Composition for preventing, alleviating, or treating atopic march comprising novel lactococcus lactis subsp. lactis strain and gardenia jasminoides fruit extract
Patent Information
- Application Number
- PCT/KR2026/003077
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2026-02-24
- Filing Date
- 2026-02-24
- Publication Date
- 2026-08-27
Smart Images

Figure 00000039_0000 
Figure 00000040_0000 
Figure 00000041_0000
Abstract
Description
A composition for the prevention, improvement, or treatment of the atopic march comprising a novel Lactococcus lactis subspecies lactis strain and gardenia extract.
[0001] The present invention relates to exhibiting a synergistic effect in the prevention, improvement, and treatment of the atopic march when the Lactococcus lactis subspecies lactis strain is used in combination with a gardenia extract. Specifically, the present invention relates to a composition containing the Lactococcus lactis subspecies lactis strain and a gardenia extract for the prevention, improvement, or treatment of the atopic march, and a method for the prevention, improvement, or treatment of the atopic march using the same.
[0002] The present application claims priority based on Korean Patent Application No. 10-2025-0023912 filed on February 24, 2025 and Korean Patent Application No. 10-2026-0034303 filed on February 24, 2026, and all contents disclosed in the specifications and drawings of said applications are incorporated by reference into the present application.
[0003]
[0004] For decades, probiotics have been widely utilized in the food and beverage industry, known for providing beneficial effects to the health of humans and animals by improving the function of the gut microbiome. Most microorganisms used as probiotics belong to the lactic acid bacteria (LAB) group, and among them, Lactococcus lactis strains play a crucial role as a core component of starter cultures. These strains hold significant value in food development by differentiating food flavors through the formation of diverse tastes and providing technical, nutritional, and health benefits. Recently, active research is being conducted to isolate novel probiotic strains, evaluate their characteristics, and apply them to the food and health sectors.
[0005] Among all substances or microorganisms used in the food industry, the most important criterion is safety. Currently, the safety and probiotic properties of lactic acid bacteria (LABs) are primarily evaluated through in vitro analysis. However, with the recent rapid advancement of whole genome sequencing (WGS) technology, it has become possible to gain valuable insights into antibiotic resistance, safety, and various other factors that may pose a health threat. In particular, WGS enables a comprehensive examination of the genetic robustness of strains inhabiting the human gut and provides significant assistance in understanding mobile genetic elements (MGE) regions, adaptation to environmental stress, metabolism of nutrients and toxic metabolites, recovery from digestive disorders, secretory systems, extracellular matrix formation, immune modulation, adhesion characteristics, flavor development, antimicrobial activity, and biosynthetic pathways. Meanwhile, lactic acid bacteria can produce various bioactive substances during the fermentation process, including enzymes, vitamins, conjugated linoleic acid, exopolysaccharides, gamma-aminobutyric acid (GABA), and neuroactive compounds such as serotonin, dopamine, and acetylcholine. These metabolites are closely linked to the rapidly growing functional food industry and are considered important criteria for defining the functional characteristics of probiotics.
[0006] The newly isolated Lactococcus lactis subsp. Lactis LB1022 is a strain derived from cheese, and the inventors have confirmed its safety and preventive and therapeutic effects against various diseases through previous in vivo studies. Furthermore, through whole-genome sequencing analysis of L. lactis LB1022, they sought to identify the probiotic safety and functional genes of the strain and to gain a deeper understanding of the genetic basis of its functional characteristics.
[0007] Meanwhile, the term "atopic march" has been used to describe the clinical characteristics of patients who experience atopic dermatitis (AD) in infancy, followed by immunoglobulin E (IgE)-mediated food allergies and allergic asthma (AA). AD is one of the most common chronic inflammatory skin diseases, with a global prevalence of approximately 15–30% in children and 2–10% in adults. Various factors, including susceptibility genes, environmental influences, and immune mediators, are known to contribute to the pathogenesis of AD. In AD, the early manifestation of barrier-related gene imbalances and high serum IgE levels are risk factors for the development of AA.
[0008] Recent studies have shown that the composition of the gut microbiome is closely associated with the alleviation of allergic asthma, suggesting that the gut microbiome can be an important target for the treatment of allergic airway diseases. Probiotics have been shown to aid in and improve gut health, and to support the immune system. Probiotic treatment alleviates the symptoms of allergic diseases by reducing IgE levels and regulating Th1 / Th2 balance. Furthermore, probiotic-derived metabolites can improve the symptoms of AD or AA induced by OVA sensitization in mice and improve the microbial composition of the animals.
[0009] Probiotic foods perform important functions, including supporting a healthy immune system, metabolism, and digestion. Among these functional dairy products, cheese is an excellent source of protein, minerals, and vitamins with high nutritional value. Probiotic soft cheese products are manufactured using starter strains of the genera Lactococcus and Lactiplantibacillus. Studies indicate that probiotic-derived cheeses are associated with anti-inflammatory, anti-allergic, and immunomodulatory activities. In particular, the inventors have previously demonstrated in studies that Lactococcus lactis strains exhibit anti-inflammatory and anti-allergic effects. Specifically, Lactococcus chungangensis CAU 28 and Lactococcus lactis LB1022 derived from cream cheese were shown to alleviate symptoms of atopic dermatitis. However, nothing is known about the mechanism of the atopic march, along with its effects on atopic dermatitis and allergic asthma.
[0010] Based on functional genes identified in the LB1022 strain, the inventors identified the efficacy of probiotic cheese and LB1022 derived therefrom in alleviating allergic diseases, and completed the present invention by identifying key microbial communities in the intestines and lungs and their interrelationships.
[0011]
[0012] The present invention aims to solve all the problems of the aforementioned prior art.
[0013] In addition, the present invention has the objective of providing a technology capable of effectively preventing, improving, or treating the atopic march, which progresses from atopic dermatitis to airway inflammation / asthma-like symptoms.
[0014] In addition, the present invention has another objective of providing a composition that exhibits an improved atopic march alleviation effect compared to existing technology through a composition comprising a Lactococcus lactis subspecies lactis strain (e.g., LB1022) and a gardenia extract.
[0015] Another objective of the present invention is to provide a composition for atopic march that can comprehensively regulate skin lesions, systemic immune response, intestinal barrier function, airway inflammatory response, and the gut-lung axis microbial environment.
[0016] Another objective of the present invention is to provide a method for suppressing the onset or progression of atopic march-related diseases (e.g., food allergies, dermatitis, rhinitis, conjunctivitis, and asthma) and alleviating symptoms using the above composition.
[0017] The objectives of the present invention are not limited to those mentioned above. The objectives of the present invention will become more apparent from the following description and will be realized by the means and combinations thereof described in the claims.
[0018]
[0019] A representative configuration of the present invention for achieving the above objective is as follows.
[0020] According to one aspect of the present invention, a composition for the prevention, improvement, or treatment of the atopic march is provided, comprising: a strain of Lactococcus lactis subsp. lactis or a culture thereof, culture supernatant, cell, cell lysate, dead cell, metabolite, and combinations thereof; and gardenia extract or a fraction thereof.
[0021] According to another aspect of the present invention, a food composition for preventing or improving the atopic march is provided, comprising cheese curds prepared by inoculating a strain of Lactococcus lactis subsp. lactis; and gardenia extract or a fraction thereof.
[0022] According to another aspect of the present invention, a food composition for preventing or improving the atopic march is provided, comprising cheese curds prepared by inoculating a mixture containing a Lactococcus lactis subsp. lactis strain and gardenia extract.
[0023] In one embodiment, the Lactococcus lactis subsp. lactis strain may be the Lactococcus lactis subsp. lactis LB1022 strain deposited under accession number KCTC 15324BP.
[0024] In another embodiment, the Lactococcus lactis subspecies lactis strain may be a dairy-derived strain.
[0025] The term “dairy product” as used in this specification is not limited to the narrow conventional food classification, but is used to encompass all solid, semi-solid, liquid, powder, paste, gel, or coagulated compositions manufactured using animal milk (e.g., raw milk of mammals such as cow's milk, goat's milk, sheep's milk, buffalo milk, etc., skim milk, whole milk, partially skim milk, recombinant milk, or reconstituted milk) as a raw material or including ingredients derived therefrom. Accordingly, the term "dairy product" is not limited by whether it is fermented, aged, heated / pasteurized, moisture content, fat content, protein content, formulation, or manufacturing process, and may include, for example, cheese (including aged and unaged cheese), cheese curd, soft / semi-hard / hard cheese, processed cheese, fresh cheese, fermented milk, yogurt, cream, butter, whey and whey products, casein / caseinate-containing products, concentrated milk, milk powder, compositions containing milk protein or milk fat, ice cream or frozen dairy product bases, and intermediates, semi-finished products, and finished products thereof. Furthermore, the term is interpreted to include not only the dairy product itself but also mixed compositions in which strains, extracts, cultures, metabolites, functional ingredients, additives, or other food- or pharmaceutically acceptable ingredients are additionally included using the dairy product as a matrix or carrier, and shall not be interpreted as being limited by specific product names, specific manufacturing standards, or specific sub-classifications in the Food Code. In particular, the "dairy products" in this specification explicitly include cheese and cheese curds.
[0026] In another embodiment, the gardenia extract may be an extract, concentrate, fraction, or combination thereof obtained from gardenia fruit, seeds, peel, or a combination thereof.
[0027] In another embodiment, the gardenia extract may be an extract, fraction, concentrate, or combination thereof prepared using water, an organic solvent, a mixed solvent, or a supercritical fluid. For example, it may be obtained by one or more extraction methods selected from water extracts, hot water extracts, cold water extracts, alcohol extracts, water-soluble alcohol mixed extracts, hydrocarbon solvent extracts, ester solvent extracts, ketone solvent extracts, ether solvent extracts, supercritical or subcritical carbon dioxide extracts, pressurized extracts, reflux extracts, leachates, serial extracts, ultrasonic extracts, microwave extracts, enzyme-treated extracts, fermented extracts, distilled extracts, fractions, or combinations thereof, but is not limited thereto.
