251] First 2,2’-sulfonyldiethanol 65% in water was dried by co-evaporation with toluene and dissolved in anhydrous pyridine. Then, triethylammonium phosphate 6 (70 mg, 0.071 mmol) was dried by co-evaporation with toluene and anhydrous pyridine. The residue was dissolved in 1 mL of anhydrous pyridine and mixed with 2,4,6-triisopropylbenzenesulfonyl chloride (86 mg, 0.0284 mmol, 4 eq.), 2,2’-sulfonyldiethanol (0.024 g, 1.4 eq.), and / V-methylimidazole (23 pl, 0.0284 mmol, 4 eq.). The mixture was stirred overnight at room temperature (15 hours) and then 1 hour at 40 °C. The resulting solution was concentrated to dryness and the residue was co-evaporated with toluene to remove the pyridine. The residue was dissolved with 40 mL of dichloromethane and washed with 10% sodium bicarbonate and brine. The organic phase was dried (MgSCL) and concentrated to dryness yielding 40 mg of 5'-DMT-T (2-hydroxyethyl)sulfonyl compound 8 (0.035 mmol, approx. 49% yield). TLC (5% methanol / dichloromethane) Rf 0.28 (iodine and DMT positive spot).
[0252] (2R,3S,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1 (2H)-yl)tetrahydrofuran-3-yl (2-((2-hydroxyethyl)sulfonyl)ethyl) (6-oleamidohexyl) phosphate (8):31P-NMR (CDCI3, 161 MHz) 5 = -2.37ppm.1H- NMR (CDCI3, 400 MHz) 5 = 8.7 (m, 1H, NH), 7.5 (m, 1H, H-6), 7.3-7.1 (m, 9H, DMT), 6.7 (m, 4H, DMT), 6.2 (m, 1H, H-T), 5.2-5.1 (m, 2H, CH=CH), 4.5-3.8 (m, 7H, 3CH2, H-3’), 3.7 and 3.8 (s, 6H, DMT), 3.5-3.0 (m, 5H, CH2, H-4’, H-5’), 2.7-1.1 ( m, 34H, H-2’, CH2), 0. 81 (m, 3H, CH3).
[0253] MS (MALDI-TOF): Exp 1122; Found 761.2 (M-361, -oleamidohexyl).
[0254] Example 12 - Preparation of Type III 5’-DMT-T-3’-(6-oleamidohexyl) phosphate 9
[0255] 5'-DMT-T (2-hydroxyethyl)sulfonyl phosphate 8 (40 mg, 0.035 mmol) was dissolved in 2 ml of dichloromethane and treated with succinic anhydride (3.5 mg, 0.035 mmol) and / V, / V-dimethylaminopyridine (DMAP, 4.2 mg). The mixture was stirred overnight at room temperature. The resulting solution was diluted with 20 mL of dichloromethane and washed with brine and a 10% NaH2PC>4 solution. The organic phase was dried (MgSCL) and concentrated to dryness yielding 26 mg of 5'-DMT-T hemisuccinate 9 (0.021 mmol, approx.
[0256] 49% yield). TLC (5% methanol / dichloromethane) Rf 0.11 (iodine and DMT positive spot). 4-(2-((2-(((((2R,3S,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl)oxy)((6-oleamidohexyl)oxy)phosphoryl)oxy)ethyl)sulfonyl)ethoxy)-4-oxobutanoic acid (9):31P-NMR (CDCh, 161 MHz) 6 = -1.67 and -2.62 ppm (2 diastereoisomers). The product is impurified with dimethylaminopyridine but it may be used in the next step as it uses DMAP in the coupling reaction.
[0257] Example 13 - Preparation of Type II 5'-DMT-LNA ABz-3’-(6-oleamidohexyl) phosphate 10 First 2,2’-sulfonyl diethanol 65% in water (35 mg, 0.15 mmol) was dried by co-evaporation of toluene and dissolved in anhydrous pyridine. Then, triethylammonium phosphate 7 (132 mg, 0.107 mmol) was dried by co-evaporation with toluene and anhydrous pyridine. The residue was dissolved in 2 mL of anhydrous pyridine and mixed with 2,4,6-triisopropylbenzenesulfonyl chloride (130 mg, 0.428 mmol, 4 eq.), 2,2’-sulfonyldiethanol (35 mg, 0.15 mmol, 1.4 eq.), and / V-methylimidazole (34 pl, 0.428 mmol, 4 eq.). The mixture was stirred overnight at room temperature (15 hours) and then 1 hour at 40 °C. The resulting solution was concentrated to dryness and the residue was co-evaporated with toluene to remove the pyridine. The residue was dissolved with 40 mL of dichloromethane and washed with 10% sodium bicarbonate and brine. The organic phase was dried (MgSCL) and concentrated to dryness yielding 216 mg of the 5'-DMT-LNA ABz(2-hydroxyethyl)sulfonyl phosphate 10 as an oil that was used without further purification. TLC (5% methanol / dichloromethane) Rf 0.31 (iodine and DMT positive spot).
[0258] (1R,3R,4R,7S)-3-(6-benzamido-9H-purin-9-yl)-1-((bis(4-methoxyphenyl)(phenyl)methoxy) methyl)-2,5-dioxabicyclo[2.2.1]heptan-7-yl (2-((2-hydroxyethyl)sulfonyl)ethyl) (6-oleamidohexyl) phosphate (10):31P-NMR (CDCI3, 161 MHz) 5 = -2.8 and -3.2 ppm (two diastereoisomers).1H- NMR (CDCh, 400 MHz) 5 = 8.7 (m, 1H, H2); 8.0 (m, 3H, H8, Bz), 7.4-7.6 (m, 3H, Bz), 7.3-6.8 (m, 9H, DMT), 6.15-6.0 (m, 1H, H-T), 5.28 (m, 2H, CH=CH), 5.0-4.8 (m), 4.5-4.3 (m, 4H, 2CH2), 4.1-3.9 (m, 11 H, 5CH2, H-3’), 3.73 (s, 6H, DMT), 3.5-3.1 (m, 4H, H-5’, CH2), 2.8-2.6 (m, 2H, H-2’), 2.1-2.0 (m, 4H, CH2), 1.7-1.0 (m, 28H, CH2), 0.81 (m, 3H, CH3).
[0259] Example 14 - Preparation of Type III 5'-DMT-LNA ABz-3’-(6-oleamidohexyl) phosphate 11 5'-DMT-LNA ABz(2-hydroxyethyl)sulfonyl phosphate 10 (0.1 mmol) was dissolved in 2 ml of dichloromethane and treated with succinic anhydride (15 mg, 0.15 mmol) and / V, / V-dimethylaminopyridine (DMAP, 18.3 mg, 0.15 mmol). The mixture was stirred overnight at room temperature. The resulting solution was diluted with 20 mL of dichloromethane and washed with brine and a 5% NaH2PC>4 solution. The organic phase was dried (MgSCh) and concentrated to dryness yielding 140 mg of an oil, 5'-DMT-LNA ABzhemisuccinate 11, whichwas used in the next reaction without further purification. TLC (5% methanol / dichloromethane) Rf 0.28 (iodine and DMT positive spot).
[0260] 4-(2-((2-(((((1R,3R,4R,7S)-3-(6-benzamido-9H-purin-9-yl)-1-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-2,5-dioxabicyclo[2.2.1]heptan-7-yl)oxy)((6-oleamidohexyl)oxy)phosphoryl)oxy)ethyl)sulfonyl)ethoxy)-4-oxobutanoic acid (11):31P-NMR (CDCh, 161 MHz) 5 = -3.4 ppm. The product is impurified with dimethylaminopyridine.
