Composition for wound healing comprising succinic acid and preparation method therefor

WO2026177243A1PCT designated stage Publication Date: 2026-08-27CURAGENE CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/002640
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-02-19
Filing Date
2025-02-26
Publication Date
2026-08-27

Smart Images

  • Figure KR2025002640_27082026_PF_FP_ABST
    Figure KR2025002640_27082026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for wound healing comprising succinic acid and a preparation method therefor. The composition according to the present invention accelerates wound healing by promoting cell regeneration and collagen synthesis, is harmless to the human body, and has high safety. The composition can be applied to various types of dressings, and improves both healing efficacy and ease of use. Through this, the development and applicability of wound treatment technology are expanded.
Need to check novelty before this filing date? Find Prior Art

Description

A wound healing composition containing succinic acid and a method for preparing the same

[0001] The present invention relates to a composition for wound healing, a formulation, and a formulation containing the same.

[0002] A wound refers to the destruction of the continuity and integrity of skin tissue and damage to skin appendages. Evolving from traditional approaches to wound treatment, moist dressings are used that incorporate concepts such as maintaining a moist environment at the wound site, and recently, dressings designed to deliver various active substances are being researched and developed. Dressing agents for wound treatment are selected according to the different types of wounds, and research on various systems is currently underway due to recent advancements in materials and technology.

[0003] To address all aspects of wound care, wound dressings come in various forms and characteristics, and depending on the complexity of the wound, different types such as films, foams, hydrogels, and hydrocolloids have been developed and are in use. An ideal wound dressing should promote rapid healing while minimizing patient discomfort; in particular, it must adhere to the damaged tissue, maintain a balanced moist environment, allow for oxygen exchange, protect against external infectious agents such as bacteria, and ensure an optimal microenvironment that accelerates the healing process.

[0004] Organic acids are emerging as active substances capable of playing a crucial role in the wound healing process. Organic acid-based formulations have the advantage of being highly safe due to their natural origin and applicability to various types of dressings. Recent research aims to maximize healing effects by developing nanoparticles, hydrogels, or multilayer dressings utilizing organic acids. These formulations deliver active substances uniformly to the wound site, suggesting the potential to simultaneously enhance patient convenience and treatment efficacy.

[0005] Although there are prior patents regarding wound healing agents containing organic acids (such as Korean Registered Patent No. 10-0660392), the primary ingredients are raw materials other than organic acids, and in most cases, organic acids are included only as incidental additives. Since there are almost no cases where organic acids are applied as the main ingredient in wound healing agents, there is a need for development in this area.

[0006] The present invention aims to provide an organic acid-based wound healing composition that accelerates the recovery of damaged tissue by promoting cell regeneration and collagen synthesis.

[0007] In addition, we aim to provide an organic acid-based wound healing composition that is non-cytotoxic and harmless to the human body.

[0008] In addition, the present invention aims to provide an optimal manufacturing method for synthesizing the above-mentioned wound healing composition and to provide a wound healing agent using the same.

[0009] The present invention provides a wound healing composition comprising one or more substances from the group consisting of succinic acid, fumaric acid, malic acid, and tartaric acid.

[0010] The present invention provides a wound healing composition characterized by further comprising a Centella asiatica extract, wherein the Centella asiatica extract comprises madecassoside, asiaticoside, madecassic acid, and asiatic acid.

[0011] The present invention provides a wound healing composition further comprising bamboo leaf components or propolis components.

[0012] The present invention provides a method for preparing a wound healing composition comprising the steps of: dissolving succinic acid in high-purity dimethyl sulfoxide (DMSO); and diluting the dissolved succinic acid in distilled water (DW).

[0013] The present invention provides a method for preparing a wound healing composition characterized by the purity of the dimethyl sulfoxide (DMSO) being 100%.

[0014] The present invention provides a method for preparing a wound healing composition characterized by further including a diluted product obtained by dissolving one or more substances from the group consisting of fumaric acid, malic acid, and tartaric acid in high-purity dimethyl sulfoxide (DMSO) and then diluting it in distilled water (DW).

[0015] The present invention provides a method for preparing a wound healing composition characterized by further including a Centella asiatica extract, wherein the Centella asiatica extract comprises madecassoside, asiaticoside, madecassic acid, and asiatic acid.

[0016] The present invention provides a wound healing agent applied with one or more substances selected from the group consisting of succinic acid, fumaric acid, malic acid, and tartaric acid.

[0017] The present invention provides a wound healing agent in which the agent is composed of a polyurethane dressing foam.

[0018] The present invention provides a wound healing agent characterized in that the agent has a three-dimensional shape with a protruding central portion.

[0019] The present invention provides a wound healing agent characterized in that the three-dimensional shape is a dome shape.

[0020] The present invention provides a wound healing agent characterized by applying one or more substances from the group consisting of succinic acid, fumaric acid, malic acid, and tartaric acid to the polyurethane dressing foam to form a grid pattern in multiple lines.

[0021] The present invention provides a wound healing agent characterized in that the grid pattern is formed on a protrusion of the polyurethane dressing foam, and the width of the lines of the grid pattern is 300 to 1000 μm.

[0022] The above-mentioned grid-forming substance provides a wound healing preparation further comprising Centella asiatica extract, bamboo leaf components, or propolis components.

[0023] The wound healing composition containing an organic acid according to the present invention can improve wound healing efficacy by promoting cell regeneration and collagen synthesis.

[0024] In addition, the present invention ensures both safety and effectiveness by using naturally derived ingredients and high-purity materials that are harmless to the human body.

[0025] A composition containing organic acids including succinic acid, Centella asiatica extract, bamboo leaf components, and propolis components contributes to preventing infection, alleviating inflammation, and maintaining a balanced moist environment, thereby providing an optimal healing environment. In particular, it can be applied to various types of dressings, increasing the flexibility and versatility of wound treatment.

[0026] Figure 1 is a photograph showing the visual evaluation of the solubility of four types of organic acids.

[0027] Figure 2 is a graph analyzing cytotoxicity on HaCaT cells, THP-1 cells, and HDF cells.

[0028] Figure 3 is a graph showing the wound distance measured at 40x magnification, standardized to the 0-hour standard.

[0029] Figure 4 is a graph showing the wound area measured at 100x magnification, standardized to the 0-hour standard.