[0028] As used herein, the term “Gardenia extract” is a concept comprising extracts, fractions, concentrates, purified products, dried products, powders, re-dissolved products, suspensions, solutions, fermented products, enzymatic hydrolysates, hydrolysates, decolorized products (e.g., activated carbon / carbon-treated products), degreased products, desalinated products, deodorized products, or mixtures thereof obtained from the fruit (e.g., mature fruit, immature fruit, dried fruit), peel, pulp, seeds, or mixtures thereof of Gardenia (Gardenia jasminoides Ellis), and includes extraction solvents (e.g., water, hot water, cold water, ethanol, methanol, propanol, isopropanol, butanol, acetone, ethyl acetate, supercritical fluid, carbon dioxide supercritical fluid, or mixtures thereof), extraction methods (e.g., leaching, reflux, thermal reflux, ultrasonic extraction, microwave extraction, pressurized extraction, enzyme-assisted extraction, supercritical extraction, etc.), and post-treatment Includes all forms manufactured by the method.In addition, the above gardenia extract comprises all extracts containing pharmacologically relevant components (active ingredients) of gardenia reported in the literature, such as iridoids and iridoid glycosides (e.g., geniposide, genipin, gardenoside, geniposidic acid, genipin-1-β-gentiobioside, shanzhiside and their analogs), carotenoid / apocalotenoid pigment components (e.g., crocins, crocetin and their esters / glycosides), phenolic acids and organic acids (e.g., chlorogenic acid, neochlorogenic acid, cryptochlorogenic acid, caffeic acid, ferulic acid, p-coumaric acid, quinic acid and their derivatives), flavonoids (e.g., quercetin, kaempferol, rutin and their glycosides / derivatives), triterpenoids (e.g., ursolic acid, oleanolic acid and their derivatives), volatile components / essential oil components, It may include polysaccharides and other low or high molecular weight components derived from gardenia. The description of the above components is exemplary, and the “gardenia extract” of the present invention encompasses all cases where one or more of the above components are isolated or purified and used alone, two or more are used in combination, used in the form of an enriched fraction derived from gardenia, or used in the form of pharmaceutically / foodsally acceptable salts, esters, glycosides, aglycones, isomers, solvates, hydrates, precursors, metabolites, or functionally equivalent derivatives of the above components.
[0029] In another embodiment, the gardenia extract may be included at a concentration of about 100 μg / mL to 2,000 μg / mL.
[0030] The term “about” means an amount, level, value, number, frequency, percentage, dimension, size, quantity, weight, or length that varies by about 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1% with respect to a reference amount, level, value, number, frequency, percentage, dimension, size, quantity, weight, or length. For example, when the term “about” is used in relation to a value x expressed as a number or numerical value, it may mean x ± 10%.
[0031] In another embodiment, the composition may be implemented in the form of a pharmaceutical composition, a quasi-drug composition, a health functional food composition, or a food composition.
[0032] When the present invention is embodied in the form of a pharmaceutical composition, the pharmaceutical composition may be formulated into an appropriate dosage form depending on the method of administration used. For example, if the pharmaceutical composition is an oral dosage form, it may be manufactured in the form of a tablet, capsule, granule, powder, suspension, emulsion, syrup, liquid, dry syrup, powder, pill, or a combination thereof. In addition, if the pharmaceutical composition is a parenteral dosage form, it may be manufactured in the form of an injection, infusion, or drop, and may include an isotonic agent, a buffer, a stabilizer, a preservative, etc., as needed. The isotonic agent may include, for example, sodium chloride, dextrose, mannitol, sorbitol, or lactose, and the buffer solution may include phosphate-buffered physiological saline. As a stabilizer, gelatin, albumin, or a similar stabilizer may be used.
[0033] The above composition may further include pharmaceutically acceptable excipients. The pharmaceutically acceptable excipients may function as a vehicle, adjuvant, carrier, or diluent and may be used to improve the formulation stability, dispersibility, storage stability, or ease of administration of the composition.
[0034] The actual dosage of the above (pharmaceutical) composition may vary depending on various factors, such as the content of the active ingredient, the formulation form of the active ingredient, the age and body weight of the subject, the type and severity of symptoms, the route of administration, the frequency and duration of administration, etc. The composition of the present invention may include a strain of Lactococcus lactis subspecies lactis (e.g., strain LB1022 deposited under accession number KCTC 15324BP) and a Gardenia extract as active ingredients, and said strain may be provided in the form of live cells, dead cells, cell lysates, cultures, culture supernatants, metabolites, or combinations thereof. In addition, the Gardenia extract may be provided in the form of a crude extract, fractions, or a fraction containing the active ingredient.
[0035] In one embodiment, the composition may be a composition for oral administration. The composition for oral administration may be the composition itself of the strain and gardenia extract, a composition comprising a cheese curd prepared by inoculating the strain and a gardenia extract together, or a composition comprising a cheese curd prepared by inoculating a mixture of the strain and gardenia extract. As an example, the composition may be prepared and consumed in the form of a cheese curd, fermented milk, fermented food, powder, granule, capsule, or liquid formulation.
[0036] In a preferred embodiment, the composition may be administered orally to control systemic allergic reactions, skin inflammatory reactions, intestinal mucosal barrier abnormalities, and / or airway inflammatory reactions associated with the atopic march. The oral formulation may be prepared considering the intestinal delivery and bioavailability of the active ingredient, and, if necessary, technologies such as enteric coating, microencapsulation, nanoparticle formation, or liposomal formation may be applied. This can improve the stability, shelf life, or in vivo delivery efficiency of the active ingredient.
[0037] The above pharmaceutical composition may further comprise a carrier (e.g., water, saline solution, buffer solution, ethanol, glycerol, propylene glycol, polyethylene glycol, etc.), a diluent, a pharmaceutically acceptable carrier (e.g., phosphate-buffered saline solution), a pharmaceutically acceptable excipient, and / or other additives known in the art. Additionally, it may comprise, as needed, a binder, a disintegrant, a lubricant, a suspending agent, an emulsifier, a sweetener, a flavoring agent, a preservative, or a stabilizer.
[0038] When the present invention is embodied in the form of a quasi-drug composition, the quasi-drug composition may be a composition for assisting in the prevention or improvement of symptoms associated with the atopic march, such as dermatitis symptoms, skin barrier abnormalities, allergic rhinitis, discomfort related to conjunctivitis, or allergic airway symptoms.
[0039] The term "quasi-drug" as used in this specification is defined in accordance with relevant laws and regulations and may be used to include preparations that are not instruments, machines, or devices, as articles used for the purpose of preventing diseases or managing hygiene in humans or animals. The above quasi-drugs may include external preparations and personal hygiene products, and in one embodiment, may be a formulation applicable to the skin or mucous membranes.
[0040] In addition, when the active ingredient of the present invention or a composition containing it is used as an additive for quasi-drugs, it may be used alone or together with other quasi-drug ingredients, and may be appropriately combined according to conventional methods. The amount of the active ingredient may be appropriately determined according to the purpose of use, the form of the formulation, and the site of application.
[0041] The above external preparations and personal hygiene products may include all forms of products that can be applied directly or indirectly to the skin or mucous membranes to help improve skin condition, protect the skin barrier, or alleviate inflammatory responses. Specifically, but not limited to, they may be manufactured in the form of gel, ointment, cream, lotion, emulsion, spray, mist, patch, powder, mousse, solution, suspension, hydrogel, hydrocolloid formulation, microsphere, nanoparticle, liposome formulation, mucoadhesive microparticle, etc.
[0042] In addition, the personal hygiene products mentioned above may include, but are not specifically limited to, forms such as skin cleansers, body washes, soaps, shampoos, conditioners, skin moisturizers, skin protectants, skin soothing mists, skin patches, topical gels, topical lotions, or topical creams. However, the above formulations and product forms are exemplary and should not be interpreted as limiting the scope of protection of the present invention.
[0043] Meanwhile, as disclosed in this specification, a composition comprising the above-described Lactococcus lactis subspecies lactis strain (e.g., LB1022) and gardenia extract may be a food composition. Additionally, the food composition may be for the prevention or improvement of the atopic march. Here, the food composition may be a health functional food composition, a functional food composition, or a special dietary food composition.
[0044] In one embodiment, the food composition may be a composition that can help control allergic reactions associated with the atopic march, improve skin condition, maintain or improve intestinal mucosal barrier function, and / or alleviate airway inflammatory reactions. In another embodiment, the food composition may be a composition that can help prevent or improve symptoms associated with one or more conditions selected from the group consisting of food allergies, dermatitis, rhinitis, conjunctivitis, and asthma.
[0045] In one embodiment, the food composition of the present invention may include the form of a general food, a functional food, a nutritional supplement, a health food, a food additive, etc., and may be manufactured in various forms according to conventional methods known in the art. For example, the food composition may be manufactured in the form of cheese curd, fermented milk, yogurt, dairy products, powder, granules, tablets, capsules, liquids, drinks, stick-type formulations, jellies, or pills.
[0046] In another embodiment, the food composition of the present invention may be used as a health functional food. The meanings of "health functional food" and "functionality" may be as prescribed by relevant laws and regulations. Additionally, "special purpose food" may refer to a food manufactured or processed for a specific purpose of nutritional management or consumption, unlike general food.
[0047] For example, as a health food, a composition containing the strain and gardenia extract may be prepared in the form of powder, granules, capsules, or liquid formulations for consumption, or applied to a food matrix such as fermented dairy products or cheese curds for consumption. In particular, in one embodiment, the food composition may be a composition containing a cheese curd prepared using Lactococcus lactis LB1022 and a gardenia extract.
[0048] The food composition of the present invention may include conventional food additives, and the suitability of said food additives may be determined according to standards in accordance with relevant laws and regulations and public decree. In addition, the food composition of the present invention may include excipients, binders, disintegrants, lubricants, sweeteners, flavorings, colorings, preservatives, stabilizers, thickeners, or emulsifiers commonly used in the art, as needed.
[0049] The formulation, additives, and manufacturing forms of the above food composition are exemplary and should not be interpreted as limiting the scope of protection of the present invention.
[0050] In another embodiment, the atopic march may include one or more selected from the group consisting of food allergy, atopic dermatitis, rhinitis, conjunctivitis, and asthma.
[0051] The term “atopic march” as used in this specification is not limited to the narrow medical definition, but is used to encompass the phenomenon and the overall risk condition in which one or more allergic or immune-mediated conditions appear in the skin, intestinal tract, nasal cavity / upper respiratory tract, lower respiratory tract, lungs, mucosa, or the whole body over time based on immunological imbalance, epithelial / mucosal barrier dysfunction (e.g., skin barrier, intestinal mucosal barrier, airway mucosal barrier), changes in microbial composition and / or function, changes in inflammatory mediators, and / or changes in allergy-related antibodies, etc. Accordingly, the above "atopic march" does not mean only the sequential progression of typical atopic dermatitis, allergic rhinitis, conjunctivitis, and asthma, but may include atopic dermatitis (or AD-like lesions), food allergies, allergic rhinitis, allergic conjunctivitis, asthma, airway hyperresponsiveness, eosinophilic inflammatory states, allergic inflammation of the skin, intestines, and airways and related prodromal symptoms, subtypes, mixed forms, borderline states, relapsed / exacerbated states, or states with increased risk of developing these, and may even include states evaluated by changes in biological indicators such as IgE, cytokines (e.g., IL-4, IL-5, IL-13, IL-17, IL-33, TSLP, etc.), inflammatory cell infiltration, mucosal / barrier-related factors (e.g., ZO-1, claudin, occludin, etc.), changes in the intestinal or airway microbiome, and changes in metabolites, regardless of the presence or absence of symptoms. Furthermore, the above terms may be applied to subjects including not only humans but also non-human animals, and are interpreted to encompass the entire range of conditions subject to prevention, delay of onset, inhibition of progression, improvement, alleviation, treatment, prevention of recurrence, and management, and shall not be interpreted as being limited by a specific diagnosis, specific stage, specific causative antigen, or specific sequence of expression.