[0261] Example 15 - Functionalization of solid-supports. Preparation of Type IV compounds IV-CPG-9 and IV-CPG-11
[0262] Dithiobis(nitropyridine) (DTNP, 6.2 mg, 0.02 mmol, 0.95 eq) was dissolved in 0.06 mL of dichloroethane / acetonitrile (3:1 v / v). In a 10 mL round-bottom flask 5'-DMT-T hemisuccinate 9 (0.021 mmol, 1 eq.) or 5'-DMT-LNA ABzhemisuccinate 11 (0.021 mmol, 1 eq.) was dissolved in 0.2 mL of acetonitrile and 0.2 mL of dichloromethane and 5.49 mg of DMAP (0.045 mmol, 2.14 eq.) were added. This solution was mixed with the DTNP solution and then triphenylphosphine (TPP, 6.81 mg, 0.026 mmol, 1.36 eq.) dissolved in 0.2 mL of acetonitrile were added. The solution turned intense red, and it was added to 100 mg of aminofunctionalised CPG (degree of functionalization: 80 pmol / g). After 90 minutes at room temperature, the solution was filtered out and the resulting solid support was washed with dichloromethane, acetonitrile, dichloromethane, methanol and dichloromethane. The resulting solid support was acetylated with a 1:1 mixture of capping A and B solutions for 5 minutes, washed with dichloromethane, acetonitrile, dichloromethane and dried to obtain IV-CPG-9 and IV-CPG-11. An aliquot of the support was treated with 2% trichloroacetic acid in dichloromethane giving an intense orange colour that was measured at 500 nm (extinction coefficient 76000). Degree of functionalization approx. 20-30 pmol / g.
[0263] 2-((2-(((((2R,3S,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl)oxy)((6-oleamidohexyl)oxy)phosphoryl)oxy)ethyl)sulfonyl)ethyl 4-(CPG-amino)-4-oxobutanoate (IV- CPG-9). The same as IV-CPG-6
[0264] 2-((2-(((((1R,3R,4R,7S)-3-(6-benzamido-9H-purin-9-yl)-1-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-2,5-dioxabicyclo[2.2.1]heptan-7-yl)oxy)((6-oleamidohexyl)oxy)phosphoryl)oxy)ethyl)sulfonyl)ethyl 4-(CPG-amino)-4-oxobutanoate (IV-CPG-11). The same as IV-CPG-7Example 16 - Synthesis of lipid-oliqonucleotides: 5’-T7-3’-(6-oleamidohexyl), 5’-drGTACGCT]-3’-(6-oleamidohexyl) and df 5’-ATCCCTGGCAATGTG]AL-3’-(6-oleamidohexyl)
[0265] Oligonucleotide sequences 5’-TTTTTT-3’, 5’- d[GTACGC]-3’ or 5’- d[ATCCCTGGCAATGTG]-3’ were assembled, respectively, on the functionalized CPG solid support, namely IV-CPG-9 or IV-CPG-11. After the assembly of the respective oligonucleotide, the solid support was treated with concentrated ammonia for 1 hour at room temperature (5’-T?-3’-(6-oleamidohexyl)), for 6 hours at 55 °C (5’-d[GTACGCT]-3’-(6-oleamidohexyl) and 5’-d[ATCCCTGGCAATGTG]AL-3’-(6-oleamidohexyl)). The respective ammonia solutions were concentrated to dryness and desalted by NAP-10 columns (Sephadex G-25). The amount of respective lipid-oligonucleotide obtained after NAP-10 purification was 22 O.D. units for 5’-T?-3’-(6-oleamidohexyl)), 25 O.D. units for 5’-d[GTACGCT]-3’-(6-oleamidohexyl) and 30 O.D. units for 5’-d[ATCCCTGGCAATGTG]AL-3’-(6-oleamidohexyl), at 260 nm (0.7-0.8 mg, 290-330 nmols, 29-33%) respectively. Analysis by reversed-phase HPLC gave a major peak with a retention time of 24 minutes in DMT-on conditions (assigned to the desired oleic-oligonucleotides, Fig. 3).
[0266] DNA, [5’-T-p-T-p-T-p-T-p-T-p-T-p-T]-3’-p-O-(CH2)6-NH-CO-oleyl sodium salt where -p- is phosphate (5’-T7-3’-(6-oleamidohexyl)): MS (Maldi-Tof, negative) expected 2509, found 2509.
[0267] DNA, d[5’-G-p-T-p-A-p-C-p-G-p-C-p-T]-3’-p-O-(CH2)6-NH-CO-oleyl sodium salt where -p- is phosphate (5’- d[GTACGCT]-3’-(6-oleamidohexyl)). Expected 2538, found 2538 (Fig. 4)
[0268] DNA, d[5’-A-p-T -p-C-p-C-p-C-p-T -p-G-p-G-p-C-p-A-p-A-p-T -p-G-p-T -p-G]-p-AL-3’-p-O-(CH2)6-NH-CO-oleyl sodium salt where AL is LNA-A and -p- is phosphate (5’-d[ATCCCTGGCAATGTG]AL-3’-(6-oleamidohexyl)). MS expected: 5350, found 5333 (M-17) Example 17 - Preparation of N-(2-(2-hydroxyethoxy)ethyl)palmitamide 12
[0269] In a 50 mL round-bottom flask, 562 mg (2.19 mmol) of palmitic acid were dissolved with 5 mL of dioxane and 5 mL / V, / V-dimethylformamide (DMF) and 444 mg (3.29 mmol) of 1-hydroxybenzotriazol hydrate were added. Then 0.157 mL (3.29 mmol) of triethylamine and 460 mg (3.29 mmol) of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDO HOI) were added and the mixture was stirred for 10 minutes at room temperature. Then 142 mg (1.35 mmol) of 2-(2-aminoethoxy)ethanol were added and the mixture was stirred 15 hours at room temperature. The reaction mixture was concentrated to dryness and the residue was dissolved in CH2CI2 (20 ml). The resulting organic solution was washed with 5% sodium bicarbonate and brine. The organic phase was dried with magnesium sulphate andconcentrated to dryness. TLC (5% methanol / dichloromethane) Rf 0.56 (phosphomolybdic positive and ninhydrin negative spot). Silica gel purification was performed using a 0-20% methanol gradient in dichloromethane. The desired compound eluted at 5% methanol / dichloromethane obtaining 0.406 g (1.18 mmol, yield 88%).
[0270] N-(2-(2-hydroxyethoxy)ethyl)palmitamide (12):1H- NMR (CDCI3, 400 MHz) 5 = 3.68 (m, 2H, CH2), 3.52 (m, 4H, 2 CH2), 3.42 (m, 2H, CH2), 2.12 (m, 2H, CH2), 1.84 (broad, 4H, NH, OH, water), 1.56 (m, 2H, CH2), 1.21 (m, 24H, 12 CH2), 0.81 (m, 3H, CH3).13C-NMR (101 MHz, CDCI3) 6 = 173.6 (CONH), 72.2, 70.0, 61.7, 39.2, 36.7, 31.9, 29.7, 29.6, 25.7, 22.7, 14.1 (CH3). MS (electrospray): Expected forC2oH4iN03343.3086; Found positive 344.3113 (M+H+), Found negative 342.3016 (M-H+).