[0030] Figure 5 is a graph measured by evaluating the cell proliferation induction of succinic acid and tartaric acid.

[0031] Figure 6 is a graph measured by evaluating the cell proliferation induction of succinic acid and Centella asiatica extract.

[0032] Figure 7 is an evaluation of cytokine and growth factor induction. Figure 7(a) is a graph measuring TNF-α expression in THP-1 cells, Figure 7(b) is a graph measuring IL-1β expression, and Figure 7(c) is a graph measuring TGF-β1 expression.

[0033] Figure 8 shows the verification of changes in EMT factors, and Figure 8(a) is a graph showing the expression of human fibronectin mRNA in HDF cells treated with succinic acid and Centella asiatica extract, Figure 8(b) is a graph showing the expression of human E-cadherin mRNA, and Figure 8(c) is a graph showing the expression of human Vimentin mRNA.

[0034] Figure 9 is a graph showing procollagen expression in HDF cells, verified by changes in cell remodeling factors.

[0035] Figure 10 is a photograph of wound healing observed visually in an in vivo experiment.

[0036] Figure 11 is a graph showing the measurement of wound size and the analysis of the recovery rate.

[0037] Figure 12 is a photograph showing histopathological changes through H&E staining.

[0038] Figure 13 is a graph showing the procollagen content measured via ELISA.

[0039] Figure 14 is a drawing showing an organic acid wound healing agent applied in a grid pattern to a protruding polyurethane foam.

[0040] Figure 15 is a drawing showing an organic acid wound healing agent applied in a grid pattern to a semi-protruding polyurethane foam.

[0041] Hereinafter, the present invention will be described in more detail to aid in understanding the invention. In this case, terms and words used in this specification and claims should not be interpreted as being limited to their ordinary or dictionary meanings, but should be interpreted in a meaning and concept consistent with the technical spirit of the invention, based on the principle that the inventor can appropriately define the concept of the terms to best describe his invention.

[0042] Throughout the specification, when a part is described as "including" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but rather allows for the inclusion of additional components.

[0043] The terms used in this specification are used merely to describe specific embodiments and are not intended to limit the invention. The singular expression includes the plural expression unless the context clearly indicates otherwise.

[0044] Furthermore, in this specification, terms such as “comprising,” “having,” or “having” are intended to specify the existence of the implemented features, numbers, steps, components, or combinations thereof, and should be understood as not excluding in advance the existence or addition of one or more other features, numbers, steps, components, or combinations thereof.

[0045]

[0046] The present invention provides a composition in which the effects of skin regeneration, wound treatment, and wound recovery are maximized after application.

[0047] The present invention provides a wound healing composition comprising one or more substances from the group consisting of succinic acid, fumaric acid, malic acid, and tartaric acid.

[0048] The present invention further comprises a Centella asiatica extract, said Centella asiatica extract comprising madecassoside, asiaticoside, madecassic acid, and asiatic acid.

[0049] The above Centella asiatica extract possesses anti-inflammatory and antibacterial properties, and when combined with succinic acid, the induction of collagen synthesis is further enhanced, resulting in an improved function as a wound healing composition.

[0050] Furthermore, the present invention may further include bamboo leaf components. Bamboo leaf extract contains bioactive components such as flavonoids, polyphenols, and silica, exhibiting powerful antioxidant, antibacterial, and anti-inflammatory effects. In particular, it plays a role in protecting cells and promoting tissue regeneration during the wound healing process, and when used in combination with polyurethane dressing foam, it can enhance the skin barrier strengthening effect. Additionally, bamboo leaf components have excellent moisturizing effects, preventing dryness of the wound area and creating a more optimal healing environment.

[0051] In addition, the present invention may further include propolis components. Propolis contains powerful antibacterial, antiviral, and anti-inflammatory components, making it effective in reducing the risk of infection at the wound site and alleviating inflammatory responses. In particular, it is rich in flavonoids and phenolic compounds, which inhibit free radicals and promote tissue regeneration, thereby increasing the speed of wound healing. Furthermore, propolis helps restore the skin barrier to improve the protective capacity of the wound site, and through combined treatment with succinic acid and Centella asiatica extract, it further promotes collagen synthesis, thereby providing a more effective therapeutic composition.

[0052] The present invention may further include physiological or pharmacological active substances that aid in wound healing. Such active substances may include antibiotics, wound healing promoters, disinfectants, local anesthetics, and anti-inflammatory agents.

[0053] Antibiotics include penicillin antibiotics such as amoxicillin, ampicillin, moxolactam, piperacillin, sulfenicillin, talampicillin or their salts; cephalosporin antibiotics such as cefadroxil, cefatrizine, cefradine, cefaclor, cefotiam, cefuroxim, cefixim, ceftriaxone, cefepim, cefpirom or their salts; beta-lactam antibiotics such as azusureonam, meropenem or their salts; aminoglycoside antibiotics such as amikacin, abekacin, isefamicin, sisomycin, tobramycin, vancomycin or their salts; macrolide antibiotics such as azithromycin, clarithromycin, erythromycin, midecamycin, roxithromycin, spiramycin or their salts; ciprofloxacin, enoxacin, gatifloxacin, levofloxacin, There are quinolone antibiotics such as lomefloxacin, tosufloxacin or their salts, tetracycline antibiotics such as doxycycline, metacycline, minocycline, tetracycline or their salts, and in addition, antimicrobial substances such as bacitricin, chloroxylenol, clindamycin, fusafungin, gentamicin, mafenid, mupirocin, neomycin, nitrofurazone, oxytetracycline, retapamulin, sulfadiazine, tyrothricin, fusidic acid, polymyxin, nystatin or their salts may be included.

[0054] In addition, the present composition may include a disinfectant as an active substance for the initial sterilization and disinfection of a wound, examples of which include glutaryl concentrate, benzalkonium, benzethonium, chlorhexidine, cresol, ethanol, isopropylethanol, povidone iodine, silver nitrate, or salts thereof. Furthermore, the present invention may include a wound healing promoter to promote wound healing, examples of which include water-soluble azulene, polycresulene, becapremin, Centella Asiatica extract, dexpanthenol, skin keratinocytes, lysozyme, polydeoxyribonucleoside, solcoceryl 120 concentrate, trapermin, or salts thereof. Local anesthetics may also be included, examples of which include benzocaine, bupivacaine, levobupivacaine, lidocaine, mepivacaine, procaine, ropimacaine, tetracaine, prilocaine, or salts thereof.