[0052] In another embodiment, the composition can improve or alleviate one or more atopic dermatitis-like skin lesions selected from the group consisting of erythema, edema, dryness, erosion, and excoriation.
[0053] In another embodiment, the composition can reduce the levels of one or more Th2-related cytokines selected from the group consisting of IL-4, IL-5, and IL-1β.
[0054] In another embodiment, the composition can reduce the levels of one or more Th17-related cytokines selected from the group consisting of IL-17A, IL-17F, IL-21, IL-22, IL-23, IL-1β, and IL-6.
[0055] In another embodiment, the composition may exhibit an immunomodulatory effect of (i) reducing the levels of IgE and / or IgG1 and (ii) increasing the levels of IgG2a or improving the IgG2a / IgE ratio.
[0056] In another embodiment, the composition can restore the intestinal mucosal epithelium.
[0057] In another embodiment, the composition can increase the expression level of one or more selected from the group consisting of ZO-1, claudin-1, and occludin.
[0058] In another embodiment, the composition may increase GLP-1 expression and inhibit IL-4 and / or IL-5 expression.
[0059] In another embodiment, the composition can inhibit an increase in the number of one or more inflammatory cells selected from the group consisting of macrophages, lymphocytes, eosinophils, and neutrophils.
[0060] In another embodiment, the composition can inhibit the proliferation of goblet cells and / or the increase in mucus secretion.
[0061] In another embodiment, the composition can reduce IL-4 and IgE levels in bronchoalveolar lavage fluid (BALF).
[0062] Unless otherwise specified, "decrease," "inhibition of increase," "increase," or "improvement of ratio" means that the measured value or amount of change of the relevant indicator changes in a direction favorable to the prevention, improvement, or treatment of the disease when compared to an untreated group in which the disease is induced or sensitized / challenged, a group treated with a control composition not containing the active ingredient, a reference value of the same subject before administration, or an appropriate comparison group equivalent thereto (reference group), and includes a recovery to the normal group level or a change approaching the normal group.
[0063] For example, "improvement of the IgG2a / IgE ratio" includes not only cases where the IgG2a / IgE ratio increases compared to the comparison group (reference group), but also cases where the immunoglobulin balance altered in the disease state is restored toward the normal group or non-disease state.
[0064] In another embodiment, the composition can regulate the intestinal fatty acid metabolism profile, including changes in the concentration of short-chain fatty acids (SCFA) or long-chain fatty acids (LCFA).
[0065] In another embodiment, the composition can remodel the intestinal microbial composition.
[0066] In another embodiment, the remodeling may involve (i) increasing / increasing the abundance of one or more bacterial genera selected from the group consisting of Bacteroides, Lactococcus, Bifidobacterium, Lachnoclostridium and Colidextribacter, and (ii) decreasing the abundance of one or more bacterial genera selected from the group consisting of Escherichia-Shigella, Genella, Ligilactobacillus, Blautia and Alloprevotella.
[0067] According to another aspect of the present invention, a method for preventing, improving, or treating an atopic march is provided, comprising the step of administering to an individual a composition comprising a Lactococcus lactis subsp. lactis strain and a gardenia extract as active ingredients, a composition comprising a cheese curd prepared by inoculating said strain and a gardenia extract, or a composition comprising a cheese curd prepared by inoculating said strain and a mixture of said strain and gardenia extract.
[0068] The term “individual” may be used interchangeably with “subject” or “patient,” and may be a mammal requiring prevention, improvement, or treatment of the atopic march, e.g., primates (e.g., humans), companion animals (e.g., dogs, cats, etc.), livestock animals (e.g., cattle, pigs, horses, sheep, goats, etc.), and laboratory animals (e.g., rats, mice, guinea pigs, etc.). In one embodiment of the present invention, the subject is preferably a human.
[0069] The term "treatment" generally means achieving desired pharmacological and / or physiological effects. These effects are therapeutic in that they partially or completely cure the disease and / or adverse effects resulting from such disease. Desirable therapeutic effects include, but are not limited to, prevention of the onset or recurrence of the disease, improvement of symptoms, reduction of any direct or indirect pathological consequences of the disease, prevention of metastasis, reduction of the rate of disease progression, improvement or alleviation of the disease state, and remission or improved prognosis. Preferably, "treatment" may mean medical intervention for an already manifested disease or disorder. More preferably, "treatment" may be preventing disease progression and improving prognosis by modulating the immune response and / or suppressing allergic reactions in the pathophysiology of the atopic march.
[0070] The term "improvement" refers to any action that at least reduces or alleviates parameters related to the condition being treated, such as the severity of symptoms.
[0071] The term "prevention" refers to any act of suppressing the symptoms of the atopic march or delaying its progression through the administration of the composition of the present invention.
[0072] According to another aspect of the present invention, a composition comprising a Lactococcus lactis subsp. lactis strain and a gardenia extract as active ingredients, a composition comprising a cheese curd prepared by inoculating said strain and a gardenia extract, or a composition comprising a cheese curd prepared by inoculating said strain and a mixture of said strain and gardenia extract is provided for the prevention, improvement, or treatment of the atopic march.
[0073] According to another aspect of the present invention, a use is provided for producing a pharmaceutical product used for the prevention, improvement, or treatment of the atopic march using a Lactococcus lactis subsp. lactis strain and a gardenia extract.
[0074]
[0075] According to the present invention, a composition comprising the Lactococcus lactis subspecies lactis LB1022 strain and a gardenia extract (and / or a cheese curd-derived composition prepared including these) provides useful effects for the prevention, improvement, or treatment of the atopic march by multi-facetedly regulating inflammatory pathologies of the skin, intestines, and airways / lungs associated with the atopic march. Specifically, the composition can exhibit effects such as alleviation of atopic dermatitis-like skin lesions, regulation of Th2-related cytokines and allergy-related antibodies (e.g., IgE, IgG1, etc.), restoration of intestinal mucosal barrier function (e.g., increased expression of tight junction-related factors), reduction of airway inflammation and airway hyperresponsiveness, inhibition of mucus oversecretion and inflammatory cell infiltration in lung tissues, and improvement of immune homeostasis at the intestinal-lung axis level through compositional / functional remodeling of the gut and BALF microbiome; thus, it can be effectively applied to overall management and treatment strategies for the atopic march, including progression from atopic dermatitis to asthmatic lesions.
[0076]
[0077] Figures 1a and 1b are diagrams showing the genomic characteristics of Lactococcus lactis subsp. lactis LB1022: Figure 1a shows the circular genome map of LB1022, and Figure 1b shows the COG-based functional categories.
[0078] Figure 2 is a diagram showing the results of the functional annotation of the Lactococcus lactis subspecies lactis LB1022 based on the KEGG database.
[0079] Figures 3a and 3b illustrate the results of in silico and in vitro analyses related to the bile tolerance and acid tolerance of Lactococcus lactis subspecies LB1022: Figure 3a illustrates the results of in silico analysis including genes or functional factors related to resistance to bile salts and acids, and Figure 3b illustrates the results of viability evaluation under bile salt and acidic conditions.
[0080] FIGS. 4a to 4d are drawings showing the results of in silico and in vitro analysis of genes and functions related to adhesion, gut persistence, and cheese fermentation of the Lactococcus lactis subspecies LB1022: FIGS. 4a and 4c show the results of gene analysis related to said functions, and FIGS. 4b and 4d show the results of in vitro evaluation related to said functions (e.g., results of adhesion ability or gut environment adaptability evaluation).
[0081] Figure 5 is a diagram showing the arginine biosynthesis pathway of LB1022, illustrating the result of displaying the arginine metabolism-related pathway of the LB1022 genome on a KEGG diagram.
[0082] Figures 6a and 6b illustrate the immunomodulatory effects of Lactococcus lactis subspecies lactis LB1022: Figure 6a shows the changes in the relative gene expression levels of TLR4, NF-kB p65, and NF-kB p50, and Figure 6b shows the changes in TNF-α and IL-6 cytokine concentrations.
[0083] Figures 7a and 7b illustrate the inhibitory effect of the potential probiotic strain LB1022 on allergy activity: Figure 7a shows the results of histamine release in HMC-1 cells, and Figure 7b shows the results of degranulation analysis in HMC-1 cells.
[0084] Figure 8 is a diagram showing the OVA sensitization and challenge protocol for BALB / c mice under probiotic cheese intervention conditions.
[0085] Figures 9a to 9c illustrate symptoms of atopic dermatitis (AD)-like lesions in OVA-sensitized mice: Figure 9a shows a photograph of a dorsal skin lesion, Figure 9b shows the results of the dermatitis score evaluation, and Figure 9c shows the results of hematoxylin and eosin (H&E) staining and toluidine blue (TB) staining for the skin lesions of each group.
[0086] Figure 10 is a diagram showing the changes in concentrations of Th2-type mediators (IL-4, IL-5, and IL-17; top graph), Th2 regulators (IL-33 and TSLP; bottom left and middle graphs), and inflammatory cytokines (IL-1β; bottom right graph).
[0087] Figure 11 is a diagram showing changes in serum IgE, IgG1, and IgG2a levels.
[0088] Figures 12a and 12b illustrate the effects of GCC administration on ileum integrity and tight junction expression: Figure 12a shows the results of morphological analysis of ileum tissue by H&E staining, and Figure 12b shows the results of tight junction-related gene expression detected by RT-PCR.
[0089] Figures 13a to 13e illustrate the effect of GCC administration on improving airway inflammation: Figure 13a shows the results of measuring airway hyperresponsiveness (AHR) to methacholine in mice, Figure 13b shows the number of differentiated inflammatory cells in BALF, Figure 13c shows the H&E and PAS staining results of lung tissue (peribronchial infiltration and mucus secretion, respectively), Figure 13d shows the inflammatory score based on H&E and PAS staining, and Figure 13e shows the IL-4 and IgE levels in BALF measured by ELISA.
[0090] Figures 14a and 14b are figures showing the results of the concentration analysis of short-chain fatty acids (SCFAs) and long-chain fatty acids (LCFAs): Figure 14a shows a heatmap of SCFAs and LCFAs concentrations between groups, and Figure 14b shows the results of the ROC curve analysis of LCFAs concentrations between the OVA group and the GCC group.