[0271] Example 18 - Preparation of 5’-DMT-T-3’-(2-cyanoethyl) (2-(2-palmitamidoethoxy)ethyl) phosphate 13
[0272] In a 50 mL round bottom flask / \ / -(2-(2-hydroxyethoxy)ethyl)palmitamide (12) (230 mg, 0.67 mmol. 1 eq.) were dried by co-evaporation with dry acetonitrile (2x). The residue was maintained in nitrogen atmosphere and dissolved with 4 mL of dry dichloromethane. Then, 4,5-dicyanoimidazole (DCI, 119 mg, 1.0 mmol, 1.5 eq.) was dissolved in 3 mL dry acetonitrile and added to the alcohol together with a solution of DMT-T-3’-(2-cyanoethyl)- / V, / \ / -diisopropylphosphoramidite (0.5 g, 0.67 mmol, 1.0 eq.) dissolved in dry acetonitrile. After 1 hour of magnetic stirring 0.64 mL offBuOOH 70% solution in water (5 mmol) were added. The mixture was stirred 1 hour at room temperature and concentrated to dryness. The residue was dissolved in dichloromethane (20 mL) and washed with 5% sodium bicarbonate and brine. The organic phase was dried (MgSCL) and concentrated to dryness. TLC (5% methanol / dichloromethane) Rf 0.42 (DMT positive spot). Silica gel purification was performed using a 0-10% methanol gradient in dichloromethane. The desired compound eluted at 5% methanol / dichloromethane obtaining 0.27 g of the cyanoethyl phosphate 13 (0.27 mmol, yield 41%). (2R,3S,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1 (2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) (2-(2-palmitamidoethoxy)ethyl) phosphate (13):31P-NMR (CDCI3, 161 MHz) 5 = -2.59 ppm.1H- NMR (CDCI3, 400 MHz) 5 = 8.28 (s wide, 1H), 7.46 and 7.44 (two s, 1H), 7.2-7.1 (m, 9H), 6.75 (m, 4H), 6.35 (m, 1H), 6.15 (m, 1H), 5.14 (m, 1H), 4.2 (m, 5H), 3.83 (m, 2H), 3.72 (s, 6H), 3.63 (m, 2H), 3.52 (m, 2H), 3.40 (m, 2H), 2.73 (m, 2H), 2.47 (m, 2H), 2.12 (m, 2H), 1.85 (s, 3H), 1.55 (m, 2H), 1.18 (m, 24H), 0.81 (m, 3H).13C-NMR (101 MHz, CDCI3) 5 = 207.1, 174.1, 163.5, 158.7, 150.4, 147.5, 139.6, 136.6, 129.3, 127.9, 127.8, 113.3, 111.5, 86.4, 85.9, 81.5, 70.2, 67.8, 62.2, 61.9, 55.4, 53.5, 39.3, 38.6, 36.7, 32.0, 31.0, 29.8-29.5, 25.9, 22.8, 19.9, 14.2, 12.7. MS (electrospray, negative mode): Expected for C54H?6N40I2P 1003.5; Found 1001.5 (M-H+).Example 19 - Preparation of Type I DBU 5’-DMT-T-3’-(2-(2-palmitamidoethoxy)ethyl) phosphate salt 14
[0273] The cyanoethyl phosphate 13 (270 mg, 0.27 mmol) was treated with 3 mL of DBU / pyridine / acetonitrile (1:1:1 v / v / v). After 1 hour, the mixture was divided in 12 eppendorf tubes (0.25 mL each) and 1.5 mL of ethyl ether / hexanes (1:1) were added in each tube. The mixture was centrifuged, and the supernatant was separated leaving an oil. The oil was washed with 1.5 mL of ethyl ether / hexanes (1:1 v / v) and the mixture was centrifuged. The residual solvent was removed by vacuum. TLC analysis (5% methanol / dichloromethane) showed the conversion of the cyanoethyl phosphate to the DBU phosphate salt 14 that was used without further purification (Rf salt: 0.1; Rf starting compound 0.4).
[0274] DBU (2R,3S,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1 (2H)-yl)tetrahydrofuran-3-yl (2-(2-palmitamidoethoxy)ethyl) hydrogen phosphate salt (14):31P-NMR (CDCI3, 161 MHz) 5 = -0.63 ppm.1H- NMR (CDCI3, 400 MHz) 5 = 8.62 (wide, 1H), 7.7 (m, 1H), 7.56 (m, 1H), 7.2-7.1 (m, 9H), 6.7-6.6 (m, 4H), 6.46 (m, 1H), 5.0 (m, 1H), 4.26 (m, 1H), 3.78 (s, 6H), complex signals due to the presence of DBU, 0.86 (m, 3H). MS (electrospray, negative mode): Expected for C51H72N3O12P 949.4854; Found 948.4796 (M-H+).
[0275] Example 20 - Preparation of Type II 5’-DMT-T-3’-(2-(2-palmitamidoethoxy)ethyl) phosphate 15
[0276] First 2,2’-sulfonyldiethanol 65% in water was dried by co-evaporation with toluene and dissolved in anhydrous pyridine. Then, the DBU phosphate salt 14 (0.27 mmol) was dried by co-evaporation with toluene and anhydrous pyridine. The residue was dissolved in 2 mL of anhydrous pyridine and mixed with triisopropylsulfonyl chloride (327 mg, 1.08 mmol, 4 eq.), 2,2’-sulfonyldiethanol (0.378 mmol, 1.4 eq.), and / V-methylimidazole (86 pl, 1.08 mmol, 4 eq.). The mixture was stirred overnight at room temperature (16 hours). The resulting solution was concentrated to dryness and the residue was co-evaporated with toluene to remove the pyridine. The residue was dissolved with 30 mL of dichloromethane and washed with 10% sodium bicarbonate and brine. The organic phase was dried (MgSCL) and concentrated to dryness. TLC (5% methanol / dichloromethane) Rf 0.4 (two DMT positive spots). Silica gel purification was performed using a 0-10% methanol gradient in dichloromethane. The compound eluted at 5% methanol / dichloromethane obtaining 0.12 g of the 5'-DMT-T (2-hydroxytethyl)sulfonyl phosphate 15 (0.11 mmol, yield 41%).
[0277] (2R,3S,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1 (2H)-yl)tetrahydrofuran-3-yl (2-((2-hydroxyethyl)sulfonyl)ethyl) (2-(2-palmitamidoethoxy)ethyl) phosphate (15):31P-NMR (CDCh, 161 MHz) 6 = -2.6, -2.8 ppm (two diastereoisomers).1H- NMR (CDCh, 400 MHz) 5 = 8.77 and 8.76 (m, 1H), 7.90 (m, 1H), 7.49 (m, 1H), 7.23-7.20 (m, 5H), 7.10 (m, 4H), 6.76 (m, 4H), 6.15 (m, 1H), 5.12 (m, 1H), 4.48 (m, 2H), 4.18 (m, 3H), 4.04 (m, 1H), 3.81 (m, 1H), 3.73 (s, 6H), 3.64 (m, 2H), 3.52 (m, 3H), 3.35 (m, 3H), 3.22 (m, 1H), 2.4-2.3 (m, 2H), 2.13 (m, 3H), 1.85 (m, 3H), 1.54 (m, 2H), 1.23-1.17 (m, 24H), 0.81 (m, 3H). MS (MALDI-Tof, negative mode): Expected for C55H81N3O15PS 1086.51; Found 1086.6 (M-H+), 1066.6 (M-H2O).