[0055] In addition, anti-inflammatory agents may also be included in the composition, such as alcromethasone, amminolone, beclomethasone, budesonide, clobetasol, desonide, desoximethasone, dexaltin NK, dexamethasone, diflucotolon, fluocinolone, fluocinonide, fluticasone, halcinoide, hydrocortisone, methylprednisolone, prednicarbate, prednisolone, triamcinolone, or salts thereof.

[0056] The composition of the present invention may additionally include a preservative, and various compounds suitable for this purpose may be used. For example, quaternary ammonium compounds include benzalkonium chloride, benzethonium chloride, cetrimide, dequalinium chloride, and cetylpyridinium chloride, and alcohol-based drugs include chlorobutanol, phenylethyl alcohol, and benzyl alcohol. In addition, parabens such as methylparaben, ethylparaben, propylparaben, and butylparaben may be included as examples, and esters of parahydroxybenzoic acid are suitable as antibacterial esters. Furthermore, antimicrobial agents such as chlorhexidine, chlorocresol, benzoic acid, polymyxin, and phenoxyethanol may also be utilized. Preferably, sodium benzoate, phenoxyethanol, benzyl alcohol, methylparaben, imidazolidinyl urea, and diazolidinyl urea may be used as preservatives, and it is appropriate to include them in an amount of 0.1 to 10 weight percent of the total weight of the composition.

[0057] In addition, the present invention may further include a plasticizer, a thickener, a surfactant, and a preservative. The plasticizer is selected from propylene glycol, polyethylene glycol, propylene carbonate, labrazol, transcutol, labrapack, flurol oleate, lauroglycol, capriol, labrafil, migliol, glycerin, or a mixture thereof. The thickener is selected from hydroxypropylcellulose, hydroxypropylcellulose, hydroxyethylcellulose, xanthan gum, logust bean gum, gum arabic, guar gum, carbomer, polyethylene oxide, poloxamer, or a mixture thereof. The above surfactant is selected from polysorbate, polyethylene hydroxystearate, polyethoxylated castor oil, ethylene oxide / propylene oxide copolymer, stearoyl macrogol-32 glyceride, lauroyl macrogol-32 glyceride, propylene glycol monocaprylate, cappylocaproyl macrogol-8 glyceride, sodium lauryl sulfate, sodium docusate, benzalkonium chloride, benzethonium chloride, or mixtures thereof.

[0058]

[0059] The present invention provides a method for preparing a wound healing composition that can be utilized as a physiologically active substance, a pharmacologically active substance, a film-forming substance, a cosmetic composition material, a quasi-drug composition material, or a pharmaceutical composition material, comprising the steps of: dissolving succinic acid in high-purity dimethyl sulfoxide (DMSO); and diluting the dissolved succinic acid in distilled water (DW).

[0060] The purity of the above-mentioned dimethyl sulfoxide (DMSO) is characterized as being 50 to 100%, preferably 70 to 100%, more preferably 90 to 100% or 100%. When dissolving at a purity below this range, there is a limitation in that some organic acids, including succinic acid, do not dissolve. Therefore, considering the physical properties (solubility) of the raw material and potential harm to the human body, it is preferable to first perform dissolution in high-purity dimethyl sulfoxide and then dilute it to a low concentration with distilled water. It is preferable to dilute it to 1 / 100 or less of the existing concentration.

[0061] The succinic acid mentioned above possesses performance characteristics that are more suitable as a wound healing composition compared to other organic acids. Compared to other organic acids, it exhibits concentration-dependent and time-dependent properties. Furthermore, it possesses not only the ability to heal wounds through cell regeneration but also the ability to synthesize collagen, making it the most desirable choice as a wound healing composition containing organic acids.

[0062] The present invention is characterized by further comprising a diluted solution obtained by dissolving one or more substances from the group consisting of fumaric acid, malic acid, and tartaric acid in high-purity dimethyl sulfoxide (DMSO) and then diluting it in distilled water (DW). Since the fumaric acid, malic acid, and tartaric acid also possess wound healing capabilities through cell regeneration, they can exhibit enhanced wound healing performance when combined with succinic acid.

[0063] The present invention provides a method for preparing a wound healing composition characterized by further including a Centella asiatica extract, wherein the Centella asiatica extract comprises madecassoside, asiaticoside, madecassic acid, and asiatic acid.

[0064] The present invention comprises a wound healing agent coated with one or more substances selected from the group consisting of succinic acid, fumaric acid, malic acid, and tartaric acid. The wound healing agent provides a wound healing agent composed of a polyurethane dressing foam.

[0065] The above-mentioned polyurethane is a polymer compound containing urethane bonds formed by the reaction of alcohol groups and isocyanate groups, and is a synthetic rubber with excellent ozone resistance and wear resistance. For this reason, it is widely used in various fields, such as automobile tires and household mattresses. The present invention relates to a technology for manufacturing a dressing foam that can be used at the incision site after laparoscopic surgery and single-port laparoscopic surgery using polyurethane.

[0066] In particular, the dressing foam manufactured in the present invention is characterized by improving the inhibition of infection at the wound site, disinfection effect, and skin regeneration effect by modifying the surface of the dressing foam through treatment with NO (nitric oxide) plasma.

[0067] Here, "plasma" refers to a state of matter in which negatively charged electrons and positively charged ions are separated in a gaseous state, and is commonly referred to as the "fourth state of matter." When NO plasma is generated and applied to the dressing foam manufacturing process, the infection inhibition and disinfection effects are enhanced through the modification of the dressing foam surface, and the skin regeneration ability of the wound site is improved.

[0068] In the present invention, the term “surface modification” of the dressing foam refers not only to a state in which the beneficial effects of NO can be utilized by having NO gas remain on the surface of the polyurethane constituting the dressing foam, but also to both effects of solving problems such as skin tissue adhering to the dressing material by reducing the size of open pores that are too large, which is a problem of conventional polyurethane foam, through the use of NO plasma in the manufacturing process. The above-mentioned effects are only a part of the various effects resulting from surface modification, and the effects of the present invention are not limited by the contents described above.

