Ionizable lipid for delivering nucleic acid

Abstract

The present disclosure provides an ionizable lipid that can be used for nucleic acid delivery to the cytoplasm.　An ionizable lipid according to the present disclosure is, for example, a compound represented by formula (I) or a pharmaceutically acceptable salt thereof. [In the formula, L1 represents –(CH2)n-, L2 represents –(CH2)m-, n represents an integer of 1-5, m represents an integer of 1-5, X1 and X2 each independently represent –OC(O)- or –OC(O)O-, Y represents -OC(O)- or –OC(O)O-, R1 and R2 each independently represent a C2-C25 alkyl group or a C2-C25 alkenyl group which may be substituted with at least one C4-C12 alkoxy group, the total number of carbon atoms of either R1 or R2 is 4-30, P is represented by formula P-1 or formula P-2, R3 represents a C1-C5 alkyl group which may be substituted with a hydroxy group, R4 and R5 each independently represent a hydrogen atom or a C1-C5 alkyl group, or R4 and R5 are bonded to each other to form a C2-C5 alkylene group, p represents 0 or 1, q represents an integer of 0-2, R6 and R7 each independently represent a C1-C5 alkyl group, r represents an integer of 1-5, and * represents a linking site.]

Description

Ionized lipids for nucleic acid delivery

[0001] This disclosure relates to ionized lipids for nucleic acid delivery.

[0002] In recent years, research and development of nucleic acid drugs containing nucleic acids as active ingredients has been conducted. These nucleic acids include nucleic acids that induce sequence-specific gene expression repression in vivo, such as siRNA (small interfering RNA), miRNA (micro RNA), shRNA (short hairpin RNA, or small hairpin RNA) expression vectors, and antisense oligonucleotides. Research is also being conducted on nucleic acid drugs that express target proteins, such as mRNA encoding the target protein, within cells.

[0003] Among these nucleic acid drugs, nucleic acids, while chemically stable, have drawbacks for therapeutic use, such as being easily degraded by RNAs (ribonucleases) in plasma and having difficulty penetrating cell membranes on their own. To address these problems, it is known that encapsulating nucleic acids such as siRNA and mRNA within particles containing ionized lipids (lipid particles, especially lipid nanoparticles; LNPs) protects the encapsulated nucleic acids from degradation in plasma and enables them to penetrate lipid-soluble cell membranes. For example, Patent Documents 1 to 8 report ionized lipids used for the delivery of nucleic acid drugs. In recent years, the practical application of mRNA vaccines against COVID-19 has accelerated the development of nucleic acid drugs utilizing LNP technology, and development of LNP preparations for use in the treatment of a variety of diseases, not just vaccines, is progressing.

[0004] International Publication No. 2010 / 144740 Brochure International Publication No. 2011 / 153493 Brochure International Publication No. 2013 / 086354 Brochure International Publication No. 2013 / 158579 Brochure International Publication No. 2015 / 095346 Brochure International Publication No. 2016 / 104580 Brochure International Publication No. 2014 / 089239 Brochure International Publication No. 2017 / 222016 Brochure Chinese Published Patent No. 114874106

[0005] Despite recent progress, there is still a need for ionizable lipids that can be used for nucleic acid delivery into the cytoplasm.

[0006] The present disclosure is as follows, for example. [1] A compound represented by the following formula (I) or a pharmaceutically acceptable salt thereof. [In the formula, L ６ , １ , ７ represents -(CH ２ ) ｎ -, L ２ represents -(CH ２ ) ｍ -, n represents an integer from 1 to 5, m represents an integer from 1 to 5, X １ and X ２ each independently represents -OC(O)- or -OC(O)O-, Y represents -OC(O)- or -OC(O)O-, R １ and R ２ each independently represents an alkyl group having 2 to 25 carbon atoms or an alkenyl group having 2 to​​​​​​​​​​​​​​​​​​​​​This is expressed by the following formula C-1, and R ２ This is represented by the following formula C-1, or represents a linear alkyl group having 4 to 12 carbon atoms, a linear alkenyl group having 4 to 12 carbon atoms, or a linear alkoxy group having 4 to 12 carbon atoms. X ３ and X ４ Each of these independently represents a single bond or -O-, and R ８ and R ９ Each independently represents an alkyl group having 4 to 12 carbon atoms or an alkenyl group having 4 to 12 carbon atoms, s represents an integer from 1 to 4, and * represents a linking site. The compound described in any of [1] to [3] or a pharmaceutically acceptable salt thereof. [5] P is represented by the formula P-1, n represents 2 or 3, m represents 2 or 3, X １ and X ２ They are identical to each other, R １ and R ２ They are identical to each other, R ３ R represents an alkyl group having 1 to 4 carbon atoms, which may be substituted with a hydroxyl group. ４ and R ５ Each of these independently represents a hydrogen atom, or R ４ and R ５ The compounds described in any of [1] to [4] or pharmaceutically acceptable salts thereof, wherein the atoms are bonded to each other to form an alkylene group having 2 or 3 carbon atoms, p represents 0 or 1, and q represents 1 or 2. [6] P is represented by the formula P-1, n represents 2 or 3, m represents 2 or 3, and X １ and X ２ They are identical to each other, R １ and R ２ They are identical to each other, R ３ R represents a methyl group. ４ and R ５ The compounds described in any of [1] to [5] or pharmaceutically acceptable salts thereof, wherein each represents a hydrogen atom independently, p represents 0 or 1, and q represents 1 or 2.

[0007] [7] The following compounds A compound selected from the group consisting of [1] to [4] or a pharmaceutically acceptable salt thereof, as described in any of [1] to [4]. [8] The following compounds A compound selected from the group consisting of [1] to [6] or a pharmaceutically acceptable salt thereof, as described in any of [1] to [6]. [9] The following compounds A compound selected from the group consisting of [1] to [5], or a pharmaceutically acceptable salt thereof, according to any one of the compounds described therein.

[0008]

[10] P is represented by the above formula P-2, n is 2 or 3, m is 2 or 3, X １ and X ２ They are identical to each other, R １ and R ２ They are identical to each other, R ６ and R ７ Each of the following compounds or pharmaceutically acceptable salts thereof, where each independently represents an alkyl group having 1 to 3 carbon atoms, and r is an integer from 2 to 4.

[11] P is represented by the formula P-2, n is 2, m is 2, and X １ and X ２ is -OC(O)-, and R ６ and R ７ Each of the following compounds or pharmaceutically acceptable salts thereof, wherein each of the following independently represents an alkyl group having 1 to 3 carbon atoms, and r is 3: [1] to [4] and

[10] .

[12] The following compounds are: A compound selected from the group consisting of [1] to [4],

[10] , and

[11] , or a pharmaceutically acceptable salt thereof.

[13] The following compounds: The compound described in any of [1] to [4],

[10] , and

[11] , or a pharmaceutically acceptable salt thereof.

[0009]

[14] A lipid complex comprising (I) a compound described in any of [1] to

[13] or a pharmaceutically acceptable salt thereof, and (II) at least one lipid selected from the group consisting of neutral lipids, polyethylene glycol-modified lipids, and sterols.

[15] A composition comprising (I) a compound described in any of [1] to

[13] or a pharmaceutically acceptable salt thereof, (II) at least one lipid selected from the group consisting of neutral lipids, polyethylene glycol-modified lipids, and sterols, and (III) nucleic acid.

[16] A method for producing a composition comprising the steps of: mixing an aqueous solution containing a polar organic solvent comprising (I) a compound described in any of [1] to

[13] or a pharmaceutically acceptable salt thereof, and (II) at least one lipid selected from the group consisting of neutral lipids, polyethylene glycol-modified lipids, and sterols, with an aqueous solution containing (III) nucleic acid to obtain a mixture; and reducing the content of the polar organic solvent in the mixture.

[17] Use of any compound described in [1] to

[13] or a pharmaceutically acceptable salt thereof, the lipid complex described in

[14] , or the composition described in

[15] for the manufacture of a pharmaceutical product.

[0010] The ionized lipids of this disclosure can efficiently release nucleic acids into the cytoplasm. Therefore, the ionized lipids of this disclosure have potential for use as lipids for nucleic acid delivery to the cytoplasm. Furthermore, one form of the ionized lipid of this disclosure exhibits excellent retention of nucleic acid activity (storage stability of the active pharmaceutical ingredient).

[0011] The present disclosure will be described in detail below with reference to embodiments and examples, but the present disclosure is not limited to the embodiments and examples shown below and can be modified and implemented at will without departing from the gist of the disclosure. All documents and publications mentioned herein, regardless of their purpose, are incorporated herein by reference in their entirety.

[0012] In this specification, “alkyl” means a linear, cyclic, or branched saturated aliphatic hydrocarbon group having a specified number of carbon atoms. In this specification, “alkoxy” means a group in which an alkyl group is bonded to an oxygen atom (O). In this specification, “alkenyl” means a linear or branched hydrocarbon group having a specified number of carbon atoms and at least one carbon-carbon double bond. Examples include, but are not limited to, monoenes, dienes, trienes, and tetraenes. In this specification, “alkylene” means a linear, cyclic, or branched divalent saturated aliphatic hydrocarbon group having a specified number of carbon atoms.

[0013] 1. Ionized Lipids One embodiment of the present disclosure is a compound represented by the following formula (I) or a pharmaceutically acceptable salt thereof, which can be used as an ionized lipid. The ionized lipid may be a hydrate of the salt or a solvate of the salt. The chiral atoms (e.g., carbon) in the compounds of the present disclosure may exist in racemic or enantiomer-enriched forms, for example, in (R)-stereoconfiguration, (S)-stereoconfiguration, or in mixtures of (R) and (S) in any proportion. In equation (I), P is represented by the following equation P-1 or equation P-2.

[0014] In formula P-1, R ３ R represents an alkyl group having 1 to 5 carbon atoms, which may be substituted with a hydroxyl group. ３ is preferably a C1-C3 alkyl group which may be substituted with a hydroxyl group. In some embodiments, R ３ is a methyl group. In some embodiments, R ３ R is a propyl group substituted with a hydroxyl group. In formula P-1, R ４ and R ５ Each of these independently represents a hydrogen atom or an alkyl group having 1 to 5 carbon atoms, or R ４ and R ５ These atoms bond to each other to form alkylene groups with 2 to 5 carbon atoms. ４ and R ５Preferably, each represents a hydrogen atom independently, or they are bonded together to form a C2-C3 alkylene group. In some embodiments, R ４ and R ５ is a hydrogen atom. In some embodiments, R ４ and R ５ These combine with each other to form an ethylene group. In formula P-1, p represents 0 or 1. In some embodiments, p is 0. In some embodiments, p is 1. In formula P-1, q represents an integer from 0 to 2. q is preferably 1 or 2, and more preferably 1. In formula P-2, R ６ and R ７ Each of these independently represents an alkyl group having 1 to 5 carbon atoms. ６ and R ７ These may be the same or different from each other. In some embodiments, R ６ and R ７ They are identical to each other. R ６ and R ７ is preferably an alkyl group having 1 to 3 carbon atoms, and more preferably a methyl group. In formula P-2, r represents an integer from 1 to 5. r is preferably an integer from 2 to 4, more preferably an integer from 1 to 3, even more preferably 2 or 3, and particularly preferably 3. In formulas P-1 and P-2, * represents a linking site.

[0015] In some embodiments, P is a compound represented by the following formula P-1, and the ionized lipid is a compound represented by the following formula (I-1) or a pharmaceutically acceptable salt thereof. In some embodiments, P is a compound represented by the following formula P-2, and the ionized lipid is a compound represented by the following formula (I-2) or a pharmaceutically acceptable salt thereof.

[0016] In equations (I), (I-1), and (I-2), L １ is, -(CH ２ ) ｎrepresents "-", and n represents an integer from 1 to 5. From the viewpoint of excellent nucleic acid releasing ability, n is preferably 2 to 4, more preferably 2 or 3. In some embodiments, n is 2. In some embodiments, n is 3. In Formula (I), Formula (I-1), and Formula (I-2), L ２ represents -(CH ２ ) ｍ -, and m represents an integer from 1 to 5. From the viewpoint of excellent nucleic acid releasing ability, m is preferably 2 to 4, more preferably 2 or 3. In some embodiments, m is 2. In some embodiments, m is 3. In Formula (I), Formula (I-1), and Formula (I-2), L １ and L ２ may be the same as or different from each other. In some embodiments, L １ and L ２ are the same as each other.

[0017] In Formula (I), Formula (I-1), and Formula (I-2), X １ and X ２ each independently represents -OC(O)- or -OC(O)O-. X １ and X ２ may be the same as or different from each other. In some embodiments, X １ and X ２ are the same as each other. In some embodiments, X １ and X ２ are each independently -OC(O)-. In some embodiments, X １ and X ２ are each independently -OC(O)O-.

[0018] In Formula (I), Formula (I-1), and Formula (I-2), Y represents -OC(O)- or -OC(O)O-. In some embodiments, Y is -OC(O)-. In some embodiments, Y is -OC(O)O-.

[0019] In Formula (I), Formula (I-1), and Formula (I-2), R １ and R ２represents an alkyl group or an alkenyl group having 2 to 25 carbon atoms, which may each independently be substituted with one or more (preferably one or two) alkoxy groups having 4 to 12 carbon atoms, and R １ or R ２ each has a total carbon number of 4 to 30. In Formula (I), Formula (I-1), and Formula (I-2), R １ and R ２ may be the same as or different from each other. In some embodiments, R １ is represented by the following Formula C-1, and R ２ is represented by the following Formula C-1, or represents a linear alkyl group having 4 to 12 carbon atoms (preferably 6 to 10 carbon atoms), a linear alkenyl group having 4 to 12 carbon atoms (preferably 6 to 10 carbon atoms), or a linear alkoxy group having 4 to 12 carbon atoms (preferably 6 to 10 carbon atoms). In Formula C-1, X ３ and X ４ each independently represents a single bond or -O-. X ３ and X ４ may be the same as or different from each other. In Formula C-1, R ８ and R ９ each independently represents an alkyl group having 4 to 12 carbon atoms or an alkenyl group having 4 to 12 carbon atoms. R ８ and R ９ are preferably an alkyl group having 4 to 10 carbon atoms or an alkenyl group having 4 to 10 carbon atoms, and more preferably an alkyl group or an alkenyl group having 6 to 8 carbon atoms. In Formula C-1, s represents an integer of 1 to 4. s is preferably 1 or 2, and more preferably 1. In Formula C-1, * represents a linking site.

[0020] In some embodiments, P is represented by the above Formula (P-1). In the above Formula (I) and Formula (I-1), n represents 2 or 3, m represents 2 or 3, X １ and X ２ are the same as each other, R １ and R ２ are the same as each other, and are preferably a group represented by the above Formula C-1 (the preferred embodiments of C-1 are as described above), and R３ R represents a C1-C4 alkyl group which may be substituted with a hydroxyl group (preferably a C1-C3 alkyl group which may be substituted with a hydroxyl group, more preferably a methyl group or a propyl group substituted with a hydroxyl group, especially a methyl group), ４ and R ５ Each of these independently represents a hydrogen atom, or R ４ and R ５ The compounds or pharmaceutically acceptable salts thereof are bonded to each other to form a C2 or C3 alkylene group, where p represents 0 or 1 and q represents 1 or 2. These may be hydrates or solvates of the salts.

[0021] In some embodiments, P is represented by the above formula (P-1), where in formula (I) and formula (I-1), n ​​represents 2 or 3, m represents 2 or 3, and X １ and X ２ They are identical to each other, R １ and R ２ These are identical to each other, preferably a group represented by the above formula C-1 (the preferred embodiment of C-1 is as described above), and R ３ R represents a methyl group. ４ and R ５ The compounds or pharmaceutically acceptable salts thereof are such that each independently represents a hydrogen atom, p represents 0 or 1, and q represents 1 or 2. These may be hydrates or solvates of the salts.

[0022] Examples of compounds of the embodiment in which P is represented by the above formula (P-1) are shown below. These compounds may also be pharmaceutically acceptable salts thereof and can be used as ionized lipids. The ionized lipid may be a hydrate of the salt or a solvate of the salt.

[0023] One embodiment of the present disclosure is a compound represented by any of (E1), (E4), (E12), (E13), (E16), (E17), (E29), (E3), (E5), (E7), (E8), (E9), (E10), (E11), (E19), (E20), (E21), (E24), (E26), (E28), (E30), (E37), or (E38) above, or a pharmaceutically acceptable salt thereof, which can be used as an ionized lipid. The ionized lipid may be a hydrate of the salt or a solvate of the salt. These compounds are excellent in nucleic acid release ability and retention of nucleic acid activity (storage stability of the active pharmaceutical ingredient). One embodiment of the present disclosure is a compound represented by any of (E1), (E4), (E12), (E13), (E16), (E17), or (E29) above, or a pharmaceutically acceptable salt thereof, which can be used as an ionized lipid. The ionized lipid may be a hydrate of the salt or a solvate of the salt. These compounds are excellent in nucleic acid release ability and retention of nucleic acid activity (storage stability of the active pharmaceutical ingredient). One embodiment of the present disclosure is a compound represented by any of (E1), (E4), (E12), (E13), (E16), (E17), (E29), (E3), (E5), (E7), (E8), (E9), (E10), (E11), (E19), (E20), (E21), (E24), (E26), (E28), (E30), (E37), or (E38) above, or a pharmaceutically acceptable salt thereof, which can be used as an ionized lipid. The ionized lipid may be a hydrate of the salt or a solvate of the salt. These compounds are excellent in nucleic acid release ability and retention of nucleic acid activity (storage stability of the active pharmaceutical ingredient). One embodiment of the present disclosure is a compound represented by any of (E1) above or a pharmaceutically acceptable salt thereof, which can be used as an ionized lipid. The ionized lipid may be a hydrate of the salt or a solvate of the salt. These compounds are particularly excellent in nucleic acid release ability and retention of nucleic acid activity (storage stability of the active pharmaceutical ingredient).One embodiment of the present disclosure is a compound represented by any of (E1), (E2), (E4), (E5), (E8), (E9), (E10), (E11), (E12), (E13), (E16), (E17), (E18), (E19), (E20), (E21), (E22), (E24), (E26), (E27), (E28), (E29), (E30), (E31), (E32), (E33), (E34), (E35), (E36), (E37), (E38), (E40), (E43), (E45), (E46), (E47), (E49), (E50), (E53), (E54), (E55), (E56), or (E57) above, or a pharmaceutically acceptable salt thereof, which can be used as an ionized lipid. The ionized lipid may be a hydrate of the salt or a solvate of the salt. These compounds exhibit excellent nucleic acid release ability. One embodiment of the present disclosure is a compound represented by any of (E1), (E2), (E4), (E8), (E9), (E10), (E11), (E12), (E16), (E17), (E18), (E19), (E20), (E21), (E22), (E24), (E26), (E27), (E28), (E29), (E30), (E31), (E32), (E33), (E34), (E35), (E36), (E37), (E38), (E43), (E46), (E47), (E49), (E53), (E54), (E55), (E56), or (E57) above, or a pharmaceutically acceptable salt thereof, which can be used as an ionized lipid. The ionized lipid may be a hydrate of the salt or a solvate of the salt. These compounds exhibit particularly excellent nucleic acid release ability.

[0024] In some embodiments, P is represented by the above formula (P-2), where in formulas (I) and (I-2), n represents 2 or 3, m represents 2 or 3, and X １ and X ２ They are identical to each other, R １ and R ２ These are identical to each other, preferably a group represented by the above formula C-1 (the preferred embodiment of C-1 is as described above), and R ６ and R ７Each of the following independently represents an alkyl group having 1 to 3 carbon atoms (preferably a methyl group), and r represents an integer from 2 to 4 (more preferably an integer from 1 to 3, even more preferably 2 or 3, and particularly preferably 3), and is a compound or a pharmaceutically acceptable salt thereof. These may be hydrates of the salt or solvates of the salt. In this embodiment, Y is -OC(O)- or -OC(O)O-, preferably -OC(O)-.

[0025] In some embodiments, P is represented by the above formula (P-2), where in formulas (I) and (I-2), n is 2, m is 2, and X １ and X ２ is -OC(O)-, and R １ and R ２ These are identical to each other, preferably a group represented by the above formula C-1 (the preferred embodiment of C-1 is as described above), and R ６ and R ７ Each of these independently represents an alkyl group having 1 to 3 carbon atoms (preferably a methyl group), and r is 3, and is a compound or a pharmaceutically acceptable salt thereof. These may be hydrates of the salt or solvates of the salt. In this embodiment, Y is -OC(O)- or -OC(O)O-, preferably -OC(O)-.

[0026] Examples of compounds of the embodiment in which P is represented by the above formula (P-2) are shown below. These compounds may also be pharmaceutically acceptable salts thereof and can be used as ionized lipids. The ionized lipid may be a hydrate of the salt or a solvate of the salt.

[0027] One embodiment of the present disclosure is the compound represented by (E6) above or a pharmaceutically acceptable salt thereof, which can be used as an ionized lipid. The ionized lipid may be a hydrate of the salt or a solvate of the salt. The compound exhibits excellent nucleic acid release ability and nucleic acid activity retention (storage stability of the active pharmaceutical ingredient).

[0028] In this specification, an ionized lipid is an amphiphilic molecule having a lipid affinity region containing one or more hydrocarbon groups and a hydrophilic region containing polar groups that are neutral at physiological pH but can be protonated in a low pH environment. That is, the ionized lipids of this disclosure are neutral at physiological pH but can be protonated in a low pH environment (e.g., a local low pH environment such as an endosome) to form a cation. For example, the compounds represented by formulas (I-1) and (I-2) above include compounds in which a hydrogen ion is coordinated to a lone pair of electrons on a nitrogen atom (cationic compounds), as shown in formulas (I-1)' and (I-2)' below. The cationic compound can, together with anions, form salts shown in formulas (I-1)' and (I-2)' below, and hydrates or solvates of the salts. In formulas (I-1)' and (I-2)', L １ and L ２ , X １ and X ２ , Y, R １ ~R ７ p, q, and r are synonymous with formulas (I-1) and (I-2) above. Z is an anion (counterion). The compounds of this embodiment can be used as ionized lipids. The anions (Z in formulas (I-1)' and (I-2)' above) that the ionized lipids of this embodiment may contain in combination with the cationic compound are not particularly limited as long as they are pharmaceutically acceptable, and include, for example, inorganic ions such as chloride ions, bromide ions, nitrate ions, sulfate ions, and phosphate ions; and organic acid ions such as acetate ions, oxalate ions, maleate ions, fumarate ions, citrate ions, benzoate ions, and methanesulfonate ions. The ionized lipids of this disclosure may have stereoisomers such as geometric isomers and optical isomers, as well as tautomers, etc., but the ionized lipids of this disclosure include all possible isomers and mixtures thereof.

[0029] 2. Method for Producing Ionized Lipids The method for producing the ionized lipids of this disclosure will be described below. One embodiment of the synthesis scheme for the ionized lipids is shown below. All compounds described herein are included in this disclosure as compounds. The compounds of this disclosure can be synthesized according to at least one of the methods described in the following scheme. Since the ionized lipids of this disclosure may have one or more chiral centers, the synthesized compounds may be produced as (R)- or (S)-stereoisomers or mixtures thereof. Unless otherwise noted, descriptions of specific compounds herein are intended to include both individual enantiomers and racemic mixtures thereof. Methods for determining stereochemistry and separating stereoisomers are well known to those skilled in the art.

[0030] The ionized lipid of formula (I) can be synthesized, for example, as shown in the scheme below. Specifically, it can be synthesized by obtaining an intermediate (a4) from an alcohol (a1) according to scheme 1-1, scheme 1-2, scheme 1-3, or scheme 1-4, and then obtaining the compound of formula (I) from the intermediate (a4) according to scheme 2-1 or 2-2. The scheme below will be explained below. (In the scheme, R １ , R ２ , X １ , X ２ , L １ , L ２ P is equivalent to formula (I) above. TBDMS represents a tert-butyldimethylsilyl group, and Bn represents a benzyl group.

[0031] [Scheme 1-1] Scheme 1-1 is a formula from alcohol (a1) to X １ and X ２ is -OC(O)-, and R １ and R ２This is a reaction scheme to obtain the intermediate compound (a4) (diester alcohol) when the two components are the same. (Esterification) First, alcohol (a1) and oxodicarboxylic acid (a2) are reacted in the presence of a coupling agent to obtain oxodicarboxylic acid diester (a3). Examples of coupling agents include 1-(bis(dimethylamino)methylene)-1H-1,2,3-triazolo(4,5-b)pyridinium 3-oxidehexafluorophosphate (HATU), 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide (EDC) hydrochloride, N,N'-dicyclohexylcarbodiimide (DCC), etc. A base may be added as needed. Examples of bases include N-methylmorpholine (NMM), triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), 4-(dimethylamino)pyridine (DMAP), pyridine, picoline, lutidine, etc. Examples of solvents include tetrahydrofuran (THF), methylene chloride, chloroform, toluene, hexane, ethyl acetate, and N,N-dimethylformamide (DMF). A commercially available alcohol (a1) may be used, or, for example, an alcohol having a desired number of carbon atoms, branched structure, saturated structure, and / or ether structure can be synthesized by the manufacturing method described in the examples below and any appropriate modifications thereof. (Reduction) Next, the oxo group (ketone) of the oxodicarboxylic acid diester (a3) ​​is reduced to a hydroxyl group in the presence of a reducing agent to obtain a diester alcohol (a4). Examples of reducing agents include sodium borohydride (NaBH). ４ Examples include the following. As solvents, for example, ethers such as diethyl ether, tetrahydrofuran, dioxane, and methyl tert-butyl ether (MTBE), halogenated hydrocarbons such as chloroform, methylene chloride, and dichloroethane, hydrocarbons such as hexane and toluene, and mixed solvents thereof can be used.

[0032] [Scheme 1-2] Scheme 1-2 is a formula from alcohol (a1) to X １ and X ２ is -OC(O)-, and R １ and R ２This is a reaction scheme to obtain intermediate compound (a4) (diester alcohol) when the two components are different from each other. (Monoesterification) First, alcohol (a1) and oxodicarboxylic acid anhydride (a5) are reacted by heating under reflux to obtain oxodicarboxylic acid monoester (a6). A base may be added as needed. Examples of bases include N-methylmorpholine (NMM), triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), 4-(dimethylamino)pyridine (DMAP), pyridine, picoline, lutidine, etc. Examples of solvents include tetrahydrofuran (THF), methylene chloride, chloroform, toluene, hexane, ethyl acetate, N,N-dimethylformamide (DMF), etc. Oxodicarboxylic acid anhydride (a5) can be obtained, for example, by reacting oxodicarboxylic acid (a2) in the presence of a dehydrating agent. The dehydrating agent is not particularly limited, but examples include acetyl chloride and thionyl chloride. (Esterification) Next, alcohol (a7) and oxodicarboxylic acid monoester (a6) are reacted in the presence of a coupling agent to obtain oxodicarboxylic acid diester (a7). The reaction conditions, such as the coupling agent and base, are the same as in (esterification) of Scheme 1-1. (Reduction) Next, the oxo group (ketone) of the oxodicarboxylic acid diester compound (a7) is reduced to a hydroxyl group in the presence of a reducing agent to obtain diester alcohol (a4). The reaction conditions, such as the reducing agent and solvent, are the same as in (reduction) of Scheme 1-1.

[0033] [Scheme 1-3] Scheme 1-3 is a formula from alcohol (a1) to X １ and X ２ is -OC(O)-, and R １ and R ２This is a reaction scheme to obtain intermediate compound (a4) (diester alcohol) when the two components are different from each other. (Monoesterification) First, alcohol (a1) and dicarboxylic acid anhydride (a9) in which a protecting group has been introduced to the hydroxyl group are reacted by heating under reflux to obtain dicarboxylic acid monoester (a10). Examples of solvents include tetrahydrofuran (THF), methylene chloride, chloroform, toluene, hexane, ethyl acetate, and N,N-dimethylformamide (DMF). In schemes 1-3, tert-butyldimethylsilyl (TBDMS) groups are used as hydroxy protecting groups for compounds (a9) and (a10), but the protecting group is not limited to TBDMS, and conventional hydroxy protecting groups well known to those skilled in the art can be used. (Esterification) Next, alcohol (a7) and dicarboxylic acid monoester (a10) are reacted in the presence of a coupling agent to obtain dicarboxylic acid diester (a11). The reaction conditions, including the coupling agent and base, are the same as those for (esterification) in Scheme 1-1. (Deprotection) Next, the hydroxy protecting group (TBDMS group) of the dicarboxylic acid diester (a11) is deprotected to obtain the diester alcohol (a4). Deprotection of the TBDMS group can be carried out, for example, by reacting it with a fluoride salt such as tetra-n-butylammonium fluoride (TBAF) in an organic solvent such as tetrahydrofuran.

