Hypoimmunogenic IPS cell lines and uses thereof

WO2026178485A2PCT designated stage Publication Date: 2026-08-27BOSTON MEDICAL CENTER INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2026/016240
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-02-24
Filing Date
2026-02-23
Publication Date
2026-08-27

Smart Images

  • Figure US2026016240_27082026_PF_FP_ABST
    Figure US2026016240_27082026_PF_FP_ABST
Patent Text Reader

Abstract

Aspects disclosed herein related to genetically engineered induced pluripotent stem cell (iPSC), comprising a) a biallelic disruption of endogenous beta-2-microglobulin (B2M); b) an exogenous nucleic acid encoding an HLA-E protein integrated at the endogenous B2M genomic locus, the fusion protein being expressed by the iPSC; c) a biallelic disruption of the class II transactivator (CIITA) gene; and d) an exogenous nucleic acid encoding a CD47 protein integrated at the CIITA genomic locus, wherein the genetically engineered iPSC exhibits reduced immunogenicity and is capable of long-term engraftment following transplantation into an allogeneic recipient.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket: 701586-000167WOPT HYPOIMMUNOGENIC IPS CELL LINES AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This invention claims benefit under 35 U. S. C. §119(e) of U. S. Provisional Application 63 / 762,476 filed on February 24, 2025, the contents of each are incorporated herein in their entirety by reference.FIELD OF THE INVENTION

[0002] The technology described herein relates to engineered cells that evade immune responses.BACKGROUND OF THE DISCLOSURE

[0003] The invention is an immune-cloaked (hypoimmunogenic) induced-pluripotent stem cell (iPSC) line. Current cellular therapies and regenerative medicine practices are marred by the inability to transplant cellular products between individuals as the recipient (hosts) immune system will target and eliminate all engrafted cells. Alternatively, donor cells may by immunologically matched to recipient cells through identification of common immunological signatures, (Human Leukocyte Antigen (HLA)) matching, yet this method only reduces the immunogenic responses and engrafted cells may still be eliminated. Further, creation of iPSCs on a per-patient basis would alleviate host rejection as the iPSC’s possess the same HLA match, yet this is costly and technologically impractical for widespread applications. Thus, this hypoimmunogenic cell line will be used as a “universal donor” for transplantation of iPSC-derived cell lines for regenerative medicine and cellular therapies. These universal, hypoimmunogenic iPSCs serve as the foundation for all iPSC-derived cellular and tissue transplantation for regenerative medicine. For example, the hypoimmunogenic iPSCs can be differentiated into human lung basal cells and transplanted to replace the lining of lung tissue, or the iPSCs can be differentiated into T cells to be used for replenishing Thymic cells (T cells) in blood or other applications in T cell cancer therapies. The hypoimmunogenic cells were genetically altered using CRISPR / cas9 technology to remove protein expression of HLA proteins (i.e., Major Histocompatibility Complexes (MHC) I and II) and induce expression of HLA-E and CD47 that allow the iPSC’s to evade the host’s immune system to allow successful engraftment.SUMMARY OF THE DISCLOSURE

[0004] One aspect disclosed herein provides a genetically engineered induced pluripotent stem cell (iPSC), comprising: a) a biallelic disruption of endogenous beta-2 -microglobulin (B2M); b) an exogenous nucleic acid encoding an HLA-E protein integrated at the endogenous B2M genomic locus, the fusion protein being expressed by the iPSC; c) a biallelic disruption of the class II transactivator (CIITA) gene; and d) an exogenous nucleic acid encoding a CD47 protein integrated at the CIITA genomic locus, wherein the genetically engineered iPSC exhibits reduced immunogenicity and is capable of long-term engraftment following transplantation into an allogeneic recipient.14904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT

[0005] In one embodiment of this aspect or any aspect herein, the iPSC does not express B2M.

[0006] In one embodiment of this aspect or any aspect herein, disruption of B2M prevents transcriptional activation of MHC class I genes.

[0007] In one embodiment of this aspect or any aspect herein, disruption of the CIITA gene prevents transcriptional activation of MHC class II genes.

[0008] In one embodiment of this aspect or any aspect herein, the iPSC does not express HLA-A, HLA-B, and HLA-C.

[0009] In one embodiment of this aspect or any aspect herein, the iPSC does not express HLA-DR, HLA-DP, and HLA-DQ.

[0010] In one embodiment of this aspect or any aspect herein, the HLA-E protein is operably linked to an endogenous B2M regulatory element.

[0011] In one embodiment of this aspect or any aspect herein, the nucleic acid encoding a CD47 protein is constitutively expressed.

[0012] In one embodiment of this aspect or any aspect herein, the nucleic acid encoding an HLA-E protein comprises a sequence of SEQ ID NO: 7.

[0013] In one embodiment of this aspect or any aspect herein, the nucleic acid encoding a CD47 protein comprises a sequence of SEQ ID NO: 8.

[0014] In one embodiment of this aspect or any aspect herein, genetic modifications are introduced using CRISPR / Cas9-mediated genome editing.

[0015] In one embodiment of this aspect or any aspect herein, a guide RNA targets exon 1 of the endogenous B2M gene to mediate homologous recombination of the nucleic acid encoding an HLA-E protein.

[0016] In one embodiment of this aspect or any aspect herein, a guide RNA targets exon 1 of the CIITA gene to mediate insertion of the nucleic acid encoding a CD47 protein.

[0017] In one embodiment of this aspect or any aspect herein, the iPSC is not capable of being detected by a T-cell.

[0018] In one embodiment of this aspect or any aspect herein, the iPSC is not capable of being detected by a natural killer (NK)-cell.

[0019] In one embodiment of this aspect or any aspect herein, the iPSC further comprises a nucleic acid sequence encoding an HLA-G protein. In one embodiment of this aspect or any aspect herein, the nucleic acid sequence encoding an HLA-G protein is expressed in the B2M locus.

[0020] Another aspect disclosed herein provides a method of producing a hypoimmunogenic iPSC, comprising a) introducing into an iPSC a CRISPR / Cas9 system comprising i) a guide RNA targeting exon 1 of the endogenous B2M gene and a donor nucleic acid comprising a nucleic acid sequence encoding an HLA-E protein flanked by homology arms corresponding to the B2M locus, and ii) a guide RNA targeting exon 1 of the CIITA gene and a donor nucleic acid comprising a nucleic acid sequence encoding a CD47 protein; and b) selecting iPSCs comprising a biallelic insertion of the nucleic acid24904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT sequence encoding an HLA-E protein and a biallelic disruption of endogenous B2M and a biallelic disruption of CIITA and insertion of the nucleic acid sequence encoding a CD47 protein.

[0021] Another aspect disclosed herein provides a method of reducing immune-mediated rejection of transplanted cells, comprising a) differentiating any of the engineered iPSCs disclosed herein into a therapeutic cell type; and b) transplanting the differentiated cells into a human subject, wherein the transplanted cells evade T-cell, natural killer cell, and macrophage-mediated immune responses.

[0022] Another aspect disclosed herein provides a method of reducing immune-mediated rejection of transplanted cells, comprising a) differentiating any of the engineered iPSCs disclosed herein into a therapeutic cell type; and b) transplanting the differentiated cells into a human subject, wherein the transplanted cells evade T-cells and natural killer cells.

[0023] In one embodiment of this aspect or any aspect herein, the therapeutic cell type is selected from the group consisting of lung basal cells, T cells, NK cells, hematopoietic cells, epithelial cells, and tissue progenitor cells.

[0024] In one embodiment of this aspect or any aspect herein, the iPSCs cells are autologous to the subject receiving the transplanted differentiated cells.

[0025] In one embodiment of this aspect or any aspect herein, the iPSCs cells are allogenic to the subject receiving the transplanted differentiated cells.

[0026] In one embodiment of this aspect or any aspect herein, the transplanted differentiated cells have an increased engraftment rate as compared to an appropriate control.