[0069] Specifically, in the present invention, the NO (nitric oxide) plasma treatment may be performed by treating with NO plasma gas at a concentration of 100 to 8000 ppm, more specifically at 1200 to 7600 ppm, and most specifically at 1600 to 3600 ppm, and the treatment time may be 2 to 300 seconds, or more specifically at 20 to 90 seconds, but is not limited thereto.

[0070] If the treatment is performed at a concentration lower than the NO plasma treatment concentration disclosed above, the amount of residual NO is small, so the desired effect cannot be obtained, and if the concentration exceeds the above concentration, it may exhibit an effect that inhibits cell survival.

[0071] The dressing foam of the present invention may include natural medicinal products such as willow bark, white wood ear mushroom, Sophora root, iris, licorice, grapefruit seeds, Centella asiatica, Portulaca oleracea, Citrus aurantium, and aloe. These natural medicinal products may be prepared by extracting one or more of the natural products using a vacuum nano extractor and then treating them with NO plasma in the range of 2,000 to 8,000 ppm. The natural product extract may be extracted using water, C1 to C4 lower alcohols, or a mixture thereof as a solvent; in particular, extraction using water is also possible. The extraction process may utilize one or more of various methods, such as cold maceration, hot maceration, heating, reflux, and ultrasonic extraction, either individually or in combination, and may be appropriately modified and applied as needed. Furthermore, the extract may be concentrated by removing the solvent through a vacuum filtration process after extraction or fractionation, or through additional concentration or freeze-drying processes. Specifically, it is possible to obtain the extract by undergoing a vacuum concentration step after extraction, and such a process may be appropriately modified and utilized as needed.

[0072] In addition, the above-mentioned preparation may have a three-dimensional shape with a protruding central part, and more preferably, may be dome-shaped. When formed in a three-dimensional dome shape, it is easier to insert into the treatment site and has the effect of providing superior wound healing performance.

[0073] In addition, the present invention may be formed by applying one or more substances from the group consisting of succinic acid, fumaric acid, malic acid, and tartaric acid to the polyurethane dressing foam. In addition, it may be formed by further including Centella asiatica extract, bamboo leaf components, or propolis components.

[0074] In addition, the present invention may apply one or more substances from the group consisting of succinic acid, fumaric acid, malic acid, tartaric acid, Centella asiatica extract, bamboo leaf components, or propolis components to the polyurethane dressing foam to form a grid pattern in multiple lines.

[0075] The above plurality of lines are preferably formed in the central part of the polyurethane dressing foam, and in the case of a polyurethane dressing foam with a protrusion formed thereon, a plurality of lines may be formed on the surface of the protrusion.

[0076] As shown in FIGS. 14 and 15, the wound healing agent of the present invention can be applied in a grid pattern to the wound healing agent of the present invention. By applying the wound healing agent in a grid pattern, the organic acid-based agent having wound healing efficacy and the polyurethane dressing foam agent having exudate absorption efficacy can function simultaneously, resulting in a superior effect. The organic acid-based agent according to the present invention is sprayed or applied to the polyurethane dressing foam through a filter having a grid pattern, and is manufactured by undergoing a sterilization process after drying (including freeze-drying and natural drying). Accordingly, when it comes into contact with the wound area of ​​the affected site, the wound healing efficacy provided by the formulation (agent) and the wound healing efficacy provided by the polymer (polyurethane) (exudate removal) occur simultaneously, exhibiting a synergistic effect in wound healing.

[0077] The materials constituting the filter are not limited to plastics, metals, polymers, Gore-Tex, etc. Among these, using a Gore-Tex filter can further help the formulation maintain a consistent shape. Gore-Tex is a special film (membrane, filter) material that possesses both waterproofness and breathability. When applying a formulation to wound healing agents where maintaining a moist environment and absorbing exudate are important, it can be advantageous for maintaining a specific shape and maintaining an appropriate moist environment. When the formulation is sprayed onto the agent, it can maintain a consistent shape without spreading or dripping.

[0078] The width of the lines forming the grid pattern is preferably 300 to 1000 µm. If it is thinner than 300 µm, it is difficult to operate and control the filter for applying the wound healing agent, and the exudate removal efficacy of the polyurethane foam is reduced, which may slow down wound healing. In addition, if it exceeds 1000 µm, the flexibility of the dressing foam may decrease due to the applied agent, and the adhesion to the wound site may decrease. Furthermore, the function of the dressing foam may deteriorate due to an imbalance in the absorption of exudate.

[0079] In addition, repeated formulation application experiments confirmed that the absorption capacity of the formulation was best at 300 to 600 µm. It was confirmed that the adhesion of the formulation to the material (polyurethane dressing foam) after spraying was best in this range.

[0080] The wound healing agent of the present invention can simultaneously maximize the wound healing effect of the organic acid-based agent and the exudate absorption function of the polyurethane dressing foam through the grid-pattern application method, and can contribute to improving the speed of wound healing and reducing the risk of infection. In addition, compared to the conventional uniform application method, the grid-pattern application method can optimize the local drug concentration at the wound site and ensure both economic efficiency and effectiveness by minimizing the use of unnecessary agents.

[0081] Through these characteristics, the wound healing agent of the present invention can be effectively applied in various medical environments, such as general wound treatment, as well as burns, wounds, pressure ulcers, diabetic foot ulcers, and post-surgical dressings. It is expected to be useful for wound treatment and skin regeneration as it possesses efficacy in wound healing, sterilization, prevention of scar tissue, inhibition of scar tissue, and wound recovery.

[0082]

[0083] The present invention will be described in detail below through examples and experimental examples. However, the following examples and experimental examples are solely for the purpose of specifically describing the present invention and do not limit the scope of the present invention.

[0084]

[0085] Example 1. Preparation of a wound healing composition

[0086] One or more substances from the group consisting of succinic acid, fumaric acid, malic acid, and tartaric acid are dissolved in high-purity (100%) dimethyl sulfoxide (DMSO), and then diluted in distilled water (DW) to prepare a concentration of 1 / 100. Additionally, it may be prepared by further including Centella asiatica extract, bamboo leaf components, or propolis components.