[0278] Example 21 - Preparation of Type III 5’-DMT-T-3’-(2-(2-palmitamidoethoxy)ethyl) phosphate 16
[0279] 5'-DMT-T (2-hydroxyethyl)sulfonyl phosphate 15 (120 mg, 0.11 mmol) was dissolved in 4 ml of dichloromethane and treated with succinic anhydride (16.5 mg, 0.165 mmol) and DMAP (20.1 mg, 0.165 mmol). The mixture was stirred overnight at room temperature. The resulting solution was diluted with 20 mL of dichloromethane and washed with brine and a 0.1 M NaH2PC>4 solution. The organic phase was dried (MgSCh) and concentrated to dryness yielding 101 mg of 5'-DMT-T hemisuccinate 16 (0.086 mmol, approx. 78% yield). TLC (5% methanol / dichloromethane) Rf 0.1 (DMT positive spot). The product contained a small amount of DMAP, but it was used in the next step without further purification.
[0280] Example 22 - Preparation of 5’-DMT-dABz-3’-(2-cyanoethyl) (1 -tetradecyl) phosphate 17 In a 50 mL round bottom flask 1-tetradecyl alcohol (249 mg, 1.16 mmol. 1 eq.) was dried by co-evaporation with dry acetonitrile (2x). The residue was maintained in nitrogen atmosphere and dissolved with 1 mL of dry dichloromethane. Then, 4,5-dicyanoimidazole (DCI, 205.3 mg, 1.74 mmol, 1.5 eq.) was dissolved in 2 mL dry acetonitrile and added to the alcohol together with a solution of 5’-DMT-dABz-3’-(2-cyanoethyl)- / V, / \ / -diisopropylphosphoramidite (1 g, 1.16 mmol, 1.0 eq.) dissolved in dry acetonitrile (5 mL). After 1 hour of magnetic stirring 0.745 mL offBuOOH 70% solution in water (5.8 mmol) were added. The mixture was stirred 1 hour at room temperature and concentrated to dryness. The residue was dissolved in dichloromethane (30 mL) and washed with 5% sodium bicarbonate and brine. The organic phase was dried (MgSCL) and concentrated to dryness. TLC (5% methanol / dichloromethane) Rf 0.55 (DMT positive spot). Silica gel purification was performed using a 0-10% methanol gradient in dichloromethane. The compound eluted at 3% methanol / dichloromethane obtaining 0.703 g of the 2-cyanoethyl phosphate 17 (0.72 mmol, yield 62%).
[0281] (2R,3S,5R)-5-(6-benzamido-9H-purin-9-yl)-2-((bis(4-methoxyphenyl)(phenyl)methoxy) methyl) tetrahydrofuran-3-yl (2-cyanoethyl) tetradecyl phosphate (17)31P-NMR (CDCI3, 161 MHz) 5 = -2.43 and -2.52 ppm.1H- NMR (CDCh, 400 MHz) 5 = 8.70 (s, 1H), 8.09 (s, 1H), 7,95(m, 2H), 7.52 (m, 1 H), 7.45 (m, 2H), 7.20 (m, 5H), 7.10 (m, 4H), 6.74 (m, 4H), 6.35 (m, 1 H), 5.25 (m, 1 H), 4.40 (m, 1 H), 4.22 (m, 2H), 4.08 (m, 2H), 3.92 (m, 1 H), 3.80 (m, 1 H), 3.73 (s, 6H), 3.12 (m, 1 H), 2.72 (m, 2H), 2.62 (m, 1 H), 1.66 (m, 2H), 1.3-1.2 (m, 22H), 0.80 (m, 3H)13C-NMR (101 MHz, CDCI3) 6 = 164.6, 158.6, 152.2, 150,6, 150.3, 147.4, 142.6, 139.5, 133.3, 133.0, 129.1, 128.9, 128.0, 127.8, 127.0, 116.4, 113.2, 87.9, 87.4, 81.4, 80.2, 69.1, 63.0, 62.1, 55.3, 39.2, 31.9, 30.3, 29.7-29.1, 25.4, 22.7, 19.9, 14.1. MS (MALDI-ToF, negative mode): Expected for CssHesNeOgP 987.5; Found 987 (M-H+).
[0282] Example 23 - Preparation of Type I DBU 5’-DMT-dABz-3’-(1 -tetradecyl) phosphate salt 18 The cyanoethyl phosphate 17 (460 mg, 0.2474 mmol) was treated with 6 mL of DBU / pyridine / acetonitrile (1:1:1 v / v / v). After 1 hour, the mixture was divided in 24 eppendorf tubes (0.25 mL each) and 1.5 mL of ethyl ether / hexanes (1:1 v / v) were added in each tube. The mixture was centrifuged, and the supernatant was separated leaving an oil. The oil was washed with 1.5 mL of ethyl ether / hexanes (1:1 v / v) and the mixture was centrifuged. The residual solvent was removed by vacuum. TLC analysis (5% methanol / dichloromethane) showed the conversion of the cyanoethyl phosphate to the DBU phosphate salt 18 that was used without further purification (Rf salt: 0.1; Rf starting compound 0.55).
[0283] DBU (2R,3S,5R)-5-(6-benzamido-9H-purin-9-yl)-2-((bis(4-methoxyphenyl)(phenyl)methoxy) methyl)tetrahydrofuran-3-yl tetradecyl phosphate salt (18)31P-NMR (CDCI3, 161 MHz) 5 = -0.62 ppm.1H- NMR (CDCI3, 400 MHz) 5 = 8.70 (s, 1H), 8.17 (s, 1H), 8.06 (m, 2H), 7.52 (m, 1H), 7.52 (m, 1H), 7.50 (m, 2H), 7.4-7.2 (m, 9H), 6.77 (m, 4H), 6.60 (m, 1H), 5.06 (m, 1H), 3.77 (s, 6H) complex signals due to the presence of DBU, 0.86 (m, 3H).13C-NMR (101 MHz, CDCI3) 5 = 165.3, 164.6, 158.5, 152.5, 150.4, 149.8, 144.6, 141.2, 136.0, 135.8, 134.3, 132.4, 130.1, 128.7, 128.2, 128.0, 127.8, 123.7, 123.3, 113.1, 86.5, 86.0, 84.7, 75.5, 65.8, 65.7, 64.1, complex signals due to the presence of DBU, 11.4. MS (MALDI-ToF, negative mode): Expected for C52H64N5O9P 933.4; Found 932.5 (M-H+).
[0284] Example 24 - Preparation of Type II 5’-DMT-dABz-3’-(1-tetradecyl) phosphate 19
[0285] First 2,2’-sulfonyldiethanol 65% in water was dried by co-evaporation with toluene and dissolved in anhydrous pyridine. Then, the DBU phosphate salt 18 (0.158 mmol) was dried by co-evaporation with toluene and anhydrous pyridine. The residue was dissolved in 2 mL of anhydrous pyridine and mixed with triisopropylsulfonyl chloride (191 mg, 0.632 mmol, 4 eq.), 2,2’-sulfonyldiethanol (0.221 mmol, 1.4 eq.), and / V-methylimidazole (50 pl, 0.632 mmol, 4 eq.). The mixture was stirred overnight at room temperature (16 hours). The resulting solution was concentrated to dryness and the residue was co-evaporated with toluene to remove the pyridine. The residue was dissolved with 20 mL of dichloromethane and washed with 5%sodium bicarbonate and brine. The organic phase was dried (MgSCL) and concentrated to dryness. TLC (5% methanol / dichloromethane) Rf 0.5. Silica gel purification was performed using a 0-10% methanol gradient in dichloromethane. The compound (2-hydroxyethyl)sulfonyl phosphate 19 eluted at 5% methanol / dichloromethane obtaining 0.11 g (0.104 mmol, yield 66%). In addition, a by-product (39 mg, 0.037 mmol, 24%) was isolated, that was determined coming from the dehydration of the terminal CH2CH2OH group (CH=CH2) as it had signals at 6.42 and 6.12 ppm in the1H- NMR.