[0027] In one embodiment of this aspect or any aspect herein, the subjects receiving the transplanted differentiated cells have a decreased risk of host versus graft disease as compared to an appropriate control.BRIEF DESCRIPTION OF THE DRAWINGS

[0028] FIG. 1 depicts a schematic of the B2M-G4S-HLA-E plasmid used to inhibit the HLA-A, HLA-B, and HLA-C genes, and knock in HLA-E gene operatively linked to B2M regulatory element.

[0029] FIG. 2 depicts a schematic of the EF-la-CD47 plasmid used to inhibit the HLA-DR, HLA-DP, and HLA-DQ genes, and knock in the CD47 gene operatively linked to EFla.DETAILED DESCRIPTION OF THE DISCLOSUREEngineered iPSCs

[0030] In all aspects of the technology as described herein generally relates to methods, compositions and kits for engineering pluripotent stem cells and iPSC that, when differentiated into a therapeutic cell tell (i.e., a T cell or natural killer (NK) cell, exhibit reduced immunogenicity as compared to a wild-type cell.34904-2225-06372701586-000167WOPTAtorney Docket: 701586-000167WOPT

[0031] One aspect disclosed herein provides a genetically engineered induced pluripotent stem cell (iPSC), comprising a knock out of MHC I class genes and MHC II class genes. In one embodiment, the genetically engineered iPSC further expresses an HLA-E protein and CD47 protein.

[0032] Another aspect disclosed herein provides a genetically engineered induced pluripotent stem cell (iPSC), comprising: a biallelic disruption of endogenous beta-2 -microglobulin (B2M); an exogenous nucleic acid encoding an HLA-E protein integrated at the endogenous B2M genomic locus, the fusion protein being expressed by the iPSC; a biallelic disruption of the class II transactivator (CIITA) gene; and an exogenous nucleic acid encoding a CD47 protein integrated at the CIITA genomic locus, wherein the genetically engineered iPSC exhibits reduced immunogenicity and is capable of long-term engraftment following transplantation into an allogeneic recipient.

[0033] In one embodiment, the iPSC is not capable of being detected by a T cell mediated immune response. In one embodiment, the iPSC is not capable of being detected by an NK cell mediated immune response. In one embodiment, the iPSC is not capable of being detected by a T cell mediated immune response nor an NK cell mediated immune response.

[0034] Knock-out of MHC I

[0035] In some embodiments, an engineered iPSC disclosed herein have a knock-out of MHC class I expression. In some embodiments, knock-out of MHC class I expression is achieved by removing native expression of B2M (i.e., generation of a [32M knock-out) which abrogates the expression of MHC class I alleles, making it difficult for the immune system to recognize these cells as allogeneic. In some embodiments, to achieve knock-out of endogenous expression of beta-2 microglobulin (referred to as a “B2M-K0”), one can insert a beta-2 microglobulin_HLA-E fusion protein into the beta-2 microglobulin locus, effectively blocking MHC I expression and instead over-expressing HLA-E, and inhibitory MHC I molecule to block NK cell recognition.

[0036] Beta-2 microglobulin”, also known as “B2M”, is the light chain of MHC class I molecules, and as such an integral part of the major histocompatibility complex. In humans, B2M is encoded by the b2m gene which is located on chromosome 15, opposed to the other MHC genes which are located as gene cluster on chromosome 6. The human protein is composed of 119 amino acids and has a molecular weight of 11.8 Kilodaltons. Mice models deficient for beta-2 microglobulin have shown that B2M is necessary for cell surface expression of MHC class I and stability of the peptide binding groove. It was further shown that haemopoietic transplants from mice that are deficient for normal cell-surface MHC I expression are rejected by NK1.1+ cells in normal mice because of a targeted mutation in the beta-2 microglobulin gene, suggesting that deficient expression of MHC I molecules renders marrow cells susceptible to rejection by the host immune system (Bix M. et al (1991). “Rejection of class I MHC-deficient haemopoietic cells by irradiated MHC-matched mice.” Nature 349(6307):329-31).

[0037] In one embodiment, the iPSC does not express HLA-A, HLA-B, and HLA-C.

[0038] In one embodiment, a guide RNA targets exon 1 of the endogenous B2M gene to mediate homologous recombination of the nucleic acid encoding an HLA-E protein.44904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT

[0039] In one embodiment, CRISPR gene editing is used to knock out HLA-A, HLA-B, and HLA-C genes, and expression of the HLA-E gene.

[0040] In one embodiment, the HLA-E protein is operably linked to an endogenous B2M regulatory element.

[0041] The B2M-HLA-E plasmid is generated via two separate gene blocks of B2M-G4S linker - HLA-E (i.e., comprising two halves of the sequence, which was cut in half due to size limitation), flanked by left and right arms comprising B2M genomic sequences. (See, e.g., Fig. 7) Each of the two gene block sequences were inserted into their own pjet 1.2 plasmid using the CloneJet PCR Cloning kit. Restriction enzyme digestion was used to assemble the full B2M-HLA-E sequence into one plasmid. Confirmation of donor plasmid sequence was performed using sanger sequencing (GeneWiz).

[0042] In one embodiment, the exogenous nucleic acid sequence encoding the HLA-E protein comprises a sequence of SEQ ID NO: 7. atgtctcgctccgtggccttagctgtgctcgcgctactGtctctGtctggcctCgaAgctatccagcgtactccaaa gattcaggtttactcacgt cat ccagcagagaatggaaagtcaaatttcctgaattgctatgtgtctgggttt catc catccgacattgaagttgacttactgaagaatggagagagaattgaaaaagtggagcattcagacttgtctttcagc aaggactggtctttctatctcttgtactacactgaattcacccccactgaaaaagatgagtatgcctgccgtgtgaa ccatgtgactttgtcacagcccaagatagttaagtgggat egaga catgggCggaggaggatcgggaggCggaggat cgggCggaggCggatcgggaggaggaggCtcgatggtagatggaaccctccttttactcctctcggaggccctggcc cttacccagacctgggcgggctcccactccttgaagtatttccacacttccgtgtcccggcccggccgcggggagcc ccgcttcatctctgtgggctacgtggacgacacccagttcgtgcgcttcgacaacgacgccgcgagtccgaggatgg tgccgcgggcgccgtggatggagcaggaggggtcagagtattgggaccgggagacacggagcgccagggacaccgca cagattttccgagtgaatctgcggacgctgcgcggctactacaatcagagcgaggccgggtctcacaccctgcagtg gatgcatggctgcgagctggggcccgacgggcgcttcctccgcgggtatgaacagttcgcctacgacggcaaggatt atctcaccctgaatgaggacctgcgctcctggaccgcggtggacacggcggctcagatctccgagcaaaagtcaaat gatgcctctgaggcggagcaccagagagcctacctggaagacacatgcgtggagtggctccacaaatacctggagaa ggggaaggagacgctgcttcacctggagcccccaaagacacacgtgactcaccaccccatctctgaccatgaggcca ccctgaggtgctgggccctgggcttctaccctgcggagatcacactgacctggcagcaggatggggagggccatacc caggacacggagctcgtggagaccaggcctgcaggggatggaaccttccagaagtgggcagctgtggtggtgccttc tggagaggagcagagatacacgtgccatgtgcagcatgaggggctacccgagcccgtcaccctgagatggaagccgg cttcccagcccaccatccccatcgtgggcatcattgctggcctggttctccttggatctgtggtctctggagctgtg gttgctgctgtgatatggaggaagaagagctcaggtggaaaaggagggagctactctaaggctgagtggagcgacag tgcccaggggtctgagtctcacagcttgtaa ( SEQ ID NO: 7 )

[0043] In one embodiment, the B2M-HLA-E plasimd is into the genomic B2M sequence of iPSCs using CRISPR gene editing. In one embodiment, three single guide RNA (sgRNA) were designed that target exon 1 of B2M sequence. (See, e.g., Table 1)Table 1 - sgRNA targeting exon 1 of B2MsgRNA Sequence SEQ ID NO:B2M sgRNA #1 ACTCTCTCTTTCTGGCCTGG 1B2M sgRNA #2 ACTCACGCTGGATAGCCTCC 2B2M sgRNA #3 GCTACTCTCTCTTTCTGGCC 354904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT

[0044] In one embodiment, confirmation and efficiency of insertion was validated using flow cytometry for a reporter gene, e.g., GFP.