[0087]

[0088] Example 2. Preparation of a polyurethane dressing foam coated with a wound healing composition

[0089] The composition prepared according to Example 1 above is applied by spraying it onto a dome-shaped polyurethane dressing foam (μ45PS, μ30PS) using a Gore-Tex filter, and then dried by a freeze-drying method. The grid-patterned line sections are set as the sections where the formulation can adhere to the foam after spraying during application. It was confirmed that the efficacy of this formulation is exhibited at a distance of at least 300μm.

[0090]

[0091] *

[0092] Experimental Example 1. Evaluation of Solubility for Preparation of Optimal Composition

[0093] 1.1. Sample Preparation

[0094] Prepare four types of organic acids (Fumaric acid, DL-Malic acid, Succinic acid, L(+)-Tartaric acid), distilled water (DW), ethanol (Et-OH), and dimethyl sulfoxide (DMSO).

[0095]

[0096] 1.2. Evaluation of Organic Acid Solubility

[0097] Solubility evaluations were conducted using five solvents (DW, 70% Et-OH, 100% Et-OH, 10% DMSO, 100% DMSO). The tests were performed by adding 100 mg and 10 mg of each solute (Succinic acid, Tartaric acid, Malic acid, Fumaric acid).

[0098] As shown in Figure 1, the evaluation results showed that 10 mg and 100 mg of Tartaric acid and Malic acid were 100% soluble in Distilled Water (DW), 70% Ethanol, 10% DMSO, and 100% DMSO. 100 mg of Succinic acid and Fumaric acid were not soluble in 10% DMSO. On the other hand, 100 mg of Succinic acid and Fumaric acid were confirmed to be completely soluble in 100% DMSO. Therefore, since all four types of organic acids are completely soluble in 100% DMSO, the sample to be used in the experiment was prepared by dissolving 100 mg in 100% DMSO and then diluting it with DW at a ratio of 1 / 100 (final DMSO concentration of 0.1% or less).

[0099]

[0100] Experimental Example 2. In vitro experiment

[0101] 2.1. Cytotoxicity Test

[0102] The experiment is conducted using the composition prepared through the above Example 1. 3×10 cells of human skin keratinocyte cell line HaCaT cells and human-derived fibroblasts Norma Human Dermal Fibroblasts are used. 5 Cells were plated in a 96-well plate at a concentration of cells / mL and stabilized by incubating in a 37°C, 5% CO2 incubator for 24 hours. Subsequently, all culture medium was removed from the cells, and 180 μL of DMEM medium containing 1% P / S without FBS and 20 μL of an appropriately diluted sample were added, followed by incubation for 24 hours. During this process, 1 μg / mL (20 μL) of LPS was used as a control. After removing all culture supernatant, 100 μL of MTT solution (500 μg / mL) was added to the attached cells and incubated for 30 minutes. 100 μL of DMSO was added, and the absorbance was measured at OD 550 nm.

[0103] In the HaCaT cell experiment, all samples used in the test, including allantoin (50 μg / mL, positive control), showed a survival rate of over 80% compared to 0.1% DMSO (negative control), indicating no specific cytotoxicity to HaCaT cells. Significant cell proliferation occurred with 10 μg / mL tartaric acid (18.3%) and fumaric acid in the concentration range of 0.1–10 μg / mL compared to 0.1% DMSO. Tartaric acid increased by 18.3% (**p<0.01), while fumaric acid increased by 23.5%, 18.3%, and 22.7% (**p<0.001), respectively. In cells treated with succinic acid, a concentration-dependent increase was observed in the range of 1–100 μg / mL.

[0104] In the HDF cell experiment, all samples used in the test, including allantoin (50 μg / mL, positive control), showed a survival rate of over 80% compared to 0.1% DMSO (negative control), indicating no severe cytotoxicity to HDF cells. Concentration-dependent cell proliferation was observed with succinic acid.

[0105] Toxicity evaluation on THP-1 suspension cells was performed using WST-1 solution instead of MTT solution. Specifically, 20 μL of WST-1 solution was applied to the cells without changing the medium after 24 hours of culture, and the OD (540 nm) value was measured after 30 minutes of culture.

[0106] THP-1 cell experiment results showed that all samples used in the test, including Allantoin (50 μg / mL, positive control), exhibited a survival rate of over 80% compared to 0.1% DMSO (negative control), indicating no severe cytotoxicity to THP-1 cells.

[0107]

[0108] 2.2. Wound Healing Test

[0109] The experiment is conducted using the composition prepared through Example 1 above. 3 to 7 x 10⁴ in a 6-well plate 5HaCaT cells (human skin keratinocytes) were plated at a concentration of cells / mL and cultured overnight until approximately 80–90% confluence was achieved. A straight wound was created in the cells using a tip, and after light washing to remove unattached cells, the media was replaced with fresh media. Images (at 40x and 100x magnification) were acquired using a phase contrast microscope. After adding the sample, the cells were incubated in a 37°C, 5% CO2 incubator. Images were acquired after 24, 48, and 72 hours to calculate the length and area of ​​the wound and compare the degree of wound healing.

[0110] As shown in Figure 3, the experimental results in 40x magnification images showed that succinic acid caused a concentration-dependent and time-dependent reduction in wound length. In particular, a succinic acid concentration of 100 μg / mL reduced wound length more efficiently than 0.1% DMSO and Allantoin (50 μg / mL) used as controls. At a treatment concentration of 100 μg / mL and after 72 hours, succinic acid reduced wound length by 21.1±2.12%, which was more than 2.7 times faster than DMSO (55.9±3.46%) and Allantoin (56.9±1.94%) (***p<0.001). In the case of tartaric acid, a time-dependent reduction in wound length was confirmed at a treatment concentration of 10 μg / mL. At a treatment concentration of 10 μg / mL and after 72 hours, tartaric acid reduced wound length by 23.1 ± 0.7%, which was 2.4 times faster than DMSO and allantoin (***p<0.001). In the case of malic acid, wound healing was observed at concentrations of 10 to 100 μg / mL, but it did not show significantly improved efficacy compared to 0.1% DMSO (negative control). In particular, there were no significant changes over concentration or time. Fumaric acid demonstrated concentration-dependent and time-dependent efficacy in reducing wound length within the concentration range of 0.1 to 10 μg / mL. Notably, excellent efficacy was observed at concentrations of 1 μg / mL and 10 μg / mL. Based on a 72-hour treatment period, the wound length ratios of fumaric acid at treatment concentrations of 1 μg / mL and 10 μg / mL were 18.9 ± 1.11% and 20.0 ± 2.1%, respectively (***p<0.001). On the other hand, at a high concentration of 100 μg / mL, Fumaric acid was observed to rapidly decrease in efficacy with a wound length ratio of 60.1 ± 3.3%.