[0034] [Scheme 1-4] Scheme 1-4 is a formula from alcohol (a1) to X １ and X ２ is -OC(O)O-, and R １ and R ２This is a reaction scheme to obtain the intermediate compound (a4) (dicarbonate alcohol) when the conditions are the same. (Carbonate formation) First, alcohol (a1) and 4-nitrophenyl chloroformate are reacted in the presence of a base to obtain nitrophenyl carbonate compound (a12). Examples of solvents include tetrahydrofuran (THF), methylene chloride, chloroform, toluene, hexane, ethyl acetate, and N,N-dimethylformamide (DMF). Examples of bases include N-methylmorpholine (NMM), triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), 4-(dimethylamino)pyridine (DMAP), pyridine, picoline, and lutidine. Next, nitrophenyl carbonate compound (a12) and diol compound (a13) are reacted in the presence of a base to obtain dicarbonate compound (a14). The reaction conditions, such as the base and solvent, are the same as described above. Alternatively, carbonate formation may be carried out by reacting an alcohol (a1), a diol compound (a13), and a phosgene (e.g., triphosgene) in the presence of a base, similar to the method of (carbonate formation) in Scheme 2-2 described later. (Deprotection) Subsequently, the hydroxy protecting group (benzyl (Bn) group) of the dicarbonate compound (a14) is deprotected to obtain a dicarbonate alcohol (a4). Deprotection of the Bn group can be carried out, for example, by catalytic hydrogenation in the presence of a metal catalyst such as palladium / carbon. Also, in this Scheme 1-4, R １ and R ２ We have described a method for producing the intermediate compound (a4) when the same, but for example, R １ and R ２ When producing different compounds (a4), for example, instead of the diol compound (a13), a compound in which one of the hydroxyl groups of the diol compound (a13) is protected by a protecting group is used. １ A nitrophenyl carbonate compound (a12) containing is reacted to form a carbonate, and then the protecting group is deprotected, and then R ２ A method can be used in which a nitrophenyl carbonate compound (a12) containing the above is further subjected to a carbonate formation reaction.

[0035] [Scheme 2-1] Scheme 2-1 is a reaction scheme for obtaining a compound of formula (I) in which Y is -OC(O)- from an intermediate (a4) (diester alcohol or dicarbonate alcohol). (Esterification; Introduction of P) The intermediate (a4) (diester alcohol or dicarbonate alcohol) and P-COOH (carboxylic acid) or its derivative (hydrohalide salt, organic acid salt, etc.) (a15) are esterified in the presence of a condensing agent and a base to obtain a compound of formula (I). The same condensing agent and base as in step 1-1 (esterification) can be used.

[0036] [Scheme 2-2] Scheme 2-2 is a reaction scheme for obtaining a compound of formula (I) in which Y is -OC(O)O- from an intermediate (a4) (diester alcohol or dicarbonate alcohol). (Carbonate formation) The intermediate (a4) (diester alcohol or dicarbonate alcohol), P-OH (alcohol) or its derivative (a16), and phosgenes (e.g., triphosgene) are reacted in the presence of a base to obtain the final compound of formula (I). The condensing agent and base can be the same as those used in (esterification) of step 1-1. Examples of solvents include tetrahydrofuran (THF), methylene chloride, chloroform, toluene, hexane, ethyl acetate, and N,N-dimethylformamide (DMF). Examples of bases include N-methylmorpholine (NMM), triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), 4-(dimethylamino)pyridine (DMAP), pyridine, picoline, and lutidine. The method of carbonate formation is not limited to the above method; for example, a reaction using a chloroformic acid derivative such as 4-nitrophenyl chloroformate, as shown in Scheme 1-4, may also be used.

[0037] In schemes 2-1 and 2-2, by using starting materials with controlled stereochemistry (for example, the stereochemistry of the carbon atom at position 3 of the pyrrolidine ring) as P-COOH (carboxylic acid) or its derivative (a15) or P-OH (alcohol) or its derivative (a16), it is possible to control the stereochemistry of P in the compound of formula (I). Furthermore, the alcohol (R) used in schemes 1-1 to 1-4 １ -OH, R ２ By using raw materials with controlled stereochemistry as -OH, R １ and R ２ It is possible to control the stereochemistry of the compound. Furthermore, after introducing P in schemes 2-1 and 2-2, modification of P (for example, introduction of an alkyl group substituted with a hydroxyl group) may be performed.

[0038] Note that in schemes 1-1 to 1-4 and schemes 2-1 and 2-2 above, R １ and R ２ Although P is introduced after R is introduced, for example, as shown in Scheme 3 below, P is introduced first, and then R １ and R ２ The ionized lipids of this disclosure may be synthesized by a method that introduces [the specified element]. (In the scheme, R １ , R ２ , L １ , L ２ P is equivalent to the formula (I) above. Bn represents a benzyl group.

[0039] [Scheme 3] Scheme 3 is a carboxyl group protected oxodicarboxylic acid compound (a17) X １ and X ２ is -OC(O)-, and R １ and R ２This is a reaction scheme to obtain the compound of formula (I) when the two components are the same. Compound (a17) may be obtained by reacting formic acid with benzyl acrylate as in Example 9-1 described later, or by protecting the carboxyl group of the oxodicarboxylic acid (a2) with a protecting group (e.g., Bn). (Reduction) First, the oxo group (ketone) of compound (a17) is reduced to a hydroxyl group in the presence of a reducing agent to obtain alcohol (a18). The reaction conditions, such as the reducing agent and solvent, are the same as in (reduction) of scheme 1-1. (Esterification: Introduction of P) Next, alcohol (a18) and P-COOH (carboxylic acid) or its derivative (hydrohalide salt, etc.) (a15) are esterified in the presence of a condensing agent and a base to obtain ester (a19). The same condensing agent and base as in (esterification) of step 1-1 can be used. (Deprotection) Next, the carboxyl protecting group (benzyl (Bn) group) of ester (a19) is deprotected to obtain esterdiol (a20). Deprotection of the Bn group can be carried out, for example, by catalytic hydrogenation in the presence of a metal catalyst such as palladium / carbon. (Esterification: R １、 R ２ (Introduction) Next, the alcohol (a1) and the ester diol (a20) are reacted in the presence of a condensing agent to obtain the compound of formula (I). The same condensing agent and base as in step 1-1 (esterification) can be used.

[0040] In the synthesis of the compounds of this disclosure, unless otherwise specified, the preparation of the starting materials can be made from known materials or similar methods known in the art, or as described in the following examples. Those skilled in the art will understand that the above schemes are merely representative methods for the preparation of the compounds of this disclosure, and other well-known methods can be used in the same manner. For example, methods and intermediate compounds described in prior art publications, including International Publication No. 2015 / 105131, International Publication No. 2016 / 104580, International Publication No. 2017 / 222016, and International Publication No. 2019 / 131580, can be used for the synthesis of the compounds of this disclosure.

[0041] In the synthesis of the compounds of this disclosure, it may be necessary and / or desirable to protect the functional groups of the molecules. This can be done using conventional protecting groups well known to those skilled in the art. The protecting groups can be removed at a convenient subsequent stage using methods well known in the art. The protecting groups shown in the above scheme (benzyl (Bn) protecting group, tert-butyldimethylsilyl (TBDMS) protecting group) can also be substituted with other protecting groups well known to those skilled in the art.

[0042] The compounds relating to this disclosure may exist in crystalline polymorphisms, but are not limited to any of them, and may be a single substance or a mixture of any of the crystalline forms. Furthermore, amorphous forms are also included in the compounds relating to this disclosure, and the compounds relating to this disclosure include anhydrous and solvates (especially hydrates).

[0043] In this specification, "pharmaceutically acceptable salt" is not particularly limited as long as it forms a salt with the compound relating to this disclosure, and specifically, examples include inorganic salts, organic salts, or acid addition salts such as acidic amino acid salts.

[0044] In this specification, "pharmaceutically acceptable salt" means, unless otherwise specified, a salt formed in an appropriate ratio, and the number of acid molecules per molecule of compound in the formed salt is not particularly limited, but preferably the number of acid molecules per molecule of compound is about 0.5 to about 2, and more preferably about 0.5, about 1, or about 2.

[0045] Preferred examples of inorganic salts include hydrochloride, hydrobromide, sulfate, nitrate, and phosphate, while preferred examples of organic salts include acetate, succinate, fumarate, maleate, tartrate, citrate, lactate, stearate, benzoate, methanesulfonate, p-toluenesulfonate, and benzenesulfonate.

[0046] Preferred examples of acidic amino acid salts include, for example, aspartate and glutamate.

[0047] If the compound relating to this disclosure is obtained as a free form, it can be converted to a salt or hydrate thereof, which may be formed by the compound, according to conventional methods.

[0048] When the compound relating to this disclosure is obtained as a salt of the compound or a hydrate of the compound, it can be converted to the free form of the compound according to conventional methods.

[0049] Furthermore, various isomers (e.g., optical isomers, rotational isomers, stereoisomers, etc.) obtained from the compounds relating to this disclosure can be purified and isolated using conventional separation methods, such as recrystallization, diastereomer salting, enzymatic resolution, and various chromatography methods (e.g., thin-layer chromatography, column chromatography, gas chromatography, etc.).

[0050] 3. Lipid Complex One embodiment of the present disclosure provides a lipid complex containing (I) the ionized lipid described above, and (II) at least one lipid selected from the group consisting of neutral lipids, polyethylene glycol-modified lipids, and sterols. In one embodiment of the present disclosure, the lipid complex contains (I) the ionized lipid described above, (II) at least one lipid selected from the group consisting of neutral lipids, polyethylene glycol-modified lipids, and sterols, and (III) a nucleic acid. Therefore, the lipid complex of the present disclosure may or may not contain a nucleic acid. The lipid complex of this embodiment enables the efficient release of nucleic acids into the cytoplasm. Furthermore, the lipid complex of this embodiment exhibits excellent retention of nucleic acid activity (storage stability of the active pharmaceutical ingredient). In addition, the lipid complex of this embodiment may exhibit excellent physical stability, with suppressed particle size increase when stored for a certain period (e.g., 1 month, 1.5 months, or 3 months).

[0051] Examples of complexes formed by lipids containing ionized lipids and nucleic acids include complexes of nucleic acids with a membrane (reverse micelle) consisting of a lipid single (single molecule) layer, complexes of nucleic acids with liposomes, and complexes of nucleic acids with micelles. In some embodiments, the lipid complex has a structure in which nucleic acids are encapsulated in lipids containing ionized lipids. In some embodiments, the lipid complex is a lipid particle. The lipid particle has a structure in which nucleic acids are encapsulated within a particle composed of lipids. In some embodiments, the lipid complex is a lipid nanoparticle (LNP). The LNP has a structure in which nucleic acids are encapsulated within a nano-sized particle with an average particle diameter (for example, about 1 nm to 1000 nm) composed of lipids.

[0052] (Nucleic Acids) Examples of nucleic acids include siRNA, miRNA, shRNA expression vectors, antisense oligonucleotides, mRNA, and ribozymes. In one embodiment, the nucleic acid may be siRNA, miRNA, or mRNA.

[0053] (Lipid component) The lipid complex of this embodiment contains, as a lipid component, (I) the ionized lipid described above, and (II) at least one lipid selected from the group consisting of neutral lipids, polyethylene glycol-modified lipids, and sterols.

[0054] Neutral lipids refer to lipids that exist at physiological pH in either an uncharged or neutral amphoteric ion form. Examples of neutral lipids are not limited to dioleoylphosphatidylethanolamine (DOPE), phosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), palmitoyloleoylphosphatidylcholine (POPC), egg phosphatidylcholine (EPC), dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), and diarachidoylphosphatidyl Phospholipids such as glycerol (DAPC), dibehenoylphosphatidylcholine (DBPC), dilignoceroylphosphatidylcholine (DLPC), dioleoylphosphatidylcholine (DOPC), stearyloleoylphosphatidylcholine (SOPC), hydrogenated soybean phosphatidylcholine (HSPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), distearoylphosphatidylglycerol (DSPG), dioleylphosphatidylserine (DOPS), sphingomyelin, etc.; ceramide (Cer); etc. Neutral lipids can be used individually or in combination of two or more. In some embodiments, the neutral lipids include at least one selected from DOPE, HSPC, DPPC, DSPC, and DAPC. In certain embodiments, the neutral lipids include DSPC.

[0055] Polyethylene glycol-modified lipids are not particularly limited, but examples include PEG2000-DMG (PEG2000-dimyristylglycerol), PEG2000-DPG (PEG2000-dipalmitoylglycerol), PEG2000-DSG (PEG2000-distearoylglycerol), PEG5000-DMG (PEG5000-dimyristylglycerol), PEG5000-DPG (PEG5000-dipalmitoylglycerol), PEG5000-DSG (PEG5000-distearoylglycerol) Examples include glycerol, PEG-cDMA (N-[(methoxypoly(ethylene glycol)2000)carbamyl]-1,2-dimyristyloxypropyl-3-amine), PEG-C-DOMG (R-3-[(ω-methoxy-poly(ethylene glycol)2000)carbamoyl)]-1,2-dimyristyloxypropyl-3-amine), PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), and PEG-cholesterol. Examples of PEG-DAAs include PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl, and PEG-distearyloxypropyl.

[0056] Polyethylene glycol-modified lipids can be used individually or in combination of two or more types. Furthermore, the polyethylene glycol-modified lipids may have methoxylated ends (MPEG; methoxy(polyethylene glycol)). For example, PEG2000-DMG contains MPEG2000-DMG.

[0057] In some embodiments, the polyethylene glycol-modified lipid comprises at least one selected from PEG2000-DMG, PEG2000-DPG, PEG2000-DSG, PEG-cDMA, or PEG-C-DOMG. In certain embodiments, the polyethylene glycol-modified lipid comprises PEG2000-DMG.

[0058] Sterols are alcohols that have a steroid skeleton. Examples of sterols are not particularly limited, but include cholesterol, dihydrocholesterol, lanosterol, β-sitosterol, campesterol, stigmasterol, brassicasterol, ergocasterol, fucosterol, and 3β-[N-(N',N'-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol). Sterols can be used individually or in combination of two or more.

[0059] In some embodiments, the sterol comprises at least one selected from cholesterol, dihydrocholesterol, lanosterol, or β-sitosterol. In certain embodiments, the sterol comprises cholesterol.

[0060] (Composition and proportions)

[0061] The lipid complex of this embodiment contains lipid components in an amount of, for example, 50 to 100% by weight, 50 to 9.99% by weight, 70 to 99.97% by weight, or 90 to 99.95% by weight, relative to the total weight of the lipid complex. The lipid complex of this embodiment contains the above-mentioned ionized lipids in an amount of, for example, 10 to 100 mol%, 20 to 90 mol%, or 40 to 80 mol%, based on the total lipids contained in the lipid complex. The ionized lipids can be used individually or in a mixture of two or more types. The lipid complex of this embodiment may also contain neutral lipids in an amount of, for example, 0 to 50 mol%, 0 to 40 mol%, or 0 to 30 mol%, based on the total lipids contained in the lipid complex.

[0062] The lipid complex of this embodiment may contain polyethylene glycol-modified lipids in amounts of, for example, 0 to 30 mol%, 0 to 20 mol%, or 0 to 10 mol%, based on the total lipids contained in the lipid complex.

[0063] The lipid complex of this embodiment may contain sterols in amounts of, for example, 0 to 90 mol%, 10 to 80 mol%, or 20 to 50 mol%, based on the total lipids contained in the lipid complex.

[0064] The combination of lipid components in the lipid complex of this embodiment is not particularly limited, and examples include the above-mentioned combination of ionized lipids, neutral lipids, and sterols, and the above-mentioned combination of ionized lipids, neutral lipids, polyethylene glycol-modified lipids, and sterols. Ionized lipids are necessary for encapsulating nucleic acids and for efficiently delivering nucleic acids into target cells. The presence of neutral lipids and sterols in addition to ionized lipids allows for the formation of stable particles encapsulating nucleic acids. Furthermore, since polyethylene glycol-modified lipids can suppress particle aggregation, the simultaneous presence of these four types of lipids allows for the formation of stable particles encapsulating nucleic acids while suppressing particle aggregation.

[0065] In some embodiments, the lipid complex is composed of ionized lipids / neutral lipids / polyethylene glycol-modified lipids / sterols as lipids, and the molar ratio of the lipids may be, for example, 10-99 / 0-50 / 0-30 / 0-90, 20-90 / 0-40 / 0-20 / 10-80, or 30-70 / 0-30 / 0-10 / 20-50. In some embodiments, the molar ratio of ionized lipids / neutral lipids / polyethylene glycol-modified lipids / sterols in the lipid complex may be 10-99 / 1-50 / 1-30 / 1-90, 20-90 / 1-40 / 1-20 / 10-80, or 30-70 / 1-30 / 1-10 / 20-50. In certain embodiments, the molar ratio of ionized lipids / neutral lipids / polyethylene glycol-modified lipids / sterols in the lipid complex is approximately 50 / approximately 10 / approximately 1.5 / approximately 38.5.

[0066] The lipid complex of this embodiment contains nucleic acids in an amount of, for example, 0.01 to 50% by weight, for example, 0.03 to 30% by weight, or for example, 0.05 to 10% by weight, relative to the total weight of the lipid complex.

[0067] (Characteristics) The "average particle size" of the lipid complex of this embodiment can be calculated by any of the following methods: volume average, number average, or Z-average average particle size. The average particle size (Z-average) of the lipid complex of this embodiment may be, for example, 10 to 1000 nm, for example, 30 to 500 nm, or for example, 30 to 200 nm.

[0068] In this embodiment, from the viewpoint of suppressing nonspecific adsorption and immune responses, it is preferable that the lipid complex has almost no surface charge in an environment with a pH of approximately 7.4, such as in blood. Furthermore, from the viewpoint of improving the fusion efficiency with the endosomal membrane when taken up into cells by endocytosis, it is preferable that the lipid complex is positively charged in a low pH environment (e.g., 3.5 to 7.0).

[0069] The nucleic acid encapsulation rate in the lipid complex was measured, for example, using Quant-iT RiboGreen RNA Reagent (Invitrogen, Cat#R11491). Specifically, the nucleic acid concentration (A) measured by dilution with RNA-Free Water was taken as the nucleic acid present in the solution outside the lipid complex, and the nucleic acid concentration (B) measured by dilution with 1% Triton X-100 was taken as the total nucleic acid concentration in the formulation to calculate the encapsulation rate. Encapsulation rate (%) = 100 - (A / B) × 100 In some embodiments, the nucleic acid encapsulation rate (%) in the lipid complex calculated by the above method was higher than, for example, 80%, 85%, or 90%. In one embodiment, the nucleic acid encapsulation rate (%) in the lipid complex was higher than 90%.

[0070] In some embodiments, the lipid complex has a polydispersity index (PDI) of less than 0.3 (particularly less than 0.2, and especially less than 0.1).

[0071] 4. Compositions One embodiment of the present disclosure provides a composition comprising (I) an ionized lipid as described above, (II) at least one lipid selected from the group consisting of neutral lipids, polyethylene glycol-modified lipids, and sterols, and (III) a nucleic acid. In one embodiment of the present disclosure, the composition contains a lipid complex comprising the nucleic acid described above. The composition of this embodiment enables efficient release of nucleic acid into the cytoplasm. The composition of this embodiment may also contain the lipid complex described above, a pharmaceutically acceptable medium, and optionally additives. Pharmaceutically acceptable mediums and additives will be described later.

[0072] (Nucleic Acid and Lipid Components) The composition contains nucleic acids. Examples of nucleic acids include those described in "3. Lipid Complexes" above. The composition contains, as lipid components, (I) the ionized lipids described above, and (II) at least one lipid selected from the group consisting of neutral lipids, polyethylene glycol-modified lipids, and sterols. Examples of ionized lipids, neutral lipids, polyethylene glycol-modified lipids, and sterols include those described in "3. Lipid Complexes" above.

[0073] (Composition and proportions)

[0074] The composition of this embodiment contains lipid components in an amount of, for example, 50 to 100% by weight, 50 to 9.99% by weight, 70 to 99.97% by weight, or 90 to 99.95% by weight, relative to the total weight of the composition. The composition of this embodiment contains, for example, 10 to 100 mol%, 20 to 90 mol%, or 40 to 80 mol% of the above-mentioned ionized lipids, based on the total lipids contained in the composition. The ionized lipids can be used individually or in a mixture of two or more types. The composition of this embodiment may also contain, for example, 0 to 50 mol%, 0 to 40 mol%, or 0 to 30 mol% of neutral lipids, based on the total lipids contained in the composition.

[0075] The composition of this embodiment may contain polyethylene glycol-modified lipids in amounts of, for example, 0 to 30 mol%, 0 to 20 mol%, or 0 to 10 mol%, based on the total lipids contained in the composition.

[0076] The composition of this embodiment may contain sterols in amounts of, for example, 0 to 90 mol%, 10 to 80 mol%, or 20 to 50 mol%, based on the total lipids contained in the composition.

[0077] The combination of lipid components in the composition of this embodiment is not particularly limited, and examples include the above-mentioned combination of ionized lipids, neutral lipids, and sterols, and the above-mentioned combination of ionized lipids, neutral lipids, polyethylene glycol-modified lipids, and sterols. Ionized lipids are necessary for encapsulating nucleic acids and for efficiently delivering nucleic acids into target cells. The presence of neutral lipids and sterols in addition to ionized lipids allows for the formation of stable particles encapsulating nucleic acids. Furthermore, since polyethylene glycol-modified lipids can suppress particle aggregation, the simultaneous presence of these four types of lipids allows for the formation of stable particles encapsulating nucleic acids while suppressing particle aggregation.

[0078] In some embodiments, the composition consists of ionized lipids / neutral lipids / polyethylene glycol-modified lipids / sterols as lipids, and the molar ratio of the lipids may be, for example, 10-99 / 0-50 / 0-30 / 0-90, 20-90 / 0-40 / 0-20 / 10-80, or 30-70 / 0-30 / 0-10 / 20-50. In some embodiments, the molar ratio of ionized lipids / neutral lipids / polyethylene glycol-modified lipids / sterols in the composition may be 10-99 / 1-50 / 1-30 / 1-90, 20-90 / 1-40 / 1-20 / 10-80, or 30-70 / 1-30 / 1-10 / 20-50. In a particular embodiment, the molar ratio of ionized lipids / neutral lipids / polyethylene glycol-modified lipids / sterols in the composition is about 50 / about 10 / about 1.5 / about 38.5.

[0079] The composition of this embodiment contains nucleic acids in an amount of, for example, 0.01 to 50% by weight, for example, 0.03 to 30% by weight, or for example, 0.05 to 10% by weight, based on the total weight of the composition.

[0080] (Pharmaceutically Acceptable Media) The composition of this embodiment may contain a pharmaceutically acceptable media. Examples of pharmaceutically acceptable media include sterile water; physiological saline; isotonic solutions containing adjuvants such as glucose, D-sorbitol, D-mannose, D-mannitol, and sodium chloride; and buffers such as phosphate buffer, citrate buffer, and acetate buffer.

[0081] (Additives) The composition of this embodiment may further contain additives such as solubilizers such as alcohols like ethanol, propylene glycol, and polyethylene glycol, stabilizers, antioxidants, preservatives, excipients, fillers, bulking agents, binders, wetting agents, disintegrants, lubricants, surfactants, dispersants, preservatives, flavoring and deodorizing agents, and analgesics commonly used in pharmaceutical manufacturing. The composition of this embodiment may also contain other additives such as sugars like sucrose, glucose, sorbitol, and lactose; amino acids like glutamine, glutamic acid, sodium glutamate, and histidine; and salts of acids such as citric acid, phosphoric acid, acetic acid, lactic acid, carbonic acid, and tartaric acid.

[0082] The compositions of this disclosure may be formulated as pharmaceutical compositions. In some embodiments, the pharmaceutical compositions may contain the lipid complexes described above, pharmaceutically acceptable carriers, and optionally additives. Dosage forms of the pharmaceutical compositions include, for example, injections.

[0083] The compositions of this disclosure may be in powder form, for example, by freeze-drying, or they may be in liquid form. One embodiment of the composition of this disclosure is a powder composition containing the lipid complex of the above-described embodiment. The powder composition may be prepared by removing the solvent from a liquid composition (dispersion) by, for example, filtration, centrifugation, or by freeze-drying the dispersion. If the composition is in powder form, it can be used as an injectable by suspending or dissolving it in a pharmaceutically acceptable medium before use. One embodiment of the composition of this disclosure is a liquid composition containing the lipid complex of the above-described embodiment and a pharmaceutically acceptable medium. If the composition is in liquid form, it can be used as is or by suspending or dissolving it in a pharmaceutically acceptable medium before use as an injectable.

[0084] The composition can be administered to patients by parenteral methods such as intra-arterial injection, intravenous injection, or subcutaneous injection. The dosage of the composition varies depending on the target, target organ, symptoms, and method of administration. The target of administration of the composition is not limited and can be applied to various animals, but it can be applied particularly to mammals, preferably humans, and to experimental animals in clinical trials, screenings, and experiments.

[0085] If the nucleic acid encapsulated in the composition is a nucleic acid drug, the composition can be used as a pharmaceutical composition. For example, the composition of this disclosure can be used in a treatment (e.g., gene therapy) that introduces a desired nucleic acid in vivo or in vitro into a target cytoplasm (e.g., the cytoplasm causing various diseases). Therefore, one embodiment of this disclosure provides a method for treating various diseases (particularly a gene therapy method) using a pharmaceutical composition containing the lipid complex described above. The target of administration, method of administration, and conditions are the same as described above.

[0086] 5. Method for Producing Lipid Complexes and Compositions The method for producing the above lipid complexes and compositions is not particularly limited. Examples of methods for encapsulating molecules in lipid complexes include reverse-phase evaporation, Zwitterion (NaCl) hydration, cationic core hydration, and methods using ethanol and calcium (see also Biomembr., 1468, 239-252 (2000)). Lipid complexes encapsulating the nucleic acids of this disclosure can be prepared by methods known in the art as described above.

[0087] In some embodiments of this disclosure, the composition is produced by a method comprising, for example, the steps of (a) mixing (I) an ionized lipid, (II) an aqueous solution containing a polar organic solvent containing at least one lipid selected from the group consisting of neutral lipids, polyethylene glycol-modified lipids, and sterols, and (III) an aqueous solution containing nucleic acid to obtain a mixture, and (b) reducing the content of the polar organic solvent in the mixture. According to the production method of this embodiment, a composition capable of efficiently releasing nucleic acid into the cytoplasm can be produced.

[0088] Through electrostatic interactions between water-soluble nucleic acids and the ionized lipids described above, and hydrophobic interactions between lipids, lipid complexes can be formed in which nucleic acids are encapsulated within lipid-composed particles. For example, by reducing the content of polar organic solvents in the mixture, the solubility of a lipid component comprising (I) the ionized lipids described above and (II) at least one lipid selected from the group consisting of neutral lipids, polyethylene glycol-modified lipids, and sterols is changed in an aqueous solution containing a polar organic solvent, thereby forming a lipid complex, and obtaining a lipid complex whose interior is filled with a core of nucleic acids and lipids, and a composition containing said lipid complex.

[0089] In the method of this embodiment, first, in step (a), a mixture is obtained by mixing an aqueous solution containing a polar organic solvent, in which (I) the ionized lipid described above and (II) at least one lipid selected from the group consisting of neutral lipids, polyethylene glycol-modified lipids, and sterols are dissolved, with (III) an aqueous solution containing nucleic acid. The concentration of the polar organic solvent in the aqueous solution containing the polar organic solvent is not particularly limited, as long as the conditions for the dissolution of lipid molecules are met even after mixing with the aqueous solution of nucleic acid are met. For example, the concentration of the polar organic solvent in the aqueous solution containing the polar organic solvent in step (a) may be 0.1 to 60% by weight. The aqueous solution containing nucleic acid can be obtained, for example, by dissolving nucleic acid in an acidic buffer. Examples of polar organic solvents for dissolving lipids include polar organic solvents such as alcohols, and may be, for example, ethanol, isopropanol, chloroform, or tert-butanol. Examples of acidic buffers for dissolving nucleic acid include sulfuric acid buffer, phosphate buffer, phthalate buffer, tartaric acid buffer, citrate buffer, formate buffer, oxalate buffer, and acetate buffer. Next, in step (b), the content of the polar organic solvent is reduced by adding water or the like to the above mixture. This allows for the formation of a lipid complex. To efficiently form the lipid complex, it is preferable to rapidly reduce the content of the polar organic solvent. For example, the concentration of the polar organic solvent in the final aqueous solution containing the polar organic solvent in step (b) may be 0 to 5% by weight. Alternatively, the above mixture obtained in step (a) may be removed by dialysis to remove the polar organic solvent and the solvent may be replaced with a pharmaceutically acceptable medium. Since the content of the polar organic solvent in the solution decreases during the dialysis process, this allows for the formation of a lipid complex.

[0090] 6. Kit One embodiment of the present disclosure may be a nucleic acid drug delivery kit containing the above-mentioned ionized lipid. This kit can be preferably used for the treatment of various target cells (e.g., gene therapy). In the kit of this embodiment, the storage state of the ionized lipid is not particularly limited and can be set to any state, such as solution or powder, taking into consideration the stability (storability) and ease of use of each. In addition to the above-mentioned ionized lipid, the kit of this embodiment may also include, for example, various nucleic acids, various media (pharmaceutically acceptable media, buffers), and instructions for use (user manual). The kit of this embodiment is used to prepare a composition or lipid complex containing a desired nucleic acid and the above-mentioned ionized lipid to be introduced into target cells. The prepared composition or lipid complex can be effectively used for nucleic acid delivery to target cells. Furthermore, one embodiment of the present disclosure may be a nucleic acid drug delivery kit containing a pharmaceutical composition containing the above-mentioned ionized lipid. In addition to the above-mentioned pharmaceutical composition, the kit of this embodiment may also include, for example, various media (pharmaceutically acceptable media), and instructions for use (user manual).