[0045] In one embodiment, B2M sgRNA guide #2 (i.e., SEQ ID NO: 2) led to the most efficient genomic insertion into the B2M.

[0046] In one embodiment, the sgRNA #2 is expressed in the iPSCs via nucleofection to insert the B2M-HLA-E plasmid into the iPSC cell line within the genomic B2M sequence. In one embodiment, post nucleofection, cells were treated with M-3814 (Non-Homogenous End Joining inhibitor to improve efficiency of insertion of the DNA plasmid. Individual colonies were then screened for homogenous insertion of B2M-G4S linker-HLA-E using PCR. Colonies that demonstrated the presence of the gene insertion were expanded and further validated using PCR and DNA sequencing.

[0047] In one embodiment, the engineered iPSCs further express the HLA-G protein. In one embodiment, the HLA-G protein is operably linked to an endogenous B2M regulatory element. In one embodiment, the HLA-G protein is expressed in engineered iPSCs in the same manner as the HLA-E protein, as disclosed herein above.

[0048] Knock-out ofMHCII

[0049] In some embodiments, an engineered iPSCs disclosed herein have a knock-out of MHC class II expression. Removing expression of MHC II from the surface of the cell would reduce recognition of these cells as allogeneic by the immune system. CIITA is the master-regulator transcription factor for MHC II expression, and creating CIITA -I- iPSCs (i.e., a “CIITA-KO”) would block all MHC II expression. CD47 is a molecule expressed by many cell types to block phagocytosis by macrophages.

[0050] In some embodiments, knock-out of MHC class II expression is achieved by interrupting the expression of CIITA (i.e., generation of a CIITA knock-out). In one embodiment, disruption of the CIITA gene prevents transcriptional activation of MHC class II genes.

[0051] In one embodiment, the iPSC does not express HLA-DR, HLA-DP, and HLA-DQ.

[0052] In one embodiment, exon 1 of the CIITA gene is targeted by a sgRNA to mediate insertion of the nucleic acid encoding a CD47 protein. In one embodiment, the nucleic acid encoding a CD47 protein is constitutively expressed.

[0053] In one embodiment, the EF-la-CD47 plasmid is used herein to knockout of HLA-DR, HLA-DP, and HLA-DQ, and knocking in EFla-CD47.

[0054] The DNA sequence of CD47 was amplified using PCR of genomic DNA from iPSC-derived T cells. EFla and CD47 were inserted into the same pjetl.2 plasmid using restriction enzyme digestion and DNA ligation, in between genomic CIITA leaving left and right homology arms. (See, e.g., Fig. 2) These iPSC colonies were then screened using PCR to identify an iPSC colony with homogenous insertion of EFla-CD47 in the genomic region of CIITA. Colonies that demonstrated the presence of the gene insertion were expanded and further validated using PCR and DNA sequencing. One colony was then selected for all downstream experiments.

[0055] In one embodiment, the exogenous nucleic acid sequence encoding the CD47 protein comprises a sequence of SEQ ID NO: 8.64904-2225-06372701586-000167WOPTAtorney Docket: 701586-000167WOPT Atgtggcccctggtagcggcgctgttgctgggctcggcgtgctgcggatcagctcagctactatttaataaaacaaa atctgtagaattcacgttttgtaatgacactgtcgtcattccatgctttgttactaatatggaggcacaaaacacta ctgaagtatacgtaaagtggaaatttaaaggaagagatatttacacctttgatggagctctaaacaagtccactgtc cccactgactttagtagtgcaaaaattgaagtctcacaattactaaaaggagatgcctctttgaagatggataagag tgatgctgtctcacacacaggaaactacacttgtgaagtaacagaattaaccagagaaggtgaaacgatcatcgagc taaaatatcgtgttgtttcatggttttctccaaatgaaaatattcttattgttattttcccaatttttgctatactc ctgttctggggacagtttggtattaaaacacttaaatatagatccggtggtatggatgagaaaacaattgctttact tgttgctggactagtgatcactgtcattgtcattgttggagccattcttttcgtcccaggtgaatattcattaaaga atgctactggccttggtttaattgtgacttctacagggatattaatattacttcactactatgtgtttagtacagcg attggattaacctccttcgtcattgccatattggttattcaggtgatagcctatatcctcgctgtggttggactgag tctctgtattgcggcgtgtataccaatgcatggccctcttctgatttcaggtttgagtatcttagctctagcacaat tacttggactagtttatatgaaatttgtggcttccaatcagaagactatacaacctcctaggaaagctgtagaggaa ccccttaatgcattcaaagaatcaaaaggaatgatgaatgatgaataaggatcc ( SEQ ID NO: 8 )

[0056] In one embodiment, the EF-la-CD47 plasimd is into the genomic CIITA sequence of iPSCs using CRISPR gene editing. In one embodiment, three single guide RNA (sgRNA) were designed that target the CIITA sequence. (See, e.g., Table 2)Table 2 - sgRNA targeting exon 1 of CIITAsgRNA Sequence SEQ ID NO:CIITA sgRNA #1 TCCTACCTGTCAGAGCCCCAAGG 4CIITA sgRNA #2 ACCTTGGGGCTCTGACAGGTAGG 5CIITA sgRNA #3 CTGACAGGTAGGACCCAGCAGGG 6

[0057] In one embodiment, knockout and knock ins of protein expression for our immune cloaking genetic edits were validated by differentiating the engineered iPSCs into (1) Lung Basal Cells and (2) hemogenic endothelium, and protein expression was validated using flow cytometry. Conjugated antibodies for HLA-A, HLA-B, HLA-C (to confirm B2M knockout); HLA-E; HLA-DR, HLA-DP, HLA-DQ (knockout of CIITA) and CD47 were used to confirm loss and / or gain of expression of knockout and knock in genomic edits, respectively. Protein expressions were compared to lung basal or hemogenic endothelial cells differentiated from the parent, un-edited iPSC cell line. To confirm functional immune cloaking of our iPSC cell line, Lung Basal cells were differentiated and co-cultured with primary CD8+ T cells and Lung basal cell cytotoxicity was measured using an LDH assay to confirm loss of T cell mediated cytotoxicity of hypoimmunogenic iPSC-derived cell linesMethods for engineering iPSCs

[0058] Disclosed herein is a method of producing a hypoimmunogenic iPSC, comprising: introducing into an iPSC a CRISPR / Cas9 system comprising a guide RNA targeting exon 1 of the endogenous B2M gene and a donor nucleic acid comprising a nucleic acid sequence encoding an HLA-E protein flanked by homology arms corresponding to the B2M locus, and a guide RNA targeting exon 1 of the CIITA gene and a donor nucleic acid comprising a nucleic acid sequence encoding a CD47 protein; selecting iPSCs 74904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT comprising a biallelic insertion of the nucleic acid sequence encoding an HLA-E protein and a biallelic disruption of endogenous B2M and a biallelic disruption of CIITA and insertion of the nucleic acid sequence encoding a CD47 protein.

[0059] In some embodiments, the disruption of the expression, activity, and / or function of the gene is carried out by disrupting the gene. In some aspects, the gene is disrupted so that its expression is reduced by at least at or about 20, 30, or 40%, generally at least at or about 50, 60, 70, 80, 90, or 95% as compared to the expression in the absence of the gene disruption or in the absence of the components introduced to effect the disruption.