[0111] As shown in Figure 4, just as with the 40x magnification analysis (wound length analysis), analysis of the 100x magnification image (wound area) revealed that succinic acid caused a concentration-dependent and time-dependent reduction in wound area at concentrations ranging from 0.1 μg / mL to 100 μg / mL. Succinic acid at a concentration of 100 μg / mL reduced the wound area more effectively than 0.1% DMSO and Allantoin (50 μg / mL) used as controls. At a treatment concentration of 100 μg / mL and after 72 hours, succinic acid reduced the wound area by 28.8 ± 0.43%, which was 2.1 times and 2.3 times faster than DMSO (61.2 ± 0.22%) and Allantoin (66.5 ± 0.61%), respectively (***p<0.001). In the case of tartaric acid, a time-dependent reduction in wound area was confirmed at a treatment concentration of 10 μg / mL. At a treatment concentration of 10 μg / mL and after 72 hours, Tartaric acid reduced wounds by 23.1 ± 0.2%, which was 2.6 times and 2.9 times faster than DMSO and Allantoin, respectively (***p<0.001). Malic acid did not show any time- or concentration-dependent synergistic effects. Fumaric acid demonstrated concentration- and time-dependent efficacy in reducing wound area within the concentration ranges of 1 μg / mL and 10 μg / mL. At 72-hour treatment, the wound area ratios of Fumaric acid at 1 μg / mL and 10 μg / mL were 33.0 ± 0.32% and 30.8 ± 0.38%, respectively (***p<0.001). On the other hand, at a high concentration of 100 μg / mL, the efficacy of Fumaric acid was observed to drop sharply, with the wound area ratio dropping to 81.4 ± 0.46%.

[0112] As a result of analyzing wound length and wound area using 40x and 100x magnification images, excellent wound healing effects were observed in in vitro cell experiments when using 100μg / mL succinic acid, 10μg / mL tartaric acid, and 1μg / mL and 10μg / mL fumaric acid.

[0113]

[0114] 2.3. Cell proliferation test

[0115] The experiment is conducted using the composition prepared through Example 1 above. 3×10 HaCaT cells 5 Cells were plated in a 96-well plate at a concentration of cells / mL and stabilized by incubating in a 37°C, 5% CO2 incubator for 24 hours. Subsequently, all culture medium was removed from the cells, and 180 μL of DMEM medium containing 1% P / S without FBS and 20 μL of an appropriately diluted sample were added, followed by incubation for 24, 48, and 72 hours. Cell proliferation ability induced by the sample was measured by adding MTT solution to adhered cells from which the culture supernatant had been completely removed, and was expressed as the cell proliferation rate (%) relative to the untreated group.

[0116] As shown in Figure 5, the experimental results showed that succinic acid induced proliferation of HaCaT cells in a concentration- and time-dependent manner. At 72 hours, succinic acid showed significant cell proliferation compared to DMSO, with 115.99±10.75% at a concentration of 10 μg / mL and 125.5±8.12% at a concentration of 100 μg / mL. A significant increase compared to DMSO was also observed in the treatment with a mixture of succinic acid and tartaric acid (ST mix).

[0117] As shown in Figure 6, the experimental results showed that the cell proliferation rate of the group treated with 100 μg / mL of succinic acid increased in a time-dependent manner. Based on 100% at 0 hours, it increased to 178.5±7.93% at 24 hours, 279.2±2.54% at 48 hours, and 299.9±6.4% at 72 hours. When 100 μg / mL of succinic acid was treated together with various concentrations of Centella asiatica extract, the cell proliferation rate showed a tendency to increase in a concentration-dependent manner of the Centella asiatica extract. In the case of Centella asiatica extract, the highest proliferation rate was observed at treatment concentrations of 0.1 μg / mL and 1 μg / mL, followed by a decrease at concentrations of 10 μg / mL or higher, but no significant difference was observed between treatment concentrations.

[0118]

[0119] 2.4. Cytokine and Growth Factor Measurement Test

[0120] 3x10 human-derived monocyte cell line THP-1 cells 5 Cells were plated in a 96-well plate at a concentration of cells / mL and stabilized by incubation in a 37°C, 5% CO2 incubator for 24 hours. All culture medium was removed, and 180 μL of RPMI medium and 20 μL of an appropriately diluted sample were added, followed by incubation for 24 hours. The content of the inflammatory cytokines TNF-α and IL-1β, and the growth factor TGF-β, released from the cell culture supernatant, was measured using the sandwich ELISA method. The content of TNF-α, IL-1β, and TGF-β analyzed by the ELISA method was calculated as the yield (pg / mL) using a standard curve constructed with the lyophilized recombinant protein provided by the manufacturer.

[0121] As shown in Figure 7, the experimental results showed that the succinic acid, tartaric acid, and mixture used in the test did not induce the expression of TNF-α, IL-1β, and TGF-β1 in THP-1 cells. This suggests that they are ineffective in inducing the expression of inflammatory cytokines and growth factors in immune cells.

[0122]

[0123] 2.5. Verification Test of EMT Factor Changes

[0124] The experiment is conducted using the composition prepared through Example 1 above. HaCaT cells 3 x 10 5 Cells / mL were plated into a 6-well plate and stabilized by incubating at 37°C in a 5% CO2 incubator for 24 hours. All culture medium was removed, and 180 μL of DMEM medium and 20 μL of an appropriately diluted sample were added, followed by incubation for 24 hours. After removing the culture medium and harvesting the cells, they were lysed with Trizol, and changes in the expression of Fibronectin, E-cadherin, and Vimentin were measured using Real-time PCR. GAPDH was used as an internal control. The primer sequences used for RT-qPCR are as follows.