[0091] The compounds relating to this disclosure can be produced, for example, by the methods described in the following production examples and examples. However, these are illustrative examples, and the compounds relating to this disclosure are not limited in any way to the following specific examples. The names of the compounds listed below, except for commonly used reagents, are those displayed in "E-Notebook" version 23 (Revvity Signals Software).

[0092] Unless otherwise specified in the manufacturing examples and examples, the silica gel used for purification in silica gel column chromatography is YMC GEL SILICA (YMC Co., Ltd, catalog code: SL06I52W), Silica gel 60 (Kanto Chemicals), Silica gel Spherical (Fuji Silysia Chemical LTD., catalog code: PSQ60B), Silica gel 60 (Merck KGaA, catalog code: 1.07734), Chromatrex BW (Fuji Silysia Chemical LTD., catalog code: BW-300), Hi-Flash Column (YAMAZEN CORPORATION), or Presep Silica. For NH silica gel column chromatography using Gel (WAKO), the silica gel used for purification was NH Silicagel (Fuji Silysia Chemical LTD., catalog code: NH-DM2035), Hi-Flash Column Amino (YAMAZEN CORPORATION), or Presep NH2 HC (WAKO). For ODS silica gel column chromatography, the silica gel used for purification was Hi-Flash Column ODS (YAMAZEN CORPORATION).

[0093] Unless otherwise specified in the manufacturing examples and examples, a fully automated preparative LC system (Waters MassLynx MS preparative system) was used for preparative purification. The column used was a Waters Xbridge Prep C18 5μm OBD (19mm x 100mm).

[0094] Unless otherwise specified in the manufacturing examples and examples, supercritical fluid chromatography (SFC) (Waters prep100 SFC system) was used for chiral resolution. The columns used were Daicel's CHIRALPAK® IB (2cm x 25cm), CHIRALPAK® IF (3cm x 25cm), and CHIRALPAK® IG (2cm x 25cm).

[0095] Proton nuclear magnetic resonance (MRL) spectra were measured using Varian Mercury 400, Varian Mercury Plus 400, JEOL 400 (JMTC-400 / 54 / SS, ECZ400S), JEOL 500 (JMTC-500 / 54 / JJ, ECZ500RS), or Bruker AVIII (600 MHz). Chemical shifts of the MRLs were recorded in δ units (ppm) relative to tetramethylsilane, and coupling constants were recorded in Hertz (Hz). The abbreviations for the fission patterns are as follows: s: singlet, d: doublet, t: triplet, q: quartet, quin: quintet, spt: septet, m: multiplet, brs: broad singlet, brd: broad doublet.

[0096] For mass spectral measurements, use Waters UPLC. ＴＭ The following method was used. For the ionization method, electrospray ionization (ESI) was used for measurement.

[0097] The abbreviations used in the examples are common abbreviations well known to those skilled in the art. Some of these abbreviations are listed below. Bn: Benzyl DCC: N,N'-Dicyclohexylcarbodiimide DCM: Methylene chloride DIPEA: Diisopropylethylamine DMAP: 4-Dimethylaminopyridine DMF: N,N-Dimethylformamide DMP: Des-Martinperiodinane EDCI: 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide ESI: Electrospray ionization HATU: 1-(bis(dimethylamino)methylene)-1H-1,2,3-Triazolo(4,5-b)pyridinium 3-Oxidohexafluorophosphate Me: Methyl MTBE: Methyl tert-butyl ether MS: Mass spectrometry n-: n- n-BuLi: n-butyllithium NMR: Nuclear magnetic resonance PPTS: Pyridinium p-toluenesulfonate TBAF: Tetra-n-butylammonium fluoride tert-: tertiary THF: tetrahydrofuran

[0098] In the following examples and manufacturing examples, "room temperature" typically refers to a temperature range of approximately 10°C to 35°C. Unless otherwise specified, percentages are weight percentages.

[0099] A. Synthesis of ionized lipids [Example 1]

[0100] (1) Synthesis of bis(2-hexyldecyl)4-oxoheptane dioate 4-oxoheptane dioic acid (100 mg) and 2-hexyl-1-decanol (348 mg) were mixed with DMF (2 mL), and DIPEA (0.50 mL) and HATU (546 mg) were added at room temperature. The mixture was stirred at 70°C for 4 hours. Ethyl acetate (50 mL) and water (50 mL) were added to the mixture, the organic layer was separated, and the aqueous layer was extracted with ethyl acetate. The combined organic layers were washed with water and saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (199 mg) as the crude product.

[0101] (2) Synthesis of bis(2-hexyldecyl)4-hydroxyheptane dioate The compound obtained in Example 1 (1) (304 mg) was added to MTBE (2 mL) and methanol (2 mL), sodium borohydride (28.4 mg) was added at 0°C, and the mixture was stirred at 0°C for 10 minutes. MTBE (20 mL) and water (20 mL) were added to the mixture and the mixture was stirred at 0°C for 10 minutes, after which the organic layer was separated and the aqueous layer was extracted with MTBE. The combined organic layers were washed with water and saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (184 mg). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81-0.92 (m, 12H) 1.18-1.35 (m, 50H) 1.56 (d, J=0.91Hz, 1H) 1.57-1.65 (m, 2H) 1.66-1.90 (m, 4H) 2.26 (d, J=5.44Hz, 1H) 2.46 (d, J=2.27Hz, 2H) 3.58-3.70 (m, 1H) 3.96 (d, J=5.89Hz, 4H)

[0102] (3) Synthesis of bis(2-hexyldecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptane dioate (compound (E1)) The compound obtained in Example 1(2) (430 mg) and 1-methylpiperidine-4-carboxylate hydrochloride (371 mg) were added to DMF (6 mL), and DIPEA (0.599 mL), EDCI (396 mg), and DMAP (25.2 mg) were added at room temperature and the mixture was stirred for 16 hours at room temperature. Ethyl acetate (50 mL) and water (50 mL) were added to the mixture, the organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (n-heptane / ethyl acetate, ethyl acetate / methanol) to obtain the labeled compound (407 mg). ESI-MS: 772.5 ([M ＋ Na] ＋ ) １ H NMR (500MHz, CDCl ３ ) δ ppm 0.87 (t, J=7.03Hz, 12H) 1.17-1.31 (m, 48H) 1.63 (brs, 2H) 1.87 (brs, 10H) 2.25 (s, 4H) 2.28-2.35 (m, 4H) 2.76-2.86 (m, 2H) 3.95 (d, J=5.50Hz, 4H) 4.90-5.00 (m, 1H)

[0103] [Example 2]

[0104] (1) Synthesis of bis(3-pentyloctyl)4-oxoheptanediote: Using the same method as in Example 3(1) described below, 3-pentyloctan-1-ol (115 mg) was used instead of 3-hexylundecane-1-ol to obtain the marked compound (120 mg) as the crude product.

[0105] (2) Synthesis of bis(3-pentyloctyl)4-hydroxyheptanediote The marked compound (57 mg) was obtained using the same method as in Example 3(2) described below, but using the compound obtained in Example 2(1) (120 mg) instead of the compound obtained in Example 3(1).

[0106] (3) Synthesis of bis(3-pentyloctyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E2)) Using the same method as in Example 3(3) described below, the compound obtained in Example 2(2) (57 mg) was used instead of the compound obtained in Example 3(2) described below to obtain the marked compound (26 mg). ESI-MS: 666.2 ([M+H] ＋ ) １ H NMR (500MHz, CDCl ３ ) δ ppm 0.87 (t, J=7.16Hz, 12H) 1.15-1.32 (m, 22H) 1.25-1.42 (m, 10H) 1.41 (m, 1H) 1.51-1.60 (m, 4H) 1.61-1.69 (m, 1H) 1.69-2.02 (m, 10H) 2.16-2.23 (m, 1H) 2.25 (s, 3H) 2.26-2.35 (m, 4H) 2.79 (brd, J=11.46Hz, 2H) 4.06 (t, J=7.16Hz, 4H) 4.87-4.98 (m, 1H)

[0107] [Example 3]

[0108] (1) Synthesis of bis(3-hexylundecyl)4-oxoheptane dioate 4-oxoheptane dioic acid (150 mg) and 3-hexylundecane-1-ol (552 mg) were mixed with DMF (5 mL), and DIPEA (0.75 mL) and HATU (819 mg) were added at room temperature. The mixture was stirred at room temperature for 16 hours. Ethyl acetate (50 mL) and water (50 mL) were added to the mixture, the organic layer was separated, and the aqueous layer was extracted with ethyl acetate. The combined organic layers were washed with water and saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (222 mg) as the crude product.

[0109] (2) Synthesis of bis(3-hexylundecyl)4-hydroxyheptane dioate The compound obtained in Example 3 (1) (222 mg) was added to MTBE (5 mL) and methanol (5 mL), sodium borohydride (19.9 mg) was added at 0°C, and the mixture was stirred at 0°C for 1 hour. MTBE (20 mL) and water (20 mL) were added to the mixture and the mixture was stirred at 0°C for 10 minutes. The organic layer was separated, and the aqueous layer was extracted with MTBE. The combined organic layers were washed with water and saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (130 mg). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.80-0.92 (m, 12H) 1.20-1.31 (m, 48H) 1.38 (brs, 2H) 1.51-1.59 (m, 7H) 1.67-1.88 (m, 4H) 2.26 (d, J=5.44Hz, 2H) 2.4 (m, 4H) 3.54-3.74 (m, 1H) 4.07 (t, J=7.25Hz, 4H)

[0110] (3) Synthesis of bis(3-hexylundecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptane diatomate (compound (E3)) The compound obtained in Example 3(2) (130 mg) and 1-methylpiperidine-4-carboxylate hydrochloride (107 mg) were added to DMF (5 mL), and DIPEA (0.17 mL), EDCI (114 mg), and DMAP (7.3 mg) were added at room temperature and the mixture was stirred for 16 hours at room temperature. n-heptane (50 mL) and water (50 mL) were added to the mixture, the organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by NH silica gel column chromatography (n-heptane / ethyl acetate) to obtain the marked compound (135 mg). ESI-MS: 780.5 ([M+H]) ＋ ) １ H NMR (396MHz, CDCl ３) δ ppm 0.82 - 0.91 (m, 12H), 1.21 - 1.29 (m, 47H), 1.50 - 1.59 (m, 9H), 1.68 - 2.03 (m, 8H), 2.18 - 2.34 (m, 8H), 2.74 - 2.85 (m, 2H), 4.06 (t, J = 7.25 Hz, 4H), 4.82 - 5.01 (m, 1H)

[0111] [Example 4]

[0112] (1) Synthesis of bis(2 - hexyldecyl) 4-(2-(1 - methylpiperidin - 4 - yl)acetoxy)heptanedioate (Compound (E4)) Using the same method as in Example 1(3), instead of hydrochloride of 1 - methylpiperidine - 4 - carboxylate, 2-(1 - methylpiperidin - 4 - yl)acetic acid (7.2 mg) was used as the raw material, and the title compound (17 mg) was obtained. ESI - MS: 786.7 ([M + Na] ＋ ) １ H NMR (396 MHz, CDCl ３ ) δ ppm 0.82 - 0.92 (m, 12H), 1.19 - 1.35 (m, 54H), 1.64 - 1.98 (m, 9H), 2.20 (d, J = 6.80 Hz, 2H), 2.24 (s, 3H), 2.28 - 2.34 (m, 3H), 2.80 (brd, J = 11.78 Hz, 1H), 3.95 (d, J = 5.44 Hz, 4H), 4.80 - 5.03 (m, 1H)

[0113] [Example 5]

[0114] (1) Synthesis of bis(2 - heptyundecyl) 4 - oxoheptanedioate Using the same method as in Example 3(1), instead of 3 - hexylundecan - 1 - ol, 2 - heptyundecan - 1 - ol (1.94 g) was used, and the title compound (690 mg) was obtained as a crude product.

[0115] (2) Synthesis of bis(2 - heptyundecyl) 4 - hydroxyheptanedioate Using the same method as in Example 3(2), instead of the compound obtained in Example 3(1), the compound obtained in Example 5(1) (690 mg) was used, and the title compound (328 mg) was obtained. １ H NMR (​) δ ppm 0.81 - 0.93 (m, 12H) 1.21 - 1.31 (m, 56H) 1.60 (brs, 2H) 1.67 - 1.86 (m, 4H) 2.27 (dd, J = 5.44, 0.91 Hz, 1H) 2.39 - 2.52 (m, 4H) 3.57 - 3.73 (m, 1H) 3.96 (d, J = 5.89 Hz, 4H)

[0116] (3) Synthesis of bis(2-heptylundecyl) 4-(2-(1-methylpiperidin-4-yl)acetoxy)heptanedioate (Compound (E5)) In the same manner as in Example 3(3), instead of the compound obtained in Example 3(2), 15 mg of the compound obtained in Example 5(2) was used, and instead of 1-methylpiperidine-4-carboxylic acid hydrochloride, 2-(1-methylpiperidin-4-yl)acetic acid (7.2 mg) was used to obtain the title compound (11.7 mg). ESI-MS: 842.1 ([M+Na] ＋ ) １ H NMR (396 MHz, CDCl ３ ) δ ppm 0.84 - 0.90 (m, 12H) 1.25 (s, 57H) 1.57 (s, 5H) 1.65 - 1.99 (m, 9H) 2.21 (d, J = 6.80 Hz, 2H) 2.24 (s, 3H) 2.27 - 2.35 (m, 2H) 2.74 - 2.85 (m, 2H) 3.95 (d, J = 5.89 Hz, 4H) 4.88 - 4.97 (m, 1H) [[ID=__11]]

[0117] [Example 6]

[0118] (1) Synthesis of bis(2-hexyldecyl) 4-((4-(dimethylamino)butanoyl)oxy)heptanedioate (Compound (E6)) Using the same method as in Example 1(iii), instead of 1-methylpiperidine-4-carboxylic acid hydrochloride, 4-dimethylaminobutyric acid hydrochloride (26.8 mg) was used as the raw material to obtain the title compound (35.6 mg). ESI-MS: 760.3 ([M+Na] ＋ ) １ H NMR (396 MHz, CDCl ３) δ ppm 0.83-0.92 (m, 12H) 1.25 (s, 48H) 1.71-1.99 (m, 6H) 2.19 (s, 6H) 2.26 (t, J=7.25Hz, 2H) 2.23-2.39 (m, 8H) 3.95 (d, J=5.89Hz, 4H) 4.88-5.01 (m, 1H)

[0119] [Example 7]

[0120] (1) Synthesis of 4-(1,7-bis((2-hexyldecyl)oxy)-1,7-dioxoheptan-4-yl) 1-(tert-butyl)piperidine-1,4-dicarboxylate Using the same method as in Example 1 (3), 1-((tert-butoxy)carbonyl)piperidine-4-carboxylic acid (97 mg) was used as the starting material instead of 1-methylpiperidine-4-carboxylate hydrochloride to obtain the marked compound (131 mg). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.83-0.91 (m, 12H), 1.21-1.31 (m, 48H), 1.44 (s, 9H), 1.55-1.65 (m, 4H), 1.80-1.97 (m, 6H), 2.26-2.34 (m, 4H) ), 2.37-2.45 (m, 1H), 2.80 (brt, J=11.78Hz, 2H), 3.95 (d, J=5.89Hz, 4H), 3.98-4.10 (m, 2H), 4.91-4.97 (m, 1H)

[0121] (2) Synthesis of bis(2-hexyldecyl)4-((piperidine-4-carbonyl)oxy)heptanediote The compound obtained in Example 7(1) (131 mg) was dissolved in DCM (5 mL), and trifluoroacetic acid (0.36 mL) was added at room temperature and the mixture was stirred for 4 hours. The mixture was cooled to 0°C and the pH of the mixture was adjusted to 10 with 5N sodium hydroxide aqueous solution. The aqueous layer was extracted with DCM, and the combined organic layers were washed with water and saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain the labeled compound (129 mg) as the crude product.

[0122] (3) Synthesis of bis(2-hexyldecyl)4-((1-(2-hydroxypropyl)piperidine-4-carbonyl)oxy)heptane dioate (compound (E7)) The compound obtained in Example 7(2) (20 mg) was dissolved in ethanol (1 mL) and propylene oxide (19 μL) was added at room temperature. The mixture was stirred at 70°C for 2 hours. After the mixture was cooled to room temperature, it was purified directly by NH silica gel column chromatography (heptane / ethyl acetate) to obtain the labeled compound (10.7 mg). ESI-MS: 816.4 ([M+Na] ＋ ) １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81-0.92 (m, 12H) 1.11 (d, J=5.89Hz, 3H) 1.17-1.36 (m, 52H) 1.65-2.02 (m, 9H) 2.13-2.39 (m, 6H) 2.71-2.81 (m, 1H) 2.98 (brd, J=11.78Hz, 1H) 3.50-3.57 (m, 1H) 3.74-3.86 (m, 1H) 3.95 (d, J=5.89Hz, 4H) 4.88-5.02 (m, 1H)

[0123] [Example 8]

[0124] (1) Synthesis of bis(2-hexyldecyl)4-((1-methylazepane-4-carbonyl)oxy)heptanediote (compound (E8)) Using the same method as in Example 1 (3), 1-methylazepane-4-carboxylic acid (10.1 mg) was used as the starting material instead of 1-methylpiperidine-4-carboxylic acid hydrochloride to obtain the marked compound (19.1 mg). ESI-MS: 786.8 ([M+Na] ＋ ) １ H NMR (396MHz, CDCl ３ ) δ ppm 0.83-0.90 (m, 12H) 1.25 (s, 51H) 1.72-2.06 (m, 9H) 2.27-2.34 (m, 7H) 2.45-2.70 (m, 5H) 3.95 (d, J=5.89Hz, 4H) 4.86-4.97 (m, 1H)

[0125] [Example 9-1]

[0126] (1) Synthesis of dibenzyl 4-oxoheptane dioate Palladium trifluoroacetate (83 mg) and 1,3-bis(diphenylphosphono)propane (206 mg) were suspended in acetonitrile (522 μL), and benzyl acrylate (1.53 mL), formic acid (575 μL), and acetic anhydride (708 μL) were added at room temperature. The reaction vessel was sealed and purged with nitrogen, and stirred at 90°C for 20 hours. The mixture was cooled to room temperature and then purified by direct silica gel column chromatography (cyclohexane / diethyl ether) to obtain the labeled compound (446 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 2.58-2.73 (m, 4H) 2.73-2.85 (m, 4H) 5.12 (s, 4H) 7.30-7.41 (m, 10H)

[0127] (2) Synthesis of dibenzyl 4-hydroxyheptane dioate To the compound obtained in Example 9-1 (1) (446 mg), diethyl ether (20 mL) and methanol (5 mL) were added, and sodium borohydride (57.1 mg) was added at -20°C and the mixture was stirred for 2 hours. Diethyl ether (100 mL) and saturated ammonium chloride aqueous solution (10 mL) were added to the mixture, and the aqueous layer was extracted with diethyl ether. The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / diethyl ether) to obtain the labeled compound (338 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 1.76-1.79 (m, 2H) 1.79-1.88 (m, 2H) 2.08 (d, J=5.69Hz, 1H) 2.44-2.57 (m, 4H) 3.59-3.71 (m, 1H) 5.12 (s, 4H) 7.30-7.40 (m, 10H)

[0128] (3) Synthesis of dibenzyl 4-((1-methylpiperidine-4-carbonyl)oxy)heptane dioate The compound obtained in Example 9-1(2) (350 mg) and 1-methylpiperidine-4-carboxylic acid (337 mg) were added to DMF (10 mL), EDCI (489 mg) and DMAP (288 mg) were added at room temperature, and the mixture was stirred at 50°C for 18 hours. MTBE (50 mL) and water (20 mL) were added to the mixture, and the aqueous layer was extracted with MTBE. The combined organic layers were washed with saturated brine, dried over sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (DCM / methanol) to obtain the labeled compound (272 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 1.66-1.79 (m, 2H) 1.80-2.01 (m, 8H) 2.24 (s, 4H) 2.32-2.41 (m, 4H) 2.71-2.86 (m, 2H) 4.91-5.00 (m, 1H) 5.07-5.13 (m, 4H) 7.28-7.40 (m, 10H)

[0129] (4) Synthesis of 4-((1-methylpiperidine-4-carbonyl)oxy)heptanedioc acid The compound obtained in Example 9-1 (3) (336 mg) was added to ethyl acetate (75 mL) and methanol (75 mL), and palladium carbon (10%, 300 mg) was added. The reaction vessel was purged with hydrogen gas and stirred for 40 hours. The mixture was filtered through Celite®, and the Celite was washed with methanol (50 mL) and ethyl acetate (50 mL). The resulting solution was concentrated under reduced pressure to obtain the labeled compound (214 mg). １ H NMR (600 MHz, DMSO-d6) δ ppm 1.51-1.59 (m, 2H) 1.67-1.73 (m, 2H) 1.75-1.82 (m, 4H) 1.87-1.93 (m, 2H) 2.13 (s, 3H) 2.17-2.26 (m, 5H) 2.64-2.72 (m, 2H) 4.79-4.86 (m, 1H) 11.15-12.73 (m, 2H)

[0130] (5) Synthesis of bis((S)-2-hexyldecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E9)) The compound obtained in Example 9-1(4) (100 mg) was added to DMF (5 mL), (S)-2-hexyldecane-1-ol (177 mg), DMAP (24 mg), and EDCI (153 mg) were added, and the mixture was stirred at room temperature for 18 hours. MTBE (5 mL) and water (2 mL) were added to the mixture, and the aqueous layer was extracted twice with MTBE (5 mL). The combined organic layers were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / MTBE) to obtain the marked compound (103 mg). ESI-MS: 750.8 ([M+H]) ＋ ) １ H NMR (600 MHz, CDCl ３ ) δ ppm 0.76-1.00 (m, 12H) 1.17-1.39 (m, 48H) 1.59-1.67 (m, 2H) 1.72-2.06 (m, 10H) 2.10-2.42 (m, 8H) 2.66-2.94 (m, 2H) 3.96 (d, J=5.87Hz, 4H) 4.84-5.05 (m, 1H)

[0131] [Example 9-2]

[0132] (1) Synthesis of (S)-4-benzyl-3-decanoyl-5,5-dimethyloxazolidine-2-one (500 mg) was added to THF (10 mL), cooled to -78°C, then n-BuLi (2.5 M hexane solution, 1.07 mL) was added over 15 minutes, followed by the addition of decanoic acid chloride (604 mg) in THF (2 mL) over 20 minutes. The mixture was stirred at room temperature for 2 hours. Saturated ammonium chloride aqueous solution (2 mL) was added to the mixture, followed by ethyl acetate (5 mL). The aqueous layer was extracted twice with ethyl acetate (5 mL), and the combined organic layer was washed with saturated sodium bicarbonate aqueous solution (2 mL) and saturated saline solution (2 mL), dried over sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (710 mg).１ H NMR (600MHz, CDCl ３ ) δ ppm 0.84-0.91 (m, 3H) 1.24-1.38 (m, 18H) 1.57-1.67 (m, 2H) 2.84-2.94 (m, 3H) 3.14 (dd, J=14.31, 3.85Hz, 1H) 4.50 (dd, J=9.54, 3.85Hz, 1H) 7.21-7.25 (m, 1H) 7.25-7.31 (m, 4H)

[0133] (2) Synthesis of heptanoic peroxyanhydride Heptanoic acid (4.15 mL) was added to DCM (80 mL), and 30% aqueous hydrogen peroxide solution (800 μL) was added at 0°C and stirred for 10 minutes. Then DMAP (0.358 g) and DCC (6.58 g) were added and stirred for 2 hours. The mixture was diluted with hexane (400 mL), the solid was filtered off and dried over magnesium sulfate, and then concentrated. The residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (2.03 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.86-0.92 (m, 6H) 1.27-1.35 (m, 8H) 1.35-1.43 (m, 4H) 1.68-1.75 (m, 4H) 2.42 (t, J=7.43Hz, 4H)

[0134] (3) Synthesis of (S)-4-benzyl-3-((S)-2-hexyldecanoyl)-5,5-dimethyloxazolidine-2-one The compound obtained in Example 9-2 (1) (709 mg) was dissolved in 1,2-dichloroethane, and titanium tetrachloride (0.239 mL) was added dropwise at 0°C. After 5 minutes, triethylamine (0.825 mL) was added, and the mixture was stirred for a further 40 minutes at 0°C. A solution of the compound obtained in Example 9-2 (2) (764 mg) in 1,2-dichloroethane (4 mL) was added dropwise to the mixture, and the mixture was stirred at room temperature for 2 hours. A saturated aqueous solution of ammonium chloride (12 mL) was added to the mixture, and the aqueous layer was extracted twice with DCM (40 mL). The combined organic layers were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the labeled compound (527 mg). １ H NMR (600MHz, CDCl３ ) δ ppm 0.83-0.90 (m, 6H) 1.25 (brd, J=8.25Hz, 20H) 1.35 (d, J=8.07Hz, 6H) 1.43-1.49 (m, 2H) 1.60-1.71 (m, 2H) 2.89 (dd, J=14.40, 9.81Hz, 1H) 3.12 (dd, J=14.31, 3.48Hz, 1H) 3.77-3.87 (m, 1H) 4.54 (dd, J=9.90, 3.48Hz, 1H) 7.19-7.25 (m, 1H) 7.30 (d, J=4.40Hz, 4H)

[0135] (4) Synthesis of (S)-2-hexyldecane-1-ol The compound obtained in Example 9-2 (3) (469 mg) was added to THF (10 mL) and methanol (342 μL), and lithium borohydride (2.0 M THF solution, 4.22 mL) was added dropwise at 0°C. The mixture was stirred at 0°C for 30 minutes and then stirred overnight at room temperature. The mixture was cooled to 0°C, and MTBE (5 mL) and saturated saline solution (1 mL) were added, and the aqueous layer was extracted three times with MTBE (5 mL). The combined organic layers were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / MTBE) to obtain the labeled compound (243 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.84-0.92 (m, 6H) 1.16 (br t, J=5.32Hz, 1H) 1.21-1.38 (m, 24H) 1.43-1.50 (m, 1) 3.54 (t, J=5.23Hz, 2H)

[0136] [Example 10]

[0137] (1) Synthesis of (R)-4-benzyl-3-decanoyl-5,5-dimethyloxazolidine-2-one: Using the same method as in Example 9-2 (1), (R)-4-benzyl-5,5-dimethyloxazolidine-2-one (500 mg) was used instead of (S)-4-benzyl-5,5-dimethyloxazolidine-2-one to obtain the labeled compound (711 mg). １ H NMR (600MHz, CDCl ３) δ ppm 0.84-0.91 (m, 3H) 1.24-1.34 (m, 12H) 1.35 (s, 3H) 1.37 (s, 3H) 1.56-1.68 (m, 2H) 2.84-2.94 (m, 3H) 3.14 (dd, J=14.31, 3.85Hz, 1H) 4.50 (dd, J=9.54, 3.85Hz, 1H) 7.21-7.25 (m, 1H) 7.26-7.32 (m, 4H)

[0138] (2) Synthesis of (R)-4-benzyl-3-((R)-2-hexyldecanoyl)-5,5-dimethyloxazolidine-2-one: Using the same method as in Example 9-2(3), the compound obtained in Example 10(1) (710 mg) was used as a starting material instead of the compound obtained in Example 9-2(1), and the labeled compound (610 mg) was obtained. １ H NMR (600MHz, CDCl ３ ) δ ppm 0.87 (t, J=7.06Hz, 6H) 1.21-1.31 (m, 20H) 1.34 (s, 3H) 1.35 (s, 3H) 1.43-1.51 (m, 2H) 1.61-1.70 (m, 2H) 2.88 (dd, J=14.40, 9.81Hz, 1H) 3.12 (dd, J=14.49, 3.48Hz, 1H) 3.79-3.85 (m, 1H) 4.54 (dd, J=9.72, 3.48Hz, 1H) 7.21-7.24 (m, 1H) 7.27-7.33 (m, 4H)

[0139] (3) Synthesis of (R)-2-hexyldecane-1-ol: Using the same method as in Example 9-2(4), the compound obtained in Example 10(2) (610 mg) was used as a starting material instead of the compound obtained in Example 9-2(3), and the labeled compound (304 mg) was obtained. １ H NMR (600MHz, CDCl ３ ) δ ppm 0.85-0.94 (m, 6H) 1.16 (t, J=5.69Hz, 1H) 1.24-1.37 (m, 24H) 1.45-1.50 (m, 1H) 3.55 (t, J=5.50Hz, 2H)

[0140] (4) Synthesis of bis((R)-2-hexyldecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E10)) was performed using the same method as in Example 9-1(5), but with the compound obtained in Example 10(3) (177 mg) instead of (S)-2-hexyldecane-1-ol, to obtain the marked compound (90 mg). ESI-MS: 750.8 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.84-0.92 (m, 12H) 1.24-1.34 (m, 48H) 1.58-1.63 (m, 2H) 1.73-1.82 (m, 2H) 1.83-2.00 (m, 8H) 2.21-2.28 (m, 4H) 2.29-2.34 (m, 4H) 2.81 (brd, J=11.19Hz, 2H) 3.96 (d, J=5.87Hz, 4H) 4.95 (dt, J=8.21, 3.87Hz, 1H)

[0141] [Example 11]

[0142] (1) Synthesis of 3-(1,7-bis((2-hexyldecyl)oxy)-1,7-dioxoheptan-4-yl)-8-(tert-butyl)(1R,3s,5S)-8-azabicyclo[3.2.1]octane-3,8-dicarboxylate. Using the same method as in Example 1(3), (1R,3s,5S)-8-((tert-butoxy)carbonyl)-8-azabicyclo[3.2.1]octane-3-carboxylic acid (184 mg) was used instead of 1-methylpiperidine-4-carboxylic acid hydrochloride to obtain the marked compound (410 mg). ESI-MS: 885.4 ([M+Na] ＋ )

[0143] (2) and (3) Synthesis of bis(2-hexyldecyl)4-(((1R,3s,5S)-8-(2-hydroxypropyl)-8-azabicyclo[3.2.1]octane-3-carbonyl)oxy)heptanediote (compound (E11)) Using the same method as in Examples 7(2) and (3), the compound obtained in Example 11(1) (410 mg) was used instead of the compound obtained in Example 7(1) to obtain the marked compound (216 mg). ESI-MS: 842.4 ([M+Na]＋ ) １ H NMR (400 MHz, CDCl ３ ) δ ppm 0.86 (brt, J = 6.59 Hz, 12H) 1.06 - 1.13 (m, 3H) 1.24 (brs, 49H) 1.47 - 1.71 (m, 6H) 1.73 - 2.04 (m, 9H) 2.28 (brt, J = 7.81 Hz, 4H) 2.45 (brd, J = 1.95 Hz, 2H) 3.11 - 3.30 (m, 2H) 3.59 - 3.71 (m, 1H) 3.94 (brd, J = 5.85 Hz, 4H) 4.84 - 4.98 (m, 1H)

[0144] [Example 12]

[0145] (1) Synthesis of bis(2-heptylnonyl) 4-oxoheptanedioate Using the same method as in Example 3(1), 2-heptylnonan-1-ol (522 mg) was used instead of 3-hexylundecan-1-ol to obtain the title compound (195 mg) as a crude product.