[0286] (2R,3S,5R)-5-(6-benzamido-9H-purin-9-yl)-2-((bis(4-methoxyphenyl)(phenyl)methoxy) methyl)tetrahydrofuran-3-yl (2-((2-hydroxyethyl)sulfonyl)ethyl) tetradecyl phosphate (19)31P-NMR (CDCh, 161 MHz) 5 = -2.3, -2.6 ppm (two diastereoisomers).1H- NMR (CDCI3, 400 MHz) 5 = 8.9 (wide, 1H), 8.64 (s, 1H), 8.1 (s, 1H), 7.9 (m, 2H), 7.55 (m, 1H), 7.48 (m, 2H), 7.2-7.1 (m, 9H), 6.75 (m, 4H), 6.48 (m, 1H), 5.2 (m, 1H), 4.40 (m, 4H), 4.06 (m, 4H), 3.72 (m, 6H), 3.5-3.1 (m, 6H), 2.8 (m, 2H), 1.60 (m, 4H), 1.18 (m, 22H), 0.80 (m, 3H). MS (MALDI-Tof, negative mode): Expected for C56H73N5O13PS 1086.5; Found 996.2 (M-benzoyl), 872.1 (M-myristyl). Example 25 - Preparation of Type III 5’-DMT-dAbz-3’-(1 -tetradecyl) phosphate 20
[0287] The (2-hydroxyethyl)sulfonyl compound 19 (100 mg, 0.1 mmol) was dissolved in 3 ml of dichloromethane and treated with succinic anhydride (15 mg, 0.15 mmol) and DMAP (18.3 mg, 0.15 mmol). The mixture was stirred 6 hours at room temperature. The resulting solution was diluted with 20 mL of dichloromethane and washed with brine and a 0.1 M NaH2PO4 solution. The organic phase was dried (MgSCL) and concentrated to dryness yielding 69 mg (0.06 mmol, approx. 60% yield). TLC (5% methanol / dichloromethane) Rf 0.20 (DMT positive spot). The 5'-DMT-dABzhemisuccinate 20 contained a small amount of DMAP but it was used in the next step without further purification.
[0288] Example 26 - Preparation of Type V methyl 5’-DMT-dABz-3’-(1 -tetradecyl) (3-nitro-4-(2-ethyl)benzoate) phosphate 21
[0289] Methyl 3-nitro-4-(2-hydroxyethyl)benzoate (49.8 mg) was dried by co-evaporation with toluene and anhydrous pyridine. Then, the DBU phosphate salt 18 (0.158 mmol) was dried by coevaporation with toluene and anhydrous pyridine. The residue was dissolved in 2 mL of anhydrous pyridine and mixed with 2,4,6-triisopropylbenzenesulfonyl chloride (191 mg, 0.632 mmol, 4 eq), methyl 3-nitro-4-(2-hydroxyethyl)benzoate (49.8 mg, 0.22 mmol, 1.4 eq) dissolved in 2 mL of anhydrous pyridine, and / V-methylimidazole (50 pl, 0.632 mmol, 4 eq). The mixture was stirred overnight at room temperature (22 hours). The resulting solution was concentrated to dryness and the residue was co-evaporated with toluene to remove the pyridine. The residue was dissolved with 20 mL of dichloromethane and washed with 5% sodium bicarbonate andbrine. The organic phase was dried (MgSCL) and concentrated to dryness. TLC (5% methanol / dichloromethane) Rf 0.75. Silica gel purification was performed using a 0-10% methanol gradient in dichloromethane. The compound eluted at 2% methanol / dichloromethane obtaining 0.12 g of 5’-DMT-dABznitrobenzoate 21 (0.1 mmol, yield 63%). Methyl 4-(2-(((((2R,3S,5R)-5-(6-benzamido-9H-purin-9-yl)-2-((bis(4-methoxyphenyl)(phenyl) methoxy)methyl)tetrahydrofuran-3-yl)oxy)(tetradecyloxy)phosphoryl)oxy)ethyl)-3-nitrobenzoate (21):31P-NMR (CDCI3, 161 MHz) 5 = -2.17 ppm.1H- NMR (CDCI3, 400 MHz) 5 = 8.73 (s, 1H), 8.53 (m, 1H), 8.33 (m, 1H), 8.15 (m, 1H), 8.01 (m, 2H), 7.57 (m, 1H), 7.47 (m, 2H), 7.2-7.15 (m, 9H, DMT), 6.77 (m, 4H, DMT), 6.33 (m, 1H, H-1 '), 4.61 (m, 1H), 4.33 (m, 3H), 3.97 (m, 2H), 3.93 (s, 3H, COOCH3), 3.76 (s, 6H), DMT), 3.33 (m, 2H), 3.1-2.57 (m, 2H), 1.58 (broad), 1.19 (m, 22H), 0.81 (m, 3H). MS (MALDI-Tof, positive mode): Expected for C55H81N3O15PS 1141.5; Found 1163 (M+Na+).
[0290] Example 27 - Preparation of Type V 5’-DMT-dABz-3’-(1 -tetradecyl) (3-nitro-4-(2-ethyl)benzoic) phosphate 22
[0291] 5’-DMT-dABznitrobenzoate compound 21 (120 mg, 0.1 mmol) was dissolved in 6 mL of acetonitrile. To the solution, 12 mL of a 0.05 M NaOH solution in water / dioxane (1:1 v / v) were added (approx. 6 times excess of NaOH). After 5 min of magnetic stirring, the progress of the reaction was analysed by TLC (10% methanol in dichloromethane) showing complete reaction. The reaction was stopped at time 12 min by the addition of 0.034 mL (0.06 mmol) of acetic acid. The solution was concentrated to remove the organic solvents until water started to evaporate. Then, a precipitate formed, and the resulting mixture was treated with 30 mL of dichloromethane and 20 mL of 0.1 M Na^PCL aqueous solution. The organic phase was separated and washed with 20 mL of 0.1 M Na^PCL aqueous solution and brine. The organic phase was dried with anhydrous MgSCL and concentrated to dryness obtaining a white solid of 5’-DMT-dABznitrobenzoic compound 22 (80 mg, 0.072 mmol, yield 72%) that was used without further purification. TLC (5% methanol in dichloromethane) Rf = 0.2, starting methyl ester Rf= 0.8)
[0292] 4-(2-(((((2R,3S,5R)-5-(6-benzamido-9H-purin-9-yl)-2-((bis(4-methoxyphenyl)(phenyl) methoxy)methyl)tetrahydrofuran-3-yl)oxy)(tetradecyloxy)phosphoryl)oxy)ethyl)-3-nitrobenzoic acid (22):31P-NMR (CDCI3, 161 MHz) 5 = -2.12, -2.99 ppm (two diastereoisomers).1H- NMR (CDCI3, 400 MHz): similar spectra than (21) without the peak assigned to the methyl ester at 5 = 3.93 ppm.Example 28 - Functionalization of solid-supports. Preparation of IV-CPG-16, IV-CPG-20 and VI-CPG-22.
