Nucleic acid molecule and use thereof, and virus particle, and preparation method therefor and use thereof

Abstract

Provided are a nucleic acid molecule and a use thereof, and a virus particle, and a preparation method therefor and a use thereof. Provided is a nucleic acid molecule, comprising: one or more of nucleic acid molecule 1 to nucleic acid molecule 4. Provided recombinant promoters have a length of about 260 bp, are suitable for expressing large exogenous genes in AAV vectors, and have wide application ranges. Additionally, these recombinant promoters have different degrees of expression intensity in PR cells, and are also applicable in certain scenarios where a high expression level of a target gene is required.

Description

Nucleic acid molecules, virus particles, their preparation methods and applications

[0001] This application claims priority to Chinese Patent Application No. 202411982388X, filed on December 30, 2024, entitled “Nucleic Acid Molecule, Virus Particle and Preparation Method Thereof and Application”, the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention relates to the field of bioengineering, and more particularly to nucleic acid molecules, viral particles, their preparation methods and applications. Background Technology

[0003] Photoreceptor cells are specialized neuroepithelial cells with light transduction capabilities. They absorb photons from the visual field and then, through a series of complex biochemical pathways, transmit these signals as changes in membrane potential. Finally, the visual system processes these signals to present a complete visual world. When photoreceptor cells malfunction, such as when rod cells are underdeveloped and fewer in number than normal, or when a deficiency in vitamin A prevents the normal synthesis of rhodopsin, dark adaptation decreases, and the ERG a-wave amplitude decreases, making it difficult to see objects in the dark. Although damaged rod cells can still re-establish synaptic connections with horizontal and bipolar cells to transmit signals to the nerves, the ERG a-wave amplitude in the dark vision curve is reduced compared to when rod cells are normal, making it difficult to see objects in low light.

[0004] Several hereditary ophthalmic diseases have been reported, many of which are related to mutations in different genes associated with retinal pathology. When these genes cannot be expressed correctly, progressive cell death occurs, leading to blindness. Therefore, gene therapy, which involves introducing exogenous normal genes into target cells to correct or compensate for diseases caused by gene defects and abnormalities, is a promising treatment approach.

[0005] Specific promoters typically drive gene expression only in specific tissues and cells, avoiding the side effects caused by the continuous expression of exogenous genes in non-specific tissues and cells in experimental animals. They also enhance the expression of exogenous genes in specific cells. For gene therapy, using specific promoters in conjunction with tissue-specific, tropism-dependent AAV serotypes can significantly improve treatment specificity, avoid impacts on other organs, and reduce side effects.

[0006] AAV has attracted much attention due to its safety profile, but its very small vector capacity often exceeds its limits when carrying large functional proteins, such as Cas9, leading to problems such as a significant drop in viral titer or truncation of the genome sequence. Therefore, obtaining promoters that are shorter in length but retain the ability to express downstream genes in specific tissues or cell types can solve this problem to some extent, ensuring the specific expression of the target gene while keeping the vector length within the AAV genome's capacity limit. Summary of the Invention

[0007] In view of this, the present invention provides a nucleic acid molecule, viral particles, a method for their preparation, and their applications. The recombinant promoter provided by the present invention is approximately 260 bp in length, suitable for the expression of larger exogenous genes in AAV vectors, and has a wide range of applications. Furthermore, the recombinant promoter exhibits very high expression intensity in PR cells, making it suitable for certain scenarios requiring high levels of target gene expression.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0009] This invention provides nucleic acid molecules, including one or more of nucleic acid molecules 1 to 4;

[0010] The nucleic acid molecule 1 includes at least one of (1) to (4):

[0011] (1) Nucleic acids having the nucleotide sequence shown in SEQ ID NO:1;

[0012] (2) Nucleic acids that replace, delete, or add one or more nucleotides in the fragment described in (1);

[0013] (3) A nucleotide sequence that has at least 70% identity with the nucleotide sequence shown in (1) or (2); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%.