[0146] (2) Synthesis of bis(2-heptylnonyl) 4-hydroxyheptanedioate Using the same method as in Example 3(2), the compound obtained in Example 12(1) (195 mg) was used instead of the compound obtained in Example 3(1) to obtain the title compound (95 mg). １ H NMR (396 MHz, CDCl ３ ) δ ppm 0.83 - 0.91 (m, 12H), 1.22 - 1.30 (m, 48H), 1.56 - 1.65 (m, 2H), 1.67 - 1.86 (m, 4H), 2.二25 (d, J = 5.44 Hz, 1H), 2.39 - 2.52 (m, 4H), 3.六1 - 3.69 (m, 1H), 3.96 (d, J = 5.89 Hz, 4H)

[0147] (3) Synthesis of bis(2-heptylnonyl) 4-((1-methylpiperidine-4-carbonyl)oxy)heptanedioate (Compound (E12)) Using the same method as in Example 3(3), the compound obtained in Example 12(2) (The original text has an incorrect '15mg' which should probably be '15 mg') was used instead of the compound obtained in Example 3(2) to obtain the title compound (15.4 mg). ESI: 772.5 ([M+Na] ＋ ) １H NMR (396MHz, CDCl ３ ) δ ppm 0.82-0.90 (m, 12H) 1.18-1.32 (m, 50H) 1.67-2.01 (m, 9H) 2.21-2.27 (m, 5H) 2.29 (d, J=7.70Hz, 4H) 2.80 (brd, J=11.78Hz, 2H) 3.95 (d, J=5.89Hz, 4H) 4.88-4.97 (m, 1H)

[0148] [Example 13]

[0149] (1) Synthesis of bis(2-heptylnonyl)4-((1-methylpiperidine-4-yl)acetosyl)heptanediote (compound (E13)) Using the same method as in Example 5(3), but instead of the compound obtained in Example 5(2) as a starting material, the compound obtained in Example 12(2) (15 mg) was used to obtain the marked compound (18.5 mg). ESI: 1550.9 ([2M + Na] ＋ ) １ H NMR (396MHz, CDCl ３ ) δ ppm 0.78-0.92 (m, 12H) 1.16-1.36 (m, 50H) 1.76-2.02 (m, 13H) 2.24 (s, 3H) 2.28-2.37 (m, 4H) 2.71-2.88 (m, 2H) 3.95 (d, J=5.89Hz, 4H) 4.84-5.00 (m, 1H)

[0150] [Example 14]

[0151] (1) Synthesis of dibenzyl 4-((4-dimethylamino)butanoyl)oxy)heptanediote. The compound obtained in Example 9-1(2) (700 mg), 4-(dimethylamino)butyric acid hydrochloride (494 mg), and DMAP (120 mg) were added to DMF (7.6 mL), EDCI (527 mg) was added at room temperature, and the mixture was stirred at room temperature for 18 hours. Ethyl acetate (50 mL) and water (20 mL) were added to the mixture, and the aqueous layer was extracted three times with acetic acid. The combined organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (DCM / methanol) to obtain the labeled compound (758 mg). １H NMR (600MHz, CDCl ３ ) δ ppm 1.67-1.80 (m, 2H) 1.82-2.00 (m, 4H) 2.18 (s, 6H) 2.23-2.45 (m, 8H) 4.89-5.00 (m, 1H) 5.11 (d, J=1.47Hz, 4H) 7.34 (d, J=2.38Hz, 10H)

[0152] (2) Synthesis of 4-((4-(dimethylamino)butanoyl)oxy)heptanedioc acid The compound obtained in Example 14(1) (223 mg) was added to methanol (120 mL) and reduced with H-Cube® (10% palladium carbon, Full H ２ The resulting solution was concentrated under reduced pressure (0–3 Bar) to obtain the labeled compound (116 mg). １ H NMR (600MHz, METHANOL-d4) δ ppm 1.83-2.11 (m, 6H) 2.18-2.38 (m, 4H) 2.43-2.52 (m, 2H) 2.86 (s, 6H) 3.05-3.20 (m, 2H) 4.98-5.08 (m, 1H)

[0153] (3) Synthesis of bis((S)-2-hexyldecyl)4-((4-dimethylamino)butanoyl)oxy)heptanediote (compound (E14)) The compound obtained in Example 14(2) (115 mg), the compound obtained in Example 9-2(4) (202 mg), and DMAP (24 mg) were added to DMF (1.5 mL), EDCI (190 mg) was added, and the mixture was stirred for 17 hours. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (diethyl ether / methanol) to obtain the marked compound (141 mg). ESI-MS: 738.8 ([M+H]) ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.79-0.96 (m, 12H) 1.15-1.43 (m, 48H) 1.59-1.67 (m, 2H) 1.73-2.01 (m, 6H) 2.21 (s, 6H) 2.25-2.41 (m, 8H) 3.97 (d, J=5.87Hz, 4H) 4.81-5.04 (m, 1H)

[0154] [Example 15]

[0155] (1) Synthesis of bis((R)-2-hexyldecyl) 4-((4-(dimethylamino)butanoyl)oxy)heptanediote (compound (E15)) The compound obtained in Example 14(2) (135 mg), (R)-2-hexyldecane-1-ol (238 mg), and DMAP (28.5 mg) were added to DMF (1.8 mL), EDCI (224 mg) was added, and the mixture was stirred for 17 hours. The mixture was purified by silica gel column chromatography (MTBE / methanol) to obtain the labeled compound (220 mg). ESI-MS: 738.8 ([M+H]) ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=7.06Hz, 12H) 1.17-1.38 (m, 48H) 1.58-1.65 (m, 2H) 1.73-1.97 (m, 6H) 2.21 (s, 6H) 2.25-2.42 (m, 8H) 3.97 (d, J=5.87Hz, 4H) 4.84-5.11 (m, 1H)

[0156] [Example 16]

[0157] (1) Synthesis of 2-octylmalonate di-tert-butyl The marked compound (1.20 g) was obtained by the same method as in Example 18(1) described below. １ H NMR (500MHz, CDCl ３ ) δ ppm 0.83-0.87 (m, 3H) 1.23-1.29 (m, 14H) 1.44 (s, 18H) 1.80-1.88 (m, 1H)

[0158] (2) Synthesis of 2-heptyl-2-octylmalonate di-tert-butyl The marked compound (1.11 g) was obtained using the same method as in Example 18(2) described below, but with 1-bromoheptane (1.19 g) instead of 1-bromo-5-methylhexane. ESI-MS: 449.2 ([M + Na] ＋ )

[0159] (3) Synthesis of 2-heptyl-2-octylmalonic acid Using the same method as in Example 18(3) described below, the compound obtained in Example 16(2) (1.10 g) was used instead of the compound obtained in Example 18(2) described below to obtain the marked compound (0.80 g). ESI-MS: 313.1 ([M-H] － )

[0160] (4) Synthesis of 2-heptyldecanoic acid Using the same method as in Example 18(4), the compound obtained in Example 16(3) (0.80 g) was used instead of the compound obtained in Example 18(3) to obtain the labeled compound (0.58 g).

[0161] (5) Synthesis of 2-heptyldecane-1-ol Using the same method as in Example 18(5), the compound obtained in Example 16(4) (0.58 g) was used instead of the compound obtained in Example 18(4) to obtain the labeled compound (0.56 g). １ H NMR (400MHz, CDCl ３ ) δ ppm 0.85 (t, J=7.81Hz, 6H) 1.24 (m, 26H) 1.36-1.50 (m, 1H) 3.49 (d, J=5.85Hz, 2H)

[0162] (6) Synthesis of bis(2-heptyldecyl)4-oxoheptanediote Using the same method as in Example 3(1), the compound obtained in Example 16(5) (589 mg) was used instead of 3-hexylundecane-1-ol to obtain the marked compound (500 mg). The marked compound contained the starting material 2-heptyldecane-1-ol, but no further purification was performed and it was used in the next reaction. (7) Synthesis of bis(2-heptyldecyl)4-hydroxyheptanediote Using the same method as in Example 3(2), the compound obtained in Example 16(6) (500 mg) was used instead of the compound obtained in Example 3(1) to obtain the marked compound (260 mg).

[0163] (8) Synthesis of bis(2-heptyldecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E16)) Using the same method as in Example 3(3), the compound obtained in Example 16(7) (40 mg) was used instead of the compound obtained in Example 3(2) to obtain the marked compound (6.62 mg). ESI-MS: 779.4 ([M+H]＋ ) １ H NMR (500MHz, CDCl ３ ) δ ppm 0.87 (t, J=6.87Hz, 12H) 1.17-1.35 (m, 54H) 1.70-1.79 (m, 2H) 1.80-1.93 (m, 6H) 1.95-2.08 (m, 2H) 2.26 (s, 4H) 2.30 (t, J=8.02Hz, 4H) 2.75-2.89 (m, 2H) 3.95 (d, J=5.73Hz, 4H) 4.88-5.01 (m, 1H)

[0164] [Example 17]

[0165] (1) Synthesis of bis(2-heptyldecyl)4-(2-(1-methylpiperidine-4-yl)acetoxy)heptanediate (compound (E17)) Using the same method as in Example 5(3), the compound obtained in Example 16(7) (40 mg) was used instead of the compound obtained in Example 5(2) to obtain the marked compound (13.8 mg). ESI-MS: 814.7 ([M+Na] ＋ ) １ H NMR (500MHz, CDCl ３ ) δ ppm 0.87 (t, J=6.87Hz, 12H) 1.25 (brs, 46H) 1.29 (brs, 10H) 1.66-1.75 (m, 3H) 1.82-1.99 (m, 6H) 2.16-2.22 (m, 2H) 2.24 (s, 3H) 2.31 (brs, 4H) 2.76-2.85 (m, 2H) 3.95 (d, J=5.73Hz, 4H) 4.89-5.00 (m, 1H)

[0166] [Example 18]

[0167] (1) Synthesizing ditert-butyl 2-octylmalonate: Sodium hydride (60%, 911 mg) was added to DMF (70 mL), and a solution of ditert-butyl malonate (5.38 g) in DMF (20 mL) was added at 0°C. The mixture was stirred at 0°C for 30 minutes, and then a solution of sodium iodide (3.10 g) and 1-bromooctane (3.60 mL) in DMF (10 mL) was added. The mixture was stirred at 0°C for 30 minutes and then stirred at room temperature for 4 hours. The mixture was cooled to 0°C and then saturated ammonium chloride aqueous solution (50 mL) was added. Further dilution was performed with ethyl acetate (100 mL) and water (50 mL). The aqueous layer was extracted with ethyl acetate, the combined organic layers were washed with water and saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified twice by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (3.70 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.80-0.91 (m, 3H) 1.20-1.32 (m, 13H) 1.44 (s, 17H) 1.70-1.84 (m, 2H) 3.06-3.13 (m, 1H)

[0168] (2) Synthesize 2-(5-methylhexyl)-2-octylmalonate di-tert-butyl. Add 60% sodium hydride (308 mg) to DMF (70 mL), and add dropwise a solution of the compound obtained in Example 18 (1) (2.30 g) in DMF (20 mL) at 0°C. The mixture was stirred at 0°C for 30 minutes, and then a solution of sodium iodide (1.05 g) and 1-bromo-5-methylhexane (1.38 g) in DMF (10 mL) was added. The mixture was stirred at 0°C for 30 minutes, and then stirred at room temperature for 4 hours. After cooling the mixture to 0°C, saturated ammonium chloride aqueous solution (50 mL) was added. Further dilution was performed with ethyl acetate (100 mL) and water (50 mL). The aqueous layer was extracted with ethyl acetate, the combined organic layers were washed with water and saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified twice by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (2.29 g). １ H NMR (396MHz, CDCl ３) δ ppm 0.81-0.88 (m, 9H), 1.04-1.20 (m, 6H), 1.22-1.32 (m, 12H), 1.42 (s, 18H), 1.46-1.51 (m, 1H), 1.71-1.80 (m, 4H)

[0169] (3) Synthesis of 2-(5-methylhexyl)-2-octylmalonic acid: 2.29 g of the compound obtained in Example 18 (2) was added to 4 M HCl (1,4-dioxane solution, 30 mL), stirred at room temperature for 16 hours, and then concentrated under reduced pressure to obtain the labeled compound (2.71 g) as the crude product. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81-0.88 (m, 9H), 1.09-1.32 (m, 20H), 1.41-1.55 (m, 1H), 1.89-1.98 (m, 4H) (4) Synthesis of 2-(5-methylhexyl)decanoic acid The compound obtained in Example 18 (3) (2.71 g) was mixed with orthoxylene (30 mL) and stirred at 160°C for 3 hours. The mixture was concentrated under reduced pressure to obtain the labeled compound (1.62 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.77-0.92 (m, 9H) 1.09-1.20 (m, 3H) 1.25 (brs, 15H) 1.35-1.53 ​​(m, 3H) 1.59 (brd, J=5.44Hz, 2H) 2.21-2.27 (m, 1H) 2.28-2.44 (m, 1H)

[0170] (5) Synthesis of 2-(5-methylhexyl)decane-1-ol To the compound obtained in Example 18 (4) (1.62 g), THF (20 mL) was added, and lithium aluminum hydride (1.0 M THF solution, 11.9 mL) was added at 0°C. The mixture was stirred at 0°C for 4 hours, and then stirred at room temperature for 2 hours. After the mixture was cooled to 0°C, ethyl acetate (10 mL) was added, followed by the sequential addition of water (0.45 mL), 15% sodium hydroxide aqueous solution (0.48 mL), and water (1.35 mL). The mixture was stirred at room temperature for 10 minutes, and the precipitate was filtered through Celite. The resulting solution was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (994 mg). １H NMR (396MHz, CDCl ３ ) δ ppm 0.82-0.89 (m, 9H), 1.13-1.32 (m, 23H), 1.36-1.56 (m, 2H), 3.52 (t, J = 5.44Hz, 2H)

[0171]

[0172] (6) Synthesis of bis(2-(5-methylhexyl)decyl)4-oxoheptanediote: Using the same method as in Example 3(1), the compound obtained in Example 18(5) was used as a starting material instead of 3-hexylundecane-1-ol to obtain the marked compound (241 mg) as a crude product.

[0173] (7) Synthesis of bis(2-(5-methylhexyl)decyl)4-hydroxyheptanediote The labeled compound (34 mg) was obtained using the same method as in Example 3(2), but with the compound obtained in Example 18(6) (241 mg) instead of the compound obtained in Example 3(1) as a starting material. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81-0.92 (m, 17H) 1.14 (brd, J=6.34Hz, 4H) 1.25 (s, 41H) 1.44-1.64 (m, 6H) 1.65-1.94 (m, 4H) 2.25-2.30 (m, 1H) 2.46 (d, J=2.27Hz, 2H) 3.65 (brdd, J=8.61, 3.62Hz, 1H) 3.96 (d, J=5.44Hz, 4H)

[0174] (8) Synthesis of bis(2-(5-methylhexyl)decyl)4-(2-(1-methylpiperidine-4-yl)acetoxy)heptanediate (compound (E18)) Using the same method as in Example 5(3), the compound obtained in Example 18(7) (13 mg) was used instead of the compound obtained in Example 5(2) to obtain the marked compound (10.2 mg). ESI-MS: 792.9([M+H)+) １ H NMR (396MHz, CDCl ３) δ ppm 0.62-0.95 (m, 18H) 1.05-1.33 (m, 48H) 1.39 (brd, J=9.51Hz, 1H) 1.44-1.55 (m, 4H) 1.65-1.77 (m, 5H) 1.81-1.91 (m, 3H) 1.98-2.12 (m, 2H) 2.22 (brd, J=6.80Hz, 2H) 2.28-2.39 (m, 4H) 2.73-3.00 (m, 1H) 3.75-4.08 (m, 4H) 4.77-5.05 (m, 1H)

[0175] [Example 19]

[0176] (1) Synthesis of (Z)-octo-5-en-1-ylmethanesulfonate (Z)-octo-5-en-1-ol (4.46 g) and triethylamine (7.28 mL) were added to DCM (50 mL), and methanesulfonic acid chloride (3.25 mL) was added over 4 minutes at 3°C. The mixture was stirred at 3°C ​​for 15 minutes, and then stirred at room temperature for 105 minutes. Ethyl acetate (200 mL) was added to the mixture and washed with a mixture of water (100 mL) and saturated brine (10 mL). The aqueous layer was extracted with ethyl acetate (100 mL), and the combined organic layer was washed with saturated brine (100 mL), dried over sodium sulfate, filtered to remove the solid, dried under reduced pressure to obtain the marked compound (7.03 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.96 (t, J=7.52Hz, 3H) 1.43-1.52 (m, 2H) 1.72-1.80 (m, 2H) 1.99-2.13 (m, 4H) 3.00 (s, 3H) 4.23 (t, J=6.51Hz, 2H) 5.24-5.33 (m, 1H) 5.37-5.44 (m, 1H)

[0177] (2) Synthesis of (Z)-8-bromoocto-3-ene The compound obtained in Example 19(1) (7.03 g) was added to anhydrous THF (140 mL), and tetra-n-butylammonium bromide (13.18 g) was added under a nitrogen atmosphere, and the mixture was heated under a nitrogen atmosphere at 80°C under reflux for 1 hour. The mixture was drained under reduced pressure, and the residue was diluted with water (75 mL) and extracted twice with cyclohexane (75 mL). The organic layer was washed with saturated brine (50 mL), dried over sodium sulfate, filtered, and concentrated under reduced pressure to obtain the labeled compound (5.58 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.96 (t, J=7.52Hz, 3H) 1.47-1.53 ​​(m, 2H) 1.84-1.91 (m, 2H) 1.99-2.11 (m, 4H) 3.41 (t, J=6.88Hz, 2H) 5.27-5.35 (m, 1H) 5.35-5.44 (m, 1H)

[0178] (3) Synthesis of 2,2-di((Z)-octo-5-en-1-yl)dimethyl malonate 0.439 mL of dimethyl malonate was mixed with anhydrous THF (15 mL), sodium hydride (60%, 382 mg) was added under a nitrogen atmosphere, and the mixture was stirred for 30 minutes. An anhydrous THF solution (2 mL, 1 mL wash) of the compound obtained in Example 19 (2) (1.83 g) was added and the mixture was stirred at room temperature for 44.5 hours. Then sodium iodide (57.3 mg) was added and the mixture was heated under reflux at 70°C for 3 days. The mixture was cooled to room temperature, water (20 mL) was added, and the mixture was extracted twice with ethyl acetate (25 mL). The combined organic layers were washed with saturated brine (20 mL), dried over sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (704 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.92-0.98 (m, 6H) 1.10-1.20 (m, 4H) 1.35 (quin, J=7.47Hz, 4H) 1.83-1.91 (m, 4H) 1.99-2.07 (m, 8H) 3.67-3.73 (m, 6H) 5.25-5.32 (m, 2H) 5.32-5.39 (m, 2H)

[0179] (4) Synthesis of methyl (Z)-2-((Z)-octo-5-en-1-yl)dec-7-enoate. The compound obtained in Example 19(3) (66 mg) and lithium chloride (80 mg) were added to anhydrous DMF (2 mL) and heated at 120°C for 18 hours under a nitrogen atmosphere. Water (20 mL) and saturated saline (5 mL) were added to the mixture and extracted twice with ethyl acetate (20 mL). The combined organic layers were washed with saturated saline (20 mL), dried over sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (45.7 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.95 (t, J=7.52Hz, 6H) 1.23-1.38 (m, 8H) 1.40-1.48 (m, 2H) 1.56-1.64 (m, 2H) 1.97-2.06 (m, 8H) 2.33 (m, 1H) 3.67 (s, 3H) 5.26-5.39 (m, 4H)

[0180] (5) Synthesis of (Z)-2-((Z)-octo-5-en-1-yl)dec-7-en-1-ol: 42.5 mg of the compound obtained in Example 19(4) was added to anhydrous THF (1 mL), and lithium aluminum hydride (2 M THF solution, 0.144 mL) was added at room temperature under a nitrogen atmosphere. The mixture was stirred at 70°C for 2 hours, cooled to room temperature, and then sodium sulfate decahydrate (93 mg) was added and stirred for 37 minutes. The mixture was diluted with ethyl acetate, and the solid was removed by filtration. The solid was washed with ethyl acetate, and the combined organic layers were concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (29.1 mg). ¹H NMR (600 MHz, CDCl) ３ ) δ ppm 0.96 (t, J=7.52Hz, 6H) 1.12-1.17 (m, 1H) 1.25-1.38 (m, 12H) 1.41-1.49 (m, 1H) 1.98-2.09 (m, 8H) 3.51-3.57 (m, 2H) 5.29-5.40 (m, 4H)

[0181] (6) Synthesis of bis((Z)-2-((Z)-octo-5-en-1-yl)dec-7-en-1-yl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E19)) was performed using the same method as in Example 9-1(5), but with the compound obtained in Example 19(5) (42.7 mg) instead of the compound obtained in Example 9-2(4) as a starting material, to obtain the marked compound (31 mg). ESI-MS: 798.8 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.96 (t, J=7.52Hz, 12H) 1.24-1.36 (m, 24H) 1.58-1.65 (m, 2H) 1.72-1.81 (m, 2H) 1.82-2.07 (m, 24H) 2.21-2.28 (m, 4H) 2.28-2.35 (m, 4H) 2.80 (brd, J=11.00Hz, 2H) 3.96 (d, J=5.87Hz, 4H) 4.95 (tt, J=8.14, 4.24Hz, 1H) 5.26-5.40 (m, 8H)

[0182] [Example 20]

[0183] (1) Synthesis of 2-(6-methylheptyl)-2-octylmalonate ditert-butyl: The marked compound (2.37 g) was obtained using the same method as in Example 18(2), but with 1-bromo-6-methylheptane (1.29 g) instead of 1-bromo-5-methylhexane as a starting material. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81-0.88 (m, 9H) 1.06-1.17 (m, 6H) 1.22-1.29 (m, 14H) 1.43 (s, 18H) 1.45-1.51 (m, 1H) 1.71-1.79 (m, 4H)

[0184] (2) Synthesis of 2-(6-methylheptyl)-2-octylmalonic acid: Using the same method as in Example 18(3), the compound obtained in Example 20(1) (2.37 g) was used as a raw material instead of the compound obtained in Example 18(2) to obtain the labeled compound (2.45 g) as a crude product. ESI-MS: 329.1 ([M+H] ＋ )

[0185] (3) Synthesis of 2-(6-methylheptyl)decanoic acid Using the same method as in Example 18(4), the compound obtained in Example 20(2) (2.45 g) was used as a starting material instead of the compound obtained in Example 18(3) to obtain the labeled compound (1.67 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.83-0.88 (m, 9H) 1.12-1.15 (m, 1H) 1.22-1.29 (m, 19H) 1.42-1.49 (m, 3H) 1.54-1.70 (m, 2H) 2.25 (s, 1H) 2.29-2.42 (m, 1H)

[0186] (4) Synthesis of 2-(6-methylheptyl)decane-1-ol The labeled compound (1.15 g) was obtained using the same method as in Example 18(5), but with the compound obtained in Example 20(3) (1.67 g) instead of the compound obtained in Example 18(4) as a starting material. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81 - 0.89 (m, 9 H) 1.08-1.19 (m, 3H) 1.22-1.31 (m, 22H) 1.41-1.54 (m, 2H) 3.53 (t, J=5.66Hz, 2H)

[0187] (5) Synthesis of bis(2-(6-methylheptyl)decyl)4-oxoheptanediote: Using the same method as in Example 18(6), the compound obtained in Example 20(4) (582 mg) was used as a starting material instead of the compound obtained in Example 18(5) to obtain the labeled compound (384 mg) as a crude product.