[0293] Functionalization of solid supports was performed as described in example 15. Dithiobis(nitropyridine) (DTNP, 0.95 eq) was dissolved in 0.06 mL of dichloroethane / acetonitrile (3:1 v / v). In a 10 mL round-bottom flask 5’-DMT-T hemisuccinate 16 (1 eq) or 5’-DMT-dABzhemisuccinate 20 (1 eq) or 5’-DMT-dABznitrobenzoic acid 22 (1 eq) was dissolved in 0.2 mL of acetonitrile and 0.2 mL of dichloromethane and 2.14 eq of DMAP were added. This solution was mixed with the DTNP solution and then triphenylphosphine (TPP, 1.36 eq) dissolved in 0.2 mL of acetonitrile were added. The solution turned intense red, and it was added to 100 mg of amino-functionalised CPG (degree of functionalization: 80 pmol / gr). After 90 min at room temperature, the corresponding solution was filtered out and the resulting solid support was washed with dichloromethane, acetonitrile, dichloromethane, methanol and dichloromethane. The resulting solid support was acetylated with a 1:1 mixture of capping A and B solutions for 5 min, washed with dichloromethane, acetonitrile, dichloromethane and dried. An aliquot of the corresponding support was treated with 3% trichloroacetic acid in dichloromethane giving an intense orange colour that was measured at 500 nm (extinction coefficient 76000). Degree of functionalization approx. 35-50 pmol / g. 2-((2-(((((2R,3S,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl)oxy)(2-(2-palmitamidoethoxy) ethoxy)phosphoryl)oxy)ethyl)sulfonyl)ethyl 4-(CPG-amino)-4-oxobutanoate (IV-CPG-16) 2-((2-(((((2R,3S,5R)-5-(6-benzamido-9H-purin-9-yl)-2-((bis(4-methoxyphenyl)(phenyl) methoxy)methyl)tetrahydrofuran-3-yl)oxy)(tetradecyloxy)phosphoryl)oxy)ethyl)sulfonyl)ethyl 4-(CPG-amino)-4-oxobutanoate (IV-CPG-20)
[0294] (2R,3S,5R)-5-(6-benzamido-9H-purin-9-yl)-2-((bis(4-methoxyphenyl)(phenyl)methoxy) methyl)tetrahydrofuran-3-yl (4-(CPG-carbamoyl)-2-nitrophenethyl) tetradecyl phosphate (VI-CPG-22)
[0295] Example 29 - Synthesis of oligonucleotides 5’-drGTACGCTT]-3’-(2-palmitamidoethoxy)ethyl, and 5’-drGTACGCTAl-3’-myristoyl (using two different linkers) Oligonucleotides were prepared as described in example 16. Oligonucleotide sequence 5’-d[GTACGCT]-3’ was assembled on the IV-CPG-16, IV-CPG-20 or VI-CPG-22 solid supports. After the assembly of the respective oligonucleotides, the respective solid supports were treated with concentrated ammonia for 6 hours at 55 °C. The respective ammonia solutions were concentrated to dryness and desalted by NAP-10 columns (Sephadex G-25). The corresponding lipid-oligonucleotides were analysed by HPLC and MALDI-TOF (Figure 5: 5’-d[GTACGCTT]-3’-(2-palmitamidoethoxy)ethyl; Figure 6: 5’-d[GTACGCTA]-3’-myristoyl assembled using the (ethylsulfonyl)ethylsuccinyl linker (ESE); and Figure 7: 5’-d[GTACGCTA]-3’-myristoyl assembled using the 3-nitro-4-(2-ethyl)benzoyl linker (NPE)).
[0296] DNA, d[5’-G-p-T-p-A-p-C-p-G-p-C-p-T-p-T-3’-p-O-(CH2)2-O-(CH2)2-NH-CO-palmitoyl] sodium salt where -p- is phosphate (5’- d[GTACGCTT]-3’-(2-palmitamidoethoxy)ethyl)
[0297] DNA, d[5’-G-p-T-p-A-p-C-p-G-p-C-p-T-p-A-3’-p-O-Ci4H29] sodium salt where -p- is phosphate (5’-d[GTACGCTA]-3’-myristoyl).
[0298] Example 30 - Synthesis of oligonucleotides carrying oleyl residues at 3’ and both at 3’ and 5’ ends. drTGATGAATGGTGGGTGAGAGGTTTT1-3’-(6-oleamidohexyl) and 5’-Oleyl-6-aminohexyl-drTGATGAATGGTGGGTGAGAGGTTTT1-3’-(6-oleamidohexyl)
[0299] The oligonucleotide was prepared as described in example 16. Oligonucleotide seguence 5’-d[TGATGAATGGTGGGTGAGAGGTTTT]-3’-(6-oleamidohexyl) was assembled on the IV-CPG-9 solid support (example 15).
[0300] After the assembly of the oligonucleotide, half of the solid support was treated with concentrated ammonia for 6 hours at 55 °C. The ammonia solution was concentrated to dryness and desalted by NAP-10 columns (Sephadex G-25). The resulting lipidoligonucleotide was analysed by HPLC (Figure 8).
[0301] [5’-T -p-G-p-A-p-T -p-G-p-A-p-A-p-T -p-G-p-G-p-T -p-G-p-G-p-G-p-T -p-G-p-A-p-G-p-A-p-G-p-G-p-T -p-T -p-T -p-T -3’-p-O-(CH2)6-N H-CO-oleyl ammonium salt where -p- is phosphate: MS (Maldi-Tof, negative) expected 8294, found 8368 (M+3 Na+).
[0302] The other half of the solid support was then further reacted with MMT-aminohexylphosphoramidite to yield the corresponding 5’-MMT-aminohexyl-oligonucleotide-3’-oleamidehexyl-CPG solid support. This solid support was treated with 3% trichloroacetic acid in DCM to remove the MMT group followed by a wash with 5% diisopropylethylamine in DCM to deprotonate the alkylamino group. The resulting solid support was reacted with oleic acid (20 eguivalents), diisopropylethylamine (40 eguivalents) and PyBOP (20 eguivalents) dissolved in anhydrous dimethylformamide. The reaction was left 4 hours at room temperature with occasional mixing. The resulting solid support was washed with acetonitrile and dried. Next, the solid support was treated with concentrated ammonia for 6 hours at 55 °C. The ammonia solution was concentrated to dryness and desalted by NAP-10 columns (Sephadex G-25). The corresponding lipid-oligonucleotide carrying 3’ and 5’-oleyl groups was analysed by HPLC (Figure 9).[5’-T -p-G-p-A-p-T -p-G-p-A-p-A-p-T -p-G-p-G-p-T -p-G-p-G-p-G-p-T -p-G-p-A-p-G-p-A-p-G-p-G-p-T-p-T-p-T-p-T-3’-p-O-(CH2)6-NH-CO-oleyl ammonium salt where -p- is phosphate: MS (Maldi-Tof, negative) expected 8747, found 8742.
[0303] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.