[0060] In some embodiments, the disruption can be carried out using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins. In general, “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (transactivating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), atracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), and / or other sequences and transcripts from a CRISPR locus.

[0061] The CRISPR / Cas nuclease or CRISPR / Cas nuclease system can include a non-coding RNA molecule (guide) RNA, which sequence-specifically binds to DNA, and a Cas protein (e.g., Cas9), with nuclease functionality (e.g., two nuclease domains). One or more elements of a CRISPR system can derive from a type I, type II, or type III CRISPR system, e.g., derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes.

[0062] In some aspects, a Cas nuclease and gRNA (including a fusion of crRNA specific for the target sequence and fixed tracrRNA) are introduced into the cell. In general, target sites at the 5' end of the gRNA target the Cas nuclease to the target site, e.g., the gene, using complementary base pairing. The target site may be selected based on its location immediately 5' of a protospacer adjacent motif (PAM) sequence, such as typically NGG, or NAG. In this respect, the gRNA is targeted to the desired sequence by modifying the first 20, 19, 18, 17, 16, 15, 14, 14, 12, 11, or 10 nucleotides of the guide RNA to correspond to the target DNA sequence. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence. Typically, “target sequence” generally refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between the target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex.

[0063] The CRISPR system can induce double stranded breaks (DSBs) at the target site, followed by disruptions as discussed herein. In other embodiments, Cas9 variants, deemed “nickases,” are used to nick a single strand at the target site. Paired nickases can be used, e.g., to improve specificity, each directed by a pair of different gRNAs targeting sequences such that upon introduction of the nicks84904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT simultaneously, a 5' overhang is introduced. In other embodiments, catalytically inactive Cas9 is fused to a heterologous effector domain such as a transcriptional repressor or activator, to affect gene expression.

[0064] The target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. The target sequence may be located in the nucleus or cytoplasm of the cell, such as within an organelle of the cell. Generally, a sequence or template that may be used for recombination into the targeted locus comprising the target sequences is referred to as an “editing template” or “editing polynucleotide” or “editing sequence”. In some aspects, an exogenous template polynucleotide may be referred to as an editing template. In some aspects, the recombination is homologous recombination.

[0065] Typically, in the context of an endogenous CRISPR system, formation of the CRISPR complex (comprising the guide sequence hybridized to the target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. The tracr sequence, which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g. about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracr sequence), may also form part of the CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operably linked to the guide sequence. The tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of the CRISPR complex, such as at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.

[0066] One or more vectors driving expression of one or more elements of the CRISPR system can be introduced into the cell such that expression of the elements of the CRISPR system direct formation of the CRISPR complex at one or more target sites. Components can also be delivered to cells as proteins and / or RNA. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors.Alternatively, two or more of the elements expressed from the same or different regulatory elements, may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. The vector may comprise one or more insertion sites, such as a restriction endonuclease recognition sequence (also referred to as a “cloning site”). In some embodiments, one or more insertion sites are located upstream and / or downstream of one or more sequence elements of one or more vectors. When multiple different guide sequences are used, a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell.

[0067] A vector may comprise a regulatory element operably linked to an enzyme-coding sequence encoding the CRISPR enzyme, such as a Cas protein. Non-limiting examples of Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csfl, homologs thereof, or modified versions thereof. These enzymes are known; for94904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT example, the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2.

[0068] The CRISPR enzyme can be Cas9 (e.g., from S. pyogenes or S. pneumonia). The CRISPR enzyme can direct cleavage of one or both strands at the location of a target sequence, such as within the target sequence and / or within the complement of the target sequence. The vector can encode a CRISPR enzyme that is mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence. For example, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). In some embodiments, a Cas9 nickase may be used in combination with guide sequence(s), e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce NHEI or HDR.

[0069] In some embodiments, an enzyme coding sequence encoding the CRISPR enzyme is codon optimized for expression in particular cells, such as eukaryotic cells. The eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate. In general, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization.

[0070] In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of the CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more.

[0071] Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), Clustal W, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available atmaq.sourceforge.net).

[0072] The CRISPR enzyme may be part of a fusion protein comprising one or more heterologous protein domains. A CRISPR enzyme fusion protein may comprise any additional protein sequence, and 104904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity. Non-limiting examples of epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Examples of reporter genes include, but are not limited to, glutathione -5 -transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP). A CRISPR enzyme may be fused to a gene sequence encoding a protein or a fragment of a protein that bind DNA molecules or bind other cellular molecules, including but not limited to maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusions, GAL4A DNA binding domain fusions, and herpes simplex virus (HSV) BP 16 protein fusions. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in US 20110059502, incorporated herein by reference.

[0073] In some aspects, a nucleic acid encoding the DNA-targeting molecule, complex, or combination, is administered or introduced to the cell. The nucleic acid typically is administered in the form of an expression vector, such as a viral expression vector. In some aspects, the expression vector is a retroviral expression vector, an adenoviral expression vector, a DNA plasmid expression vector, or an AAV expression vector. In some aspects, one or more polynucleotides encoding the disruption molecule or complex, such as the DNA-targeting molecule, are delivered to the cell. In some aspects, the delivery is by delivery of one or more vectors, one or more transcripts thereof, and / or one or more proteins transcribed therefrom, is delivered to the cell.

[0074] In some embodiments, the polypeptides are synthesized in situ in the cell as a result of the introduction of polynucleotides encoding the polypeptides into the cell. In some aspects, the polypeptides could be produced outside the cell and then introduced thereto. Methods for introducing a polynucleotide construct into animal cells are known and include as non-limiting examples stable transformation methods wherein the polynucleotide construct is integrated into the genome of the cell, transient transformation methods wherein the polynucleotide construct is not integrated into the genome of the cell, and virus mediated methods. In some embodiments, the polynucleotides may be introduced into the cell by for example, recombinant viral vectors (e.g. retroviruses, adenoviruses), liposome and the like. For example, in some aspects, transient transformation methods include microinjection, electroporation, or particle bombardment. In some embodiments, the polynucleotides may be included in vectors, more particularly plasmids or viruses, in view of being expressed in the cells.

[0075] In some embodiments, viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues. Non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic acid 114904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. For a review of gene therapy procedures, see Anderson, 1992; Nabel & Feigner, 1993; Mitani & Caskey, 1993; Dillon, 1993; Miller, 1992; Van Brunt, 1988; Vigne, 1995; Kremer & Perricaudet, 1995; Haddada et al., 1995; and Yu et al., 1994.

[0076] Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Lipofection is described in (e.g., U. S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient receptorrecognition lipofection of polynucleotides include those of Feigner, WO 91117424; WO 91116024. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).

[0077] In some embodiments, delivery is via the use of RNA or DNA viral based systems for the delivery of nucleic acids. Viral vectors in some aspects may be administered directly to patients (in vivo) or they can be used to treat cells in vitro or ex vivo, and then administered to patients. Viral -based systems in some embodiments include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer.

[0078] In some aspects, a reporter gene which includes but is not limited to glutathione -5 -transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, betaglucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP), may be introduced into the cell to encode a gene product which serves as a marker by which to measure the alteration or modification of expression of the gene product. In a further embodiment, the DNA molecule encoding the gene product may be introduced into the cell via a vector. In some embodiments, the gene product is luciferase.Sources of Pluripotent stem cells

[0079] Pluripotent stem cells may be obtained from any suitable source, including, without limitation, umbilical cord, blood, embryos, embryonic tissue, fetal tissue, bone marrow and blood. In one embodiment, the stem or progenitor cell is an induced pluripotent stem cell (iPSC). In another embodiment, the stem cell is an embryonic stem (ES) cell. For therapeutic applications, the stem cells or progenitor cells used to generate the T cells may be preferably obtained from the patient to be treated. Progenitor T cells may be isolated from the stem or progenitor cells by techniques known in the art. Typically, a sample containing the cells is first depleted with non-stem cells or mature cells.