[0188] (6) Synthesis of bis(2-(6-methylheptyl)decyl)4-hydroxyheptanediote: Using the same method as in Example 18(7), the compound obtained in Example 20(5) (384 mg) was used as a starting material instead of the compound obtained in Example 18(6) to obtain the labeled compound (201 mg). １ H NMR (396MHz, CDCl ３) δ ppm 0.82-0.90 (m, 18H) 1.11-1.28 (m, 48H) 1.44-1.53 ​​(m, 2H) 1.60 (brs, 2H) 1.67-1.86 (m, 4H) 2.25 (d, J=4.98Hz, 1H) 2.40-2.51 (m, 4H) 3.61-3.69 (m, 1H) 3.96 (d, J=5.44Hz, 4H)

[0189] (7) Synthesis of bis(2-(6-methylheptyl)decyl)4-(2-(1-methylpiperidine-4-yl)acetoxy)heptanediate (compound (E20)) The marked compound (10.2 mg) was obtained using the same method as in Example 18(8), but with the compound obtained in Example 20(6) (12 mg) instead of the compound obtained in Example 18(7) as the starting material. ESI-MS: 820.9 ([M+H] ＋ ) １ H NMR (396MHz, CDCl ３ ) δ ppm 0.82-0.90 (m, 18H) 1.09-1.18 (m, 4H) 1.19-1.33 (m, 46H) 1.44-1.55 (m, 3H) 1.74 (brd, J=12.23Hz, 3H) 1.79-1.97 (m, 5H) 1.98-2.13 (m, 2H) 2.22 (d, J = 7.25Hz, 2H) 2.26-2.39 (m, 7H) 2.92 (brd, J = 2.27Hz, 2H) 3.95 (d, J = 5.89Hz, 4H) 4.86-5.01 (m, 1H)

[0190] [Example 21]

[0191] (1) Synthesis of ethyl(E)-non-2-enoate: 2.10 g of sodium hydride was added to 50 mL of THF, and 13.74 g of ethyl 2-(diethoxyphosphoryl) acetate was added and stirred for 1 hour. A THF solution of heptanal (6.09 ml) (10 ml) was added to the mixture over 1 hour and stirred for 16 hours. A saturated aqueous solution of ammonium chloride (5 ml) and water (25 ml) were added to the mixture and stirred for 5 minutes, after which ethyl acetate (100 ml) was added. The aqueous layer was extracted twice with ethyl acetate (25 ml), and the combined organic layers were dried over anhydrous sodium sulfate. The filtrate was filtered, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (cyclohexane / ether) to obtain the labeled compound (4.65 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.89 (s, 3H) 1.20-1.38 (m, 9H) 1.45 (s, 2H) 2.15-2.23 (m, 2H) 4.14-4.22 (m, 2H) 5.78-5.86 (m, 1H) 6.91-7.02 (m, 1H)

[0192] (2) Ethyl 3-hexyl nonanoate synthesis: Copper bromide (0.078 g) and lithium chloride (0.023 g) were added to THF (10 mL) and stirred at room temperature for 10 minutes. The mixture was cooled to 0°C, and the compound obtained in Example 21(1) (1.0 g) and trimethylsilyl chloride (0.832 mL) were added and stirred for 20 minutes. At the same temperature, magnesium hexyl bromide (2 M diethyl ether solution, 3.26 mL) was added and stirred for 1 hour, then the temperature was raised to room temperature. Saturated ammonium chloride aqueous solution (10 mL) and water (20 mL) were added to the mixture, and then extracted twice with diethyl ether (20 mL). The combined organic layer was dried over anhydrous sodium sulfate. The mixture was filtered, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (cyclohexane / ether) to obtain the labeled compound (1.14 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.84-0.93 (m, 6H) 1.14-1.34 (m, 23H) 1.79-1.92 (m, 1H) 2.22 (d, J=6.97Hz, 2H) 4.12 (d, J=7.15Hz, 2H)

[0193] (3) Synthesis of 3-hexylnonan-1-ol The compound obtained in Example 21 (3) (1.14 g) was dissolved in THF (20 mL), and lithium aluminum hydride (2.0 M THF solution, 6.32 mL) was added at 0°C. The mixture was heated to room temperature and stirred for 16 hours. After the mixture was cooled to 0°C, MTBE (20 mL) and water (0.5 mL) were added, followed by 2N sodium hydroxide aqueous solution (1 mL) and water (2 mL) in sequence. The resulting solid was removed by Celite filtration, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / diethyl ether) to obtain the labeled compound (671 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (s, 6H) 1.11-1.15 (m, 1H) 1.26 (s, 20H) 1.54 (s, 3H) 3.63-3.71 (m, 2H)

[0194] (4) Synthesis of bis(3-hexylnonyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E21)) The compound obtained in Example 9-1 (4) (15 mg) was added to DMF (1 mL), 3-hexylnonan-1-ol (56.9 mg), DMAP (3.04 mg), and EDCI (28.6 mg) were added, and the mixture was stirred at room temperature for 16 hours. MTBE (10 mL) and water (1 mL) were added to the mixture, and the organic layer was separated. The organic layer was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (MTBE / methanol) to obtain the marked compound (12 mg). ESI-MS: 722.8 ([M+H]) ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=6.97Hz, 12H) 1.17-1.34 (m, 40H) 1.35-1.41 (m, 2H) 1.56 (d, J=6.79Hz, 4H) 1.70-2.02 (m, 10H) 2.20-2.36 (m, 8H) 2.76-2.88 (m, 2H) 4.07 (t, J=7.24Hz, 4H) 4.88-5.00 (m, 1H)

[0195] [Example 22]

[0196] (1) Synthesis of ethyl(E)-dec-2-enoate: Using the same method as in Example 21(1), octanal (5 g) was used instead of heptanal as a starting material to obtain the marked compound (6.8 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (s, 3H) 1.26-1.35 (m, 11H) 1.39-1.51 (m, 2H) 2.13-2.25 (m, 2H) 4.18 (d, J=7.15Hz, 2H) 5.77-5.87 (m, 1H) 6.89-7.03 (m, 1H)

[0197] (2) Synthesis of ethyl 3-pentyldecanoate Using the same method as in Example 21(2), the compound obtained in Example 22(1) (1.0 g) and magnesium pentyl bromide (2 M diethyl ether solution, 3.03 ml) were used instead of the compound obtained in Example 21(1) to obtain the labeled compound (1.08 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.86-0.92 (m, 6H) 1.24-1.32 (m, 23H) 1.76-1.91 (m, 1H) 2.17-2.30 (m, 2H) 3.99-4.19 (m, 2H)

[0198] (3) Synthesis of 3-pentyldecane-1-ol Using the same method as in Example 21(3), the compound obtained in Example 22(2) (1.08 g) was used instead of the compound obtained in Example 21(2) to obtain the labeled compound (0.70 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.11, 1.38Hz, 6H) 1.12-1.16 (m, 1H) 1.26 (brs, 20H) 1.38-1.43 (m, 1H) 1.52 (s, 2H) 3.62-3.72 (m, 2H)

[0199] (4) Synthesis of bis(3-pentyldecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E22)) Using the same method as in Example 21(4), the compound obtained in Example 22(3) (56.9 mg) was used instead of the compound obtained in Example 21(3) to obtain the marked compound (17.6 mg). ESI-MS: 722.8 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.15, 1.10Hz, 12H) 1.12-1.43 (m, 43H) 1.56 (q, J=7.09Hz, 4H) 1.70-2.03 (m, 10H) 2.16-2.39 (m, 8H) 2.74-2.92 (m, 2H) 4.07 (t, J=7.24Hz, 3H) 4.89-5.01 (m, 1H)

[0200] [Example 23]

[0201] (1) Synthesis of 2-decylmalonate dimethyl malonate Dimethyl malonate (1.00 g) was mixed with anhydrous THF (20 mL), and under a nitrogen atmosphere at 3°C, sodium hydride (60%, 303 mg) was added and stirred at room temperature for 37 minutes. 1-iododecane (1.62 mL) was added dropwise over 4 minutes and stirred at room temperature for 23 hours. Water (30 mL) and saturated saline (5 mL) were added to the mixture and extracted with ethyl acetate (30 mL). The organic layer was washed with saturated saline (30 mL), dried over sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (1.48 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=7.06Hz, 3H) 1.22-1.32 (m, 16H) 1.89 (q, J=7.52Hz, 2H) 3.35 (t, J=7.52Hz, 1H) 3.71-3.76 (m, 6H)

[0202] (2) Synthesis of dimethyl 2-decyl-2-pentylmalonate To the compound obtained in Example 23(1) (746 mg), anhydrous THF (15 mL) was added, and under a nitrogen atmosphere, sodium hydride (60%, 164 mg) was added at 2°C and stirred at room temperature for 35 minutes. 1-iodopentane (0.715 mL) was added dropwise over 3 minutes and stirred at room temperature for 17.5 hours. Water (30 mL) and saturated saline (5 mL) were added to the mixture and extracted with ethyl acetate (30 mL). The organic layer was washed with saturated saline (30 mL), dried over sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (561 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.02, 3.58Hz, 6H) 1.08-1.17 (m, 4H) 1.21-1.34 (m, 18H) 1.83-1.89 (m, 4H) 3.70 (s, 6H)

[0203] (3) Synthesis of methyl 2-pentyldodecanoate The compound obtained in Example 23(2) (561 mg) and lithium chloride (694 mg) were added to anhydrous DMF (11 mL) and heated at 120°C for 43.5 hours under a nitrogen atmosphere. Water (100 mL) was added to the mixture and extracted with ethyl acetate (100 mL). The organic layer was washed with saturated saline solution (50 mL), rinsed off under reduced pressure, and the residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (398 mg). ¹H NMR (600 MHz, CDCl) ３ ) δ ppm 0.88 (td, J=7.06, 3.67Hz, 6H) 1.21-1.33 (m, 22H) 1.39-1.47 (m, 2H) 1.55-1.64 (m, 2H) 2.33 (tt, J=8.92, 5.39Hz, 1H) 3.67 (s, 3H)

[0204] (4) Synthesis of 2-pentyldodecane-1-ol The compound obtained in Example 23 (3) (395 mg) was added to anhydrous THF (8 mL), and lithium aluminum hydride (2 M THF solution, 1.39 mL) was added at room temperature under a nitrogen atmosphere. The mixture was stirred at 70°C for 2 hours, cooled to room temperature, and then sodium sulfate decahydrate (894 mg) was added and stirred for 45 minutes. The mixture was diluted with ethyl acetate, and the solid was removed by filtration. The solid was washed with ethyl acetate, and the combined organic layer was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (347 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.06, 4.03Hz, 6H) 1.11-1.16 (m, 1H) 1.23-1.36 (m, 26H) 1.46 (quin, J=5.69Hz, 1H) 3.54 (t, J=5.69Hz, 2H)

[0205] (5) Synthesis of bis(2-pentyldodecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E23)) The marked compound (30.6 mg) was obtained using the same method as in Example 9-1 (5), but with the compound obtained in Example 23 (4) (41 mg) instead of the compound obtained in Example 9-2 (5) as the starting material. ESI-MS: 778.9 ([M+H] ＋ ) １ H NMR (600 MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.11, 2.48Hz, 12H) 1.21-1.34 (m, 52H) 1.57-1.64 (m, 2H) 1.73-1.81 (m, 2H) 1.82-2.01 (m, 8H) 2.22-2.28 (m, 4H) 2.28-2.35 (m, 4H) 2.81 (brd, J=11.00Hz, 2H) 3.96 (d, J=5.87Hz, 4H) 4.95 (tt, J=8.21, 4.26Hz, 1H)

[0206] [Example 24]

[0207] (1) Synthesis of ethyl(E)-dodec-2-enoate: The marked compound (5.7 g) was obtained using the same method as in Example 21(1), but with decanal (5 g) instead of heptanal as the starting material. １ H NMR (600MHz, CDCl ３ ) δ ppm 0.85-0.91 (m, 3H) 1.25-1.34 (m, 15H) 1.44-1.48 (s, 2H) 2.16-2.22 (m, 2H) 4.15-4.21 (m, 2H) 5.78-5.86 (m, 1H) 6.92-7.02 (m, 1H)

[0208] (2) Synthesis of ethyl 3-butyl dodecanoate Using the same method as in Example 21(2), the compound obtained in Example 24(1) (1.0 g) was used instead of the compound obtained in Example 21(1), and butylmagnesium bromide (2 M THF solution, 2.65 ml) was used instead of hexylmagnesium bromide to obtain the labeled compound (1.01 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (brd, J=4.03Hz, 6H) 1.25-1.34 (m, 25H) 1.77-1.90 (m, 1H) 2.19-2.24 (m, 2H) 4.09-4.15 (m, 2H)

[0209] (3) Synthesis of 3-butyldodecane-1-ol Using the same method as in Example 21(3), the compound obtained in Example 24(2) (1.01 g) was used instead of the compound obtained in Example 21(2) to obtain the labeled compound (0.716 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.89 (d, J=6.24Hz, 6H) 1.11-1.14 (m, 1H) 1.26 (brd, J=3.48Hz, 22H) 1.39-1.45 (m, 1H) 1.49-1.54 (m, 2H) 3.61-3.73 (m, 2H)

[0210] (4) Synthesis of bis(3-butyldodecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E24)) Using the same method as in Example 21(4), the compound obtained in Example 24(3) (60.3 mg) was used instead of the compound obtained in Example 21(3) to obtain the marked compound (17.9 mg). ESI-MS: 750.9 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.89 (d, J=5.87Hz, 12H) 1.25 (m, 44H) 1.35-1.43 (m, 2H) 1.56 (d, J=6.79Hz, 4H) 1.73-1.81 (m, 2H) 1.82-2.04 (m, 8H) 2.20-2.38 (m, 8H) 2.73-2.88 (m, 2H) 4.08 (t, J=7.24Hz, 4H) 4.89-5.00 (m, 1H)

[0211] [Example 25]

[0212] (1) Synthesis of ethyl (E)-undec-2-enoate: Add 30 mL of THF to 4.76 mL of ethyl 2-(diethoxyphosphoryl) acetate, cool to -78°C, then add 9.6 mL of n-BuLi (2.5 M hexane solution), stir for 30 minutes, then add 30 mL of nonanal (3.44 mL) in a 30 mL THF solution over 1 hour, and stir for 30 minutes. Add 10 mL of saturated ammonium chloride aqueous solution to the mixture and raise to room temperature, then add 10 mL of water and 50 mL of ethyl acetate and separate the phases. Extract the aqueous layer with 50 mL of ethyl acetate, then wash the combined organic layers with 20 mL of saturated sodium bicarbonate aqueous solution and 10 mL of saturated brine, dry over sodium sulfate, filter, concentrate the filtrate under reduced pressure, and purify the residue by silica gel column chromatography (cyclohexane / diethyl ether) to obtain the marked compound (1.55 g). １ H NMR (600MHz, CDCl ３) δ ppm 0.88 (t, J=7.06Hz, 3H) 1.17-1.37 (m, 13H) 1.39-1.50 (m, 2H) 2.14-2.24 (m, 2H) 4.09-4.23 (m, 2H) 5.65-5.87 (m, 1H) 6.79-7.02 (m, 1H)

[0213] (2) Synthesis of ethyl 3-butyl undecanoate Using the same method as in Example 21(2), the compound obtained in Example 25(1) (450 mg) was used instead of the compound obtained in Example 21(1), and butylmagnesium bromide (2 M THF solution, 1.27 mL) was used instead of hexylmagnesium bromide to obtain the labeled compound (610 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.78-0.97 (m, 6H) 1.13-1.39 (m, 23H) 1.76-1.94 (m, 1H) 2.23 (d, J=6.97Hz, 2H) 4.13 (d, J=7.15Hz, 2H)

[0214] (3) Synthesis of 3-butylundecane-1-ol Using the same method as in Example 23(4), the compound obtained in Example 25(2) (600 mg) was used instead of the compound obtained in Example 23(3) to obtain the labeled compound (366 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.72-0.99 (m, 6H) 1.13 (s, 1H) 1.20-1.35 (m, 20H) 1.37-1.45 (m, 1H) 1.49-1.54 (m, 2H) 3.66 (brd, J=5.32Hz, 2H)

[0215] (4) Synthesis of bis(3-butylundecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E25)) The marked compound (16.7 mg) was obtained using the same method as in Example 9-1 (5), but with the compound obtained in Example 25 (3) (45.5 mg) instead of the compound obtained in Example 9-2 (4) as a starting material. ESI-MS: 722.9 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３) δ ppm 0.80-0.96 (m, 12H) 1.15-1.33 (m, 38H) 1.33-1.45 (m, 2H) 1.56 (brd, J=6.60Hz, 6H) 1.70-2.07 (m, 10H) 2.26 (s, 8H) 2.74-2.88 (m, 2H) 4.08 (t, J=7.24Hz, 4H) 4.94 (dt, J=8.21, 3.87Hz, 1H)

[0216] [Example 26]

[0217] (1) Synthesis of ethyl 3-pentyl undecanoate: The marked compound (610 mg) was obtained using the same method as in Example 25 (2), but with pentyl magnesium bromide (1.27 mL, 2 M diethyl ether solution) instead of butyl magnesium bromide. １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=7.14Hz, 6H) 1.16-1.41 (m, 25H) 1.73-1.90 (m, 1H) 2.22 (d, J=6.97Hz, 2H) 4.12 (q, J=7.15Hz, 2H)

[0218] (2) Synthesis of 3-pentylundecane-1-ol Using the same method as in Example 23(4), the compound obtained in Example 26(1) (600 mg) was used instead of the compound obtained in Example 23(3) to obtain the labeled compound (381 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.11, 1.56Hz, 6H) 1.13 (t, J=5.32Hz, 1H) 1.20-1.37 (m, 22H) 1.38-1.42 (m, 1H) 1.49-1.54 (m, 2H) 3.66 (td, J=7.01, 5.41Hz, 2H)

[0219] (3) Synthesis of bis(3-pentylundecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E26)) The marked compound (14.3 mg) was obtained using the same method as in Example 9-1 (5), but with the compound obtained in Example 26 (2) (48.3 mg) instead of the compound obtained in Example 9-2 (4) as a starting material. ESI-MS: 750.9 ([M+H]＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.11, 1.56Hz, 12H) 1.16-1.34 (m, 44H) 1.34-1.45 (m, 2H) 1.56 (q, J=7.09Hz, 4H) 1.66-2.08 (m, 10H) 2.26 (s, 8H) 2.81 (brd, J=11.19Hz, 2H) 4.07 (t, J=7.24Hz, 4H) 4.74-5.12 (m, 1H)

[0220] [Example 27]

[0221] (1) Synthesis of ethyl(E)-dec-2-enoate: Using the same method as in Example 21(1), the marked compound (1.60 g) was obtained by using octanal (1.8 g) instead of heptanal as the starting material. １ H NMR (500MHz, CDCl ３ ) δ ppm 0.87 (s, 3H) 1.20-1.33 (m, 13H) 1.40-1.50 (m, 2H) 4.17 (d, J=7.45Hz, 2H) 5.77-5.84 (m, 1H) 6.95 (d, J=15.47Hz, 1H)

[0222] (2) Synthesis of ethyl 3-hexyldecanoate: Using the same method as in Example 21(2), the compound obtained in Example 27(1) (1000 mg) was used instead of the compound obtained in Example 21(1) to obtain the marked compound (770 mg). ESI-MS: 285.2 ([M+H] ＋ ) １ H NMR (500MHz, CDCl ３ ) δ ppm 0.86 (t, J=6.87Hz, 6H) 1.12-1.39 (m, 25H) 1.74-1.90 (m, 1H) 2.20 (d, J=6.87Hz, 2H) 4.05-4.18 (m, 2H)

[0223] (3) Synthesis of 3-hexyldecane-1-ol Using the same method as in Example 21(3), the compound obtained in Example 27(2) (770 mg) was used instead of the compound obtained in Example 21(2) to obtain the labeled compound (390 mg). １ H NMR (400MHz, CDCl３ ) δ ppm 0.87 (s, 6H) 1.24 (s, 20H) 1.26-1.34 (m, 1H) 1.35-1.45 (m, 1H) 1.48-1.55 (m, 2H) 1.55-1.61 (m, 1H) 3.65 (s, 2H)

[0224] (4) Synthesis of bis(3-hexyldecyl)4-oxoheptanediote Using the same method as in Example 3(1), the compound obtained in Example 27(3) (140 mg) was used instead of 3-hexylundecane-1-ol to obtain the labeled compound (130 mg).

[0225] (5) Synthesis of bis(3-hexyldecyl)4-hydroxyheptanediote Using the same method as in Example 3(2), the compound obtained in Example 27(4) (130 mg) was used instead of the compound obtained in Example 3(1) to obtain the marked compound (45 mg). ESI-MS: 625.2 ([M+H] ＋ )

[0226] (6) Synthesis of bis(3-hexyldecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E27)) Using the same method as in Example 3(3), the compound obtained in Example 27(5) (15 mg) was used instead of the compound obtained in Example 3(2) to obtain the marked compound (9.97 mg). ESI-MS: 750.5 ([M+H] ＋ ) １ H NMR (500MHz, CDCl ３ ) δ ppm 0.80-0.94 (m, 12H) 1.14-1.30 (m, 44H) 1.34-1.43 (m, 2H) 1.55 (brd, J=10.88Hz, 4H) 1.86 (brs, 10H) 2.17-2.36 (m, 8H) 2.80 (brd, J=6.87Hz, 2H) 4.06 (t, J=6.87Hz, 4H) 4.87-4.99 (m, 1H)

[0227] [Example 28]

[0228] (1) Synthesis of methyl 3,3-bis(octyloxy)propanoate 500 mg of 3,3-dimethoxypropanoate and PPTS (42 mg) were mixed with octan-1-ol (1.59 mL) and stirred at 105°C for 4 hours. The mixture was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (843 mg) as the crude product. １ H NMR (600MHz, CDCl ３ ) δ ppm 0.85-0.91 (m, 6H) 1.21-1.41 (m, 21H) 1.50-1.58 (m, 4H) 1.62 (dt, J=14.40, 6.92Hz, 1H) 1.66-1.73 (m, 1H) 2.65 (dd, J=9.81, 5.96Hz, 1H) 3.42-3.49 (m, 1H) 3.56-3.63 (m, 1H) 3.67-3.71 (m, 1H) 3.79-3.86 (m, 1H) 4.05-4.11 (m, 1H) 4.93 (t, J=5.87Hz, 1H)

[0229] (2) Synthesis of 3,3-bis(octyloxy)propan-1-ol A solution of the compound obtained in Example 28(1) (851 mg) in anhydrous THF (4 mL) was added to lithium aluminum hydride (1 M THF solution, 2.96 mL) under a nitrogen atmosphere at -1°C over 2 minutes. The mixture was stirred at room temperature for 2.5 hours, after which sodium sulfate decahydrate (1 g) was added and stirred for 30 minutes. The solid was removed from the mixture by filtration, and the solid was washed four times with THF (5 mL). The combined organic layer was concentrated under reduced pressure to obtain the labeled compound (613 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=7.05Hz, 6H) 1.22-1.38 (m, 20H) 1.56-1.60 (m, 4H) 1.89 (q, J=5.38Hz, 2H) 2.53 (t, J=5.59Hz, 1H) 3.45 (dt, J=9.35, 6.69Hz, 2H) 3.63 (dt, J=9.26, 6.65Hz, 2H) 3.74 (q, J=5.69Hz, 2H) 4.65 (t, J=5.41Hz, 1H)

[0230] (3) Synthesis of bis(3,3-bis(octyloxy)propyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediate (compound (E28)) The marked compound (26.5 mg) was obtained using the same method as in Example 9-1 (5), but with the compound obtained in Example 28 (2) (45.6 mg) instead of the compound obtained in Example 9-2 (4) as a starting material. ESI-MS: 899.0 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=7.05Hz, 12H) 1.23-1.37 (m, 40H) 1.54-1.60 (m, 8H) 1.71-1.81 (m, 2H) 1.82-2.00 (m, 12H) 2.22-2.28 (m, 4H) 2.28-2.35 (m, 4H) 2.81 (brd, J=11.55Hz, 2H) 3.41 (dt, J=8.99, 6.88Hz, 4H) 3.54-3.61 (m, 4H) 4.10-4.18 (m, 4H) 4.58 (t, J=5.78Hz, 2H) 4.91-4.96 (m, 1H)

[0231] [Example 29]

[0232] (1) Synthesis of methyl 3-(2,6-dioxocyclohexyl)propanoate 2.5 g of cyclohexane-1,3-dione was mixed with 50 mL of DMF, then 2.43 mL of methyl acrylate and 4.36 g of cesium carbonate were added and the mixture was stirred at 75°C for 20 hours. Another 2.43 mL of methyl acrylate was added to the mixture and the mixture was stirred at 75°C for 17 hours. The mixture was then added to 150 mL of ice water and the pH was adjusted to 6 with dilute hydrochloric acid. The mixture was extracted twice with ethyl acetate (250 mL). The combined organic layers were washed twice with saturated brine (250 mL), dried over magnesium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the marked compound (1.35 g). １ H NMR (600MHz, CDCl ３) δ ppm 1.91 (q, J=6.46Hz, 2H) 2.32 (t, J=6.24Hz, 2H) 2.46 (t, J=6.33Hz, 2H) 2.49-2.53 (m, 2H) 2.55-2.59 (m, 2H) 3.73 (s, 3H) 9.23-9.46 (m, 1H)

[0233] (2) Synthesis of 5-oxononanedioc acid: 1.35 g of the compound obtained in Example 29 (1) was added to 40 mL of 10% hydrochloric acid and heated under reflux for 17 hours. The mixture was concentrated under reduced pressure to obtain the labeled compound (1.44 g). １ H NMR (600MHz, DMSO-d6) δ ppm 1.66 (q, J=7.34Hz, 4H) 2.19 (t, J=7.34Hz, 4H) 2.43 (t, J=7.34Hz, 4H) 11.48 (brs, 2H)

[0234] (3) Synthesis of bis(2-hexyldecyl) 5-oxononanediote: 150 mg of the compound obtained in Example 29(2) was mixed with 2-hexyldecane-1-ol (5.38 mL), and then sulfuric acid (20 μL) was added and heated at 100°C for 17 hours. The mixture was cooled to room temperature, diluted with cyclohexane (50 mL), washed with saturated sodium bicarbonate aqueous solution (20 mL), water (10 mL), and saturated saline solution (10 mL), dried over sodium sulfate, and distilled with Kugellohr (1 mbar, 190-220°C) to obtain the marked compound (278 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=6.97Hz, 12H) 1.23-1.31 (m, 48H) 1.55-1.67 (m, 2H) 1.85-1.93 (m, 4H) 2.33 (t, J=7.24Hz, 4H) 2.47 (t, J=7.24Hz, 4H) 3.97 (d, J=5.87Hz, 4H)

[0235] (4) Synthesis of bis(2-hexyldecyl) 5-hydroxynonanediote: Diethyl ether (3 mL) and methanol (0.9 mL) were added to the compound (189 mg) obtained in Example 29 (3), and sodium borohydride (11.5 mg) was added and stirred for 1 hour at -20°C. The mixture was diluted with diethyl ether (10 mL) and saturated ammonium chloride aqueous solution (2 mL) was added. The aqueous layer was extracted twice with diethyl ether (5 mL), and the combined organic layer was dried with sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / diethyl ether) to obtain the marked compound (98 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.89 (t, J=6.97Hz, 12H) 1.27 (brs, 48H) 1.42-1.54 (m, 4H) 1.68 (brd, J=5.32Hz, 7H) 2.35 (td, J=7.34, 1.65Hz, 4H) 3.53-3.66 (m, 1H) 3.98 (d, J=5.87Hz, 4H)

[0236] (5) Synthesis of bis(2-hexyldecyl) 5-((1-methylpiperidine-4-carbonyl)oxy)nonanediato (compound (E29)) The compound obtained in Example 29(4) (32.2 mg), 1-methylpiperidine-4-carboxylic acid (17.7 mg), DMAP (3 mg) were added to DMF (0.5 mL), and EDCI (22.7 mg) was added at room temperature and the mixture was stirred for 18 hours. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (MTBE / methanol) to obtain the marked compound (18.3 mg). ESI-MS: 779.0 ([M+H]) ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.79-0.96 (m, 12H) 1.16-1.40 (m, 48H) 1.51-1.68 (m, 10H) 1.72-1.83 (m, 2H) 1.86-1.93 (m, 2H) 1.97 (br t, J=10.91Hz, 2H) 2.15-2.39 (m, 8H) 2.73-2.90 (m, 2H) 3.96 (d, J=5.69Hz, 4H) 4.81-4.98 (m, 1H)

[0237] [Example 30]

[0238] (1) Synthesis of 2-hexyldecanal 2-hexyldecan-1-ol (4.5 g) was added to DCM (100 mL), and DMP (9.84 g) was added and the mixture was stirred for 2 hours. Saturated sodium bicarbonate aqueous solution (10 mL) and saturated sodium thiosulfate solution (10 mL) were added and the mixture was stirred for 1 hour. DCM (50 mL) was added to the mixture and filtered, and the filtrate was concentrated under reduced pressure to obtain the marked compound (4.0 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.86-0.90 (m, 6H) 1.25-1.33 (m, 20H) 1.38-1.48 (m, 2H) 1.55-1.67 (m, 2H) 2.17-2.26 (m, 1H) 9.51-9.60 (m, 1H)

[0239] (2) Synthesis of ethyl (E)-4-hexyldodec-2-enoate: Sodium hydride (60%, 0.798 g) was added to THF (50 mL), and ethyl 2-(diethoxyphosphoryl) acetate (5.22 g) was added and the mixture was stirred for 1 hour. A THF solution (10 ml) of the compound obtained in Example 30 (1) (4 g) was added and the mixture was stirred for 16 hours. A saturated aqueous solution of ammonium chloride (5 ml) and water (25 ml) were added and the mixture was stirred for 5 minutes, after which ethyl acetate (100 ml) was added. The aqueous layer was extracted twice with ethyl acetate (25 ml), and the combined organic phase was dried over anhydrous sodium sulfate. The mixture was filtered, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (cyclohexane / diethyl ether) to obtain the labeled compound (4.0 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.06Hz, 2.57Hz, 6H) 1.23-1.33 (m, 24H) 1.43 (m, 3H) 2.04-2.18 (m, 1H) 4.19 (d, J=7.15Hz, 2H) 5.71-5.81 (m, 1H) 6.67-6.79 (m, 1H)

[0240] (3) Synthesis of ethyl 4-hexyldodecanoate Under a nitrogen atmosphere, the compound obtained in Example 30 (2) (1.0 g) and palladium carbon (0.685 g) were added to ethyl acetate (50 mL). After replacing the atmosphere with a hydrogen atmosphere, the mixture was stirred for 16 hours. After replacing the atmosphere in the flask with a nitrogen atmosphere, the mixture was filtered, and the filtrate was concentrated under reduced pressure to obtain the labeled compound (1.28 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=7.06Hz, 6H) 1.10-1.40 (m, 29H) 1.56-1.59 (m, 1H) 2.22-2.32 (m, 2H) 4.12 (d, J=7.15Hz, 2H)

[0241] (4) Synthesis of 4-hexyldodecane-1-ol The compound obtained in Example 30 (3) (1.00 g) was dissolved in THF (20 mL), and lithium aluminum hydride (2.0 M THF solution, 6.32 mL) was added at 0°C. The mixture was heated to room temperature and stirred for 16 hours. After adding MTBE (20 mL), the reaction solution was cooled to 0°C, and water (0.5 mL), 2N sodium hydroxide aqueous solution (1 mL), and water (2 mL) were added sequentially. The resulting solid was removed by Celite® filtration, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / diethyl ether) to obtain the labeled compound (645 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=7.06Hz, 6H) 1.19-1.34 (m, 28H) 1.50-1.60 (m, 2H) 3.62 (t, J=6.69Hz, 2H)