[0125] GeneSequences (5' to 3')FibronectinForwardAGCCGAGGTTTTTAACTGCGAReverseGCTTGCAGGTCCATTCTCCTE-cadherinForwardTCATGAGTGTCCCCCGGTATReverseTCTTGAAGCGATTGCCCCATVimentinForwardTTGCCTCTCCCCCACAAATCReverseACCTGAACCTCTCAAATTAGCCAGAPDHForwardAGGTGAAGGTCGGAGTCAACReverseTTCTCAGCCTTGACGGTGC

[0126] Representative factors affecting the epithelial mesenchymal transition (EMT) of skin keratinocytes include fibronectin6), E-cadherin7)8)9), and vimentin10). In this experiment, changes in the expression of EMT factors were measured following treatment with succinic acid and Centella asiatica extract.

[0127] As shown in Figure 8, the experimental results showed that the expression of Fibronectin increased in a concentration-dependent manner with succinic acid. Compared to 0.1% DMSO at 1.0±0.08 times, it significantly increased by 1.2±0.11 times at 0.1μg / mL, 3.0±0.73 times at 1μg / mL, 4.0±0.67 times at 10μg / mL, and 6.1±0.37 times at 100μg / mL (***p<0.001). On the other hand, Centella asiatica extract decreased in a concentration-dependent manner, decreasing by 6.98±0.59 times at 0.1μg / mL, 2.12±0.35 times at 1μg / mL, and 0.71±0.05 times at 10μg / mL compared to DMSO.

[0128] In the case of the mixture of succinic acid and Centella asiatica extract, an increase in Fibronectin expression was confirmed when the mixture was treated at a high concentration (100 / 10). E-cadherin expression decreased in a succinic acid concentration-dependent manner (Figure 24). It was significantly reduced compared to DMSO (1.0±0.08 times), with 1.2±0.12 times at 0.1 μg / mL, 1.0±0.22 times at 1 μg / mL, 0.48±0.22 times at 10 μg / mL, and 0.1±0.01 times at 100 μg / mL (***p<0.001).

[0129] In the case of Centella asiatica extract, it decreased by 0.09±0.03 times, 0.07±0.04 times, and 0.03±0.02 times in the concentration range of 0.1–10 μg / mL used in the test, showing a significant decrease compared to DMSO (***p<0.001).

[0130] The expression of E-cadherin by a mixture of succinic acid and Centella asiatica extract (SA / CA Mix) also showed a significant decrease compared to DMSO. It was found to be 0.07±0.01 times at a SA / CA 1 / 0.1 concentration, 0.05±0.01 times at a SA / CA 10 / 1 concentration, and 0.28±0.09 times at a SA / CA 100 / 10 concentration.

[0131] Vimentin expression decreased in a concentration-dependent manner with succinic acid. It decreased by 4.0±0.61 times at 0.1 μg / mL, 2.2±0.22 times at 1 μg / mL, 1.1±0.03 times at 10 μg / mL, and 0.72±0.08 times at 100 μg / mL, showing a significant difference at 0.1 μg / mL compared to DMSO (1.0±0.08 times) (***p<0.001). On the other hand, Centella asiatica extract increased in a concentration-dependent manner. It increased by 1.68±0.19 times at 0.1 μg / mL, 2.26±0.5 times at 1 μg / mL, and 3.12±0.21 times at 10 μg / mL, showing a significant difference compared to DMSO at 10 μg / mL (*p<0.05). In the case of the mixture, a concentration-dependent change was observed.

[0132] Wound healing induced by succinic acid in skin keratinocytes appears to occur due to an increase in fibronectin and a decrease in E-cadherin, which play important roles in the EMT process. Meanwhile, wound healing induced by Centella asiatica extract appears to occur due to a decrease in E-cadherin and an increase in vimentin among the EMT components.

[0133] When succinic acid and Centella asiatica extract are mixed and treated, the expression of the EMT factor is delayed; this characteristic can help inhibit scar formation by effectively controlling inflammatory responses and infections.

[0134]

[0135] 2.6. Verification Test of Changes in Cell Remodeling Factors

[0136] Experiments were conducted using the composition prepared in Example 1 above. Human Normal Dermal Fibroblasts cells were plated and cultured overnight until ~80% confluence was achieved. 20 μL of the sample was added and cultured for an additional 24 hours. The expression level of collagen from the culture medium was measured using the ELISA method.

[0137] As shown in Figure 9, experimental results showed that the expression of procollagen by a mixture of succinic acid and Centella asiatica extract was significantly different when 10 μg / mL of Centella asiatica extract was added compared to 100 μg / mL of succinic acid alone (29.9 ± 2.1 pg / mL) (p<0.001). It was confirmed that using a mixture of succinic acid and Centella asiatica extract can help with wound healing and remodeling by increasing the expression of procollagen.

[0138]

[0139] Example 3. In vivo experiment

[0140] Specific Pathogen-Free (SPF) Sprague-Dawley (SD) rats were acclimatized in the animal room where the test was conducted for 15 days after acquisition, and general symptoms were observed at least once a day. Upon reviewing the pathogen test results of the test chickens provided by the animal supplier, no factors that could affect the test were found.

[0141] Before the start of the test (Day 1), hair was removed using clippers after isoflurane inhalation anesthesia, and after disinfecting with povidone iodine, the skin on the dorsal side was lifted with forceps.

[0142] After placement, a wound was formed by excising with surgical scissors. On the day of the study (Day 1) and on days 6, 9, and 12 after the administration of the test substance, the size of the wound was measured using a vernier caliper based on the long axis, and the wound site was photographed using a digital camera. For the preparation of the test substance, 15 mL of the sample solution (2% CMC only, 50 μM succinic acid, 100 μM succinic acid, or 100 μM succinic acid + 5% (w / v) Centella asiatica extract) was dispensed into a petri dish and allowed to be sufficiently absorbed into a foam provided by the client, which had been cut into four equal parts in advance. For administration of the test substance, the foam soaked in the sample was placed over the wound, wrapped with gauze, and the dressing was secured by wrapping the rat with adhesive tape cut to a sufficient length. The test substance was applied once a day for 12 days. After the end of the experiment (Day 12), the experimental animals were sacrificed using CO2, and the skin at the wound site was incised to perform H&E staining and measure the collagen content in the dermis using ELISA.

[0143] As shown in Figure 10, the experimental results showed that wound healing occurred over time in all test groups. Wound healing proceeded more rapidly in the test groups treated with succinic acid samples (G3, G4, and G5) compared to the G1 (Untreated) and G2 (Fucidin) treatment groups.