[0080] The PSCs, e.g., iPSCs, disclosed herein are characterized by the ability to renew themselves through mitotic cell division and the ability to differentiate into a diverse range of specialized cell types. The two broad types of mammalian stem cells are: embryonic stem cells that are found in blastocysts,124904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT and adult stem cells that are found in adult tissues. In a developing embryo, stem cells can differentiate into all of the specialized embryonic tissues. In adult organisms, stem cells and progenitor cells act as a repair system for the body, replenishing specialized cells, and also maintain the normal turnover of regenerative organs, such as blood, skin or intestinal tissues.

[0081] In particular aspects, the PSCs used herein are human ESCs or iPSCs which are capable of longterm proliferation in vitro, while retaining the potential to differentiate into all cell types of the body, including the T and NK cells of the present disclosure. Thus, these cells could potentially provide an unlimited supply of patient-specific functional cells for both drug development and therapeutic uses.

[0082] Embryonic Stem Cells

[0083] In some embodiments, pluripotent stem cell described herein can be derived from human embryonic stem cells as the starting material. Such pluripotent cells can be cells that originate from the morula, embryonic inner cell mass or those obtained from embryonic gonadal ridges. Human embryonic stem cells can be maintained in culture in a pluripotent state without substantial differentiation using methods that are known in the art. Such methods are described, for example, in U. S. Pat. Nos. 5,453,357, 5,670,372, 5,690,926 5,843,780, 6,200,806 and 6,251,671 the disclosures of which are incorporated herein in their entireties by reference.

[0084] In certain aspects, the PSCs are embryonic stem cells (ESCs). ES cells are derived from the inner cell mass of blastocysts and have a high in vitro differentiating capability. ES cells can be isolated by removing the outer trophectoderm layer of a developing embryo, then culturing the inner mass cells on a feeder layer of non-growing cells. The replated cells can continue to proliferate and produce new colonies of ES cells which can be removed, dissociated, replated again and allowed to grow. This process of “subculturing” undifferentiated ES cells can be repeated a number of times to produce cell lines containing undifferentiated ES cells (U. S. Pat. Nos. 5,843,780; 6,200,806; 7,029,913). ES cells have the potential to proliferate while maintaining their pluripotency. For example, ES cells are useful in research on cells and on genes which control cell differentiation. The pluripotency of ES cells combined with genetic manipulation and selection can be used for gene analysis studies in vivo via the generation of transgenic, chimeric, and knockout mice.

[0085] ES stem cells can be detected by protein markers including transcription factor Oct4, alkaline phosphatase (AP), stage-specific embryonic antigen SSEA-1, stage-specific embryonic antigen SSEA-3, stage-specific embryonic antigen SSEA-4, transcription factor NANOG, tumor rejection antigen 1-60 (TRA-1-60), tumor rejection antigen 1-81 (TRA-1-81), SOX2, or REXI.

[0086] Human ES cells can be produced or derived from a zygote or blastocyst-staged mammalian embryo produced by the fusion of a sperm and egg cell, nuclear transfer, pathogenesis, or the reprogramming of chromatin and subsequent incorporation of the reprogrammed chromatin into a plasma membrane to produce an embryonic cell by previously described methods (Thomson and Marshall, 1998; Reubinoff et al., 2000). In one method, human blastocysts are exposed to anti -human serum, and trophectoderm cells are lysed and removed from the inner cell mass which is cultured on a feeder layer of mouse embryonic fibroblasts. Further, clumps of cells derived from the inner cell mass are chemically or 134904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT mechanically dissociated, replated, and colonies with undifferentiated morphology are selected by micropipette, dissociated, and replated. In some methods, human ES cells can be grown without serum by culturing the ES cells on a feeder layer of fibroblasts in the presence of basic fibroblast growth factor (Amit et al., 2000). In other methods, human ES cells can be grown without a feeder cell layer by culturing the cells on a protein matrix such as MATRIGEL™ or laminin in the presence of “conditioned” medium containing basic fibroblast growth factor (Xu et al., 2001).

[0087] Human embryonic stem cells used herein can be maintained in culture either with or without serum. In some embryonic stem cell maintenance procedures, serum replacement is used. In others, serum free culture techniques, such as those described in US Patent Application No. 2003 / 0190748, the disclosure of which is incorporated herein by reference in its entirety, are used. Stem cells are maintained in culture in a pluripotent state by routine passage until it is desired that they be differentiated into definitive endoderm then ultimately to endocrine precursor cells and / or pancreatic islet hormone-expressing cells.

[0088] Induced Pluripotent Stem Cells

[0089] In some embodiments, the pluripotent stem cell is derived from reprogrammed cells, e.g., induced pluripotent stem cells (iPS cells), which can be derived from differentiated or somatic cells. In some embodiments, the iPSC are derived from fibroblasts, or from a subject with cancer or an immune disease. In some embodiments, the iPS cells can be derived from, for example, but not limited to, neoplastic cells, tumor cells and cancer cells. Such an embodiment is useful in identifying and / or isolating and / or studying cancerous cells and tumor cells. In some embodiments, the de -differentiated cells are from a subject, and in some embodiments, the de-differentiated stem cells are obtained from a biopsy, e.g., a patient with cancer.

[0090] In some embodiments, an iPSCs disclosed herein, can be produced by any method known in the art can be used, for example virally-induced or chemically induced generation of iPS cells are described in Mauritz et al., Circulation. 2008; 118:507-517, and disclosed in International Application W02008 / 088882, EP1970446, US2009 / 0047263, 052009 / 0068742, and 2009 / 0227032, which are incorporated herein in their entirety by reference.

[0091] iPSCs can also be generated using other methods commonly known in the art, such as, including but not limited to uses of non-viral methods, polycistronic vectors, mRNA species, miRNA, and proteins, including International Patent Applications W02010 / 019569, WO2009 / 149233, W02009 / 093022, WO2010 / 022194, W02009 / 101084, W02008 / 038148, W02010 / 059806, WO2010 / 057614, W02010 / 056831, W02010 / 050626, W02010 / 033906, W02009 / 126250, WO2009 / 143421, W02009 / 140655, W02009 / 133971, W02009 / 101407, W02009 / 091659, W02009 / 086425, W02009 / 079007, W02009 / 058413, W02009 / 032456, W02009 / 032194, W02008 / 103462, JP4411362, EP2128245, and U. S. Patent Applications US2004 / 0072343, US2009 / 0253203, US2010 / 0112693, US2010 / 07542, US2009 / 0246875, US2009 / 0203141, US2010 / 00625343, US2009 / 0269763, which are incorporated herein in their entirety by reference.144904-2225-06372701586-000167WOPTAtorney Docket: 701586-000167WOPT

[0092] The induction of pluripotency was originally achieved in 2006 using mouse cells (Yamanaka et al. 2006) and in 2007 using human cells (Yu et al. 2007; Takahashi et al. 2007) by reprogramming of somatic cells via the introduction of transcription factors that are linked to pluripotency. The use of iPSCs circumvents most of the ethical and practical problems associated with large-scale clinical use of ES cells, and patients with iPSC-derived autologous transplants may not require lifelong immunosuppressive treatments to prevent graft rejection.

[0093] With the exception of germ cells, any cell can be used as a starting point for iPSCs. For example, cell types could be keratinocytes, fibroblasts, hematopoietic cells, mesenchymal cells, liver cells, or stomach cells. T cells may also be used as a source of somatic cells for reprogramming (U. S. Pat. No.8,741,648; U. S. Publication No. 2015 / 0191697). There is no limitation on the degree of cell differentiation or the age of an animal from which cells are collected; even undifferentiated progenitor cells (including somatic stem cells) and finally differentiated mature cells can be used as sources of somatic cells in the methods disclosed herein. iPSCs can be grown under conditions that are known to differentiate human ES cells into specific cell types, and express human ES cell markers including: SSEA-1, SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81.