[0242] (5) Synthesis of bis(4-hexyldodecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E30)) The compound obtained in Example 30(4) (12 mg) was added to DMF (1 mL), and 4-hexyldodecane-1-ol (53.9 mg), DMAP (2.43 mg), and EDCI (22.90 mg) were added and the mixture was stirred for 16 hours. MTBE (10 mL), water (10 mL), and saturated saline (1 mL) were added to the mixture and the organic layer was separated. The organic layer was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (MTBE / methanol) to obtain the labeled compound (16.6 mg). ESI-MS: 806.9 ([M+H]) ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.82-0.95 (m, 12H) 1.13-1.43 (m, 54H) 1.52-1.63 (m, 4H) 1.72-1.82 (m, 2H) 1.83-2.03 (m, 8H) 2.19-2.40 (m, 8H) 2.73-2.87 (m, 2H) 4.03 (t, J=6.97Hz, 4H) 4.89-5.00 (m, 1H)

[0243] [Example 31]

[0244] (1) Synthesis of 2-hexyloctanal Using the same method as in Example 30 (1), 2-hexyloctan-1-ol (0.9 g) was used as a starting material instead of 2-hexyldecane-1-ol to obtain the marked compound (780 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.84-0.93 (m, 6H) 1.24-1.33 (m, 16H) 1.43 (m, 2H) 1.57-1.68 (m, 2H) 2.16-2.29 (m, 1H) 9.51-9.60 (m, 1H)

[0245] (2) Synthesis of ethyl (E)-4-hexyldec-2-enoate: Using the same method as in Example 30(2), the compound obtained in Example 31(1) (780 mg) was used instead of the compound obtained in Example 30(1) to obtain the labeled compound (970 mg). １ H NMR (600MHz, CDCl３ ) δ ppm 0.87 (t, J=7.06Hz, 6H) 1.14-1.36 (m, 20H) 1.38-1.43 (s, 3H) 2.05-2.17 (m, 1H) 4.19 (d, J=7.15Hz, 2H) 5.68-5.81 (m, 1H) 6.68-6.81 (m, 1H)

[0246] (3) Synthesis of ethyl 4-hexyldecanoate Using the same method as in Example 30(3), the compound obtained in Example 31(2) (0.97 g) was used instead of the compound obtained in Example 30(2) to obtain the labeled compound (0.977 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=7.06Hz, 6H) 1.14-1.35 (m, 25H) 1.57-1.59 (m, 1H) 2.20-2.32 (m, 2H) 4.12 (d, J=7.15Hz, 2H)

[0247] (4) Synthesis of 4-hexyldecane-1-ol Using the same method as in Example 30(4), the compound obtained in Example 31(3) (1 g) was used instead of the compound obtained in Example 30(3) to obtain the labeled compound (697 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=6.97Hz, 6H) 1.18-1.35 (m, 24H) 1.54 (br t, J=7.79Hz, 2H) 3.54-3.70 (m, 2H)

[0248] (5) Synthesis of bis(4-hexyldecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E31)) Using the same method as in Example 30(5), the compound obtained in Example 31(4) (15 mg) was used instead of the compound obtained in Example 30(4) to obtain the marked compound (11.5 mg). ESI-MS: 750.9 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３) δ ppm 0.88 (t, J=7.06Hz, 12H) 1.17-1.35 (m, 46H) 1.55-1.62 (m, 4H) 1.72-1.82 (m, 2H) 1.83-2.03 (m, 8H) 2.21-2.38 (m, 8H) 2.75-2.88 (m, 2H) 4.03 (t, J=6.88Hz, 4H) 4.90-4.99 (m, 1H)

[0249] [Example 32]

[0250] (1) Synthesis of 2-heptylmalonate ditert-butyl The marked compound (5.90 g) was obtained using the same method as in Example 18 (1), but with 1-bromoheptane (3.86 mL) instead of 1-bromooctane as the starting material. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.80-0.91 (m, 3H) 1.20-1.35 (m, 10H) 1.40-1.48 (m, 18H) 1.66-1.83 (m, 2H) 3.09 (t, J=7.70Hz, 1H)

[0251] (2) Synthesis of 2-heptyl-2-hexylmalonate ditert-butyl Using the same method as in Example 18(2), the compound obtained in Example 32(1) (2.50 g) was used as a starting material instead of the compound obtained in Example 18(1), and 1-bromohexane (1.34 mL) was used instead of 1-bromo-5-methylhexane to obtain the labeled compound (2.95 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81-0.90 (m, 6H) 1.03-1.19 (m, 4H) 1.26 (brs, 14H) 1.42 (s, 18H) 1.71-1.80 (m, 4H)

[0252] (3) Synthesis of 2-heptyl-2-hexylmalonic acid Using the same method as in Example 18(3), the compound obtained in Example 32(2) (2.95 g) was used as a raw material instead of the compound obtained in Example 18(2) to obtain the labeled compound (3.21 g) as a crude product. １ H NMR (396MHz, CDCl ３ ) δ ppm 1H NMR (396MHz, CDCl ３) δ ppm 0.86 (brt, J=6.80 Hz, 6H) 1.25 (brs, 18 H) 1.85-2.00 (m, 4H)

[0253] (4) Synthesis of 2-hexylnonanoic acid Using the same method as in Example 18(4), the compound obtained in Example 32(3) (3.21 g) was used as a starting material instead of the compound obtained in Example 18(3) to obtain the labeled compound (2.13 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.86 (t, J=6.57 Hz, 6H) 1.21-1.33 (m, 18H) 1.39-1.51 (m, 2H) 1.55-1.66 (m, 2H) 2.27-2.42 (m, 1H)

[0254] (5) Synthesis of 2-hexylnonan-1-ol The labeled compound (1.26 g) was obtained using the same method as in Example 18 (5), but with the compound obtained in Example 32 (4) (2.13 g) instead of the compound obtained in Example 18 (4) as a starting material. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.83-0.94 (m, 6H) 1.27 (brs, 22H) 1.54-1.60 (m, 2H) 3.54 (t, J=5.44Hz, 2H)

[0255] (6) Synthesis of bis(2-hexylnonyl)4-oxoheptanediote Using the same method as in Example 18(6), the compound obtained in Example 32(5) (492 mg) was used as a starting material instead of the compound obtained in Example 18(5) to obtain the labeled compound (345 mg) as a crude product.

[0256] (7) Synthesis of bis(2-hexylnonyl)4-hydroxyheptanediote The labeled compound (159 mg) was obtained using the same method as in Example 18(7), but with the compound obtained in Example 32(6) (345 mg) instead of the compound obtained in Example 18(6) as a starting material. １ H NMR (396MHz, CDCl ３) δ ppm 0.82-0.92 (m, 12H) 1.22-1.30 (m, 44H) 1.57-1.65 (m, 2H) 1.66-1.89 (m, 4H) 2.22-2.26 (m, 1H) 2.38-2.55 (m, 4H) 3.58-3.73 (m, 1H) 3.96 (d, J=5.89Hz, 4H)

[0257] (8) Synthesis of bis(2-hexylnonyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E32)) The marked compound (6.8 mg) was obtained using the same method as in Example 3(3), but with the compound obtained in Example 32(7) (12 mg) instead of the compound obtained in Example 3(2) as the starting material. ESI-MS: 744.6 ([M+Na] ＋ ) １ H NMR (396MHz, CDCl ３ ) δ ppm 0.85-0.90 (m, 12H) 1.19-1.34 (m, 44H) 1.68-2.04 (m, 11H) 2.18-2.34 (m, 9H) 2.72-2.88 (m, 2H) 3.95 (d, J=5.89Hz, 4H) 4.89-4.98 (m, 1H)

[0258] [Example 33]

[0259] (1) Synthesize di-tert-butyl 2-decyl-2-heptylmalonate. Add 60% sodium hydride (350 mg) to DMF (20 mL), and add dropwise a solution of the compound obtained in Example 32 (1) (2.50 g) in DMF (5 mL) at 0°C. Stir the mixture at 0°C for 30 minutes, then add a solution of 1-iododecane (2.04 mL) in DMF (5 mL). Stir the mixture at 0°C for 30 minutes, then stir at room temperature for 2 hours. Cool the mixture to 0°C, then add saturated aqueous ammonium chloride (50 mL). Further dilute with ethyl acetate (100 mL) and water (50 mL). Extract the aqueous layer with ethyl acetate, wash the combined organic layers with water and saturated brine, dry over anhydrous sodium sulfate, filter, and concentrate under reduced pressure. The residue was purified by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (2.63 g). １ H NMR (396MHz, CDCl ３) δ ppm 0.81-0.92 (m, 6H) 1.13 (brd, J=8.15Hz, 4H) 1.20-1.33 (m, 22H) 1.43 (s, 18H) 1.72-1.81 (m, 4H)

[0260] (2) Synthesis of 2-decyl-2-heptylmalonic acid Using the same method as in Example 18(3), the compound obtained in Example 33(1) (2.63 g) was used as a raw material instead of the compound obtained in Example 18(2) to obtain the labeled compound (2.56 g) as a crude product. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.80-0.91 (m, 5H) 0.83-0.84 (m, 1H) 1.23 (brs, 26H) 1.86-1.99 (m, 4H)

[0261] (3) Synthesis of 2-heptyldodecanoic acid Using the same method as in Example 18(4), the compound obtained in Example 33(2) (2.56 g) was used as a starting material instead of the compound obtained in Example 18(3) to obtain the labeled compound (1.85 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.86 (t, J=6.80 Hz, 6H) 1.20-1.32 (m, 26H) 1.41-1.50 (m, 2H) 1.53-1.65 (m, 2H) 2.27-2.42 (m, 1H)

[0262] (4) Synthesis of 2-heptyldodecane-1-ol The labeled compound (1.19 g) was obtained using the same method as in Example 18(5), but with the compound obtained in Example 33(3) (1.85 g) instead of the compound obtained in Example 18(4) as a starting material. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.82-0.91 (m, 6H) 1.20-1.32 (m, 32H) 3.52 (t, J=5.66Hz, 2H)

[0263] (5) Synthesis of bis(2-heptyldodecyl)4-oxoheptanediote: Using the same method as in Example 18(6), the compound obtained in Example 33(4) (613 mg) was used as a raw material instead of the compound obtained in Example 18(5) to obtain the labeled compound (304 mg) as a crude product.

[0264] (6) Synthesis of bis(2-heptyldodecyl)4-hydroxyheptanediote The labeled compound (213 mg) was obtained using the same method as in Example 18(7), but with the compound obtained in Example 33(5) (304 mg) instead of the compound obtained in Example 18(6) as a starting material. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.84-0.90 (m, 12H) 1.25 (s, 60H) 1.57-1.64 (m, 2H) 1.67-1.86 (m, 4H) 2.25 (d, J=4.98Hz, 1H) 2.40-2.52 (m, 4H) 3.61-3.69 (m, 1H) 3.96 (d, J=5.89 Hz, 4H)

[0265] (7) Synthesis of bis(2-heptyldodecyl)4-(2-(1-methylpiperidine-4-yl)acetoxy)heptanediate (compound (E33)) The marked compound (11.9 mg) was obtained using the same method as in Example 18(8), but with the compound obtained in Example 33(6) (12 mg) instead of the compound obtained in Example 18(7) as the starting material. ESI-MS: 870.2 ([M+Na] ＋ ) 1H NMR (396MHz, CDCl ３ ) δ ppm 0.85-0.89 (m, 12H) 1.23-1.27 (m, 60H) 1.36-1.49 (m, 2H) 1.69-1.98 (m, 8H) 2.01-2.16 (m, 2H) 2.23 (d, J=6.80Hz, 2H) 2.28-2.42 (m, 8H) 2.87-3.07 (m, 2H) 3.95 (d, J=5.89Hz, 4H) 4.85-4.99 (m, 1H)

[0266] [Example 34]

[0267] (1) Synthesis of 2-decyl-2-octylmalonate ditert-butyl ester Using the same method as in Example 33(1), the compound obtained in Example 18(1) (2.50 g) was used as a starting material instead of the compound obtained in Example 32(1) to obtain the labeled compound (3.44 g). １ H NMR (396MHz, CDCl ３) δ ppm 0.81-0.89 (m, 6H) 1.05-1.16 (m, 4H) 1.20-1.31 (m, 24H) 1.42 (s, 18H) 1.70-1.79 (m, 4H)

[0268] (2) Synthesis of 2-decyl-2-octylmalonic acid Using the same method as in Example 18(3), the compound obtained in Example 34(1) (3.44 g) was used as a raw material instead of the compound obtained in Example 18(2) to obtain the labeled compound (2.57 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.82-0.91 (m, 6H) 1.24 (brs, 28H) 1.89-2.01 (m, 4H)

[0269] (3) Synthesis of 2-octyldodecanoic acid Using the same method as in Example 18(4), the compound obtained in Example 34(2) (2.57 g) was used as a raw material instead of the compound obtained in Example 18(3) to obtain the labeled compound (2.31 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.86 (t, J=6.80 Hz, 6H) 1.17-1.36 (m, 32H) 2.32-2.40 (m, 1H)

[0270] (4) Synthesis of 2-octyldodecane-1-ol The labeled compound (2.04 g) was obtained using the same method as in Example 18(5), but with the compound obtained in Example 34(3) (2.28 g) instead of the compound obtained in Example 18(4) as a starting material. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.87 (t, J=6.34 Hz, 6H) 1.26 (brs, 32H) 1.40-1.48 (m, 1H) 3.53 (t, J=5.44Hz, 2H)

[0271] (5) Synthesis of bis(2-octyldodecyl)4-oxoheptanediote: Using the same method as in Example 18(6), the compound obtained in Example 34(4) (643 mg) was used as a raw material instead of the compound obtained in Example 18(5) to obtain the labeled compound (168 mg) as a crude product.

[0272] (6) Synthesis of bis(2-octyldodecyl)4-hydroxyheptanediote The labeled compound (145 mg) was obtained using the same method as in Example 18(7), but instead of the compound obtained in Example 18(6), the compound obtained in Example 34(5) (168 mg) was used as a starting material. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.83-0.91 (m, 12H) 1.25 (s, 64H) 1.60 (brs, 2H) 1.67-1.86 (m, 4H) 2.25 (d, J=5.44Hz, 1H) 2.40-2.52 (m, 4H) 3.61-3.69 (m, 1H) 3.96 (d, J=5.89Hz, 4H)

[0273] (7) Synthesis of bis(2-octyldodecyl)4-(2-(1-methylpiperidine-4-yl)acetoxy)heptanediote (compound (E34)) Using the same method as in Example 18(8), the compound obtained in Example 34(6) (12 mg) was used instead of the compound obtained in Example 18(7) to obtain the marked compound (8.5 mg). ESI-MS: 898.4 ([M+Na] ＋ ) １ H NMR (396MHz, CDCl ３ ) δ ppm 0.80-0.92 (m, 12H) 1.25 (s, 68H) 1.36-1.48 (m, 2H) 1.69-1.97 (m, 6H) 1.99-2.18 (m, 2H) 2.23 (d, J=6.80Hz, 2H) 2.27-2.39 (m, 7H) 2.81-3.07 (m, 1H) 3.95 (d, J=5.44Hz, 4H) 4.88-4.97 (m, 1H)

[0274] [Example 35]

[0275] (1) Synthesis of 2-octyl-2-pentylmalonate di-tert-butyl Using the same method as in Example 33(1), the compound obtained in 18(1) (2.50 g) was used as a starting material instead of the compound obtained in 32(1), and 1-iodopentane (1.09 mL) was used instead of 1-iododecane to obtain the labeled compound (2.93 g). １ H NMR (396MHz, CDCl ３) δ ppm 0.82-0.90 (m, 6H) 1.05-1.18 (m, 4H) 1.20-1.32 (m, 14H) 1.42 (s, 18H) 1.71-1.80 (m, 4H)

[0276] (2) Synthesis of 2-octyl-2-pentylmalonic acid Using the same method as in Example 18(3), the compound obtained in Example 35(1) (2.93 g) was used as a raw material instead of the compound obtained in Example 18(2) to obtain the labeled compound (2.11 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81-0.90 (m, 6H) 1.14-1.34 (m, 18H) 1.88-2.01 (m, 4H)

[0277] (3) Synthesis of 2-pentyldodecanoic acid Using the same method as in Example 18(4), the compound obtained in Example 35(2) (2.02 g) was used as a raw material instead of the compound obtained in Example 18(3) to obtain the labeled compound (1.85 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81-0.91 (m, 6H) 1.18-1.36 (m, 18H) 1.39-1.52 (m, 3H) 1.60 (ddd, J=14.27, 8.61, 5.66Hz, 2H) 2.30-2.39 (m, 1H)

[0278] (4) Synthesis of 2-pentyldecane-1-ol The labeled compound (841 mg) was obtained using the same method as in Example 18 (5), but with the compound obtained in Example 35 (3) (1.85 g) instead of the compound obtained in Example 18 (4) as a starting material. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.87 (td, J=6.91, 2.49Hz, 6H) 1.18-1.36 (m, 23H) 1.37-1.50 (m, 1H) 3.53 (t, J=5.44Hz, 2H)

[0279] (5) Synthesis of bis(2-pentyldecyl)4-oxoheptanediote Using the same method as in Example 18(6), the compound obtained in Example 35(4) (492 mg) was used as a raw material instead of the compound obtained in Example 18(5) to obtain the labeled compound (286 mg) as a crude product.

[0280] (6) Synthesis of bis(2-pentyldecyl)4-hydroxyheptanediote The labeled compound (136 mg) was obtained using the same method as in Example 18(7), but instead of the compound obtained in Example 18(6), the compound obtained in Example 35(5) (286 mg) was used as a starting material. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.83-0.91 (m, 12H) 1.25 (brs, 44H) 1.57-1.63 (m, 2H) 1.67-1.86 (m, 4H) 2.25 (d, J=4.98 Hz, 1H) 2.40-2.52 (m, 4H) 3.61-3.69 (m, 1H) 3.97 (d, J=5.89Hz, 4H)

[0281] (7) Synthesis of bis(2-pentyldecyl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E35)) The marked compound (8.8 mg) was obtained using the same method as in Example 3(3), but with the compound obtained in Example 35(6) (12 mg) instead of the compound obtained in Example 3(2) as the starting material. ESI-MS: 744.5 ([M+Na] ＋ ) １ H NMR (396MHz, CDCl ３ ) δ ppm 0.87-0.91 (brd, J=0.91Hz, 12H) 1.25 (s, 46H) 1.69-2.04 (m, 10H) 2.26 (s, 4H) 2.27-2.40 (m, 4H) 2.74-2.87 (m, 2H) 3.95 (d, J=5.89Hz, 4H) 4.89-4.99 (m, 1H)

[0282] [Example 36]

[0283] (1) Synthesis of bis(2-pentyldecyl)4-(2-(1-methylpiperidine-4-yl)acetoxy)heptanediate (compound (E36)) was performed using the same method as in Example 18(8), but instead of the compound obtained in Example 18(7), the compound obtained in Example 35(6) (12 mg) was used to obtain the marked compound (8.5 mg). ESI-MS: 758.2 ([M+Na] ＋ ) １ H NMR (396MHz, CDCl３ ) δ ppm 0.82-0.94 (m, 12H) 1.25 (s, 51H) 1.69-1.95 (m, 4H) 2.00-2.14 (m, 2H) 2.23 (d, J=6.80Hz, 2H) 2.25-2.40 (m, 7H) 2.87-3.01 (m, 2H) 3.96 (d, J=5.44Hz, 4H) 4.85-4.99 (m, 1H)

[0284] [Example 37]

[0285] (1) Synthesis of bis(2-hexyldecyl)4-((((1-methylpiperidine-4-yl)methoxy)carbonyl)oxy)heptanediate (compound (E37)) Bis(2-hexyldecyl)4-hydroxyheptanediate (50 mg) was dissolved in toluene (1000 μL), and pyridine (39 μL) and triphosgene (14.2 mg) were added at 0°C. The mixture was stirred at 0°C for 1 hour, after which (1-methylpiperidine-4-yl)methanol (17.6 mg) was added. After stirring overnight at room temperature, saturated sodium bicarbonate aqueous solution (1 mL) was added to the mixture and extracted three times with n-heptane (1 mL). The combined organic layer was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / methanol) to obtain the marked compound (9.15 mg). ESI-MS: 780.1 ([M+H]) ＋ ) １ H NMR (500MHz, CDCl ３ ) δ ppm 0.87 (s, 12H) 1.17-1.35 (m, 49H) 1.39-1.53 ​​(m, 2H) 1.66-1.84 (m, 4H) 1.88-1.99 (m, 4H) 2.07-2.18 (m, 2H) 2.30-2.45 (m, 7H) 2.96-3.06 (m, 2H) 3.95 (d, J=6.11Hz, 6H) 4.73-4.82 (m, 1H)

[0286] [Example 38]

[0287] (1) Synthesis of 2-hexyldecyl(4-nitrophenyl)carbonate 2-hexyl-1-decanol (630 mg) and triethylamine (1.09 mL) were mixed with THF (10 mL), and 4-nitrophenyl chloroformate (786 mg) was added at room temperature and the mixture was stirred for 30 minutes. The mixture was diluted with ethyl acetate (30 mL), washed with water and saturated brine, dried over sodium sulfate, and the solid was removed by filtration. The mixture was then concentrated under reduced pressure. The residue was purified by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (973 mg). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.82-0.92 (m, 6H) 1.20-1.42 (m, 25H) 4.19 (d, J=5.44Hz, 2H) 7.33-7.41 (m, 2H) 8.23-8.31 (m, 2H)

[0288] (2) Synthesis of diethyl 3-(benzyloxy)pentanediate Diethyl 3-hydroxyglutarate (1.80 mL) was mixed with DCM (30 mL), and benzyl 2,2,2-trichloroacetoimidate (2.00 mL) and trifluoromethanesulfonic acid (86 μL) was added at room temperature and the mixture was stirred for 16 hours. The mixture was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (2.05 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 1.21-1.26 (m, 6H) 2.53-2.72 (m, 4H) 4.06-4.18 (m, 4H) 4.26-4.38 (m, 1H) 4.58 (s, 2H) 7.25-7.33 (m, 5H)

[0289] (3) Synthesis of 3-(benzyloxy)pentane-1,5-diol To the compound obtained in Example 38 (2) (300 mg), THF (10 mL) was added, and lithium aluminum hydride (2.0 M THF solution, 1.53 mL) was added at 0°C, and the mixture was stirred at room temperature for 2 hours. After the mixture was cooled to 0°C, ethyl acetate (5 mL) was added, followed by the sequential addition of water (0.12 mL), 15% aqueous sodium hydroxide solution (0.12 mL), and water (0.36 mL), and the mixture was stirred at room temperature for 10 minutes. The precipitate formed was filtered through Celite, and the resulting solution was concentrated under reduced pressure to obtain the labeled compound (208 mg) as the crude product.

[0290] (4) Synthesis of 3-(benzyloxy)pentane-1,5-diylbis(2-hexyldecyl)bis(carbonate) The compound obtained in Example 38(3) (100 mg) and the compound obtained in Example 38(1) (485 mg), triethylamine (0.20 mL) were added to THF (5 mL), DMAP (174 mg) was added at room temperature, and the mixture was stirred at 80°C for 1 hour. The mixture was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (150 mg) as the crude product.

[0291] (5) Bis(2-hexyldecyl)(3-hydroxypentane-1,5-diyl) The compound obtained in Example 38(4) for the synthesis of bis(carbonate) (150 mg) was mixed with ethanol (3 mL), and 10% palladium carbon (50% wet, 43 mg) was added. The mixture was then stirred at room temperature under a hydrogen atmosphere for 2 hours, and then hydrochloric acid (1 M, 0.5 mL) was added and the mixture was stirred for another 2 hours. The solid was removed by Celite® filtration and washed with ethanol. The organic layer was concentrated under reduced pressure to obtain the labeled compound (128 mg) as the crude product.

[0292] (6) Synthesis of 9,23-dihexyl-12,20-dioxo-11,13,19,21-tetraoxahentriacontan-16-yl 1-methylpiperidine-4-carboxylate (compound (E38)) The marked compound (9.8 mg) was obtained using the same method as in Example 3 (3), but with the compound obtained in Example 38 (5) (24 mg) instead of the compound obtained in Example 3 (2) as the starting material. ESI-MS: 804.5 ([M+Na]＋ ) １ H NMR (396MHz, CDCl ３ ) δ ppm 0.82-0.91 (m, 12H) 1.25 (brs, 48H) 1.56-1.71 (m, 2H) 1.81-2.09 (m, 9H) 2.41 (brs, 5H) 2.83-2.99 (m, 2H) 4.00 (d, J=5.89Hz, 4H) 4.06-4.20 (m, 4H) 5.09-5.16 (m, 1H)

[0293] [Example 39]

[0294] (1) Synthesis of bis(2-hexyldecyl)4-(((3-(dimethylamino)propoxy)carbonyl)oxy)heptanediote (compound (E39)) was performed using the same method as in Example 37(1), but with 3-dimethylamino-1-propanol (8.25 mg) instead of (1-methylpiperidine-4-yl)methanol to obtain the marked compound (36.56 mg). ESI-MS: 776.9 ([M+Na] ＋ ) １ H NMR (500MHz, CDCl ３ ) δ ppm 0.86 (t, J=6.72Hz, 12H) 1.17-1.35 (m, 50H) 1.77-1.98 (m, 6H) 2.26 (s, 6H) 2.31-2.45 (m, 6H) 3.95 (d, J=6.11Hz, 4H) 4.13-4.22 (m, 2H) 4.72-4.85 (m, 1H)

[0295] [Example 40]

[0296] (1) Synthesis of dimethyl 2-decyl-2-hexylmalonate: Using the same method as in Example 23(2), the labeled compound (0.609 g) was obtained by replacing 1-iodohexane (0.788 mL) with 1-iodopentane instead of the compound obtained in Example 23(1). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.84-0.92 (m, 6H) 1.09-1.17 (m, 4H) 1.22-1.32 (m, 20H) 1.81-1.91 (m, 4H) 3.70 (s, 6H)

[0297] (2) Synthesis of methyl 2-hexyldodecanoate Using the same method as in Example 23(3), the compound obtained in Example 40(1) (0.605 g) was used instead of the compound obtained in Example 23(2) to obtain the labeled compound (0.445 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.06, 3.12Hz, 6H) 1.21-1.33 (m, 24H) 1.39-1.47 (m, 2H) 1.55-1.63 (m, 2H) 2.33 (tt, J=8.89, 5.32Hz, 1H) 3.67 (s, 3H)

[0298] (3) Synthesis of 2-hexyldodecane-1-ol Using the same method as in Example 23(4), the compound obtained in Example 40(2) (0.441 g) was used instead of the compound obtained in Example 23(3) to obtain the labeled compound (0.387 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=6.97, 1.65Hz, 6H) 1.12-1.16 (m, 1H) 1.23-1.35 (m, 28H) 1.41-1.48 (m, 1H) 3.54 (t, J=5.59Hz, 2H)

[0299] (4) Synthesis of 2-hexyldodecanal Using the same method as in Example 30(1), the compound obtained in Example 40(3) (120 mg) was used instead of 2-hexyldecane-1-ol to obtain the labeled compound as a crude product (55 mg).