[0091] Figures 15a to 15f illustrate the results of the diversity and composition analysis of the gut microbiota: Figure 15a shows the results of the analysis of the Chao1 and Shannon indices, Figure 15b illustrates the differences in gut microbiota composition according to PCoA analysis, Figure 15c shows the gut microbiota community composition at the phylum and genus levels, Figure 15d shows the results of the LEfSe analysis for microorganisms showing significant differences between the OVA group and the GCC group, Figure 15e shows the relative abundance of distinct microorganisms at the genus level, and Figure 15f shows the results of the Redundancy Analysis (RDA) for factors affecting bacterial metabolite formation.
[0092] Figures 16a to 16c illustrate the results of a comparison of bacterial functions between the OVA group and the GCC group in the gut: Figure 16a shows the results of a metabolic pathway-based PCoA analysis, Figure 16b shows a Venn map of differential metabolites, and Figure 16c shows the results of a predictive analysis of the potential functional characteristics of the gut microbiome.
[0093] Figures 17a to 17f illustrate the results of the diversity and composition analysis of the BALF microbiota: Figure 17a illustrates the visualization results of hierarchical cluster analysis showing significant differences in microbial composition, Figure 17b illustrates the PCoA analysis results showing differences in BALF microbial composition between groups, Figure 17c illustrates the BALF microbial community composition at the phylum and genus levels, Figure 17d illustrates the differential analysis results between the OVA group and the GCC group, Figure 17e illustrates the LEfSe analysis results for the microorganisms showing the most significant differences between the OVA group and the GCC group, and Figure 17f illustrates the relative abundance of distinct microorganisms at the genus level.
[0094] Figures 18a to 18c illustrate the results of a comparison of bacterial functions between the OVA group and the GCC group in BALF: Figure 18a shows the results of a metabolic pathway-based PCoA analysis, Figure 18b shows a Venn map of differential metabolites, and Figure 18c shows the results of a predictive analysis of the potential functional characteristics of the BALF microbial community.
[0095] Figure 19 is a schematic diagram showing the potential mechanism by which GCC is involved in the improvement of symptoms in atopic march mice, illustrating the summary of the results of this study and the gut-lung axis mechanism in the atopic march.
[0096]
[0097] The following detailed description of the invention will be described with reference to specific drawings regarding specific embodiments in which the invention may be practiced, but the invention is not limited thereto and is limited only by the appended claims, including all equivalents thereof as appropriately described. It should be understood that various embodiments of the invention are different but need not be mutually exclusive. For example, specific materials, forms, structures, and properties described herein may be modified from one embodiment to another or combined without departing from the technical spirit and scope of the invention. Technical and academic terms used herein have the same meaning as commonly used in the field to which the invention belongs, unless otherwise defined. For the purpose of interpreting this specification, the following definitions shall apply, and terms used in the singular shall include the plural where appropriate and vice versa.
[0098] Numerical ranges include the values defined in the above ranges. All maximum numerical limits given throughout this specification include all lower numerical limits as clearly stated. All minimum numerical limits given throughout this specification include all higher numerical limits as clearly stated. All numerical limits given throughout this specification will include all better numerical ranges within a wider numerical range, as clearly stated.
[0099] All technical terms used in this invention, unless otherwise defined, include all meanings recognizable by a person skilled in the art and are used in the sense generally understood, and may be interpreted appropriately according to the context. Furthermore, while preferred methods or samples are described in this specification, similar or equivalents are also included within the scope of this invention.
[0100] The invention provided by this specification will be described in more detail below through examples. These examples are intended solely to illustrate the contents disclosed by this specification, and it will be obvious to those skilled in the art that the scope of the contents disclosed by this specification is not to be interpreted as being limited by these examples.
[0101]
[0102] Examples
[0103] I. Functional Genomics and Anti-allergic Activity Analysis of Lactococcus lactis LB1022
[0104] Example 1. General genomic characteristics of L. lactis LB1022
[0105] As shown in Fig. 1a, the genomic analysis of L. lactis LB1022 consisted of 5 contigs and 3.29 Mb nucleotides, with a GC content of 35.09%. The GC contents of each contig were 35.2%, 34.5%, 32.5%, 30.9%, and 35.1%, respectively. A total of 2,622 protein-coding genes (CDS) were identified in L. lactis LB1022. Additionally, L. lactis LB1022 contained 19 rRNA and 66 rRNA genes. Functional classification of the LB1022 strain revealed that replication, amino acid transport and metabolism, carbohydrate transport and metabolism, transcription, translation, and inorganic ion transport and metabolism accounted for a large proportion of eggNOG annotations (see Fig. 1b).
[0106] Figure 2 shows gene clusters predicted into different functional categories by COG annotations based on gene ontology (GO) annotations. It was confirmed that the LB1022 strain's major COG annotation functions are related to cofactors, vitamin metabolism, and carbohydrate metabolism, among others.
[0107]
[0108] Example 2. Evaluation of Potential Probiotic Properties
[0109] 2.1. Tolerance effects against bile salts and acids
[0110] Genes encoding proteins involved in acid and bile salt resistance were identified in the LB1022 genome. These genes encode energy metabolism mediated by FoF1-type ATP synthase, ornithine carbamoyltransferase, antiporters, and chaperones (see Figure 3a and Table 1).
[0111]
[0112] KEGG ID유전자기능LB1022 내 위치내산성K02111atpAFoF1-type ATP synthase, alpha subunitcontig1_00089_1K02108atpBFoF1-type ATP synthase, membrane subunit acontig1_00089_2K02114atpCFoF1-type ATP synthase, epsilon subunitcontig1_00089_3K02112atpDFoF1-type ATP synthase, beta subunitcontig1_00089_4K02110atpEFoF1-type ATP synthase, membrane subunit ccontig1_00089_5K02109atpFFoF1-type ATP synthase, membrane subunit bcontig1_00089_6K02115atpGFoF1-type ATP synthase, gamma subunitcontig1_00089_7K02113atpHFoF1-type ATP synthase,delta subunitcontig1_00089_8K01358ClpPATP-dependent_proteasecontig1_00097_3COG1302Asp23alkaline shock proteincontig1_00098_12K00016MdhL-lactate dehydrogenasecontig1_00021_20내담즙성K15986PPX1Manganese-dependent inorganic pyrophosphatasecontig1_00092_10K00574Cfacyclopropane-fatty-acyl-phospholipid synthasecontig1_00099_7K00661ArgFornithine carbamoyltransferasecontig1_00040_23K03402ArgRArginine repressorcontig1_00105_16K03758PotEarginine:ornithine antiportercontig1_00105_12K04077GroELChaperonin GroELcontig1_00022_16K04043dnaKChaperone_DnaKcontig1_00049_5K01580gadAglutamate decarboxylasecontig1_00064_13,
[0113]
[0114] Additionally, the bile and acid tolerance of LB1022 was evaluated, and the results are shown in Figure 3b. The survival rate of LB1022 was significantly higher compared to the control group, suggesting that LB1022 can effectively withstand bile salt stress, a key characteristic for the survival of probiotic strains in the gastrointestinal environment. Furthermore, the acid resistance of LB1022 was evaluated under low pH conditions (pH 2.0). LB1022 exhibited a significantly improved survival rate compared to the control group. These results confirm the strain's strong acid resistance, a characteristic essential for maintaining viability during gastric passage. 2.2. Genes Related to Osmotic Stress, Adhesion, Intestinal Persistence, and Cheese Fermentation
[0115] As shown in Table 2 below, genes associated with probiotic characteristics were identified through annotation analysis of the whole genome of LB1022.
[0116]
[0117] KEGG ID유전자기능LB1022 내 위치삼투압K05847opuAosmoprotectant transport system ATP-binding proteincontig1_00043_11K05846opuBDosmoprotectant transport system permease proteincontig1_00043_13K05845opuCosmoprotectant transport system substrate-binding proteincontig1_00043_12K02000ProVglycine betaine / proline transport system ATP-binding proteincontig1_00072_2K02001ProWABC-type proline / glycine betaine transport systemcontig1_00072_1K02002ProXglycine betaine / proline transport system substrate-binding proteincontig1_00072_1부착K00691ATH1maltose phosphorylasecontig1_00084_10K03101lspALipoprotein signal peptidasecontig1_00051_5K02358tufATranslation elongation factor Tucontig1_00095_4K07284srtASortase Acontig1_00039_1K19420yveKprotein tyrosine kinase modulatorcontig1_00001_9K00903ywqEprotein-tyrosine kinasecontig1_00001_10K01958pycApyruvate carboxylasecontig1_00033_8K01803tpiAtriosephosphate isomerasecontig1_00056_2K00134gapAglyceraldehyde 3-phosphatedehydrogenasecontig1_00118_6K01689enoEnolasecontig1_00032_1K01810pgiglucose-6-phosphate isomerasecontig1_00113_11장 내 지속성K02759celCcellobiose PTS system EIIA componentcontig1_00023_19K02760celAcellobiose PTS system EIIB componentcontig1_00023_18K02761celBcellobiose PTS system EIIC componentcontig1_00024_1K00849galKGalactokinasecontig1_00103_2K21745pilipilus assembly proteincontig1_00012_19치즈 발효 및 풍미 관련 유전자K01190lacZbeta-galactosidasecontig1_00102_15K01784galEUDP-glucose 4-epimerasecontig1_00102_14K00016ldhL-lactate dehydrogenasecontig1_00021_20K01297ldcAmuramoyltetrapeptide carboxypeptidasecontig1_00086_12K01575alsDacetolactate decarboxylasecontig1_00059_5K01281pepPeptidasecontig1_00106_8K15580oppoligopeptide transport systemcontig1_00020_4K14731lipALipasecontig1_00025_3K00789metKS-adenosylmethionine synthetasecontig1_00099_6
[0118]
[0119] To withstand osmotic stress in the intestinal environment, the two genomes contain six genes responsible for the absorption and accumulation of osmoprotective substances such as glycine betaine, choline, and proline. The LB1022 genome was found to encode 11 genes predicted to code for adhesion-related proteins, including maltose phosphorylase, lipoprotein signaling peptidase II, elongation factor Tu, sortase A, and enolase, providing evidence of high adhesion ability. The two genomes were evaluated for adhesion analysis (see Figure 4). Compared to the control group, the viability of LB1022 was observed to decrease after 2 hours of contact with artificial gastric juice. Additionally, three genes (celC, celA, and celB) associated with intestinal persistence were also identified in the genome. Furthermore, LB1022 contained genes encoding genes related to the fermentation and flavor of cheese, including β-galactosidase, UDP-glucose 4-epimerase, L-lactate dehydrogenase, muramoyltetrapeptide carboxypeptidase, acetolactate decarboxylase, peptidase, oligopeptide transport system, lipase, and S-adenosylmethionine synthetase.
[0120]
[0121] Example 3. Evaluation of Immunomodulatory Effect
[0122] 3.1. Immunomodulatory Genes and Metabolism Prediction
[0123] Based on the KEGG database, the metabolic pathways predicted to be involved in the immunomodulation of genes encoded by LB1022 are shown in Table 3 below.