[0094] Somatic cells can be reprogrammed to produce iPSCs using methods known to one of skill in the art. One of skill in the art can readily produce iPSCs, see for example, Published U. S. Patent Application No. 2009 / 0246875, Published U. S. Patent Application No. 2010 / 0210014; Published U. S. Patent Application No. 2012 / 0276636; U. S. Pat. No. 8,058,065; U. S. Pat. No. 8,129,187; PCT Publication NO. WO 2007 / 069666 Al, U. S. Pat. No. 8,268,620; U. S. Pat. No. 8,546,140; U. S. Pat. No. 9,175,268; U. S. Pat. No. 8,741,648; U. S. Patent Application No. 2011 / 0104125, and U. S. Pat. No. 8,691,574, which are incorporated herein by reference. Generally, nuclear reprogramming factors are used to produce pluripotent stem cells from a somatic cell. In some embodiments, at least three, or at least four, of Klf4, c-Myc, Oct3 / 4, Sox2, Nanog, and Lin28 are utilized. In other embodiments, Oct3 / 4, Sox2, c-Myc and Klf4 are utilized or Oct3 / 4, Sox2, Nanog, and Lin28.

[0095] Mouse and human cDNA sequences of these nuclear reprogramming substances are available with reference to the NCBI accession numbers mentioned in WO 2007 / 069666 and U. S. Pat. No.8,183,038, which are incorporated herein by reference. Methods for introducing one or more reprogramming substances, or nucleic acids encoding these reprogramming substances, are known in the art, and disclosed for example, in U. S. Pat. Nos. 8,268,620, 8,691,574, 8,741,648, 8,546,140, in published U. S. Pat. No. 8,900,871 and U. S. Pat. No. 8,071,369, which are both incorporated herein by reference.

[0096] Once derived, iPSCs can be cultured in a medium sufficient to maintain pluripotency. The iPSCs may be used with various media and techniques developed to culture pluripotent stem cells, more specifically, embryonic stem cells, as described in U. S. Pat. No. 7,442,548 and U. S. Patent Pub. No. 2003 / 0211603. In the case of mouse cells, the culture is carried out with the addition of Leukemia Inhibitory Factor (LIF) as a differentiation suppression factor to an ordinary medium. In the case of human cells, it is desirable that basic fibroblast growth factor (bFGF) be added in place of LIF. Other 154904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT methods for the culture and maintenance of iPSCs, as would be known to one of skill in the art, may be used with the methods disclosed herein.

[0097] In certain embodiments, undefined conditions may be used; for example, pluripotent cells may be cultured on fibroblast feeder cells or a medium that has been exposed to fibroblast feeder cells in order to maintain the stem cells in an undifferentiated state. In some embodiments, the cell is cultured in the copresence of mouse embryonic fibroblasts treated with radiation or an antibiotic to terminate the cell division, as feeder cells. Alternately, pluripotent cells may be cultured and maintained in an essentially undifferentiated state using a defined, feeder-independent culture system, such as a TESR™ medium (Ludwig et al., 2006a; Ludwig et al., 2006b) or E8™ / Essential 8™ medium (Chen et al., 2011).Differentiation of engineered iPSCs into therapeutic cell types

[0098] Several aspects disclosed herein relate to methods of differentiated the enginieered iPSCs disclosed herein into an therapeutic cell type that has the capacity to evade T-cell, natural killer cell, and macrophage-mediated immune responses.

[0099] In one embodiment, any of the engineered iPSCs disclosed herein are futher differentiated into a therapeutic cell type. In one embodiment, therapeutic cell type is selected from the group consisting of lung basal cells, T cells, NK cells, hematopoietic cells, epithelial cells, and tissue progenitor cells.Methods for differentiating an iPSC into any of the therapeutic cell types are known in the art and would be readily assessable to a skilled practitioner. Exemplary methods for differentiation are further disclosed in, e.g., U. S. Patent Nos 10,947,502; 12,129,486; 12,270,050; 12,275,955; 12,410,403; 11,525,119; 11,946,069; and 10,370,452; the contents of which are incorporated herein by reference in their entireties.

[0100] One aspect provides a method of reducing immune-mediated rejection of transplanted cells, comprising differentiating any of the iPSCs disclosed herein into a therapeutic cell type; and transplanting the differentiated cells into a human subject, wherein the transplanted cells evade T-cell, natural killer cell, and macrophage -mediated immune responses.

[0101] In one embodiment, the iPSCs cells are autologous to the subject receiving the transplanted differentiated cells.

[0102] In one embodiment, the iPSCs cells are allogenic to the subject receiving the transplanted differentiated cells.

[0103] In one embodiment, the transplanted differentiated cells have an increased engraftment rate as compared to an appropriate control.

[0104] In one embodiment, the subjects receiving the transplanted differentiated cells have a decreased risk of host versus graft disease as compared to an appropriate control.

[0105] The ability to produce large populations of T cells can be used in combination with the ability to transduce the T cells and express an engineered chimeric antigen receptor (CAR) within these cell populations. These engineered T cells can further be used for treatment of cancer as a form of cancer therapy. In one embodiment, engineered iPSCs can be used to produce T or NK cells which are modified 164904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT to be CAR expressing T cells for use to kill tumor cells. The tumor cells are contacted with the CAR expressing T or NK cells in an effective amount in order to kill the tumor cells.

[0106] In another embodiment, the CAR expressing T or NK cells generated using the methods and compositions as disclosed herein can be used to treat a subject having cancer. The CAR expressing T or NK cells can be administered in an effective amount to treat the cancer. The CAR expressing iT cells can be adoptively transferred to the patient. Suitable engineered CAR-expressing T or NK cells for use in treating a subject having cancer are known in the art and include, CAR that are specific to a tumor-associated antigen.

[0107] Design and methods of making CARs are known in the art and include, but are not limited to the first, second, third and fourth generation of CARs. Genetically engineered CARs are contemplated herein. These genetically engineered receptors, CARs, comprise an antigen-specific recognition domain that binds to specific target antigen or cell and a transmembrane domain linking the extracellular domain to an intracellular signaling domain. Design and methods of making CAR are known in the art. In one embodiment, the antigen-specific recognition domain in the extracellular domain redirects cytotoxicity of the effector cell toward tumor cells.

[0108] As is known in the art, a cancer is generally considered as uncontrolled cell growth. Suitable cancers that can be treated using the T cells expressing the engineered CAR receptors include, but are not limited to, hematologic malignancies and solid tumors. Suitable hematologic malignancies are forms of cancer that begin in the cells of blood-forming tissue, such as the bone marrow, or in the cells of the immune system. Examples of hematologic cancer include, but are not limited, to, for example, acute and chronic leukemias, lymphomas, multiple myeloma and myelodysplastic syndromes. The methods of the present invention can be used to treat any cancer, any metastases thereof, including, but not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. Suitable cancers able to be treated by the compositions, methods and kits described herein include, but are not limited to, for example, breast cancer, prostate cancer, colon cancer, squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, ovarian cancer, cervical cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, liver cancer, bladder cancer, hepatoma, colorectal cancer, uterine cervical cancer, endometrial carcinoma, salivary gland carcinoma, mesothelioma, kidney cancer, vulval cancer, pancreatic cancer, thyroid cancer, hepatic carcinoma, skin cancer, melanoma, brain cancer, neuroblastoma, myeloma, various types of head and neck cancer, acute lymphoblastic leukemia, acute myeloid leukemia, Ewing sarcoma, and peripheral neuroepithelioma. In one embodiment, the cancer is selected from leukemia, lymphoma, melanoma, non-small cell lung cancer, squamous cell carcinoma of the head and neck, ovarian cancer, pancreatic cancer, renal cell carcinoma, hepatocellular carcinoma, bladder cancer, malignant glioma, colorectal cancer, and endometrial cancer.