[0300] (5) Synthesis of ethyl (E)-4-hexyltetradec-2-enoate Using the same method as in Example 30(2), the compound obtained in Example 40(4) (60 mg) was used instead of the compound obtained in Example 30(1) to obtain the labeled compound (30 mg) as a crude product. １ H NMR (600MHz, CDCl ３ ) δ ppm 0.85-0.90 (m, 9H) 1.12-1.36 (m, 25H) 1.37-1.46 (m, 2H) 1.56 (s, 1H) 2.07-2.16 (m, 1H) 4.19 (q, J=7.03Hz, 2H) 5.72-5.79 (m, 1H) 6.68-6.78 (m, 1H)

[0301] (6) Synthesis of ethyl 4-hexyltetradecanoate Using the same method as in Example 30(3), the compound obtained in Example 40(5) (30 mg) was used instead of the compound obtained in Example 30(2) to obtain the labeled compound (31 mg) as a crude product. １ H NMR (600MHz, CDCl ３ ) δ ppm 0.86-0.90 (m, 9H) 1.14-1.38 (m, 27H) 1.47-1.64 (m, 4H) 2.22-2.30 (m, 2H) 4.12 (q, J=7.15Hz, 2H)

[0302] (7) Synthesis of 4-hexyltetradecane-1-ol Using the same method as in Example 30(4), the compound obtained in Example 40(6) (30 mg) was used instead of the compound obtained in Example 30(3) to obtain the labeled compound (15 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.84-0.93 (m, 6H) 1.13-1.39 (m, 32H) 1.49-1.60 (m, 2H) 3.58-3.65 (m, 2H)

[0303] (8) Synthesis of bis(4-hexyltetradecyl) 4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E40)) Using the same method as in Example 23(5), the compound obtained in Example 40(7) (14.9 mg) was used instead of the compound obtained in Example 30(4) to obtain the marked compound (2.9 mg). ESI-MS: 862.9 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.01, 1.74Hz, 12H) 1.10-1.43 (m, 60H) 1.49-1.69 (m, 8H) 1.71-2.08 (m, 9H) 2.19-2.38 (m, 7H) 2.77-2.88 (m, 2H) 4.03 (t, J=6.88Hz, 4H) 4.89-4.99 (m, 1H)

[0304] [Example 41]

[0305] (1) Synthesis of bis(2-heptyldecyl)4-(((3-(dimethylamino)propoxy)carbonyl)oxy)heptanediate (compound (E41)) Using the same method as in Example 37(1), the marked compound (7.44 mg) was obtained by replacing bis(2-heptyldecyl)4-hydroxyheptanediate (50 mg) with bis(2-heptyldecyl)4-hydroxyheptanediate and 1-methylpiperidinemethanol with 3-dimethylamino-1-propanol (7.90 mg). ESI-MS: 783.5 ([M+H]) ＋ ) １ H NMR (500MHz, CDCl ３ ) δ ppm 0.86 (t, J=6.72Hz, 12H) 1.25 (brs, 54H) 1.79-1.97 (m, 6H) 2.26 (s, 6H) 2.33-2.46 (m, 6H) 3.89-4.01 (m, 4H) 4.13-4.23 (m, 2H) 4.76 (brs, 1H)

[0306] [Example 42]

[0307] (1) Synthesis of 2-butyl-2-undecylmalonate diethyl: Add DMF (20 mL) to sodium hydride (60%, 494 mg), add a solution of diethyl butylmalonate (2.73 mL) in DMF (5 mL) at 0°C, and stir at 0°C for 30 minutes. Then add a solution of sodium iodide (1.85 g) and 1-bromodecane (3.29 mL) in DMF (5 mL), stir at 0°C for 30 minutes, and then stir at room temperature for 2 hours. Add saturated ammonium chloride aqueous solution (50 mL), ethyl acetate (100 mL), and water (50 mL) to the mixture, separate the phases, and extract the aqueous layer with ethyl acetate. Wash the organic layer with water and saturated brine, dry over sodium sulfate, filter, and concentrate under reduced pressure. The residue was purified by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (3.52 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81-0.93 (m, 6H) 1.05-1.18 (m, 4H) 1.20-1.36 (m, 24H) 1.79-1.89 (m, 4H) 4.09-4.22 (m, 4H)

[0308] (2) Synthesis of 2-butyl-2-undecylmalonic acid The compound obtained in Example 42 (1) (3.65 g) was mixed with ethanol (20 mL) and water, and then 1.94 mL of 50% aqueous sodium hydroxide solution was added at room temperature and the mixture was stirred at 100°C for 16 hours. The mixture was cooled to 0°C, acidified with 4N hydrochloric acid, and then extracted with MTBE. The organic layer was washed with 0.1N hydrochloric acid and saturated brine / 0.1N hydrochloric acid (10 / 1), dried over sodium sulfate, filtered, and concentrated under reduced pressure to obtain the labeled compound (2.70 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.87 (td, J=7.14, 4.30 Hz, 6H) 1.19-1.32 (m, 24H) 1.89-2.01 (m, 4H)

[0309] (3) Synthesis of 2-butyltridecanoic acid The compound obtained in Example 42 (2) (2.70 g) was added to ortho-xylene (30 mL) and stirred at 160°C for 5 hours. The mixture was concentrated under reduced pressure to obtain the labeled compound (2.39 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.82-0.93 (m, 6H) 1.20-1.33 (m, 22H) 1.39-1.51 (m, 2H) 1.55-1.66 (m, 2H) 2.25-2.37 (m, 1H)

[0310] (4) Synthesis of 2-butyltridecane-1-ol Using the same method as in Example 18(5), the compound obtained in Example 42(3) (2.39 g) was used instead of the compound obtained in Example 18(4) to obtain the marked compound (1.91 g). ¹H NMR (396 MHz, CDCl) ３ ) δ ppm 0.84-0.91 (m, 6H) 1.17 (brt, J=5.66Hz, 1H) 1.23-1.37 (m, 26H) 1.39-1.49 (m, 1H) 3.53 (t, J=5.44Hz, 2H)

[0311] (5) Synthesis of bis(2-butyltridecyl)4-oxoheptane dioate 150 mg of 4-oxoheptane dioic acid and 486 mg of the compound obtained in Example 42(4) were added with sulfuric acid (9.2 μL) and stirred at 90°C for 3 hours. The mixture was directly purified by silica gel column chromatography (n-heptane / ethyl acetate) to obtain the labeled compound (473 mg) as the crude product.

[0312] (6) Synthesis of bis(2-butyltridecyl)4-hydroxyheptanediote Using the same method as in Example 3(2), the marked compound (322 mg) was obtained using the compound obtained in Example 42(5) (473 mg) instead of the compound obtained in Example 3(1). ¹H NMR (396 MHz, CDCl) ３ ) δ ppm 0.84-0.91 (m, 12H) 1.22-1.30 (m, 52H) 1.60 (brs, 2H) 1.64-1.86 (m, 4H) 2.25 (d, J=5.44Hz, 1H) 2.40-2.52 (m, 4H) 3.61-3.69 (m, 1H) 3.97 (d, J=5.89Hz, 4H)

[0313] (7) Synthesis of bis(2-butyltridecyl) 4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E42)) Using the same method as in Example 3(3), the marked compound (10.5 mg) was obtained by using the compound obtained in Example 42(6) (12 mg) instead of the compound obtained in Example 3(2). ESI-MS: 800.3 ([M+Na] ＋ ) 1H NMR (396MHz, CDCl ３ ) δ ppm 0.83-0.92 (m, 12H) 1.22-1.29 (m, 52H) 1.52-1.65 (m, 4H) 1.69-2.04 (m, 10H) 2.19-2.37 (m, 6H) 2.74-2.87 (m, 2H) 3.95 (d, J=5.89Hz, 4H) 4.86-4.98 (m, 1H)

[0314] [Example 43]

[0315] (1) Synthesis of bis(2-butyltridecyl) 4-(2-(1-methylpiperidine-4-yl)acetoxy)heptanediate (compound (E43)) Using the same method as in Example 4(1), the marked compound (11.7 mg) was obtained by using the compound obtained in Example 42(6) (12 mg) instead of the compound obtained in Example 3(2). ESI-MS: 814.5 ([M+Na] ＋ ) １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81-0.92 (m, 12H) 1.23-1.31 (m, 52H) 1.35-1.47 (m, 2H) 1.53-1.62 (m, 2H) 1.67-1.98 (m, 8H) 1.99-2.15 (m, 2H) 2.23 (d, J = 7.25Hz, 2H) 2.28-2.36 (m, 6H) 2.86-2.99 (m, 2H) 3.96 (d, J = 5.89Hz, 4H) 4.89-4.98 (m, 1H)

[0316] [Example 44]

[0317] (1) Synthesis of 3-((tert-butyldimethylsilyl)oxy)-5-((2-hexyldecyl)oxy)-5-oxopentanoic acid 4-((tert-butyldimethylsilyl)oxy)dihydro-2H-pyran-2,6(3H)-dione (0.529 g) and 2-hexyldecane-1-ol (0.5 g) were added to toluene (5 ml) and heated under reflux for 16 hours. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the marked compound (144 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.03-0.14 (m, 6H) 0.85 (s, 15H) 1.21-1.35 (m, 24H) 1.58-1.66 (m, 1H) 2.49-2.71 (m, 4H) 3.90-4.07 (m, 2H) 4.49-4.60 (m, 1H) 8.25-12.22 (m, 1H)

[0318] (2) Synthesis of 1-decyl 5-(2-hexyldecyl)3-((tert-butyldimethylsilyl)oxy)pentanediote. The compound obtained in Example 44(1) (140 mg), decane-1-ol (68.3 mg), EDCI (83 mg), and DMAP (10.5 mg) were added to toluene (2 mL), and the mixture was concentrated under reduced pressure. Toluene (1 mL) was added to the residue, and the concentration of the mixture under reduced pressure was repeated twice. DIPEA (0.151 mL) and THF (3 mL) were added to the obtained residue, and the mixture was stirred at room temperature for 16 hours. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (cyclohexane / diethyl ether) to obtain the labeled compound (153 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.07 (s, 6H) 0.85 (s, 9H) 0.86-0.91 (m, 9H) 1.21-1.38 (m, 38H) 1.59 (s, 3H) 2.51-2.59 (m, 4H) 3.97 (dd, J=11.46, 5.78Hz, 2H) 4.05 (brd, J=12.47Hz, 2H) 4.50-4.59 (m, 1H)

[0319] (3) Synthesis of 1-decyl 5-(2-hexyldecyl) 3-hydroxypentane dioate The compound obtained in Example 44(2) (153 mg) was added to THF (5 mL), and TBAF (1 M, 0.732 mL) was added at 0°C. The mixture was stirred at room temperature for 2 hours. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (cyclohexane / diethyl ether) to obtain the labeled compound (110 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.82-0.92 (m, 9H) 1.17-1.39 (m, 38H) 1.59-1.69 (m, 3H) 2.52-2.58 (m, 4H) 3.40-3.44 (m, 1H) 4.02 (d, J=5.87Hz, 2H) 4.08-4.14 (m, 2H) 4.41-4.49 (m, 1H)

[0320] (4) Synthesis of 1-decyl 5-(2-hexyldecyl)3-((1-methylpiperidine-4-carbonyl)oxy)pentanediote (compound (E44)) The compound obtained in Example 44(3) (20 mg), 1-methylpiperidine-4-carboxylic acid (11.2 mg), EDCI (22.4 mg), and DMAP (2.4 mg) were added to toluene, and the mixture was concentrated under reduced pressure. Toluene (1 mL) was added to the residue, and the concentration of the mixture under reduced pressure was repeated twice. DIPEA (0.034 mL) and DMF (1 mL) were added to the obtained residue, and the mixture was stirred at room temperature for 16 hours. Water (10 mL), MTBE (10 mL), and saturated saline (1 mL) were added. The organic layer was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (methanol / MTBE) to obtain the marked compound (8 mg). ESI-MS: 638.9 ([M+H]) ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.85-0.93 (m, 9H) 1.26 (brs, 36H) 1.57-1.66 (m, 5H) 1.69-1.79 (m, 2H) 1.82-1.89 (m, 2H) 1.91-2.01 (m, 2H) 2.17-2.24 (m, 1H) 2.24-2.27 (m, 3H) 2.66-2.74 (m, 4H) 2.74-2.81 (m, 2H) 3.94-4.01 (m, 2H) 4.02-4.10 (m, 2H) 5.45-5.56 (m, 1H)

[0321] [Example 45]

[0322] (1) Synthesis of 3-((tert-butyldimethylsilyl)oxy)-5-((2-octyldodecyl)oxy)-5-oxopentanoic acid: Using the same method as in Example 44(1), the marked compound (140 mg) was obtained by using 2-octyldodecane-1-ol (0.5 g) instead of 2-hexyldecane-1-ol. １ H NMR (600MHz, CDCl ３) δ ppm 0.08 (d, J=3.12Hz, 6H) 0.80-0.91 (m, 15H) 1.25-1.32 (m, 28H) 2.57 (d, J=6.24Hz, 4H) 3.98 (brd, J=1.65Hz, 2H) 4.45-4.64 (m, 1H)

[0323] (2) Synthesis of 1-decyl 5-(2-octyldodecyl)3-((tert-butyldimethylsilyl)oxy)pentanediote: Using the same method as in Example 44(2), the compound obtained in Example 45(1) (157 mg) was used instead of the compound obtained in Example 44(1) to obtain the labeled compound (128 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.07 (s, 6H) 0.84 (s, 9H) 0.88 (t, J=6.97Hz, 9H) 1.21-1.34 (m, 46H) 1.57-1.68 (m, 3H) 2.49-2.61 (m, 4H) 3.86-4.15 (m, 4H) 4.49-4.61 (m, 1H)

[0324] (3) Synthesis of 1-decyl 5-(2-octyldodecyl) 3-hydroxypentanediote: Using the same method as in Example 44(3), the compound obtained in Example 45(2) (128 mg) was used instead of the compound obtained in Example 44(2) to obtain the labeled compound (93 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=7.06Hz, 9H) 1.19-1.39 (m, 46H) 1.56-1.68 (m, 3H) 2.52-2.58 (m, 4H) 3.38-3.44 (m, 1H) 3.99-4.05 (m, 2H) 4.08-4.14 (m, 2H) 4.39-4.51 (m, 1H)

[0325] (4) Synthesis of 1-decyl 5-(2-octyldodecyl)3-((1-methylpiperidine-4-carbonyl)oxy)pentanediote (compound (E45)) Using the same method as in Example 44(4), the compound obtained in Example 45(3) (20 mg) was used instead of the compound obtained in Example 44(3) to obtain the marked compound (7.4 mg). ESI-MS: 695.0 ([M+H]) ＋ )１ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=6.97Hz, 9H) 1.23-1.29 (m, 44H) 1.61 (brs, 7H) 1.82-1.89 (m, 2H) 1.93-2.03 (m, 2H) 2.25 (s, 4H) 2.66-2.74 (m, 4H) 2.74-2.83 (m, 2H) 3.98 (s, 2H) 4.03-4.10 (m, 2H) 5.44-5.57 (m, 1H)

[0326] [Example 46]

[0327] (1) Synthesis of ethyl 2-(2,6-dioxocyclohexyl) acetate: 1.12 g of cyclohexane-1,3-dione was mixed with 2.0 mL of 5N sodium hydroxide aqueous solution, and then 2.23 mL of ethyl bromo was added at 0°C. The mixture was heated to 90°C and stirred overnight. The aqueous layer was separated and extracted by DCM, and the combined organic layer was washed with saturated saline solution, dried over sodium sulfate, and then purified by silica gel chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (280 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 1.21-1.36 (m, 3H) 1.92-1.98 (m, 2H) 2.40-2.50 (m, 4H) 2.57-2.80 (m, 3H) 4.19 (d, J=7.15Hz, 2H)

[0328] (2) Synthesis of 4-oxooctanedioic acid: 280 mg of the compound obtained in Example 46 (1) was added to 8 mL of 10% hydrochloric acid and heated under reflux for 17 hours. The mixture was concentrated and then purified by reverse-phase silica gel chromatography (C18 column, water / acetonitrile / formic acid) to obtain the labeled compound (114 mg). １ H NMR (600MHz, DMSO-d6) δ ppm 1.59-1.73 (m, 2H) 2.09-2.27 (m, 2H) 2.36-2.42 (m, 2H) 2.44-2.47 (m, 2H) 2.60-2.64 (m, 2H) 11.84-12.19 (m, 2H)

[0329] (3) Synthesis of bis(2-hexyldecyl) 4-oxooctanedioate The compound obtained in Example 46(2) (114 mg) and 2-hexyl-1-decanol (425 μL) were mixed with toluene (2.8 mL), sulfuric acid (16.1 μL), and molecular sieves 4A (100 mg), and heated at 90°C for 3 days. The mixture was concentrated and purified by silica gel chromatography (cyclohexane / ethyl acetate) to obtain the crude product (78 mg).

[0330] (4) Synthesis of bis(2-hexyldecyl) 4-hydroxyoctanedioate The compound obtained in Example 46(3) (33.8 mg) was added to methanol (0.2 mL) and diethyl ether (0.8 mL), and sodium borohydride (2.11 mg) was added at -20°C and stirred for 1 hour. A saturated aqueous solution of ammonium chloride (1 mL) was added to the mixture and stirred at room temperature for 20 minutes, then concentrated, and MTBE (5 mL) and water (5 mL) were added. The aqueous layer was separated and extracted with MTBE, and the combined organic layer was dried over sodium sulfate and concentrated, and purified by silica gel chromatography (cyclohexane / diethyl ether) to obtain the labeled compound (30 mg).

[0331] (5) Synthesis of bis(2-hexyldecyl) 4-((1-methylpiperidine-4-carbonyl)oxy)octane dioate (compound (E46)) The compound obtained in Example 46(4) (30 mg), 1-methylpiperidine-4-carboxylic acid (16.8 mg), and DMAP (3 mg) were added to DMF (0.5 mL), and EDCI (21.6 mg) was added and the mixture was stirred for 18 hours. The mixture was purified by silica gel chromatography (MTBE / methanol) to obtain the labeled compound (23.4 mg). ESI-MS: 765.3 ([M+H]) ＋ ) １ H NMR (600MHz, CDCl ３) δ ppm 0.88 (t, J=7.06Hz, 12H) 1.22-1.33 (m, 48H) 1.56-1.64 (m, 7H) 1.73-1.82 (m, 2H) 1.82-2.02 (m, 6H) 2.26 (s, 3H) 2.30 (brd, J=1.47Hz, 4H) 2.73-2.86 (m, 2H) 3.96 (d, J=5.87Hz, 4H) 4.89-4.96 (m, 1H)

[0332] [Example 47]

[0333] (1) Synthesis of ((2,2-bis(heptyloxy)ethoxy)methyl)benzene 2-(benzyloxy)acetaldehyde (203 mg) and PPTS (17.0 mg) were added to heptan-1-ol (573 μL) and stirred at 105°C for 2 hours and 10 minutes. The mixture was purified by silica gel chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (274 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.84-0.92 (m, 6H) 1.23-1.37 (m, 16H) 1.54-1.63 (m, 4H) 3.45-3.50 (m, 2H) 3.52 (d, J=5.32Hz, 2H) 3.57-3.65 (m, 2H) 4.58 (s, 2H) 4.63-4.67 (m, 1H) 7.26-7.30 (m, 1H) 7.30-7.38 (m, 4H)

[0334] (2) Synthesis of 2,2-bis(heptyloxy)ethane-1-ol The compound obtained in Example 47(1) (271 mg) was mixed with industrial denatured alcohol (3 mL) and ethyl acetate (3 mL), and then 10% palladium carbon (50% wet, 158 mg) was added and the mixture was stirred under a hydrogen atmosphere for 5 hours. The reaction mixture was filtered through Celite, washed with 35 mL of industrial denatured alcohol, and then concentrated. The resulting mixture was purified by silica gel chromatography (cyclohexane / diethyl ether) to obtain the labeled compound (161 mg). １ H NMR (600MHz, CDCl ３) δ ppm 0.86-0.92 (m, 6H) 1.24-1.38 (m, 16H) 1.56-1.62 (m, 4H) 1.73 (t, J=6.51Hz, 1H) 3.46-3.53 (m, 2H) 3.57 (dd, J=6.42, 5.50Hz, 2H) 3.67 (dt, J=9.31, 6.72Hz, 2H) 4.53 (t, J=5.41Hz, 1H)

[0335] (3) Synthesis of bis(2,2-bis(heptyloxy)ethyl) 4-((1-methylpiperidine-4-carbonyl)oxy)heptanediate (compound (E47)) The marked compound (25.6 mg) was obtained using the same method as in Example 9-1 (5), but instead of the compound obtained in Example 9-2 (4), the compound obtained in Example 47 (2) (33.9 mg) was used. ESI-MS: 815.6 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.85-0.92 (m, 12H) 1.24-1.36 (m, 32H) 1.56-1.60 (m, 8H) 1.72-1.80 (m, 2H) 1.83-1.99 (m, 8H) 2.21-2.28 (m, 4H) 2.35 (ddd, J=8.71, 6.88, 3.30Hz, 4H) 2.81 (brd, J=11.37Hz, 2H) 3.47 (dt, J=9.26, 6.74Hz, 4H) 3.61 (dt, J=9.17, 6.79Hz, 4H) 4.09 (d, J=5.50Hz, 4H) 4.64 (t, J=5.41Hz, 2H) 4.94 (tt, J=8.21, 4.26Hz, 1H)

[0336] [Example 48]

[0337] (1) Synthesis of ((2,2-bis(octyloxy)ethoxy)methyl)benzene: The same method as in Example 47(1) was used, but octan-1-ol (661 μL) was used instead of heptan-1-ol to obtain the marked compound (324 mg). １ H NMR (600MHz, CDCl ３) δ ppm 0.85-0.91 (m, 6H) 1.23-1.37 (m, 20H) 1.55-1.61 (m, 4H) 3.45-3.50 (m, 2H) 3.52 (d, J=5.14Hz, 2H) 3.57-3.64 (m, 2H) 4.58 (s, 2H) 4.63-4.67 (m, 1H) 7.26-7.37 (m, 5H)

[0338] (2) Synthesis of 2,2-bis(octyloxy)ethane-1-ol Using the same method as in Example 47(2), the compound obtained in Example 48(1) (321 mg) was used instead of the compound obtained in Example 47(1) to obtain the marked compound (183 mg). ¹H NMR (600 MHz, CDCl) ３ ) δ ppm 0.86-0.91 (m, 6H) 1.24-1.38 (m, 20H) 1.56-1.62 (m, 4H) 1.73 (t, J=6.51Hz, 1H) 3.49 (dt, J=9.31, 6.72Hz, 2H) 3.57 (dd, J=6.51, 5.41Hz, 2H) 3.67 (dt, J=9.35, 6.69Hz, 2H) 4.53 (t, J=5.41Hz, 1H)

[0339] (3) Synthesis of bis(2,2-bis(octyloxy)ethyl) 4-((1-methylpiperidine-4-carbonyl)oxy)heptanediate (compound (E48)) The marked compound (25.6 mg) was obtained using the same method as in Example 47(3), but with the compound obtained in Example 48(2) (36.4 mg) instead of the compound obtained in Example 47(2). ESI-MS: 871.2 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３) δ ppm 0.86-0.91 (m, 12H) 1.23-1.36 (m, 40H) 1.56-1.60 (m, 8H) 1.72-1.80 (m, 2H) 1.83-2.00 (m, 8H) 2.20-2.28 (m, 4H) 2.30-2.39 (m, 4H) 2.81 (brd, J=11.37Hz, 2H) 3.47 (dt, J=9.26, 6.65Hz, 4H) 3.61 (dt, J=9.26, 6.65 Hz, 4H) 4.09 (d, J=5.50Hz, 4H) 4.64 (t, J=5.41Hz, 2H) 4.94 (tt, J=8.18, 4.29Hz, 1H)

[0340] [Example 49]

[0341] (1) Synthesis of ((2,2-bis(nonyloxy)ethoxy)methyl)benzene: The marked compound (336 mg) was obtained using the same method as in Example 47(1), but with nonan-1-ol (710 μL) instead of heptan-1-ol. １ H NMR (600MHz, CDCl ３ ) δ ppm 0.85-0.91 (m, 6H) 1.23-1.37 (m, 24H) 1.54-1.63 (m, 4H) 3.48 (dt, J=9.31, 6.72Hz, 2H) 3.52 (d, J=5.32Hz, 2H) 3.61 (dt, J=9.31, 6.72Hz, 2H) 4.58 (s, 2H) 4.65 (t, J=5.23Hz, 1H) 7.26-7.30 (m, 1H) 7.31-7.37 (m, 4H)

[0342] (2) Synthesis of 2,2-bis(nonyloxy)ethane-1-ol The labeled compound (201 mg) was obtained using the same method as in Example 47(2), but instead of the compound obtained in Example 47(1), the compound obtained in Example 49(1) (334 mg) was used. １ H NMR (600MHz, CDCl ３) δ ppm 0.86-0.91 (m, 6H) 1.23-1.37 (m, 24H) 1.56-1.62 (m, 4H) 1.73 (t, J=6.51Hz, 1H) 3.49 (dt, J=9.35, 6.69Hz, 2H) 3.57 (dd, J=6.60, 5.50Hz, 2H) 3.67 (dt, J=9.26, 6.74Hz, 2H) 4.53 (t, J=5.41Hz, 1H)

[0343] (3) Synthesis of bis(2,2-bis(nonyloxy)ethyl) 4-((1-methylpiperidine-4-carbonyl)oxy)heptanediate (compound (E49)) The marked compound (25.6 mg) was obtained using the same method as in Example 47(3), but with the compound obtained in Example 48(2) (36.4 mg) instead of the compound obtained in Example 47(2). ESI-MS: 927.0 ([M+H]) ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.86-0.91 (m, 12H) 1.21-1.36 (m, 48H) 1.55-1.60 (m, 8H) 1.71-1.80 (m, 2H) 1.83-2.00 (m, 8H) 2.20-2.28 (m, 4H) 2.35 (ddd, J=8.67, 6.92, 3.12Hz, 4H) 2.80 (brd, J=11.19 Hz, 2H) 3.44-3.51 (m, 4H) 3.61 dt, J=9.17, 6.79Hz, 4H) 4.09 (d, J=5.32Hz, 4H) 4.64 (t, J=5.41Hz, 2H) 4.94 (tt, J=8.18, 4.20Hz, 1H)

[0344] [Example 50]

[0345] (1) Synthesis of dibenzyl 4-(2-(1-methylpiperidine-4-yl)acetoxy)heptane diatomate: Using the same method as in Example 9-1(3), the compound obtained in Example 9-1(2) (200 mg) and 2-(1-methylpiperidine-4-yl)acetic acid (221 mg) instead of piperidine-4-carboxylic acid hydrochloride were used to obtain the labeled compound (209 mg). １ H NMR (600MHz, CDCl ３) δ ppm 1.17-1.37 (m, 2H) 1.62-1.76 (m, 3H) 1.81-2.02 (m, 6H) 2.17 (d, J=7.15Hz, 2H) 2.25 (s, 3H) 2.37 (brd, J=0.73Hz, 4H) 2.70-2.87 (m, 2H) 4.88-5.00 (m, 1H) 5.11 (s, 4H) 7.30-7.42 (m, 10H)

[0346] (2) Synthesis of 4-(2-(1-methylpiperidine-4-yl)acetoxy)heptanedioc acid Using the same method as in Example 9-1(4), the compound obtained in Example 50(1) (204 mg) was used instead of the compound obtained in Example 9-1(3) to obtain the labeled compound (119 mg). ¹H NMR (600 MHz, METHANOL-d4) δ ppm 1.54-1.68 (m, 2H) 1.81-2.12 (m, 7H) 2.24-2.32 (m, 4H) 2.38 (s, 2H) 2.82 (s, 3H) 2.88-3.06 (m, 2H) 3.39-3.52 (m, 2H) 4.97-5.05 (m, 1H)

[0347] (3) Synthesis of bis(3-pentylundecyl)4-(2-(1-methylpiperidine-4-yl)acetoxy)heptanediote (compound (E50)) Using the same method as in Example 9-1(5), the compound obtained in Example 9-1(4) was replaced with the compound obtained in Example 50(2) (20 mg), and (S)-2-hexyldecane-1-ol was replaced with 3-pentylundecane-1-ol (38.4 mg) to obtain the marked compound (24 mg). ESI-MS: 765.0 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.15, 1.65Hz, 12H) 1.22-1.41 (m, 46H) 1.52-1.64 (m, 6H) 1.67-1.79 (m, 3H) 1.81-2.00 (m, 6H) 2.21 (d, J = 6.97Hz, 2H) 2.26 (s, 3H) 2.31 (ddd, J = 8.71, 6.88, 3.85Hz, 4H) 2.69-2.90 (m, 2H) 4.08 (t, J = 7.15Hz, 4H) 4.89-4.99 (m, 1H)

[0348] [Example 51]

[0349] (1) Synthesis of (Z)-octo-3-en-1-ylmethanesulfonate Using the same method as in Example 19(1), (Z)-octo-3-en-1-ol (2.0 g) was used instead of (Z)-octo-5-en-1-ol to obtain the marked compound (3.23 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.87-0.94 (m, 3H) 1.28-1.39 (m, 4H) 2.05 (q, J=6.91Hz, 2H) 2.45-2.57 (m, 2H) 3.00 (s, 3H) 4.21 (t, J=6.97Hz, 2H) 5.30-5.39 (m, 1H) 5.53-5.63 (m, 1H)

[0350] (2) Synthesis of (Z)-1-bromoocto-3-ene Using the same method as in Example 19(2), the compound obtained in Example 51(1) (3.23 g) was used instead of the compound obtained in Example 19(1) to obtain the labeled compound (2.64 g). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.86-0.94 (m, 3H) 1.29-1.38 (m, 4H) 1.99-2.10 (m, 2H) 2.58-2.66 (m, 2H) 3.36 (t, J=7.15Hz, 2H) 5.32-5.41 (m, 1H) 5.47-5.59 (m, 1H)

[0351] (3) Synthesis of 2,2-di((Z)-octo-3-en-1-yl)dimethyl malonate Dimethyl malonate (504 mg) was mixed with THF (10 mL) and sodium hydride (60%, 160 mg) was added at 3°C. After stirring at room temperature for 30 minutes, a solution of the compound obtained in Example 51(2) (802 mg) in THF (1.5 mL) was added and the mixture was stirred at room temperature for 44 hours. The mixture was placed in an ice bath and sodium hydride (60%, 160 mg) was added, followed by a solution of the compound obtained in Example 51(2) (802 mg) in THF (1.5 mL) and potassium iodide (127 mg), and the mixture was stirred at room temperature for 23 hours. Sodium hydride (60%, 81 mg) was added to the mixture and the mixture was stirred for 3 days. Water (50 mL) and ethyl acetate (100 mL) were added to the mixture. The organic layer was washed with saturated brine (30 mL), dried over sodium sulfate, filtered to remove the solid, and dried under reduced pressure. The residue was purified by silica gel column chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (126 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.85-0.93 (m, 6H) 1.26-1.35 (m, 8H) 1.88-2.03 (m, 12H) 3.69-3.75 (m, 6H) 5.28-5.42 (m, 4H)