[0124]
[0125] KEGG ID FunctionLocation within LB1022Immune regulationK03367D-alanine-poly(phosphoribitol) ligase subunit 1contig1_00063_4K03739membrane_protein_involved_in_D-alanine_exportcontig1_00063_3K03740Poly-D-alanine_transfer_proteincontig1_00063_1K01940Argininosuccinate synthasecontig1_00007_9Anti-inflammatory related MetabolismM00932Phylloquinone biosynthesis(Cofactor and vitamin metabolism)OM00125Riboflavin biosynthesis(Cofactor and vitamin metabolism)OM00844Arginine biosynthesis(Arginine and proline metabolism)OM00028Ornithine biosynthesis(Arginine and proline metabolism)OM00015Proline biosynthesis(Arginine and proline metabolism)OM00023L-tryptophan biosynthesis(Arginine and proline metabolism)O
[0126]
[0127] The genome of LB1022 encodes four genes predicted to code for immunomodulatory enzymes, including D-alanine-poly(phosphoribitol) ligase subunit 1, membrane protein involved in d-alanine export, poly-d-alanine transfer protein, and arginosuccinate synthase. KEGG analysis revealed that these genes are associated with two metabolic processes: cofactor and vitamin metabolism, and arginine and proline metabolism. Biosynthetic metabolic processes include phylloquinone biosynthesis, riboflavin biosynthesis, arginine biosynthesis, ornithine biosynthesis, and L-tryptophan biosynthesis. Among these biosynthetic processes, three biosynthetic processes (arginine biosynthesis, ornithine biosynthesis, and proline biosynthesis) are associated with arginine metabolism. The LB1022 strain has nine genes that complete arginine metabolism (see Fig. 5). These results suggest that the LB1022 strain may be an excellent probiotic candidate with potential probiotic and immunomodulatory capabilities.
[0128] 3.2. Anti-inflammatory effect
[0129] Additionally, the immunomodulatory effect of LB1022 was evaluated. As shown in Figure 6a, mRNA expression of TLR4, NF-κB p65, and NF-κB p50, genes associated with inflammatory signaling pathways, was downregulated in the LB1022-treated group compared to the LPS control group.
[0130] In addition, as shown in Figure 6b, it was confirmed that LB1022 can exhibit anti-inflammatory activity by inhibiting the concentrations of TNF-α and IL-6 cytokines.
[0131]
[0132] Example 4. Inhibitory effect of LB1022 on allergic activity
[0133] The anti-allergic activity of LB1022 was evaluated through histamine release in HMC-1 cells. As shown in Figure 7a, the level of histamine release was significantly higher compared to the control group. LB1022 showed a significant decrease compared to the C48 / 80 treatment group. The β-hexosaminase enzyme, an indicator of degranulation in HMC-1 cells, occurs simultaneously with histamine release and is therefore widely used to track mast cell degranulation. As shown in Figure 7b, an increase in HMC-1 cell degranulation was observed in the C48 / 80 treatment group. In contrast, a significant decrease was confirmed in the LB1022 treatment group, indicating that LB1022 possesses the potential to alleviate allergic activity.
[0134]
[0135] Sintering
[0136] According to the results of the above-described examples, Lactococcus lactis LB1022 (hereinafter "LB1022") was confirmed to exhibit a combination of viability, adaptability to the intestinal environment, intestinal barrier protection ability, immunomodulatory ability, and anti-allergic activity required as a probiotic strain.
[0137] Specifically, whole-genome analysis of LB1022 revealed a diverse group of genes involved in acid tolerance, bile tolerance, adhesion, intestinal persistence, and fermentation-related functions, confirming that LB1022 possesses a genetic basis advantageous for survival and functional expression in the gastrointestinal environment. In addition, enzyme-coding genes and metabolic pathways related to immunomodulation (e.g., pathways related to cofactor / vitamin metabolism, arginine and proline metabolism) were identified, providing molecular evidence to support the immunomodulatory function of LB1022.
[0138] The above genome-based predictions were consistent with the results of in vitro evaluations. LB1022 demonstrated significantly higher tolerance compared to the control group under acid and bile salt conditions, confirming its excellent survival potential during gastrointestinal transit. Additionally, in an intestinal epithelial barrier model, the LB1022-treated group showed an increase in TEER values and a decrease in FITC-dextran permeability, confirming that it can contribute to maintaining or improving intestinal barrier function.
[0139] In addition, in the evaluation of immunomodulatory activity, LB1022 showed a tendency to regulate the expression of inflammation-related mediators, and in particular, it was confirmed to exhibit anti-inflammatory immunomodulatory ability through the reduction of the expression of key factors related to inflammatory responses. These results suggest that LB1022 is a functional strain capable of effectively acting to regulate host responses, going beyond being a mere viability strain.
[0140] In addition, in the evaluation of anti-allergic activity, LB1022 was found to inhibit histamine release in an HMC-1 cell model and significantly reduce β-hexosaminidase activity, an indicator of degranulation. This result demonstrates that LB1022 can contribute to the alleviation of allergic reactions by inhibiting mast cell activation and degranulation reactions.
[0141] In summary, LB1022 exhibits multifaceted effects of (i) survival and adaptation within the gastrointestinal environment, (ii) protection of intestinal barrier function, (iii) modulation of immune response, and (iv) inhibition of allergic reaction, and accordingly, it has been confirmed that it can be usefully applied as an active ingredient in probiotic compositions, food compositions (e.g., fermented dairy products, cheese curds, etc.), or compositions for the prevention, improvement, or alleviation of immune and allergy-related conditions.
[0142] Meanwhile, the above effects and functions should not be interpreted as being limited solely to the specific indicators or specific genes / metabolic pathways identified in this embodiment, but should be understood to include related effects that can be realized by the cells, cultures, culture supernatants, lysates, dead cells, metabolites, or combinations thereof of LB1022. Furthermore, the above results exemplarily demonstrate the utility of LB1022, and the scope of protection of the present invention is determined by the claims.
[0143]
[0144] II. Analysis of the Atopic March Alleviation Effect of Lactococcus lactis LB1022 Derived from Probiotic Cheese
[0145] Example 1. Allergic symptom relief effect of GCC
[0146] Longitudinal clinical scoring for skin inflammation revealed that OVA sensitization induced atopic dermatitis (AD)-like skin lesions in mice, including erythema, edema, dryness, and erosion / scratching, at week 16 (see Figs. 9a and 9c). Oral administration of Gardenia cheese curds (hereinafter referred to as "GCC") resulted in a significant reduction in lesion severity compared to mice with atopic dermatitis (see Fig. 9a). Furthermore, while eczematous lesions were observed in all mice, the GCC group showed a remission of periorbital dermatitis at week 16 (see Fig. 9b).
[0147]
[0148] Example 2. Effect of GCC on reducing Th2-related cytokine levels
[0149] As shown in Figure 10, serum levels of Th2 cytokines IL-4, IL-5, and IL-1β were increased in OVA mice compared to control mice. These increased serum levels of Th2 cytokines were significantly lowered by GCC treatment. In addition, Th2-promoting cytokines, including IL-17, IL-33, TSLP, and IL-1β, were elevated in the OVA group, whereas were significantly inhibited by GCC treatment.
[0150]
[0151] Example 3. Effect of GCC on reducing allergy-related antibody levels
[0152] Immunoglobulins primarily mediate allergic reactions in the immune system and are associated with allergic diseases. As shown in Figure 11, the OVA group demonstrated higher IgE levels. Additionally, the control cheese curds (hereinafter referred to as "CC") group also showed increased IgE levels similar to the OVA group, whereas the GCC group significantly reduced IgE levels. Notably, serum IgG2a levels, an important Th1 antibody, were slightly higher in the GCC group compared to the OVA group. Regarding serum IgG1, the OVA group showed a strong tendency to increase its levels (see Figure 11).
[0153]
[0154] Example 4. Effect of GCC on alleviating mast cell degranulation
[0155] To investigate the effects of GCC on intestinal inflammation in OVA-sensitized mice, pathological changes in ileal tissue were observed. As shown in Figure 12a, the OVA group exhibited intestinal mucosal epithelial damage in the ileal tissue. However, after GCC intervention, the mucosal epithelium recovered, the arrangement of glands and goblet cells became orderly, and inflammatory infiltration decreased. Further studies through mRNA expression analysis provided deeper insights into mucosal barrier function.
[0156] As shown in Figure 12b, ZO-1, claudin-1, and occluding mRNA levels were significantly increased in the GCC group compared to the OVA group. In addition, it was confirmed that the GCC group increased GLP-1 expression and suppressed IL-4 and IL-5 expression compared to the OVA group.
[0157]
[0158] Example 5. Inflammation-reducing efficacy of GCC in BALF and lung tissue
[0159] To confirm the anti-inflammatory effect of the GCC group, the severity of airway inflammation was measured in each mouse group (see Figures 13a to 13e). sRAW, an indicator of airway resistance, increased in the OVA group compared to the control group at 25 mg / mL methacholine. However, sRAW levels decreased in the GCC group (see Figure 13a).
[0160] As shown in Fig. 13b, counting of differentiated inflammatory cells revealed that the numbers of macrophages, lymphocytes, eosinophils, and neutrophils increased in the OVA and CC groups. However, these cells were found to decrease in the GCC group. Furthermore, H&E staining showed that inflammatory cell infiltration in the bronchioles and perivascular areas was significantly increased in the OVA group compared to the control group (see Fig. 13c), whereas in contrast, the GCC group showed a significant decrease compared to the OVA group. PAS staining also revealed a significant increase in mucus secretion and severe goblet cell proliferation in the OVA group compared to the control group. However, the GCC group significantly reduced these results (see Fig. 13d). Additionally, IL-4 and IgE levels within BALF were significantly increased in the OVA group. Conversely, the GCC group significantly decreased IL-4 levels, and only the GCC group showed a significant decrease in IgE levels (see Fig. 13e).
[0161]
[0162] Example 6. Regulation of fatty acid metabolism by GCC
[0163] GC-MS-based metabolite analysis was performed to investigate whether changes in the gut microbiome between the control group and the GCC group altered the composition of intestinal fecal metabolites. A total of 16 compounds were identified in the fecal metabolites. Heatmap analysis revealed metabolites that differed significantly in the gut, including 4 short-chain fatty acids, 4 saturated fatty acids, and 8 unsaturated long-chain fatty acid compounds (see Fig. 14a). The results showed that the concentrations of propionic acid and butyric acid were significantly lower in the GCC group compared to the OVA group.
[0164] Interestingly, five types of long-chain fatty acids were identified in the GCC group with an area under the receiver operating characteristic curve greater than 0.95 (see Fig. 14b). These data suggest that compared to the OVA group, the concentration of SCFAs increased in the GCC group, while LCFAs (e.g., palmitic acid, stearic acid, and arachidonic acid) decreased.