[0109] The term “treating” can be characterized by one or more of the following: (a) the reducing, slowing or inhibiting the growth of tumor cells; (b) preventing the further growth of tumor cells; (c) reducing or preventing the metastasis of tumor cells within a patient, and (d) reducing or ameliorating at least one symptom of the tumor or cancer. In some embodiments, the optimum effective amounts can be 174904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT readily determined by one of ordinary skill in the art using routine experimentation. As used herein, the terms “effective amount” and “therapeutically effective amount” refer to the quantity of active therapeutic agent or agents sufficient to yield a desired therapeutic response without undue adverse side effects such as toxicity, irritation, or allergic response. The specific “effective amount” will, obviously, vary with such factors as the particular condition being treated, the physical condition of the subject, the type of animal being treated, the duration of the treatment, the nature of concurrent therapy (if any), and the specific formulations employed and the structure of the compounds or its derivatives.

[0110] As used herein “subject” or “patient” refers to mammals and non-mammals. The term “subject” does not denote a particular age or sex. In one specific embodiment, a subject is a mammal, preferably a human. In some embodiments, the subject suffers from a cancer, particularly a hemotologic malignancy.Pharmaceutical Compositions

[0111] In another aspect, the present application provides a pharmaceutical composition comprising engineered iPSCs, and a pharmaceutically acceptable diluent or carrier. In another aspect, the present application provides a pharmaceutical composition comprising therapeutic cells differentiated from the engineered iPSCs disclosed herein, and a pharmaceutically acceptable diluent or carrier.

[0112] Suitable diluents and carriers are described, for example, in Remington's Pharmaceutical Sciences. On this basis, the compositions include, albeit not exclusively, solutions of the engineered iPSCs cells as disclosed herein, in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and iso-osmotic with the physiological fluids.

[0113] Pharmaceutical compositions include, without limitation, lyophilized powders or aqueous or non-aqueous sterile injectable solutions or suspensions, which may further contain anti-oxidants, buffers, bacteriostats and solutes that render the compositions substantially compatible with the tissues or the blood of an intended recipient. Other components that may be present in such compositions include water, surfactants (such as Tween™), alcohols, polyols, glycerin and vegetable oils, for example.Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, tablets, or concentrated solutions or suspensions. The composition may be supplied, for example but not by way of limitation, as a lyophilized powder which is reconstituted with sterile water or saline prior to administration to the patient.

[0114] Suitable pharmaceutically acceptable carriers include essentially chemically inert and non-toxic compositions that do not interfere with the effectiveness of the biological activity of the pharmaceutical composition. Examples of suitable pharmaceutical carriers include, but are not limited to, water, saline solutions, glycerol solutions, ethanol, N-(l(2,3-dioleyloxy)propyl)N N, N-trimethylammonium chloride (DOTMA), diolesyl-phosphotidyl-ethanolamine (DOPE), and liposomes. Such compositions should contain a therapeutically effective amount of the compound, together with a suitable amount of carrier so as to provide the form for direct administration to the patient.184904-2225-06372701586-000167WOPTAtorney Docket: 701586-000167WOPT

[0115] The compositions of the application can be administered for example, by parenteral, intravenous, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricu-lar, intracapsular, intraspinal, intracistemal, intraperitoneal, intranasal, aerosol or oral ad-ministration. For parenteral administration, solutions of the iT cells or iNK cells as disclosed herein, can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, DMSO and mixtures thereof with or without alcohol, and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. A person skilled in the art would know how to prepare suitable formulations.

[0116] When the engineered iPSCs are differented into a therapeutic cell type, said therapeutic cells (i.e., T or NK cells) are present in an amount effective for treating a disease state in a mammalian need thereof.

[0117] The present application includes the use of the therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein.Genetic modifications

[0118] Therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein may be genetically modified (transduced or transfected) either in nature or by genetic engineering techniques in vivo or in vitro. Cells can be modified by introducing mutations into genes in the cells or by introducing transgenes into the cells. Insertion or deletion mutations may be introduced in a cell using standard techniques. A gene encoding a selectable marker may also be integrated into the cells.

[0119] Therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein are genetically engineered in such a manner that the cells or cells derived therefrom produce, in vitro or in vivo, polypeptides, hormones and proteins not normally produced in the cells in biologically significant amounts, or produced in small amounts but in situations in which regulatory expression would lead to a therapeutic benefit. For example, the cells could be engineered with a gene that expresses insulin at levels compatible with normal injected doses, or with a gene that can make up for a deficiency or abnormality of a gene causing a disease. Alternatively, the cells could be modified such that a protein normally expressed will be expressed at much lower levels. These products would then be secreted into the surrounding media or purified from the cells. The cells formed in this way can serve as continuous short term or long term production systems of the expressed substance.

[0120] Thus, in accordance with this aspect of the application, Therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein can be modified with genetic material of interest. The modified cells can be cultured in vitro under suitable conditions so that they are able to express the product of the gene expression or secrete the expression product. These modified cells can be administered so that the expressed product will have a beneficial effect.

[0121] In a further embodiment, engineered iPSCs can be induced in vivo to differentiate into T cells that will express the gene product. For example, the transduced cells may be administered to induce production of T cells having the transduced gene. The cells may be administered in a mixture with other 194904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT cells or separately and may be delivered to a targeted area. The cells can be introduced intravenously and home to a targeted area. Alternatively, the cells may be used alone and caused to differentiate in vivo.

[0122] Thus, genes can be introduced into cells that are then injected into a recipient where the expression of the gene will have a therapeutic effect. For example, an insulin gene may be introduced into the cells to provide a constant therapeutic dose of insulin in the bone marrow and peripheral blood.

[0123] The technology may be used to produce additional copies of essential genes to allow augmented expression by T cells of certain gene products in vivo. These genes can be, for example, hormones, matrix proteins, cell membrane proteins, and cytokines.

[0124] In a specific embodiment, therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein are engineered to recognize an antigen such as a tumor antigen, a viral antigen or a bacterial antigen. As such the immune response to the target antigen will be augmented by administering antigen specific progenitor T cells.Therapeutic Applications

[0125] The present application includes a method of treating an animal having a condition requiring an increase in the number of T cells comprising administering an effective amount of a progenitor T cell to an animal in need thereof.

[0126] As used herein, the phrase “effective amount” or “therapeutically effective amount” means an amount effective, at dosages and for periods of time necessary to achieve the desired result. Effective amounts may vary according to factors such as the disease state, age, sex, weight of the animal. The amount of a given cell preparation that will correspond to such an amount will vary depending upon various factors. Such as the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject or host being treated, and the like, but can nevertheless be routinely determined by one skilled in the art. An “effective amount” will preferably be an amount effective for the progenitor T cells to engraft the subject being treated.

[0127] The term “treating” or “treatment” as used herein and as is well understood in the art, means an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission (whether partial or total), whether detectable or undetectable. “Treating” and “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. “Treating” and “treatment” as used herein also include prophylactic treatment.

[0128] The term “animal” as used herein means any member of the animal kingdom and is preferably a human.

[0129] A “condition requiring an increase in number of T cells” includes any condition wherein T cell levels are reduced as compared to a healthy animal, including, without limitation, immunodeficiency,204904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT cancer, genetic diseases, infectious diseases and autoimmunity, some of which are described in detail below.

[0130] Cancer

[0131] Following aggressive myeloablative-chemo / radiotherapy of myeloma, lymphoma and leukemia, individuals may become immunodeficient and require stem cell transplantation to replace or restore their immune system. These individuals may undergo stem cell transplantation. Although, HSCs may be obtained from bone marrow, GM-CSF-mobilized peripheral blood, or cord blood, several clinical challenges present themselves in most stem cell transplantations: from finding a suitably major-histocompatible matched donor, to pre-venting GvHD, to successful engraftment of a donor immune system onto the host (So-cie, 2005). Most immune cells recover quickly following transplantation, but T cells take the most time (~2 years) to recover in terms of cell numbers and function (Petropoulos and Chan, 2005).