[0304] For reasons of completeness, various aspects of the invention are set out in the following numbered clauses:
[0305] 1. A method for linking a nucleoside lipid derivative to a solid support comprising the steps of:
[0306] a. providing a nucleoside lipid derivative of formula (I):
[0307]
[0308] wherein
[0309] • Y is O, S, CH2, CHF, CF2or -CH=CH-;
[0310] • PG is a 5' or 6’ protecting group;
[0311] • Ri is H, halogen, OZ1 , or NRsRg; R2is H, halogen, or OZ2; or Ri together with R2forms a bridge; wherein
[0312] o Z1 is H, C1-C4 alkyl, C1-C4 alkyl-oxy-C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, or a protecting group;
[0313] o Rs and Rg are independently from each other H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, carbonyl- C1-C4 alkyl, carbonyl-C2-C4 alkenyl, carbonyl-C2-C4 alkynyl, carbonylamino-C1-C4 alkyl, carbonylamino-(C1-C4 alkyl)2, or a protecting group; and
[0314] o Z2 is H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, or a protecting group; Nb is a nucleobase;• Q is a spacer molecule selected from the group consisting of linear or branched C1-C8 alkyl, linear or branched C2-C8 alkenyl, linear or branched C2-C8 alkynyl, or (C1-C3 alkyl)-O-(C1-C3 alkyl), (C1-C3 alkyl)-S-(C1-C3 alkyl), or (C1-C8 alkyl)-S-S-(C1-C8 alkyl);
[0315] • X is selected from the group consisting of -O-, -S-, -NH-, -N=, or a direct bond;
[0316] • Lipid is a lipophilic residue selected from the group consisting of fatty acid residues, fatty alcohol residues, fatty aldehyde residues, fatty amine residues, sterol residues, diglyceride residues or phospholipid residues;
[0317] • G is O, S, NH, or N-SO2CH3;
[0318] • LG is NR3R4, SR5 or ORe,
[0319] • wherein R3 and R4, independently from one another, is H, methyl, ethyl, linear or branched C3-C6 alkyl, or R3 and R4 together form a C2-C5 ring structure; and • wherein Rs and Rs, independently from one another, is H, methyl, ethyl, cyanoethyl, linear or branched C3-C6 alkyl or a negative charge;
[0320] • m is 1 or 2; and
[0321] • n is 0 or 1;
[0322] b. replacing the LG group of the nucleoside lipid derivative of formula (I) with at least one linker molecule suited for coupling the nucleoside lipid derivative via its 3’ position to a solid support, said at least one linker molecule comprising a base labile function or photo-labile function; and
[0323] c. coupling the nucleoside lipid derivative via the at least one linker molecule introduced in step b) to a solid support.
[0324] he method of clause 1, wherein in formula (I)
[0325] • Q is selected from the group consisting of (CH2)2, (ChLh, (CH2)4, (Ch^s, (CH2)e, (CH2)7, (CH2)8, CH2-O-CH2, (CH2)2-O-(CH2)2, (CH2)3-O-(CH2)3, (CH2)2-S-(CH2)2, (CH2)3-S-S-(CH2)3, or (CH2)6-S-S-(CH2)6;
[0326] • X is selected from the group of -O-, -NH-, -N=, or a direct bond; and
[0327] • Lipid is a lipophilic residue selected from the group consisting of oleic acid residue, palmitic acid residue, myristic acid residue, stearic acid residue, lauric acid residue, elaidic acid residue, myristoleic acid residue, palmitoleic acid residue, linoleic acid residue, a-linolenic acid residue, y-li nolenic acid residue, vaccenicacid residue, arachidonic acid residue, docosahexaenoic acid residue, oleyl alcohol residue, stearyl alcohol residue, palmitoleyl alcohol residue, cetyl alcohol residue, myristyl alcohol residue, lauryl alcohol residue, decyl alcoholresidue, capryl alcohol residue, octanal residue, decanal residue, dodecanal residue, perfluorooctylpropyl residue, perfluorooctylethyl residue, perfluorooctylmethyl residue, perfluorohexylpropyl residue, perfluorohexylethyl residue, perfluorohexylmethyl residue, tert-butyl residue, adamantyl residue or cholesteryl residue.
[0328] 3. The method of clause 1 or 2, wherein the at least one linker molecule of step b) comprises a base labile function selected from the group consisting of a diethylsulfone group, a 2-nitrophenylethyl group, a fluorenylmethyl (Fm) group, or a 4-((2-hydroxyethyl)sulfonyl)benzamide group.
[0329] 4. The method of clause 3, wherein step b) is carried out by reacting in solution the compound of formula (I) with a diethylsulfone group resulting in the compound of formula (II):
[0330]
[0331] Formula (II)
[0332] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined according to clause 1 or clause 2, and G1 and G2 are independently from each other O or S.
[0333] 5. The method of clause 4, wherein in step b) the compound of Formula (II) is reacted with a succinyl group, providing the compound of formula (III):
[0334]
[0335] Formula (III)
[0336] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined according to clause 1 or clause 2, and G1 and G2 are independently from each other O or S.
[0337] 6. The method of clause 5, wherein in step c) the compound of Formula (III) is coupled to a solid support, providing a compound of formula (IV):
[0338]
[0339] wherein Y, PG, R1, R2, Nb, Q, X, Lipid, m and n are defined according to clause 1 or clause 2, G1 and G2 are independently from each other O or S, and wherein SP stands for solid phase and represents a solid support.7. The method of clause 3, wherein step b) is carried out by reacting in solution the compound of formula (I) with a nitro-benzoate derivative resulting in the compound of formula (V):
[0340]
[0341] Formula (V)
[0342] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined according to clause 1 or clause 2, G1 and G2 are independently from each other O or S, and wherein R? is H, methyl or ethyl.
[0343] 8. The method of clause 7, wherein in step c) the compound of Formula (V) is coupled to a solid support, providing a compound of formula (VI):
[0344]
[0345] Formula (VI)wherein Y, PG, R1, R2, Nb, Q, X, Lipid, m and n are defined according to clause 1 or clause 2, G1 and G2 are independently from each other O or S, and wherein SP stands for solid phase and represents a solid support.
[0346] 9. The method of any one of clausesl to 8, wherein the nucleoside lipid derivative of formula (I) is prepared from (A) a compound of formula (VII)
[0347]
[0348] Formula (VII)
[0349] wherein Y, PG, Ri, R2, Nb, and m are defined according to clause 1, and (B) a compound of formula (VIII)
[0350]
[0351] Formula (VIII)
[0352] wherein Q, X, Lipid, and n are defined according to clause 1.
[0353] 10. A method of manufacturing an oligonucleotide comprising in position 3’ a lipophilic residue selected from the group consisting of fatty acid residues, fatty alcohol residues, fatty aldehyde residues, fatty amine residues, sterol residues, diglyceride residues or phospholipid residues, said method comprising the steps of:
[0354] a. carrying out the method according to clause 1 ;
[0355] b. assembling an oligonucleotide using the nucleoside lipid derivative of formula (I) coupled to a solid support as the 3’-oligonucleotide starting point.
[0356] 11. The method of clause 10, wherein the method further comprises the steps of:
[0357] c. once the oligonucleotide sequence is complete, removing all protecting groups; d. cleavage of the assembled oligonucleotide from the solid support; ande. optionally, purification of the oligonucleotide.
[0358] 12. A composition comprising a product of formula (IX):
[0359]
[0360] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined according to clause 1; G1 and G2 are independently from each other O or S; and L is at least one linker molecule suited for coupling the nucleoside lipid derivative via its 3’ position to a solid support, said at least one linker molecule comprising a base labile function.
[0361] 13. The composition of clause 12, wherein the product of formula (IX) is selected from the group consisting of products of formula (II), products of formula (III), or products of formula (V).
[0362] 14. In vitro use of a composition according to clause 12 in a method for linking a nucleoside lipid derivative to a solid support.
[0363] 15. A nucleoside lipid derivative selected from the group consisting of formula (II)
[0364]
[0365] Formula (II);
[0366] of formula (III)
[0367]
[0368] Formula (III); or
[0369] of formula (V)
[0370]
[0371] Formula (V);
[0372] wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined according to clause 1; G1 and G2 are independently from each other O or S; and R? is H, methyl or ethyl.16. Use of a nucleoside lipid derivative according to clause 15 for the preparation of an oligonucleotide comprising in 3’ position a lipophilic residue.
[0373] 17. A solid support for oligonucleotide synthesis, wherein the solid support has been derivatised with a nucleoside lipid derivative according to clause 15.
[0374] 18. A kit for oligonucleotide synthesis comprising a nucleoside lipid derivative according to clause 15.