[0014] (4) Nucleic acids that are partially or completely complementary to any one of (1), (2) or (3); and / or

[0015] The nucleic acid molecule 2 includes at least one of (5) to (8):

[0016] (5) Nucleic acids having the nucleotide sequence shown in SEQ ID NO:2;

[0017] (6) Nucleic acids that replace, delete, or add one or more nucleotides in the fragment described in (5);

[0018] (7) A nucleotide sequence that has at least 70% identity with the nucleotide sequence shown in (5) or (6); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%.

[0019] (8) Nucleic acids that are partially or completely complementary to any one of (5), (6) or (7); and / or

[0020] The nucleic acid molecule 3 includes at least one of (9) to (12):

[0021] (9) Nucleic acids having the nucleotide sequence shown in SEQ ID NO:3;

[0022] (10) Nucleic acids that replace, delete, or add one or more nucleotides in the fragment described in (9);

[0023] (11) A nucleotide sequence that has at least 70% identity with the nucleotide sequence shown in (9) or (10); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%.

[0024] (12) Nucleic acids that are partially or completely complementary to any one of (9), (10) or (11); and / or

[0025] The nucleic acid molecule 4 includes at least one of (13) to (16):

[0026] (13) Nucleic acids having the nucleotide sequence shown in SEQ ID NO:4;

[0027] (14) Nucleic acids that replace, delete, or add one or more nucleotides in the fragment described in (13);

[0028] (15) A nucleotide sequence that has at least 70% identity with the nucleotide sequence shown in (13) or (14); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%.

[0029] (16) Nucleic acids that are partially or completely complementary to any one of (13), (14) or (15).

[0030] In some embodiments of the present invention, the sequence of SEQ ID NO:1 is: TCTCTGTTCCCTTCCCTGGGCTTTCATTGGGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGAAAAGTGAGGCGGCCCCTTGGCCCTAGCTCTGGCCTACCTCCTCAGGGAAAAGTGAGGCGGCCCTGCTGGACCCCCACTTCATAGGGCAATTCGTCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCC (RCB8 promoter (289bp)).

[0031] In some embodiments of the present invention, the sequence of SEQ ID NO:2 is: TCTCTATTGCTGGTCCCCCCTGGGATTTCATTGGCCCAGAAGCCTGGTGGAGATTCTCGTGAAAAGTGAGGCGGCCCCTTGGCCCTAGCTCTGGCCTACCTCCTCAGGGAAAAGTGAGGCGGCCCTGCTGGACCCCCACTTCATAGGGCAATTCGTCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGTTGACCTGACAGTGGCAAGAAGGTTTTGACGGCGACAATCCCCTGAGCTGCTTGGAATCCGATTAGAATGAGGCTGCCC (RCB8V1 promoter (286bp)).

[0032] In some embodiments of the present invention, the sequence of SEQ ID NO:3 is: TGGACGTTCCCTGTAAGCTGGGTTGGAATTGGGTGGCGCAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGAAAAGTGAGGCGGCCCCTTGGCCCTAGCTCTGGCCTACCTCCTCAGGGAAAAGTGAGGCGGCCCTGACCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAACGCCTTAGGACGAATCCGATTAGATCTA (RCB8V2 promoter (262bp)).

[0033] In some embodiments of the present invention, the sequence of SEQ ID NO:4 is: GAAGGGAACAGAGACCTGGGCTTTCATTGGGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGGCCGCCTCACTTTTCCCTTGGATGAGGCGGAAAAGTGAGGCGGCCCTGCTGGACCCCCACTTCATAGGGCAATTCGTCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGAGTCCAGTC (RCB8V3 promoter (236bp)).

[0034] In some embodiments of the present invention, the sequence of SEQ ID NO:5 is: TAGAAAAAGACAATCCCCTGAGCTGCTTGAGGGCTAACAGAAGATCAAGTCCCATTTTAGCCTCCCTAGCTCTGGCCTACCTCCTCAGTTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCCCTGGCTCATCTCTCAGGATGCCTATCTTGTCCTTAGCACGATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTAGAAAAAGACAATCCCCGCCTGGCCCGGATCACTTATCCGTTGCCTTTGTGTATTTGGAGGCTGGGAGGCCAGCTGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGATGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTA (Comparative promoter (373bp)).