[0165]
[0166] Example 7. Effect of GCC on Reorganizing Gut Microbiota in an Atopic March Model
[0167] To gain a deeper understanding of the effects of GCC administration on the gut microbiome, fecal samples were analyzed to determine the composition of the gut microbiome. A total of 3,497,660 HiFi reads were obtained from 30 fecal samples. Sample diversity was expressed by the Chao1 and Shannon indices (see Figure 15a). The Shannon index for ASV levels was lower in the OVA and CC groups, but there were no significant differences among the other three groups. Meanwhile, the Chao1 index for ASV levels was significantly higher in the GCC group. This suggests that the gut microbiome changes induced by OVA were restored by GCC administration.
[0168] Beta diversity based on PCoA distance showed significantly different microbial structures among the groups (R2=0.3758, P=0.0004; see Fig. 15b). Firmicutes and Bacteroidota were found to be dominant species in all groups (over 90% of total bacteria; see Fig. 15c). At the genus level, Lactobacillus, Lachnospiraceae NK4A136, Ligilactobacillus, Odoribacter, Rikenella, and Alistipes were increased in the OVA groups compared to the control group (see Fig. 15c). Similarly, after GCC administration, compared to the OVA group, the abundance of NK4A136 and Bacteroides in Lachnospiraceae increased, while the abundance of Rigilactobacillus and Dubosiella decreased.
[0169] As a result of the comparative analysis between the OVA group and the GCC group, 30 ASVs were significantly detected, as can be seen in Fig. 15d (P<0.001). At the genus level, the abundance of the genera Bacteroides, Lactococcus, Bifidobacterium, Lachnoclostridium, and Collidextribacter was significantly higher after GCC administration, while the genera Escherichia-Shigella, Genella, Ligilactobacillus, Blautia, and Alloprevotella were significantly lower (see Figs. 15d and 15e).
[0170] To investigate the relationship between short-chain fatty acids (SCFAs) and gut microbial composition, microbial community distribution and associations with SCFAs were analyzed using an RDA plot. The OVA group was associated with Eubacterium xylanophilum and valerate. Notably, the GCC group was rich in butyrate-associated Alistipes taxa (see Fig. 15f).
[0171]
[0172] Example 8. Effect of GCC on Inducing Changes in Gut Microbiome Function in an Atopic March Model
[0173] Further analysis was performed on the intestinal metabolic profiles of OVA-induced atopic march mice administered GCC. The PCoA plot showed that the clusters of the PCC group were separated from the clusters of the OVA group (see Fig. 16a).
[0174] The Venn diagram revealed the existence of shared differential metabolites (see Fig. 16b). The GCC group and the OVA group shared 215 metabolic pathways, but 15 metabolic pathways were identified specifically in the GCC group and 13 metabolic pathways were specific only in the OVA group. PICRUSt2 analysis results showed that in the GCC group, D-glucuronide and D-glucuronate degradation (GLUCUROCAT-PWY), upstream pathways of hexuronide and hexuronate degradation (GALACT-GLUCUROCAT-PWY), D-galacturonate degradation I, tetrapyrrole biosynthesis I (PWY-5188), tetrapyrrole biosynthesis II (PWY-5189), D-fructuronate degradation (PWY-7242), and glycerol degradation to butanol were higher than in the OVA group, but histidine, purine, and pyrimidine The metabolism of biosynthetic (PRPP-PWY) and lactose and galactose degradation I (LACTOSECAT-PWY) was significantly lower (see Fig. 16c).
[0175]
[0176] Example 9. Effect of GCC on BALF microbial composition changes in an atopic march model
[0177] 5,879,570 high-quality 16S rDNA reads were obtained from a total of 30 lower airway creation samples. Hierarchical cluster analysis revealed differences in bacterial colonization within the lower airways between groups (see Fig. 17a).
[0178] Beta diversity based on PCoA distance showed similar microbial community structures among the groups (R2=0.1502, P=0.2672; see Fig. 17b). Taxonomic results indicated different microbial compositions among the groups. At the phylum level, all groups exhibited an overall variation in BALF microbial community composition. The results showed that Proteobacteria, Bacteroidota, and Actinomycetota were dominant in the OVA group, whereas Proteobacteria, Bacteroidota, Bacillota, and Deferribacteres were dominant in the GCC group (see Fig. 17c).
[0179] At the genus level, Paraburkholderia, Ralstonia, and Ligilactobacillus were dominant in the OVA group. Meanwhile, the control and GCC groups exhibited similar microbial compositions compared to the OVA group, being rich in Helicobacter, Rodentibacter, and Streptococcus (see Fig. 17d). Differential analysis and LEfSe (LDA=4, P < 0.001) revealed significant differences at the bacterial level between the OVA and GCC groups (see Fig. 17e).
[0180] The GCC group reduced the significantly high abundance of Bdellovibrionaceae, Archangiaceae, Legionelloceae, Mycobacteriaceae, and Thioprofundaceae at the family level. At the genus level, the abundance of Bdellovibrio, Vitosangium, Legionella, Paraeggerthella, and Thioprodundum was significantly reduced, while Rodentibacter and Oscilibacter were significantly increased in the GCC group compared to the OVA group (see Fig. 17f).
[0181]
[0182] Example 10. Effect of GCC on BALF Microbiome Function in Atopic March Model
[0183] BALF microbial function analysis was performed on OVA-induced atopic march mice administered with GCC. The PCoA plot showed that the clusters of the GCC group were not separated from the clusters of the OVA group (see Fig. 18a). However, the Venn diagram indicated the presence of shared differential metabolites (see Fig. 18b). The GCC and OVA groups shared 383 metabolic pathways, but 7 metabolic pathways were identified specifically in the GCC group, and 16 metabolic pathways were specific only in the OVA group.
[0184] PICRUSt2 analysis results showed that UDP-N-acetylmuramoyl-pentapeptide biosynthesis I and II, peptidoglycan biosynthesis III, anhydromuropeptides recycling, thiamine diphosphate biosynthesis I (THISYN-PWY), and L-tryptophan biosynthesis (TRPSYN-PWY) were higher in the GCC group than in the OVA group, whereas fatty acid elongation saturated (FASYN-ELONG-PWY), palmitate biosynthesis II (PWY-5971), and palmitoleate biosynthesis I (PWY-6282), and aerobic respiration I (PWY-3781) metabolic activity was found to be significantly lower (see Fig. 18c).
[0185]
[0186] Sintering
[0187] According to the results presented in the above-described examples, a combination composition (GCC) containing Lactococcus lactis LB1022 and gardenia extract was found to exhibit significant improvement effects across skin, intestines, lungs, and systemic immune indicators in OVA-sensitized atopic march model mice.
[0188] Specifically, the GCC administration group significantly alleviated the clinical scores and macroscopic appearance of skin lesions (erythema, edema, dryness, erosion / abrasions, etc.) induced by OVA sensitization, and also improved the appearance of periorbital dermatitis. Furthermore, regarding serum allergy-related immune markers, the GCC administration group suppressed the increase of Th2-related cytokines and related inflammatory mediators, decreased IgE and IgG1 levels, and showed a relative improvement in IgG2a levels. This suggests that GCC has an effect in regulating systemic immune imbalances associated with the atopic march.
[0189] The effects of GCC were also clearly confirmed at the intestinal level. In the GCC administration group, ileal mucosal epithelial damage, increased inflammatory infiltration, and mucosal structural abnormalities observed in the OVA sensitization group were alleviated, and the recovery of mucosal epithelium and normalization of tissue arrangement were observed. Furthermore, the expression of ZO-1, Claudin-1, and Oculudin, indicators related to intestinal barrier function, increased, and suppression of IL-4 and IL-5 expression was confirmed along with increased GLP-1 expression. This supports the fact that GCC contributes to maintaining and restoring the structural and functional stability of the intestinal mucosal barrier and suppresses allergic inflammatory responses within the intestinal tract.
[0190] Significant improvement effects of GCC were also confirmed in the evaluation of airway and lung tissues. The GCC administration group suppressed the increase in airway resistance indicators (sRAW) and reduced the increase in the number of inflammatory cells, such as macrophages, lymphocytes, eosinophils, and neutrophils, within BALF. Furthermore, inflammatory cell infiltration, goblet cell hyperplasia, and increased mucus secretion in lung tissues were significantly alleviated, and IL-4 and IgE levels within BALF were also reduced. In particular, selective or more pronounced reductions were observed in some indicators in the GCC administration group, demonstrating that GCC can effectively inhibit the progression of the atopic march from the atopic dermatitis stage to the airway inflammation / asthma-like lesion stage.
[0191] Metabolite and microbiome analyses also supported the action of GCC. The GCC administration group significantly altered the intestinal fatty acid profile (SCFA / LCFA) and intestinal microbial composition, indicating a direction for the recovery of the disrupted intestinal microbiome structure in the atopic march model. Furthermore, in the analysis of intestinal microbial function prediction, the GCC administration group exhibited differential regulation of specific metabolic pathways, suggesting that GCC regulates metabolic and immune-related pathways at the level of microbial function, rather than merely altering the flora.
[0192] Furthermore, in the BALF microbial composition and function analysis, the GCC administration group exhibited changes in bacterial communities and metabolic pathways distinct from the OVA sensitization group. This supports the possibility that GCC influences not only the intestinal environment but also the airway / lung microbiome and their functional characteristics, thereby regulating allergic inflammatory responses at the gut-lung axis level.
[0193] In summary, the combination composition (GCC) of LB1022 and gardenia extract provides multifaceted and significant effects, simultaneously exhibiting (i) alleviation of skin lesions, (ii) improvement of serum immunity / allergy indicators, (iii) improvement of intestinal barrier function and intestinal inflammation, (iv) alleviation of airway reactivity and lung inflammation, and (v) regulation of intestinal and BALF microbiome composition / function. Therefore, the combination composition can be usefully applied as a composition for the prevention, improvement, alleviation, and / or management of atopic dermatitis, allergic asthma, and associated atopic march-related conditions.
[0194] Meanwhile, the effects of the present invention described above should not be interpreted as being limited by the specific formulation (e.g., cheese curd), specific dosage form, or specific analytical indicator used in the embodiments thereof, and may be applied to various embodiments of compositions containing LB1022, such as cells, cultures, culture supernatants, lysates, dead cells, metabolites, or combinations thereof, and gardenia extract or fractions thereof / active ingredients. Furthermore, the above results are illustrative of the effects of the present invention, and the scope of protection of the present invention should be interpreted according to the description in the claims.