[0144] As shown in Figure 11, on day 6 of the experiment, the concentration of G3 (Succinic acid 50 μM, wound area 73.8 ± 3.19%) showed superior performance compared to other groups in the onset of initial wound healing. In particular, significant wound healing occurred compared to G1 (Untreated group, wound area 102.5 ± 6.75%) (*p < 0.05). The order of the speed of initial healing was G3, G4 (Succinic acid 100 μM, wound area 85.1 ± 5.97%), G5 (Succinic acid 100 μM + CA 5%, wound area 92.3 ± 6.34%), G2 (Fucidin, wound area 97.3 ± 2.72%), and G1. On day 9 of the experiment, the rankings of G3 and G4 regarding wound healing speed changed, but there was no significant difference. Compared to G1 (wound area 76.1±7.1%), G3 (wound area 46.3±3.15%, **p<0.01), G4 (wound area 40.9±2.12%, ##p<0.01), and G5 (wound area 52.2±4.15%, $p<0.05) all showed significant wound healing. Subsequently, on day 12, the wound healing rates of the top three groups appeared similar. On day 12, G2 (wound area 40.3±3.68%), G3 (wound area 27.2±3.48%), G4 (wound area 22.5±3.06%), and G5 (wound area 24.5±3.14%) all showed a higher degree of wound healing compared to G1 (wound area 53.5±6.17%), with G2 being 24.8%, G3 49.2%, G4 57.9%, and G5 54.3% higher than G1.

[0145] As shown in Figure 12, observation of the entire wound area using 1000 μm scale images from H&E staining revealed that the group treated with 100 μM succinic acid + 5% Centella asiatica extract (Group 5) showed the fastest degree of wound healing. Analysis of the granulation tissue revealed that in the case of G1, the number of fibroblasts was relatively small and the structure was loose. In contrast, the fibroblasts in the experimental groups treated with Fucidin and succinic acid were densely formed, and significant collagen formation was observed. Collagen formation was particularly high in G3, G4, and G5, which were treated with samples containing succinic acid.

[0146] When the total number of hair follicles and sebaceous glands regenerating in the wound area was measured, G4 had the highest number of regenerated at 21.5±4.68, followed by G5 at 18.7±5.99, G3 at 15.8±3.76, and G2 at 13.2±7.63, showing a larger number of regenerated hair follicles and sebaceous glands compared to G1, which had 8.8±4.58.

[0147] Statistical analysis revealed a significant increase in G3, G4, and G5 compared to G1 (*p<0.05, **p<0.01). In the inter-group comparison, G4 showed a significant difference from G2 and G3 (#p<0.05). H&E staining confirmed that G4 and G5 exhibited the best wound healing. Additionally, G4 appears to have a thinner epidermal layer compared to other experimental groups, leading to faster wound healing; this suggests that abnormal scar formation is less likely to occur.

[0148] As shown in Figure 13, the collagen content expressed in the dermis of rat skin was measured using a Procollagen type I c-peptide ELISA kit and normalized by the total protein content of the tissue used in the experiment. The collagen expression levels in the dermis by the samples were 146.8±39.69 μg / mL in group G2, 168.5±27.96 μg / mL in group G3, and 178.6±35.11 μg / mL in group G4, all of which were higher than the 131.9±21.5 μg / mL expressed in group G1. Significant differences were observed between G3 and G4 compared to G1 (*p<0.05). On the other hand, group G5, treated with a mixture of 100 μg / mL succinic acid and 5% Centella asiatica extract, showed a lower expression level of 143.4±27.26 μg / mL compared to G3 and G4. A significant difference was observed between the G4 and G5 groups (#p<0.05). From this, it is concluded that succinic acid has the effect of increasing collagen synthesis in animal skin.

[0149] The present invention relates to a composition, a formulation, and a formulation containing the same for wound healing, and is industrially applicable as it is used in the wound dressing industry.

Claims

1. A wound healing composition comprising one or more substances from the group consisting of succinic acid, fumaric acid, malic acid, and tartaric acid.

2. In Paragraph 1, A wound healing composition characterized by further including Centella asiatica extract, wherein the Centella asiatica extract comprises madecassoside, asiaticoside, madecassic acid, and asiatic acid.

3. In Paragraph 1, A wound healing composition further comprising bamboo leaf components or propolis components.

4. A method for preparing a wound healing composition comprising the steps of: dissolving succinic acid in high-purity dimethyl sulfoxide (DMSO); and diluting the dissolved succinic acid in distilled water (DW).

5. In Paragraph 4, A method for preparing a wound healing composition characterized by the purity of the above-mentioned dimethyl sulfoxide (DMSO) being 100%.

6. In Paragraph 4, A method for preparing a wound healing composition characterized by further including a diluted product obtained by dissolving one or more substances from the group consisting of fumaric acid, malic acid, and tartaric acid in high-purity dimethyl sulfoxide (DMSO) and then diluting it in distilled water (DW).

7. In Paragraph 4, A method for preparing a wound healing composition characterized by further including Centella asiatica extract, wherein the Centella asiatica extract includes madecassoside, asiaticoside, madecassic acid, and asiatic acid.

8. A wound healing preparation applied with one or more substances from the group consisting of succinic acid, fumaric acid, malic acid, and tartaric acid.

9. In Paragraph 8, The above preparation is a wound healing preparation composed of a polyurethane dressing foam.

10. In Paragraph 8, The above-mentioned preparation is a wound healing preparation characterized by having a three-dimensional shape with a protruding central part.

11. In Paragraph 10, A wound healing agent characterized by the above-mentioned three-dimensional shape being a dome shape.

12. In Paragraph 8, A wound healing agent characterized by applying one or more substances from the group consisting of succinic acid, fumaric acid, malic acid, and tartaric acid to the above-mentioned polyurethane dressing foam to form a grid pattern in multiple lines.

13. In Paragraph 12, A wound healing agent characterized in that the grid pattern is formed on a protrusion of the polyurethane dressing foam, and the width of the lines of the grid pattern is 300 to 1000 μm.

14. In Paragraph 12, The above-mentioned grid-forming substance is a wound healing preparation further comprising Centella asiatica extract, bamboo leaf components, or propolis components.