[0035] In some embodiments of the invention, the term "nucleic acid" refers to a polymer composed of nucleotides, i.e., a polynucleotide. It refers to naturally occurring, or partially or completely non-naturally occurring nucleic acids, such as those encoding recombinant polypeptides. Nucleic acids can be composed of DNA fragments isolated or synthesized by chemical means. Nucleic acids can be integrated into another nucleic acid, for example, into an expression plasmid or the genome / chromosome of a host cell. Plasmids include shuttle and expression vectors. Typically, the plasmid will also contain a prokaryotic proliferation unit containing a replication initiation region (e.g., the replication initiation region of ColE1) for vector replication and selection in bacteria, and a selection marker (e.g., a penicillin or tetracycline resistance gene).

[0036] This invention also provides the application of the above-mentioned nucleic acid molecules as promoters.

[0037] In some embodiments of the invention, the term "promoter" refers to a nucleic acid, i.e., a polynucleotide sequence that controls the transcription of a functionally linked nucleic acid. A promoter may include signals for RNA polymerase binding and transcription initiation. One or more promoters used will be functional in the host cell type, involved in the expression of a functionally linked nucleic acid in said host cell. A large number of promoters, including constitutive, inducible, and repressive promoters from a variety of different sources, are well known in the art (and have been identified in databases such as GenBank).

[0038] The present invention also provides an expression cassette comprising the above-described nucleic acid molecule.

[0039] In some embodiments of the invention, the term "expression cassette" refers to a nucleic acid containing elements necessary for the expression and secretion of structural genes present in at least one host cell. Nucleic acids are also characterized by their sequence consisting of single nucleotides, or the amino acid sequence encoded by a nucleic acid molecule.

[0040] The present invention also provides an expression vector comprising: the above-described nucleic acid molecule and / or the above-described expression cassette and target gene.

[0041] In some embodiments of the present invention, the expression vector further includes a fluorescent protein.

[0042] In some embodiments of the present invention, the fluorescent protein in the above expression vector includes: nuclear red fluorescent protein.

[0043] The present invention also provides viral particles, which are transformed and / or transfected with the above-mentioned expression vector.

[0044] In some embodiments of this invention, the AAV (adeno-associated virus) triple plasmid packaging system is a commonly used gene transfer tool, primarily used for transferring genes into cell and animal models to study gene function or develop gene therapy regimens. The AAV triple plasmid packaging system typically includes the following three plasmids:

[0045] Transfer plasmid: Contains the target gene sequence (i.e., the gene to be transferred into the cell) and inverted terminal repeats (ITRs) of AAV. ITRs are the sequences at both ends of the AAV genome, responsible for packaging and integration. AAV does not have its own replication protein, so the presence of ITR sequences allows the target gene to be recognized and embedded into the viral particle during viral packaging.

[0046] Packaging plasmids contain the major structural protein genes of the AAV virus, such as Rep and Cap. The Rep protein is the AAV replication protein, responsible for AAV genome replication and packaging; the Cap protein is the AAV capsid protein, used for viral particle assembly. Expression of these genes causes the cell to produce the necessary proteins to assemble and package viral particles, but these proteins are not included in the final packaged AAV genome.

[0047] Helper plasmids contain key adenovirus genes, such as E1A, E1B, E2A, E4, and VA genes. These genes provide additional auxiliary factors to aid in AAV replication and packaging. These genes originate from the adenovirus but do not contribute to the production of complete adenovirus; they are merely used to support the AAV production process.

[0048] The present invention also provides a method for preparing the above-mentioned virus particles, wherein the expression vector is packaged into a virus, the virus is collected, purified, and the virus particles are obtained.