[0195]
[0196] III. Materials and Methods
[0197] Experimental Example 1. Characterization of Lactococcus lactis LB1022
[0198] Strain LB1022, isolated from cheese or kimchi, was used. The strain was cultured in TSA medium under aerobic conditions at 30°C for 48 hours. Subsequently, genomic DNA was extracted using STE buffer and finally eluted with 50 μL of nuclease-free water. The concentration was adjusted to 100 ng / μL for use in next-generation sequencing (NGS), and sequencing reads were generated using the PacBio RS II platform by Macrogen (located in Seoul). Long reads were assembled using the de novoassembly SMRT method, and CheckM (v1.0.18) was used for genomic quality evaluation.
[0199]
[0200] Experimental Example 2. Functional Genomic Analysis of Lactococcus lactis LB1022
[0201] After constructing the genome sequences, annotation was performed using the Prokka v1.14.6 program. Coding sequences (CDS) were predicted using Prodigal, and functional annotations were applied to the virtual protein coding sequences predicted from Lc. lactisLB1022 and Lb. plantarumLB1025 by applying the COG (Clusters of Orthologous Group) and KEGG (Kyoto Encyclopedia of Genes and Genomes) databases. Through this process, the functional characteristics of the genes and proteins possessed by the target strains can be identified more systematically.
[0202]
[0203] Experimental Example 3. Evaluation of Probiotic Characteristics
[0204] 3.1. Analysis of Bile and Acid Resistance
[0205] Bile tolerance and acid tolerance of L. lactis LB1022 were evaluated according to a previously proposed method (Hernandez-Gomez et al., 2021). Bile tolerance was evaluated by inoculating a culture of LB1022 onto TSB agar medium supplemented with 0.4% bovine bile acid (Oxgall, USA) and checking viability. Acid tolerance was evaluated by centrifuging the culture at 12,000 g at 4°C, culturing the bacteria in TSA medium adjusted to pH 2.0, and then measuring the viable cell count to confirm viability in an acidic environment.
[0206] 3.2. Evaluation of Adhesion Performance
[0207] The adhesion ability of LB1022 to Caco-2 cells was tested using a previously proposed method (Tuomola and Salminen, 1998). First, Caco-2 cells were cultured in minimum essential medium (MEM) containing 10% (v / v) FBS and 1% (v / v) penicillin-streptomycin (PS) under conditions of 5% CO2 and 37°C. Subsequently, 5×10 5 Cells were inoculated into 24-well plates at a concentration of cells / mL and cultured for 48 hours. The cultured bacterial cells were recovered by centrifugation at 12,000 g at 4°C, resuspended in MEM without PS, and added to the corresponding cell culture wells. After culturing for a certain period, the Caco-2 cells were washed three times with PBS and lysed in 0.05% Triton-X100 solution to recover the attached bacteria. Subsequently, cell adhesion ability was evaluated by comparing the number of effective attached bacteria.
[0208] 3.3. Measurement of Transepithelial Electrical Resistance (TEER)
[0209] TEER, which can affect TJ (tight junction) permeability, was evaluated using a previously reported method (Li et al., 2019). Specifically, Caco-2 cells, primarily used as an intestinal epithelial barrier model, were placed on transwell inserts in 24-well plates at 5×10°C. 4 Cells were sown at a concentration of 400 μL, and accordingly, 600 μL of culture medium was inoculated into the lower compartment. Caco-2 cells had a TEER value of 500–550 Ω·cm 2Incubation was continued until a threshold was reached. TEER values were calculated using a Millicell-ERS-2 voltammetry meter (Millipore, Bedford, MA, USA). For TEER evaluation, the culture medium was removed from the upper and lower compartments, washed with Hank's balanced salt solution (HBSS; Manassas, VA), and the same solution was added to both compartments. The measured electrical resistance was calculated as the average of three repeated measurements, with the unit being Ω·cm. 2 It was indicated as.
[0210] 3.4. Analysis of Intercellular Permeability
[0211] To evaluate paracellular permeability, Caco-2 cells cultured in Transwells were washed with HBSS, and the culture medium in the lower compartments was removed. After washing, 100 μg / mL FITC-dextran was added to the upper compartment, and HBSS was added to the lower compartments. Then, the cells were cultured for 2 hours, and 100 μL of the basolateral solution was recovered and quantified using a fluorescence microplate reader (Tecan) at an excitation of 485 nm and an emission of 535 nm. The analysis was repeated three times for each group.
[0212]
[0213] Experimental Example 4. Evaluation of in vitro anti-allergic effect
[0214] 4.1. β-Hexosaminidase and Histamine Analysis
[0215] A β-hexosaminidase assay was performed to evaluate the inhibitory effect on degranulation. HMC-1 cells were cultured in DMEM (Dulbecco's Modified Eagle Medium) containing 10% FBS and seeded in 24-well plates for 48 hours. The cells were 3×10⁻⁶ 6 Cells were seeded at density and, after treatment with Tyrode's buffer (135 mM NaCl, 5 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2, 5.6 mM glucose, 0.1% BSA, 20 mM HEPES, pH 7.4), 1 mL was added to each well. Cells were cultured using strain LB1022 (10 8 The cells were incubated with 10 μL of CFU / mL at 37°C for 30 minutes. The reacted cells were treated with 6.8 μg / mL of C48 / 80 and incubated for 30 minutes. Next, the degranulation reaction was terminated first on ice for 10 minutes. To evaluate the activity of the released β-hexosaminidase, 30 μL of the sample and 30 μL of 1 mM p-nitrophenyl-N-acetyl-β-d-glucosaminide were mixed in 0.1 M citrate buffer (1.34 g sodium citrate dihydrate and 1 g citrate acid) and incubated at 37°C for 1 hour. The reaction was terminated a second time with a sodium bicarbonate (pH 10.2) solution. Absorbance was measured using a microplate reader.
[0216] In the case of the histamine test, HMC-1 cells (10 6 After culturing cells / mL) at 37℃ for 24 hours, the LB1022 (10 cells / mL) cultured in each well were 8OVA / Alum (CFU / mL) was added and incubated at 37°C for 1 hour. After the reaction, the cells were treated with 10 μg / mL C48 / 40 for 20 minutes. OVA / Alum was measured as a positive control. Cells were harvested and centrifuged at 1,000 g for 10 minutes. The supernatant was analyzed using a histamine ELISA kit (R&D systems, USA).
[0217] 4.2. Analysis of Immunomodulatory Effects
[0218] THP-1 cells were cultured in RPMI1640 containing 10% FBS and penicillin-streptomycin (PS) under 5% CO2 and 37°C conditions. 1 x 10⁻⁶ 6 2 mL of THP-1 cell suspension seeded in a 12-well plate at a concentration of cells / mL was treated with 60 ng / mL of PMA (phorbol 12-myristate 13-acetate) and cultured for 48 hours under 5% CO2 at 37°C to induce differentiation. After differentiation, the culture medium was replaced with a medium free of PMA and cultured for 24 hours. LB1022 was added to differentiated THP-1 cells treated with or without 1 µg / ml LPS. After culturing for 12 hours, the supernatant was removed and washed three times with PBS. The supernatant was analyzed using an ELISA kit (R&D systems, USA). For analysis, cells were harvested and total RNA was extracted using the Trizol reagent. Total RNA was synthesized into cDNA using the PrimeScript™ 1st strand cDNA synthesis kit (Takara Bio, USA), and real-time PCR (RT-PCR) was performed using SYBR Green Master Mix. mRNA expression was 2 -ΔΔct Calculated using the method. The primer sequences used in this experimental example are listed in Table 4 below.
[0219]
[0220] Gene Primer TLR4 Forward: ACTTGGACCTTTCCAGCAAC Reverse: TTTAAATGCACCTGGTTGGANF-kB p65 Forward: CAGGCGAGAGGAGCACAGATAC Reverse: TCCTTTCCTACAAGCTCGTGGGNF-kB p50 Forward: TGCAGCAGACCAAGGAGATG Reverse: TGCATTGGGGGCTTTACTGTZO-1 Forward: CACACGATGCTCAGAGACGAAGG Reverse: CTGTATGGTGGCTGCTCAAGGTCClaudin-1 Forward: CCCTATGACCCCAGTCAATG Reverse: AAGGCAGAGAGAAGCAGCAGOccludin Forward: GACCTTGTCCGTGGATGACTTCAG Reverse: ATCAGCAGCAGCCATGTACTCTTCGLP-1 Forward: CCCCAGGTTCCTTCGTGAAT Reverse: AGCCAACAAGGATGGCTGAAIL-4 Forward: GTCATCCTGCTCTTCTTTCTCG Reverse: CTCTCTGTGGTGTTCTTCGTTGIL-5 Forward: CTCTGTTGACAAGCAATGAGACG Reverse: TCTTCAGTATGTCTAGCCCCTGβ-actin Forward: AGCGAGCATCCCCCAAAGTT Reverse: GGGCACGAAGGCTCATCATT
[0221]
[0222] Experimental Example 5. Preparation of Probiotic Cheese Curd
[0223] Pasteurized milk samples were stored at 37°C with continuous stirring. At this temperature, a freeze-dried starter culture containing Lactococcus lactis LB1022 was added to achieve an initial inoculation level of 6 log CFU / mL. The starter culture was cultured in the milk for 90 minutes, after which 0.01% rennet was added, and the mixture was coagulated at 37°C for 1 hour. The coagulated mass was cut into 1 cm cubes and heated and stirred at 37°C. After draining the whey, the curds were formed and stored at room temperature for approximately 2 hours. Fresh cheese curds were collected and stored at 4°C until further analysis. Control cheese curds (also referred to herein as CC) were prepared in the same manner as the probiotic cheese curds, except that the milk acidification step using probiotics was replaced by the direct addition of citric acid. Gardenia cheese curds (GCC) are a mixture of L. Lactis LB1022 and gardenia extract. The gardenia extract was mixed to a concentration of 325 μg / 500 μl.
[0224]
[0225] Experimental Example 6. Atopic March Mouse Model
[0226] For animal experiments, 6-week-old female BALB / c mice supplied by the National Center for Laboratory Animals in Korea were used. All procedures were approved and authorized in accordance with the guidelines of Chung-Ang University (Seoul, South Korea) (Approval No. 2018-00022). The sensitization and treatment schedule is summarized in Figure 8. Briefly, dorsal hair was removed using shaving and depilatory creams. Subsequently, for atopic dermatitis sensitization, intraperitoneal sensitization with OVA (containing 50 mg aluminum) was performed on the mice on days 0, 14, 28, 42, and 56. Mice sensitized with OVA were orally administered PBS, OVA, CC (10 g / kg) without probiotic culture, or GCC (10 g / kg) containing L. lactis LB1022 and Gardenia for 8 weeks. From day 111 to day 112, all mice were exposed to OVA (2%) aerosol dissolved in PBS for 20 minutes in a sealed chamber connected to a nebulizer. Serum was collected by centrifugation at 6,000 rpm for 30 minutes and stored at -80°C until immunoglobulin analysis. All mice were sacrificed on day 113, and cecum, bronchoalveolar lavage fluid (BALF), skin, lung, and ileum tissues were collected for further study.