[0352] (4) Synthesis of methyl (Z)-2-((Z)-octo-3-en-1-yl)dec-5-enoate: Using the same method as in Example 19(4), the compound obtained in Example 51(3) (126 mg) was used instead of the compound obtained in Example 19(3) to obtain the labeled compound (44 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.86-0.94 (m, 6H) 1.25-1.37 (m, 8H) 1.46-1.53 ​​(m, 2H) 1.63-1.74 (m, 2H) 1.95-2.07 (m, 8H) 2.35-2.43 (m, 1H) 3.67 (s, 3H) 5.28-5.34 (m, 2H) 5.34-5.41 (m, 2H)

[0353] (5) Synthesis of (Z)-2-((Z)-octo-3-en-1-yl)dec-5-en-1-ol: Using the same method as in Example 19(5), the compound obtained in Example 51(4) (41.8 mg) was used instead of the compound obtained in Example 19(4) to obtain the labeled compound (34.1 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.87-0.94 (m, 6H) 1.15-1.19 (m, 1H) 1.30-1.46 (m, 12H) 1.49-1.56 (m, 1H) 2.00-2.11 (m, 8H) 3.57 (t, J=5.50Hz, 2H) 5.31-5.42 (m, 4H)

[0354] (6) Synthesis of bis((Z)-2-((Z)-octo-3-en-1-yl)dec-5-en-1-yl)4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E51)) Using the same method as in Example 19(6), but instead of the compound obtained in Example 19(5), the compound obtained in Example 51(5) (33.7 mg) was used to obtain the marked compound (26.94 mg). ESI-MS: 798.9 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.85-0.94 (m, 12H) 1.28-1.41 (m, 24H) 1.64-1.71 (m, 2H) 1.72-1.81 (m, 2H) 1.82-2.07 (m, 24H) 2.22-2.28 (m, 4H) 2.28-2.36 (m, 4H) 2.80 (brd, J=11.55 Hz, 2H) 4.01 (d, J=5.69Hz, 4H) 4.95 (tt, J=8.21, 4.26Hz, 1H) 5.29-5.40 (m, 8H)

[0355] [Example 52]

[0356] (1) Synthesis of oxocan-2,5,8-trione 1.7 g of 4-oxoheptane dioic acid was mixed with acetyl chloride (20 mL). The mixture was heated under reflux for 16 hours. After the mixture cooled to room temperature, it was concentrated under reduced pressure. 30 mL of xylene was added and the mixture was concentrated again under reduced pressure to obtain the marked compound (1.5 g).１ H NMR (600MHz, CDCl ３ ) δ ppm 2.35-2.47 (m, 2H) 2.54-2.68 (m, 4H) 2.81-2.94 (m, 2H)

[0357] (2) Synthesis of 7-(decyloxy)-4,7-dioxoheptanoic acid The compound obtained in Example 52 (1) (227 mg) and decane-1-ol (177 mg) were mixed with pyridine (90 μL). The mixture was heated under reflux for 16 hours and then concentrated under reduced pressure. Ethyl acetate (10 mL) and hydrochloric acid (1 N, 10 mL) were added, and the organic layer was separated. The obtained organic layer was washed twice with water (10 mL) and then with saturated brine (10 mL). The organic layer was concentrated under reduced pressure and purified by silica gel chromatography (ethyl acetate / cyclohexane) to obtain the labeled compound (143 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (s, 3H) 1.26 (brs, 15H) 1.58-1.64 (m, 2H) 2.57-2.63 (m, 2H) 2.64-2.69 (m, 2H) 2.74-2.81 (m, 4H) 4.00-4.13 (m, 2H)

[0358] (3) Synthesis of 1-decyl 7-(4-hexyldodecyl) 4-oxoheptanediote 83 mg of 4-hexyldodecane-1-ol was added with toluene (1 mL) and concentrated under reduced pressure. To the resulting residue, the compound obtained in Example 52 (2) (114 mg), EDCI (146 mg), DMAP (62.2 mg), and DMF (1 mL) were added. The mixture was stirred for 16 hours, and then MTBE (20 mL), water (10 mL), and saturated brine (1 mL) were added. After liquid-liquid extraction, the aqueous layer was extracted twice with MTBE (10 mL). The combined organic layers were washed with saturated brine and dried over sodium sulfate. The resulting mixture was concentrated under reduced pressure and purified by silica gel chromatography (cyclohexane / ethyl acetate) to obtain the labeled compound (120 mg). １ H NMR (600MHz, CDCl ３) δ ppm 0.88 (t, J=6.97Hz, 9H) 1.14-1.39 (m, 41H) 1.50-1.67 (m, 4H) 2.58-2.63 (m, 4H) 2.77 (s, 4H) 4.02-4.07 (m, 4H)

[0359] (4) Synthesis of 1-decyl 7-(4-hexyldodecyl) 4-hydroxyheptanediote: Using the same method as in Example 46(4), the compound obtained in Example 52(3) (120 mg) was used instead of the compound obtained in Example 46(3) to obtain the labeled compound (43 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.76-0.97 (m, 9H) 1.15-1.39 (m, 40H) 1.61 (brd, J=7.34Hz, 4H) 1.74 (dd, J=8.53, 7.06Hz, 2H) 1.79-1.87 (m, 2H) 2.28-2.35 (m, 1H) 2.39-2.53 (m, 4H) 3.61-3.70 (m, 1H) 4.06 (brd, J=9.90Hz, 4H)

[0360] (5) Synthesis of 1-decyl 7-(4-hexyldodecyl) 4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E52)) Using the same method as in Example 46(5), the compound obtained in Example 52(4) (43 mg) was used instead of the compound obtained in Example 46(4) to obtain the marked compound (22 mg). ESI-MS: 695.0 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.83-0.94 (m, 9H) 1.14-1.41 (m, 40H) 1.53-1.66 (m, 4H) 1.69-1.81 (m, 3H) 1.83-2.02 (m, 8H) 2.19-2.40 (m, 8H) 2.74-2.88 (m, 2H) 3.98-4.12 (m, 4H) 4.88-5.00 (m, 1H)

[0361] [Example 53]

[0362] (1) Synthesis of bis(2-hexylnonyl) 4-(2-(1-methylpiperidine-4-yl)acetoxy)heptanediote (compound (E53)) Using the same method as in Example 4(1), the marked compound (13.7 mg) was obtained by using the compound obtained in Example 32(6) (12 mg) instead of the compound obtained in Example 3(2). ESI-MS: 736.7 ([M+H] ＋ ) １ H NMR (396MHz, CDCl ３ ) δ ppm 0.80-0.93 (m, 12H) 1.19-1.35 (m, 46H) 1.40 (brd, J=9.51Hz, 2H) 1.74 (brd, J=12.69Hz, 2H) 1.78-1.95 (m, 5H) 1.99-2.13 (m, 2H) 2.23 (d, J = 6.80Hz, 2H) 2.26-2.41 (m, 7H) 2.86-3.03 (m, 2H) 3.95 (d, J = 5.89Hz, 4H) 4.83-4.99 (m, 1H)

[0363] [Example 54]

[0364] (1) Synthesis of 2-nonylmalonate ditert-butyl: Using the same method as in Example 18(1), the labeled compound (5.39 g) was obtained by using 1-nonane iodide (4.65 mL) instead of 1-bromooctane. １ H NMR (396MHz, CDCl ３ ) δ ppm 0.82-0.93 (m, 3H) 1.15-1.33 (m, 14H) 1.44 (s, 18H) 1.77 (brd, J=7.25Hz, 2H) 3.09 (t, J=7.70Hz, 1H)

[0365] (2) Synthesis of 2-butyl-2-nonylmalonate di-tert-butyl Using the same method as in Example 18(2), the compound obtained in Example 54(1) (2.5 g) was used instead of the compound obtained in Example 18(1) to obtain the labeled compound (2.72 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.81-0.92 (m, 6H) 1.04-1.16 (m, 4H) 1.26-1.35 (m, 4H) 1.42 (s, 18H) 1.70-1.84 (m, 4H)

[0366] (3) Synthesis of 2-butyl-2-nonylmalonic acid Using the same method as in Example 18(3), the compound obtained in Example 54(2) (2.72 g) was used instead of the compound obtained in Example 18(2) to obtain the labeled compound as a crude product (2.56 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.87 (q, J=6.80Hz, 6H) 1.23 (brs, 20H) 1.86-2.02 (m, 4H)

[0367] (4) Synthesis of 2-butylundecanoic acid Using the same method as in Example 18(4), the compound obtained in Example 54(3) (2.56 g) was used instead of the compound obtained in Example 18(3) to obtain the labeled compound (1.71 g). １ H NMR (396MHz, CDCl ３ ) δ ppm 0.87 (brd, J=6.80Hz, 6H) 1.20-1.35 (m, 18H) 1.45-1.53 ​​(m, 2H) 1.54-1.76 (m, 2H) 2.28-2.41 (m, 1H)

[0368] (5) Synthesis of 2-butylundecane-1-ol Using the same method as in Example 18(5), the compound obtained in Example 54(4) (1.71 g) was used instead of the compound obtained in Example 18(4) to obtain the labeled compound (1.32 g). １ H NMR (500MHz, CDCl ３ ) δ ppm 0.88 (q, J=7.26Hz, 6H) 1.25 (brs, 23H) 1.39-1.47 (m, 1H) 3.53 (brt, J=4.58Hz, 2H)

[0369] (6) Synthesis of bis(2-butylundecyl)4-oxoheptanediote: Using the same method as in Example 3(1), the compound obtained in Example 54(5) (525 mg) was used instead of 3-hexylundecanool to obtain the labeled compound (470 mg). ESI-MS: 595.2 ([M+H]) ＋ )

[0370] (7) Synthesis of bis(2-butylundecyl)4-hydroxyheptanediote Using the same method as in Example 3(2), the compound obtained in Example 54(6) (470 mg) was used instead of the compound obtained in Example 3(1) to obtain the marked compound (100 mg). ESI-MS: 597.3 ([M+H] ＋ )

[0371] (8) Synthesis of bis(2-butylundecyl)4-(2-(1-methylpiperidine-4-yl)acetoxy)heptanediote (compound (E54)) Using the same method as in Example 5(3), the compound obtained in Example 54(7) (20 mg) was used instead of the compound obtained in Example 5(2) to obtain the marked compound (2.36 mg). ESI-MS: 736.5 ([M+H] ＋ ) １ H NMR (500MHz, CDCl ３ ) δ ppm 0.83-0.91 (m, 12H) 1.25 (s, 48H) 1.69-1.76 (m, 3H) 1.79-1.96 (m, 5H) 1.98-2.10 (m, 2H) 2.16-2.24 (m, 2H) 2.31 (brs, 6H) 2.84-2.97 (m, 2H) 3.96 (d, J=5.73Hz, 4H) 4.89-4.99 (m, 1H)

[0372] [Example 55]

[0373] (1) Synthesis of bis(2-hexyldecyl)4-((((1-methylpiperidine-4-yl)oxy)carbonyl)oxy)heptanediote (compound (E55)) was performed using the same method as in Example 37(1), but with 4-hydroxy-1-methylpiperidine (18.43 mg) instead of (1-methylpiperidine-4-yl)methanol to obtain the marked compound (18.58 mg). ESI-MS: 766.4 ([M+H] ＋ ) １ H NMR (500MHz, CDCl ３) δ ppm 0.87 (t, J=6.72Hz, 12H) 1.14-1.36 (m, 48H) 1.55-1.65 (m, 2H) 1.75-1.85 (m, 3H) 1.87-2.05 (m, 6H) 2.31 (s, 4H) 2.34-2.44 (m, 4H) 2.63-2.76 (m, 2H) 3.96 (d, J=5.50Hz, 4H) 4.59-4.68 (m, 1H) 4.77 (s, 1H)

[0374] [Example 56]

[0375] (1) Synthesis of 2-pentyldodecanal: The compound obtained in Example 23(4) (90 mg) was added to DCM (5 mL), and then DMP (186 mg) was added at 0°C and the mixture was stirred for 3 hours. Saturated sodium thiosulfate aqueous solution (2 mL) and saturated sodium bicarbonate aqueous solution (2 mL) were added and the mixture was stirred for 10 minutes. The mixture was diluted with DCM (20 mL), filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (diethyl ether / cyclohexane) to obtain the labeled compound (50 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=7.06Hz, 6H) 1.19-1.37 (m, 22H) 1.39-1.50 (m, 2H) 1.54-1.67 (m, 2H) 2.17-2.27 (m, 1H) 9.52-9.58 (m, 1H)

[0376] (2) Synthesis of ethyl (E)-4-pentyltetradec-2-enoate: Using the same method as in Example 21(1), the compound obtained in Example 56(1) (60 mg) was used instead of heptanal to obtain the labeled compound (50 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.87 (td, J=7.06, 5.32Hz, 6H) 1.15-1.35 (m, 26H) 1.43 (s, 3H) 2.07-2.17 (m, 1H) 4.19 (q, J=7.15Hz, 2H) 5.72-5.80 (m, 1H) 6.69-6.78 (m, 1H)

[0377] (3) Synthesis of ethyl 4-pentyltetradecanoate The compound obtained in Example 56 (2) (50 mg) and palladium carbon (32.8 mg) were added to ethyl acetate (5 mL) and stirred under a hydrogen atmosphere for 16 hours. After replacing the flask with nitrogen, the mixture was filtered. The filtrate was concentrated under reduced pressure to obtain the labeled compound (44 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.85-0.91 (m, 6H) 1.26 (brd, J=3.48Hz, 30H) 1.52-1.62 (m, 2H) 2.22-2.31 (m, 2H) 4.12 (q, J=7.15Hz, 2H)

[0378] (4) Synthesis of 4-pentyltetradecane-1-ol Using the same method as in Example 21(3), the compound obtained in Example 56(3) (44 mg) was used instead of the compound obtained in Example 21(2) to obtain the labeled compound (30 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.85-0.93 (m, 6H) 1.26 (s, 30H) 1.49-1.59 (m, 2H) 3.57-3.67 (m, 2H)

[0379] (5) Synthesis of bis(4-pentyltetradecyl) 4-((1-methylpiperidine-4-carbonyl)oxy)heptanediote (compound (E56)) Using the same method as in Example 9-1 (5), the compound obtained in Example 56 (4) (30.2 mg) was used instead of the compound obtained in Example 9-2 (4) to obtain the marked compound (6.3 mg). ESI-MS: 835.0 ([M+H] ＋ ) １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (td, J=7.11, 2.29Hz, 12H) 1.11-1.40 (m, 58H) 1.53-1.62 (m, 5H) 1.73-2.04 (m, 9H) 2.20-2.36 (m, 8H) 2.74-2.89 (m, 2H) 4.03 (s, 4H) 4.90-4.99 (m, 1H)

[0380] [Example 57]

[0381] (1) Synthesis of ((4,4-bis(octyloxy)butoxy)methyl)benzene: Using the same method as in Example 47(1), 4-(benzyloxy)butanal (200 mg) was used instead of 2-(benzyloxy)acetaldehyde, and octan-1-ol (530 μL) was used instead of heptan-1-ol to obtain the marked compound (283 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.84-0.91 (m, 6H) 1.23-1.36 (m, 20H) 1.52-1.60 (m, 4H) 1.64-1.74 (m, 4H) 3.35-3.43 (m, 2H) 3.46-3.53 (m, 2H) 3.56 (dt, J=9.35, 6.69Hz, 2H) 4.44-4.49 (m, 1H) 4.50 (s, 2H) 7.26-7.30 (m, 1H) 7.31-7.35 (m, 4H)

[0382] (2) Synthesis of 4,4-bis(octyloxy)butan-1-ol Using the same method as in Example 47(2), the compound obtained in Example 57(1) (281 mg) was used instead of the compound obtained in Example 47(1) to obtain the labeled compound (168 mg). １ H NMR (600MHz, CDCl ３ ) δ ppm 0.88 (t, J=6.97Hz, 6H) 1.23-1.37 (m, 20H) 1.55-1.61 (m, 4H) 1.63-1.69 (m, 2H) 1.70-1.76 (m, 2H) 1.93 (t, J=5.69Hz, 1H) 3.42 (dt, J=9.31, 6.72Hz, 2H) 3.54-3.61 (m, 2H) 3.62-3.69 (m, 2H) 4.50 (t, J=5.41Hz, 1H)

[0383] (3) Synthesis of bis(4,4-bis(octyloxy)butyl) 4-((1-methylpiperidine-4-carbonyl)oxy)heptanediate (compound (E57)) The marked compound (28.1 mg) was obtained using the same method as in Example 47(3), but with the compound obtained in Example 57(2) (40.8 mg) instead of the compound obtained in Example 47(2). ESI-MS: 927.0 ([M+H]) ＋ ) １ H NMR (600MHz, CDCl３ ) δ ppm 0.84-0.93 (m, 12H) 1.23-1.37 (m, 40H) 1.51-1.60 (m, 8H) 1.63-1.72 (m, 8H) 1.72-1.80 (m, 2H) 1.81-2.01 (m, 8H) 2.22-2.28 (m, 4H) 2.31 (ddd, J=8.76, 6.92, 3.21Hz, 4H) 2.81 (brd, J=11.55Hz, 2H) 3.40 (dt, J=9.31, 6.72Hz, 4H) 3.56 (dt, J=9.22, 6.76Hz, 4H) 4.08 (t, J=6.24Hz, 4H) 4.47 (t, J=5.32Hz, 2H) 4.93 (tt, J=8.23, 4.33Hz, 1H)

[0384] [Comparative Compounds] The following three comparative compounds were used as ionized lipids. [Comparative Example 1] 2-{9-oxo-9-[(3-pentyloctyl)oxy]nonyl}dodecyl 1-methylpiperidine-4-carboxylate (compound (C1)) The comparative lipid compound C1 is ionized lipid 2 (2-{9-oxo-9-[(3-pentyloctyl)oxy]nonyl}dodecyl 1-methylpiperidine-4-carboxylate) described in International Publication No. 2017 / 222016. The compound was synthesized according to the method described in [Example A-2] of the same document.

[0385] [Comparative Example 2] 1-(2-decyltetradecyl)5-octyl3-((1-methylpiperidine-4-carbonyl)oxy)pentanediote (compound (C2)) The comparative lipid compound C2 is the A42F40C23 (LNP-42) compound disclosed in Patent Document 8 (Chinese Published Patent No. 114874106). It was synthesized by the method described in the same document.

[0386] [Comparative Example 3] ((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (compound (C3)) Comparative compound lipid C3 is a compound used as a lipid component in Alnylam's lipid nanoparticle formulation "Onpattro®". It was purchased from Amatek Chemical.

[0387]

[0388] [SEQ ID NO: 2 (Human Erythropoietin mRNA)] AGGGAAAUAAGAGAGAAAAGAAAGAGUAAGAAGAAAUAUAAAGAGCCACCAUGGGCGUGCACGAGUGCCCCGCCUGGCUGUGGCUGCUGCUGAGCCUGCUGAGCCUGC CCCUGGGGCCUGCCCGUGUGGGGCGCCCCCCCGGCUGAUCUGCGACAGCCGGGUGCUGGAGCGGUACCUGCUGGAGGCCAAGGAGGCCGAGAACAUCACCACCGG CUGCGCCGAGCACUGCAGCCUGGAACGAGAACAUCACCGUGCCCGACACCAAGGUGAACUUCUACGCCUGGAAGCGGAUGGAGGGGGCCAGCAGGCCGUGGAGGUG UGGCAGGGCCUGGGCCCUGCUGAGCGAGGCCGUGUGCGGGGCCAGGCCCUGCUGGUGAACAGCAGCCAGCCCUGGGAGCCCCUGCAGCUGCACGUGGACAAGGCCGU GAGCGGCCUGCGGAGCCUGACCACCCUGCUGCGGGCCCUGGGCGCCCAGAAGGAGGCCAUCAGCCCCCCCGACGCCGCCAGCGCCGCCCCCCUGCGGACCAUCACC GCCGACACCUUCCGGAAGCUGUUCCGGGUGUACAGCAACUUCCUGCGGGGCAAGCUGAAGCUGUACACCGGCGAGGCCUGCCGGACCGGCGACCGGUGAUAAGCUG CCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCUUCUUCUCUCCCUUGCACCUGUACCUUGGUCUUUGAAUAAAGCCUGAGUAGGAAGGCGGAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0389] Compositions containing lipid complexes were prepared using the ionized lipids synthesized in the above examples and comparative examples and the nucleic acids.

[0390] [Preparation Example 1: Preparation of Composition (1)] Firefly Luciferase mRNA consisting of the nucleotide sequence of Sequence ID No. 1 was prepared by in vitro transcription according to a conventional method. These included 5'UTR, ORF, 3'UTR, and polyA. Firefly Luciferase mRNA was dissolved in 10-25 mM sodium acetate (pH 4.0-5.0) to obtain an mRNA solution. Furthermore, ionized lipids, DSPC (Nippon Seika, DSPC-K2), Cholesterol (Nippon Seika, Cholesterol HP or Dishman, CHOLESTEROL HP), and MPEG2000-DMG (NOF, SUNBRIGHT GM-020) were dissolved in ethanol in a ratio of approximately 50 / 10 / 38.5 / 1.5 (molar ratio) to obtain a lipid ethanol solution. The mRNA solution and the lipid ethanol solution were mixed at a flow rate of 3:1 so that the RNA / total lipid content of the final formulation was approximately 0.06 by weight, and a nucleic acid lipid complex solution was obtained. The external solution was replaced using a dialysis membrane (14 kDa or 100 kDa) with phosphate buffer (PBS, pH 7.5), followed by Tris / sucrose buffer (20 mM Tris-HCl, 8% (w / v) Sucrose, pH 7.5). The mixture was then filtered and sterilized to obtain the composition.

[0391] [Preparation Example 2: Preparation of Composition (2)] Human Erythropoietin mRNA consisting of the nucleotide sequence of Sequence ID No. 2 was prepared by in vitro transcription according to a conventional method. These included 5'UTR, ORF, 3'UTR, and polyA. A composition was obtained in the same manner as in Preparation Example 1, except that Human Erythropoietin mRNA consisting of the nucleotide sequence of Sequence ID No. 2 was used instead of Firefly Luciferase mRNA consisting of the nucleotide sequence of Sequence ID No. 1.

[0392] [Analysis of Composition] 1. Embedding Rate of mRNA in Lipid Complex The embedding rate of mRNA in lipid complexes was measured for the compositions obtained in the above preparation example. Specifically, the mRNA concentration (A) measured using Quanti-iT Ribogreen RNA Reagent (Invitrogen, catalogue #R11491) after diluting the composition with TE (Tris-EDTA) buffer (TaKaRa, catalogog #T9111) was taken as the mRNA concentration present in the solution outside the lipid complex. In addition, the mRNA concentration (B) measured after diluting the composition with 1% (v / v) Triton X-100 was taken as the total mRNA concentration in the lipid complex. Subsequently, the embedding rate of mRNA in lipid complexes was calculated using the following formula (F1). Embedding rate (%) = 100 - (A / B) × 100 (F1) 2. The average particle size and polydispersity index of the lipid complex were measured using a particle size analyzer (ZETASIZER Nano ZS, Malvern). The results are shown in Tables 1 and 3. Table 1 shows the analysis results of the lipid complex composition containing Firefly Luciferase mRNA (SEQ ID NO: 1) prepared in Preparation Example 1. This composition was used in Test Example 1 described below. Table 3 shows the analysis results of the lipid complex composition containing Human Erythropoietin mRNA (SEQ ID NO: 2) prepared in Preparation Example 2. This composition was used in Test Example 2 described below.

[0393] As described above, the lipid complexes prepared using the ionized lipids of this disclosure were found to have excellent stability, with nucleic acid encapsulation rates all exceeding 90% and polydispersity indexes of less than 0.1.

[0394] C. Test Examples [Test Example 1: Evaluation of the protein production effect of the composition in mice] The method described in Non-Patent Literature 1 (Tanaka et al., ACS Nano 2023, 17, 2588-2601) was used as a reference. The composition obtained in Preparation Example 1 was diluted with physiological saline so that the concentration of Firefly Luciferase mRNA encapsulated in the lipid complex was 20 μg / mL. Each composition was administered intravenously to ICR mice (female, n=4) at a dose of approximately 10 mL / kg, and liver sections were collected 24 hours later. Approximately 10 times the weight of the liver section was added to the liver section in the form of 1x Glo Lysis Buffer (Promega, catalogog #E2661) and zirconia beads (Biomedic Science, catalogog #ZZ50-0003), and the mixture was homogenized using a multi-bead shocker (QIAGEN). After centrifugation to remove tissue membrane components, the Luciferase protein in the supernatant was reacted with Steady-Glo Luciferase Assay System (Promega, catalogog #E2510) and luminescence was detected. Furthermore, the total protein concentration in the supernatant was quantified using BCA reagents (Thermo Scientific, catalogog #23231, 23232, 23234), and the Luciferin emission intensity was calculated by dividing this value by the obtained emission intensity. The Luciferin emission intensity of the C1 composition administration group was set to 1.0 (100%), and the relative values ​​for each composition administration group were calculated. The results are shown in Table 2.

[0395] The results of the above Test Example 1 demonstrate that compositions using the ionized lipids (E1-E57) of this disclosure are capable of releasing nucleic acids into the cytoplasm. Compositions using the ionized lipids (E1-E57) of this disclosure exhibited a luminescence intensity of 200% or more, and furthermore, the luminescence intensity was 1.5 times higher than that of compositions using C1 or C2 as the ionized lipid in mice, suggesting a high efficacy in producing Luciferase protein. This result indicates that the ionized lipids of this disclosure exhibit excellent mRNA delivery efficiency. In particular, compositions using ionized lipids (E1, E2, E4-E6, E8-E22, E24, E26-E41, E43, E45-E47, E49, E50, E53-E57) exhibited a luminescence intensity of 250% or more, while compositions using ionized lipids (E1, E2, E4, E6, E8-E12, E14-E22, E24, E26-E39, E41, E43, E46, E47, E49, E53-E57) exhibited a luminescence intensity of 300% or more, demonstrating particularly excellent mRNA delivery efficiency. Furthermore, E1, E4, E6, E12, E13, E16, E17, and E29 are preferred as ionized lipids because they can form lipid particles with low toxicity and / or excellent stability during refrigerated storage, and E1, E4, E6, E12, and E17 are more preferred, with E4, E6, and E17 being particularly preferred.

[0396] [Test Example 2: Evaluation of the protein production effect of the composition in monkeys] The composition using ionized lipid E1 prepared in Preparation Example 2 was diluted with physiological saline so that the concentration of Human Erythropoietin mRNA encapsulated in the lipid complex was 40 μg / mL. The composition was administered to cynomolgus monkeys (male, n=2) by intravenous drip infusion at a dose of 5 mL / kg over 60 minutes. Blood was collected using a syringe immediately before administration, and 2, 6, 24, 48, and 72 hours after administration. Serum was separated from the blood by centrifugation, and the concentration of Human Erythropoietin protein in the serum was quantified using U-PLEX Human EPO Assay (Meso Scale Discovery, catalogog #K151VXK). The results are shown in Table 4.

[0397]

[0398]

[0399] The composition using the ionized lipid E1 of this disclosure showed an effect on the production of human erythropoietin protein in monkeys.

[0400] [Test Example 3: Evaluation of Aldehyde Production in Ethanol Solution of Ionized Lipids] The method described in Non-Patent Literature 2 (Hashiba et al., Commun. Biol., 2024, 7(1), 556) was generally followed. Specifically, a 0.25 mM 4-hydroxyadiazole hydroxylazene (Tokyo Chemical Industries, catalogo #A5557; hereafter referred to as NBD-H) solution (powder dissolved in acetonitrile containing 0.025% (v / v) trifluoroacetic acid) was prepared. 10 μL of ethanol solution containing 40 mM ionized lipid was mixed with 190 μL of NBD-H solution and reacted at room temperature for 60 minutes. The fluorescence values ​​of lipid mixtures were measured under the conditions of Excitation = 470 nm and Emission = 550 nm. Similarly, the fluorescence values ​​of an ethanol solution without ionized lipids were measured as background, and these values ​​were subtracted. If the fluorescence value was below the background level, it was classified as Not Detected (N.D.). The results are shown in Table 5.

[0401]

[0402] The ionized lipids E1 and E6 of this disclosure were found to have lower fluorescence values ​​than comparative compound lipid C3. This suggests that they produce less aldehyde, an impurity. Comparative compound lipid C3 is a compound used as a lipid component in Alnylam's lipid nanoparticle formulation "Onpattro®". Non-patent document 2 shows a negative correlation between the amount of aldehyde produced by ionized lipids and the activity (storage stability at 4°C) of the active pharmaceutical ingredient. Since the ionized lipids of this disclosure produce less aldehyde compared to comparative compound lipid C3, it is suggested that they have superior retention of the activity (storage stability) of the active pharmaceutical ingredient.

[0403] This disclosure provides an ionized lipid capable of releasing nucleic acids into the cytoplasm.

Images