[0049] In some embodiments of the present invention, when the three plasmids are co-transfected into packaging cells (such as HEK293 cells), each plasmid expresses its corresponding protein and gene element, thereby achieving AAV virus packaging. The target gene on the vector plasmid, with the help of ITRs, forms a complete AAV genome. The cap and rep genes in the packaging plasmid express the corresponding AAV proteins. The rep protein is responsible for replicating the AAV genome, while the cap protein forms the AAV capsid. Adenovirus helper genes in the helper plasmid provide the necessary support for packaging, enhancing the replication and packaging efficiency of AAV.

[0050] In this system, the AAV genome is encased in a capsid formed by cap proteins, forming a complete AAV particle.

[0051] The resulting AAV particles contain only the target gene sequence and lack other genes found in packaging and helper plasmids, thus exhibiting high safety and stability. These AAV particles can infect target cells and transfer the target gene, but because AAV is a replication-defective virus, it typically does not cause pathogenicity.

[0052] The present invention also provides the application of the above-mentioned nucleic acid molecules, expression cassettes, expression vectors, viral particles and / or viral particles obtained by the above preparation methods in the preparation of products that specifically express retinal structures.

[0053] In some embodiments of the present invention, in the above applications, the retinal structure includes a photoreceptor.

[0054] The present invention also provides the use of the above-mentioned nucleic acid molecules, expression cassettes, expression vectors, viral particles and / or viral particles obtained by the above preparation methods in the preparation of products for the treatment and / or prevention of retinal diseases.

[0055] The present invention also provides products comprising: the above-described nucleic acid molecule, the above-described expression cassette, the above-described expression vector, the above-described viral particles, and / or viral particles obtained by the above-described preparation method.

[0056] The recombinant promoter provided by this invention is approximately 260 bp in length, suitable for expressing larger exogenous genes in AAV vectors, and has a wide range of applications. Furthermore, the recombinant promoter provided by this invention exhibits very high expression intensity in PR cells, making it applicable in scenarios requiring high target gene expression levels. Attached Figure Description

[0057] Figure 1 shows a schematic diagram of the expression vector structure used for viral packaging, which mainly consists of an upstream promoter and a downstream red fluorescent protein gene;

[0058] Figure 2 shows slices of the eye; the first image on the left is a red fluorescence photograph taken at 40x magnification and 1000ms exposure time; the second image is a composite image of two photographs obtained after red fluorescence and immunofluorescence staining (the exposure time for each channel has been adjusted); the third image is a composite image of three photographs obtained after red fluorescence, immunofluorescence staining, and DAPI staining (the exposure time for each channel has been adjusted).

[0059] Figure 3 shows a bar chart obtained from semi-quantitative data on the fluorescence intensity of the slides;

[0060] Figure 4 shows eye slices corresponding to the mutants RCB8V1, RCB8V2, and RCB8V3 of the RCB8 promoter; the first image on the left is a red fluorescence photograph taken at 100x magnification and 500ms exposure time, and the second image is a combined image of the red fluorescence and DAPI staining (the exposure time for each channel has been adjusted). Detailed Implementation

[0061] This invention discloses a nucleic acid molecule, viral particles, their preparation method, and applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0062] The raw materials and reagents used in Examples 1 and 2 of this invention can all be purchased from the market.

[0063] The present invention will be further illustrated below with reference to the embodiments:

[0064] Example 1: Expression vector construction and promoter activity verification

[0065] 1. The RCB8 promoter sequence was obtained through artificial recombination. Based on the VB900129-0788gfe vector (internal construction, see https: / / en.vectorbuilder.com / vector / VB900129-0788gfe.html, as shown in Figure 1), the CAG promoter was replaced with RCB8 and the comparative promoter (as shown in SEQ ID NO:5) respectively using conventional enzyme digestion and ligation methods. An expression vector was constructed with RCB8 and the comparative promoter upstream and the nuclear red fluorescent protein (NLS-mCherry) gene downstream. The vector framework is shown in Figure 1.