[0227]
[0228] Experimental Example 7. Evaluation of Atopic Dermatitis Score
[0229] Gross evaluation of AD severity was performed as the sum of individual scores for erythema, edema, dryness, and erosion / abrasion (0 = none, 1 = mild, 2 = moderate, and 3 = severe).
[0230]
[0231] Experimental Example 8. Measurement of Airway Reactivity
[0232] Airway responsiveness to nebulized methacholine chloride (MCh, Sigma) was evaluated in mice using the Buxco Finepoint NAM system (FinePointe TBL4500) after final stimulation induction. Based on prior experiments, mice were secured in a chamber and acclimatized briefly; they were first stimulated by nebulized PBS (as 0 mg / mL MCh), followed by escalating doses of nebulized MCh (6.25, 12.5, and 25 mg / mL). Each mouse received the PBS or MCh spray for 30 seconds, and specific airway resistance (sRaw) parameters were measured sequentially for 3 minutes after spraying. A 5-minute recovery period was granted to the mice after measurements for each dose. Airway responsiveness was determined by sRaw.
[0233]
[0234] Experimental Example 9. Collection and Analysis of BALF
[0235] After sacrificing the mice, the lungs were immediately flushed with 1 mL of PBS via a tracheal cannula. The BALF was centrifuged at 1,000 rpm for 10 minutes at 4°C, and the supernatant was stored at -80°C until cytokine analysis. The pellets were aggregated to determine the total cell count and the differential cell count, including macrophages, eosinophils, neutrophils, and lymphocytes. The total cell count was confirmed using trypan blue and measured with a TC20 automated cell counter (Bio-Rad, USA). The total cell count, including macrophages, eosinophils, neutrophils, and lymphocytes within the BALF, was determined after Wright-Giemsa staining.
[0236]
[0237] Experimental Example 10. Cytokine Measurement
[0238] The concentrations of various cytokines (IL-4, IL-5, IL-6, IL-13, IL-17, IL-33, TSLP, eosinophils, and IFN-γ) and immunoglobulins (IgE, IgG1, and IgG2a) in serum and BALF were determined using an ELISA (Enzyme-Linked Immunosorbent Assay) kit (Abcam, UK and R&D System, USA) according to existing guidelines. Absorbance was measured at 450 nm using a spectrophotometer.
[0239]
[0240] Experimental Example 11. Analysis of gene expression by real-time quantitative polymerase chain reaction (RT-PCR)
[0241] Total RNA from skin and ileal tissues was extracted using the RNeasy lipid kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The extracted RNA was synthesized into cDNA using the PrimeScript 1st strand cDNA synthesis kit (Takara, Japan). To quantify mRNA expression levels related to the atopic march factor, Real-time Polymerase Chain Reaction (RT-PCR) was performed using the Quant Studio 3 PCR System (Thermo Scientific), and Qiagen (Hilden, Germany) SYBR green was used 2 -ΔΔCt The analysis was performed using the method. The primer sequences used for each gene in this experimental example are shown in Table 4 above.
[0242]
[0243] Experimental Example 12. Histological Analysis
[0244] The collected left lung, skin, and ileal tissues of mice were fixed in a 4% paraformaldehyde solution. Subsequently, the tissues were embedded in paraffin (thickness 5 μm), stained with hematoxylin and eosin (H&E) to evaluate inflammatory cell infiltration, and stained with periodic acid-Schiff (PAS) to evaluate goblet cell proliferation and mucus production. Scanning was performed using a microscope (DM 4000B; Leica Microsystems, Wetzlar, Germany) at 400x magnification.
[0245]
[0246] Experimental Example 13. Metabolite analysis using GC-MS
[0247] Fecal samples (100 mg) for short-chain fatty acid (SCFA) analysis were mixed with 1 mL of ultrapure water. The samples were homogenized and centrifuged at 12,000 rpm for 15 minutes at 4 °C to obtain the supernatant. The fatty acid content was quantified using an Agilent 7890A gas chromatography system (GC-MS; Agilent Technologies, Santa Clara, CA, USA). For LCFA analysis, fecal samples were prepared according to the method of Batta (2002) and analyzed by GC-MS as follows: unsaturated fatty acid C18:1 (oleic acid), and saturated fatty acids C14:0 (myristic acid), C16:0 (stearic acid), C18:0 (palmitic acid), and C20:0 (arachidic acid).
[0248]
[0249] Experimental Example 14. Metagenome Sequencing
[0250] DNA from fecal and BALF samples was obtained using a fecal DNA extraction kit (MP Biomedicals, USA), and the 16S rRNA gene in the V3-V4 region was amplified via PCR. Genomic DNA library construction and sequencing on the PacBio RSII platform for gut microbiome analysis and the MiSeq platform (Illumina) for BALF microbiome analysis were commissioned to Macrogen (South Korea). De novo assembly was performed using HGAP (v3.0), and annotations were performed using Prokka (version 1.14).
[0251]
[0252] Experimental Example 15. Microbiome Analysis
[0253] All raw sequences were analyzed using R software (version 4.0) along with Qiime2 software for the DADA2 pipeline. Sequencing was processed to remove chimeras, and final ASVs and feature tables were obtained. Next, the acquired ASVs were assigned to taxa based on the SILVA 16S rRNA gene database (Release132). Alpha diversity was expressed as Chao1 and Shannon indices in the phyloseq R package. Principal component analysis (PCoA) was also performed using the phyloseq R package. Linear Discriminant Analysis (LDA) effect size (LEfSe) analysis was performed to identify bacterial ASVs significantly. Venn plots were executed using the VennDiagram R package.
[0254]
[0255] Experimental Example 16. PICRUSt2 Function Prediction Analysis
[0256] PICRUSt2 predicts the functional profiling of microbial communities based on the number of orthologs (Kos) from the Kyoto Encyclopedia of Genes and Genomes (KEGG), and reduces them to the pathway level according to the KEGG database (genome.jp / kegg / pathway.html).
[0257]
[0258] Experimental Example 17. Statistical Analysis
[0259] For in vitro experiments, all experiments were performed in triplicate, and all data were expressed as mean ± standard deviation (mean ± SD). Statistical analysis and image generation were performed using GraphPad Prism (GraphPad Software, Inc., San Diego, CA) 8.0, and ANOVA was applied. Mean values were compared using the Dunnett test at a significance level of P < 0.05.
[0260] For in vivo experiments, the statistical significance of the data between different groups was evaluated using one-way analysis of variance (ANOVA) including the Dunnett test with GraphPad Prism 8.0. The two groups were evaluated using t-test analysis. Differences were considered statistically significant at P < 0.05.
[0261]
[0262] The description of the invention set forth above is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.
Claims
1. A composition for the prevention, improvement, or treatment of the atopic march, comprising a strain of Lactococcus lactis subsp. lactis or a culture thereof, culture supernatant, cell, cell lysate, dead cell, metabolite, and combinations thereof; and gardenia extract or a fraction thereof.
2. In Paragraph 1, The above-mentioned Lactococcus lactis subsp. lactis strain is a composition in which the Lactococcus lactis subsp. lactis LB1022 strain deposited under accession number KCTC 15324BP.
3. In Paragraph 1, The above-mentioned Lactococcus lactis subspecies lactis strain is a composition in which the strain is a dairy-derived strain.
4. In Paragraph 1, The above gardenia extract is a composition that is an extract, concentrate, fraction, or combination thereof obtained from gardenia fruit, seeds, peel, or a combination thereof.
5. In Paragraph 1, The above gardenia extract is a composition comprising an extract, fraction, concentrate, or mixed extract thereof prepared using water, an organic solvent, a mixed solvent, or a supercritical fluid.
6. In Paragraph 1, A composition containing the above gardenia extract at a concentration of 100 μg / mL to 2,000 μg / mL.
7. In Paragraph 1, The above composition is a pharmaceutical composition, a quasi-drug composition, a health functional food composition, or a food composition.
8. In Paragraph 1, The above composition is a composition for oral administration.
9. In Paragraph 1, The above atopic march is a composition comprising one or more selected from the group consisting of food allergy, atopic dermatitis, rhinitis, conjunctivitis, and asthma.
10. In Paragraph 9, The above composition is a composition for improving or alleviating one or more atopic dermatitis-like skin lesions selected from the group consisting of erythema, edema, dryness, erosion, and excoriation.
11. In Paragraph 1, The above composition is a composition that reduces the levels of one or more Th2-related cytokines selected from the group consisting of IL-4, IL-5, and IL-1β.
12. In Paragraph 1, The above composition is a composition exhibiting the following immunomodulatory effects: (i) decrease IgE or IgG1 levels; or (ii) Increase IgG2a levels or improve the IgG2a / IgE ratio.
13. In Paragraph 1, The above composition is a composition that restores the intestinal mucosal epithelium.
14. In Paragraph 1, The above composition is a composition that increases the expression level of one or more selected from the group consisting of ZO-1, claudin-1, and occludin.
15. In Paragraph 1, The above composition is a composition that increases GLP-1 expression and inhibits IL-4 or IL-5 expression.
16. In Paragraph 1, The above composition is a composition that inhibits an increase in the number of one or more inflammatory cells selected from the group consisting of macrophages, lymphocytes, eosinophils, and neutrophils.
17. In Paragraph 1, The above composition is a composition that inhibits the proliferation of goblet cells or an increase in mucus secretion.
18. In Paragraph 1, The above composition is a composition that reduces IL-4 and IgE levels in bronchoalveolar lavage fluid (BALF).
19. In Paragraph 1, The above composition is a composition for regulating the intestinal fatty acid metabolism profile, including changes in the concentration of short-chain fatty acids (SCFA) or long-chain fatty acids (LCFA).
20. In Paragraph 1, The above composition is a composition for remodeling the composition of intestinal microorganisms.
21. In Paragraph 20, The above remodeling is a composition that induces a change in the abundance of the following microorganisms: (i) Increase in the abundance of one or more bacterial genera selected from the group consisting of Bacteroides, Lactococcus, Bifidobacterium, Lachnoclostridium and Colidextribacter; or (ii) Decrease in abundance of one or more bacterial genera selected from the group consisting of Escherichia-Shigella, Genella, Ligilactobacillus, Blautia, and Alloprevotella.
22. Cheese curds prepared by inoculating a strain of Lactococcus lactis subsp. lactis; and a food composition for preventing or improving the atopic march, comprising gardenia extract or a fraction thereof.
23. A food composition for preventing or improving the atopic march, comprising cheese curds prepared by inoculating a mixture containing a strain of Lactococcus lactis subsp. lactis and gardenia extract.
24. In Paragraph 22 or 23, The above-mentioned Lactococcus lactis subsp. lactis strain is a composition in which the Lactococcus lactis subsp. lactis LB1022 strain deposited under accession number KCTC 15324BP.