Claims
1. CLAIMS1. A method of manufacturing an oligonucleotide comprising a step a) of linking a nucleoside lipid derivative to a solid support comprising the steps of:a1. providing a nucleoside lipid derivative of formula (I):Formula (I)wherein• Y is O, S, CH2, CHF, CF2or -CH=CH-;• PG is a 5' or 6’ protecting group;• Ri is H, halogen, OZ1 , or NRsRg; R2is H, halogen, or OZ2; or Ri together with R2forms a bridge; whereino Z1 is H, C1-C4 alkyl, C1-C4 alkyl-oxy-C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, or a protecting group;o Rs and Rg are independently from each other H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, carbonyl- C1-C4 alkyl, carbonyl-C2-C4 alkenyl, carbonyl-C2-C4 alkynyl, carbonylamino-C1-C4 alkyl, carbonylamino-(C1-C4 alkyl)2, or a protecting group; ando Z2 is H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, or a protecting group; • Nb is a nucleobase;• Q is a spacer molecule selected from the group consisting of linear or branched C1-C8 alkyl, linear or branched C2-C8 alkenyl, linear or branched C2-C8 alkynyl, or (C1-C3 alkyl)-O-(C1-C3 alkyl), (C1-C3 alkyl)-S-(C1-C3 alkyl), or (C1-C8 alkyl)-S-S-(C1-C8 alkyl);• X is selected from the group consisting of -O-, -S-, -NH-, -N=, or a direct bond;• Lipid is a lipophilic residue selected from the group consisting of fatty acid residues, fatty alcohol residues, fatty aldehyde residues, fatty amine residues, sterol residues, diglyceride residues or phospholipid residues;• G is O, S, NH, or N-SO2CH3;• LG is NR3R4, SR5 or ORe,• wherein R3 and R4, independently from one another, is H, methyl, ethyl, linear or branched C3-C6 alkyl, or R3 and R4 together form a C2-C5 ring structure; and • wherein Rs and Rs, independently from one another, is H, methyl, ethyl, cyanoethyl, linear or branched C3-C6 alkyl or a negative charge;• m is 1 or 2; and• n is 0 or 1;a2. replacing the LG group of the nucleoside lipid derivative of formula (I) with at least one linker molecule suited for coupling the nucleoside lipid derivative via its 3’ position to a solid support, said at least one linker molecule comprising a base labile function or a photo-labile function; anda3. coupling the nucleoside lipid derivative via the at least one linker molecule introduced in step a2. to a solid support.
2. The method of claim 1, wherein in formula (I)• Q is selected from the group consisting of (CH2)2, (ChLh, (CH2)4, (Ch^s, (ChL^, (CH2)7, (CH2)8, CH2-O-CH2, (CH2)2-O-(CH2)2, (CH2)3-O-(CH2)3, (CH2)2-S-(CH2)2, (CH2)3-S-S-(CH2)3, or (CH2)6-S-S-(CH2)6;• X is selected from the group of -O-, -NH-, -N=, or a direct bond; and• Lipid is a lipophilic residue selected from the group consisting of oleic acid residue, palmitic acid residue, myristic acid residue, stearic acid residue, lauric acid residue, elaidic acid residue, myristoleic acid residue, palmitoleic acid residue, linoleic acid residue, a-linolenic acid residue, y-li nolenic acid residue, vaccenicacid residue, arachidonic acid residue, docosahexaenoic acid residue, oleyl alcohol residue, stearyl alcohol residue, palmitoleyl alcohol residue, cetyl alcohol residue, myristyl alcohol residue, lauryl alcohol residue, decyl alcohol residue, capryl alcohol residue, octanal residue, decanal residue, dodecanal residue, perfluorooctylpropyl residue, perfluorooctylethyl residue, perfluorooctylmethyl residue, perfluorohexylpropyl residue, perfluorohexylethyl residue, perfluorohexylmethyl residue, tert-butyl residue, adamantyl residue or cholesteryl residue.
3. The method of claim 1 or 2, wherein the at least one linker molecule of step a2. comprises a base labile function selected from the group consisting of a diethylsulfone group, a 2-nitrophenylethyl group, a fluorenylmethyl (Fm) group, or a 4-((2- hydroxyethyl)sulfonyl)benzamide group.
4. The method of claim 3, wherein step a2. is carried out by reacting in solution the compound of formula (I) with a diethylsulfone group resulting in the compound of formula (II):Formula (II)wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined according to claim 1 or claim 2, and G1 and G2 are independently from each other O or S.
5. The method of claim 4, wherein in step a2. the compound of formula (II) is reacted with a succinyl group, providing the compound of formula (III):Formula (III)wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined according to claim 1 or claim 2, and G1 and G2 are independently from each other O or S.
6. The method of claim 5, wherein in step a3. the compound of Formula (III) is coupled to a solid support, providing a compound of formula (IV):wherein Y, PG, R1, R2, Nb, Q, X, Lipid, m and n are defined according to claim 1 or claim 2, G1 and G2 are independently from each other O or S, and wherein SP stands for solid phase and represents a solid support.
7. The method of claim 3, wherein step a2. is carried out by reacting in solution the compound of formula (I) with a nitro-benzoate derivative resulting in the compound of formula (V):Formula (V)wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined according to claim 1 or claim 2, G1 and G2 are independently from each other O or S, and wherein R? is H, methyl or ethyl.
8. The method of claim 7, wherein in step a3. the compound of formula (V) is coupled to a solid support, providing a compound of formula (VI):Formula (VI)wherein Y, PG, R1, R2, Nb, Q, X, Lipid, m and n are defined according to claim 1 or claim 2, G1 and G2 are independently from each other O or S, and wherein SP stands for solid phase and represents a solid support.
9. The method of any one of claims 1 to 8, wherein the nucleoside lipid derivative of formula (I) is prepared from (A) a compound of formula (VII)Formula (VII)wherein Y, PG, Ri, R2, Nb, and m are defined according to claim 1 , and (B) a compound of formula (VIII)LipidFormula (VIII)wherein Q, X, Lipid, and n are defined according to claim 1.
10. The method of claim 1, said method further comprising the steps of:b. assembling an oligonucleotide using the nucleoside lipid derivative of formula (I) coupled to a solid support as the 3’-oligonucleotide starting point; andoptionally wherein the method further comprises the steps of:c. once the oligonucleotide sequence is complete, removing all protecting groups; d. cleavage of the assembled oligonucleotide from the solid support; and e. optionally, purification of the oligonucleotide.
11. A composition comprising a product of formula (IX):Formula (IX)wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined according to claim 1; G1 and G2 are independently from each other O or S; and L is at least one linker molecule suited for coupling the nucleoside lipid derivative via its 3’ position to a solid support, said at least one linker molecule comprising a base labile function; preferably wherein the compound of formula (IX) is selected from the group consisting of a compound of formula (II), compound of formula (III), ora compound of formula (V).
12. In vitro use of a composition according to claim 11 in a method according to claim 1.
13. A nucleoside lipid derivative selected from the group consisting of a compound of formula (II)Formula (II);a compound of formula (III)Formula (III); ora compound of formula (V)Formula (V);wherein Y, PG, Ri, R2, Nb, Q, X, Lipid, m and n are defined according to claim 1; G1 and G2 are independently from each other O or S; and R? is H, methyl or ethyl.
14. Use of a nucleoside lipid derivative according to claim 13 for the preparation of an oligonucleotide comprising in 3’ position a lipophilic residue.
15. A kit for oligonucleotide synthesis comprising a nucleoside lipid derivative according to claim 13.