[0066] 2. Following conventional virus packaging methods, the expression vectors containing RCB8 and comparative promoters were mixed with the other two helper vector plasmids for AAV packaging (carrying Rep\Capsi d genes and E2\E4\VA genes, respectively) and transfected into 293T cells for virus packaging. After harvesting the virus, it was purified with cesium chloride to finally obtain virus particles (AAV8 type) for in vivo animal validation experiments.

[0067] 3. Mice (C57BL / 6J, 6-8 weeks old, purchased from Guangdong Provincial Medical Laboratory Animal Center) were injected subretinally with a viral dose of 1E+10GC / eye. Two weeks after injection, tissue samples were collected for sectioning and immunofluorescence staining. The primary antibody used in the immunofluorescence process was rabbit anti-mouse polyclonal anti-Arrestin C antibody (purchased from Sigma-Aldrich, catalog number AB15282), which specifically binds to the surface protein of cone cells in the photoreceptor (PR) layer, thereby labeling the photoreceptor layer containing cone cells. The secondary antibody used was goat anti-rabbit IgG with green fluorescence (purchased from Thermofis her, catalog number A-11008). Simultaneously, DAPI was used to stain the nuclei of cells in each layer, resulting in a blue image.

[0068] 4. Photographs were taken of the slides to obtain expression slide images of RCB8 and the comparative promoter, as shown in Figure 2. Slide image results: Images taken at 40x magnification and 1000ms exposure time are displayed. Each result consists of three images from left to right. The first image on the left is a slide taken at 1000ms exposure time, mainly used to observe the expression of red fluorescence alone. The second image is a composite image of two images obtained after cell expression fluorescence and immunofluorescence staining (exposure times for each channel have been adjusted). The third image is a composite image of three images obtained after cell expression fluorescence, immunofluorescence staining, and DAPI staining (exposure times for each channel have been adjusted).

[0069] Based on the slice results of each recombinant promoter, after viral injection, the RCB8 recombinant promoter only expressed red fluorescence in the photoreceptor cell layer under the mouse retina, and no fluorescence expression was observed in other cell layers, showing its high expression specificity.

[0070] 5. ImageJ software was used to semi-quantitatively analyze the brightness of each group of slides, and the results are shown in Figure 3. The brightness trend of the RCB8 promoter expressing red fluorescent protein in the above figure is consistent with the corresponding slide results. As shown in Table 1, the expression intensity of the RCB8 promoter is significantly better than that of the comparative promoter, and both exhibit very strong PR cell expression specificity. Overall, the RCB8 promoter shows stronger expression activity than the earlier comparative promoter, and its expression specificity is high. Different recombinant promoters can be selected according to different application needs.

[0071] Table 1

[0072] Example 2: Functional variant of the RCB8 promoter

[0073] After confirming the expression specificity of the RCB8 promoter, random mutations and deletions / replacements were performed on the RCB8 promoter to construct RCB8V1, RCB8V2, and RCB8V3 promoter variant sequences for experiments. The sequence identity between each pair of RCB8 and its variants is shown in Table 2.

[0074] Table 2

[0075] Following the method in Example 1, an expression vector was constructed with upstream variant promoters RCB8V1, RCB8V2, and RCB8V3, and downstream expression vector for the nuclear red fluorescent protein (NLS-mCherry) gene. Virus packaging and purification were performed, and promoter activity was verified in mice. Finally, the expression slice diagram of the promoter was obtained, as shown in Figure 4.

[0076] Slice image results description: The images shown are taken at 100x magnification and 500ms exposure time. Each result consists of two images from left to right. The first image on the left is the slice taken at the annotated exposure time (500ms), mainly used to observe red fluorescence expression alone; the second image is a combined image of the two images taken after cell expression of red fluorescence and DAPI staining (the exposure time for each channel has been adjusted).

[0077] As can be seen from the slice results, the variant promoters with certain homology can all maintain their expression in photoreceptor cells. Although the expression-driving ability of some variants is weaker than that of the pre-mutation promoters, they all retain their basic expression specificity and expression ability.

[0078] The above provides a detailed description of the nucleic acid molecules, virus particles, their preparation methods, and applications provided by this invention. Specific examples have been used to illustrate the principles and implementation methods of this invention. The descriptions of the above embodiments are merely for the purpose of helping to understand the methods and core ideas of this invention. It should be noted that those skilled in the art can make various improvements and modifications to this invention without departing from its principles, and these improvements and modifications also fall within the protection scope of the claims of this invention.

Claims

1. A nucleic acid molecule, characterized in that, include: One or more of nucleic acid molecules 1 to 4; The nucleic acid molecule 1 includes at least one of (1) to (4): (1) Nucleic acids having the nucleotide sequence shown in SEQ ID NO:1; (2) Nucleic acids that replace, delete, or add one or more nucleotides in the fragment described in (1); (3) A nucleotide sequence that is at least 70% identical to the nucleotide sequence shown in (1) or (2); (4) Nucleic acids that are partially or completely complementary to any one of (1), (2) or (3); and / or The nucleic acid molecule 2 includes at least one of (5) to (8): (5) Nucleic acids having the nucleotide sequence shown in SEQ ID NO:2; (6) Nucleic acids that replace, delete, or add one or more nucleotides in the fragment described in (5); (7) A nucleotide sequence that is at least 70% identical to the nucleotide sequence shown in (5) or (6); (8) Nucleic acids that are partially or completely complementary to any one of (5), (6) or (7); and / or The nucleic acid molecule 3 includes at least one of (9) to (12): (9) Nucleic acids having the nucleotide sequence shown in SEQ ID NO:3; (10) Nucleic acids that replace, delete, or add one or more nucleotides in the fragment described in (9); (11) A nucleotide sequence that is at least 70% identical to the nucleotide sequence shown in (9) or (10); (12) Nucleic acids that are partially or completely complementary to any one of (9), (10) or (11); and / or The nucleic acid molecule 4 includes at least one of (13) to (16): (13) Nucleic acids having the nucleotide sequence shown in SEQ ID NO:4; (14) Nucleic acids that replace, delete, or add one or more nucleotides in the fragment described in (13); (15) A nucleotide sequence that is at least 70% identical to the nucleotide sequence shown in (13) or (14); (16) Nucleic acids that are partially or completely complementary to any one of (13), (14) or (15).

2. The application of the nucleic acid molecule as described in claim 1 as a promoter.

3. An expression box, characterized in that, include: The nucleic acid molecule as described in claim 1.

4. An expression carrier, characterized in that, include: The nucleic acid molecule as described in claim 1 and / or the expression cassette and target gene as described in claim 3.

5. Virus particles, characterized in that, Transformation and / or transfection of the expression vector as described in claim 4.

6. The method for preparing virus particles as described in claim 5, characterized in that, After packaging the expression vector into a virus, the virus is collected, purified, and the virus particles are obtained.

7. The use of the nucleic acid molecule of claim 1, the expression cassette of claim 3, the expression vector of claim 4, the viral particles of claim 5, and / or the viral particles obtained by the preparation method of claim 6 in the preparation of products that specifically express retinal structures.

8. The application as described in claim 7, characterized in that, The retinal structure includes photoreceptors.

9. The use of the nucleic acid molecule as described in claim 1, the expression cassette as described in claim 3, the expression vector as described in claim 4, the viral particle as described in claim 5, and / or the viral particle obtained by the preparation method as described in claim 6 in any of the following: (a) Preparing products for the treatment and / or prevention of retinal diseases; and / or (b) Treatment and / or prevention of retinal diseases.

10. The product, characterized in that, include: The nucleic acid molecule as described in claim 1, the expression cassette as described in claim 3, the expression vector as described in claim 4, the virus particle as described in claim 5, and / or the virus particle obtained by the preparation method as described in claim 6.

11. A treatment method for a disease, characterized in that, Apply the product as described in claim 10; the disease includes: retinal disease.

Images