[0132] Accordingly, the present application provides a method of treating or preventing cancer comprising administering an effective amount of therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein.

[0133] In one embodiment, the therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein, have been genetically engineered to recognize tumor specific antigens. For example, progenitor T cells could be manufactured to recognize tumor-specific antigens found in certain breast cancers as well as Burkitt's lymphoma, neuroblastoma, malignant melanoma, osteosarcoma, and renal cell carcinoma (Renkvist et al., 2001). One example of this genetic approach utilizing CD8+ Wilms' tumor (WT1) gene-specific cytotoxic T-lymphocyte clones for the treatment of Chronic Myeloid Leukemia (CML) or Acute Lymphoblastic Leukemia (ALL). Thus, progenitor T cell transplantation could be used as an adjuvant therapy with stem cell transplantation to quickly reconstitute the T cell compartment in patients with terminal illness or specifically target cancer cells for destruction (van den Brink et al., 2004).

[0134] In certain aspects, the invention includes a method of using therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein for the production of engineered CAR-T cells using an expression vector containing a DNA construct encoding the CAR.

[0135] In another aspect, this invention is a method of stably transfecting the therapeutic cells, i.e., T cells, generated using the methods disclosed herein by electroporation, or other non-viral gene transfer (such as, but not limited to sonoporation) using naked DNA. Most investigators have used viral vectors to carry heterologous genes into T cells. By using naked DNA, the time required to produce redirected T cells can be reduced. “Naked DNA” means DNA encoding a chimeric T-cell receptor (cTCR) contained in an expression cassette or vector in proper orientation for expression. The electroporation method of this invention produces stable transfectants that express and carry on their surfaces the chimeric TCR (cTCR).

[0136] ‘ ‘Chimeric TCR” means a receptor that is expressed by T cells and that comprises intracellular signaling, transmembrane, and extracellular domains, where the extracellular domain is capable of 214904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT specifically binding in an MHC unrestricted manner an antigen that is not normally bound by a T-cell receptor in that manner. Stimulation of the T cells by the antigen under proper conditions results in proliferation (expansion) of the cells. However, the method is applicable to transfection with chimeric TCRs that are specific for other target antigens, such as chimeric TCRs that are specific for HER2 / Neu, ERBB2, folate binding protein, renal cell carcinoma, and HIV-1 envelope glycoproteins gp20 and gp41. Other cell-surface target antigens include, but are not limited to, CD20, carcinoembryonic antigen, mesothelin, c-Met, CD56, HERV-K, GD2, GD3, aiphafetoprotein, CD23, CD30, CD123, IL-llRalpha, kappa chain, lambda chain, CD70, CA-125, MUC-1, EGFR and variants, epithelial tumor antigen, and so forth.

[0137] Suitable doses for a therapeutic effect would be at least 105or between about 105and about 1010cells per dose, for example, preferably in a series of dosing cycles. An exemplary dosing regimen consists of four one-week dosing cycles of escalating doses, starting at least at about 105cells on day 0, for example increasing incrementally up to a target dose of about 1010cells within several weeks of initiating an intra-patient dose escalation scheme. Suitable modes of administration include intravenous, subcutaneous, intracavitary (for example by reservoir-access device), intraperitoneal, and direct injection into a tumor mass.

[0138] In some embodiments, a pharmaceutical composition of the present invention can be used alone or in combination with other well-established agents useful for treating cancer. Whether delivered alone or in combination with other agents, the pharmaceutical composition of the present invention can be delivered via various routes and to various sites in a mammalian, particularly human, body to achieve a particular effect. One skilled in the art will recognize that, although more than one route can be used for administration, a particular route can provide a more immediate and more effective reaction than another route. For example, intradermal delivery may be advantageously used over inhalation for the treatment of melanoma. Local or systemic delivery can be accomplished by administration comprising application or instillation of the formulation into body cavities, inhalation or insufflation of an aerosol, or by parenteral introduction, comprising intramuscular, intravenous, intraportal, intrahepatic, peritoneal, subcutaneous, or intradermal administration.

[0139] In some embodiments, a composition of the present invention can be provided in unit dosage form wherein each dosage unit, e.g., an injection, contains a predetermined amount of the composition, alone or in appropriate combination with other active agents. The term unit dosage form as used herein refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of the composition of the present invention, alone or in combination with other active agents, calculated in an amount sufficient to produce the desired effect, in association with a pharmaceutically acceptable diluent, carrier, or vehicle, where appropriate. The specifications for the novel unit dosage forms of the present invention depend on the particular pharmacodynamics associated with the pharmaceutical composition in the particular subject.

[0140] Desirably an effective amount or sufficient number of the therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein is present in the composition and introduced 224904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT into the subject such that long-term, specific, anti-tumor responses are established to reduce the size of a tumor or eliminate tumor growth or regrowth than would otherwise result in the absence of such treatment. Desirably, the amount of the therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein reintroduced into the subject causes a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 100% decrease in tumor size when compared to otherwise same conditions wherein the therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein are not present. Accordingly, the amount of therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein administered should take into account the route of administration and should be such that a sufficient number of the iT cells will be introduced so as to achieve the desired therapeutic response. Furthermore, the amounts of each active agent included in the compositions described herein (e.g., the amount per each cell to be contacted or the amount per certain body weight) can vary in different applications. In general, the concentration of the therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein desirably should be sufficient to provide in the subject being treated at least from about 1×106to about 1×109cells, even more desirably, from about 1×107to about 5×108cells, although any suitable amount can be utilized either above, e.g., greater than 5×107cells, or below, e.g., less than 1×107cells. The dosing schedule can be based on well-established cell-based therapies (see, e.g., Topalian and Rosenberg, Acta Haematol, 78 Suppl 1:75-76, 1987; U. S. Pat. No. 4,690,915), or an alternate continuous infusion strategy can be employed.

[0141] These values provide general guidance of the range of the cells to be utilized by the practitioner upon optimizing the method of the present invention for practice of the invention. The recitation herein of such ranges by no means precludes the use of a higher or lower amount of a component, as might be warranted in a particular application. For example, the actual dose and schedule can vary depending on whether the compositions are administered in combination with other pharmaceutical compositions, or depending on interindividual differences in pharmacokinetics, drug disposition, and metabolism. One skilled in the art readily can make any necessary adjustments in accordance with the exigencies of the particular situation.

[0142] Autoimmunity

[0143] Traditionally, tolerance was thought to be established centrally in the thymus to self-antigen presented by thymic cells and blood-borne self-antigens, while T cells with specificity towards tissuespecific antigens underwent tolerance induction in the periphery (Kyewski and Derbinski, 2004). The recent observation that thymic epithelial cells that express the AIRE gene can promote the promiscuous expression of tissue-restricted anti-gens has yielded new insights for how self-tolerance is maintained and broken (Kyewski and Derbinski, 2004). Autoimmune diseases result from the dysregulation or breakdown of the processes that maintain self-tolerance in the periphery. Many investigators have reported that a population of T cells with regulatory activity (TReg) can suppress pathological immune responses in murine models of autoimmune disease, transplantation and GvHD (Chatenoud et al., 2001) suggesting that these cells could be utilized therapeutically to treat human autoimmune disease (Bluestone, 2005). TReg cells express CD4 and CD25 as wells as the forkhead transcription factor boxP3234904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT (Foxp3) (Sakaguchi, 2005), which serves as a master regulator for TReg development and function (Fontenot et al., 2003; Hori et al., 2003). Indeed, Foxp3-mutant mice have a deficiency in TReg cells and develop severe lymphoproliferative autoimmune syndrome. Similarly, humans with the rare recessive disorder: Immunodysregulation, Polyendocrinopathy and Enteropathy X-linked (IPEX) syndrome exhibit aggressive autoimmunity and early (Walker et al., 2003).

[0144] TReg cells can be generated both in the thymus and in the periphery and appear phenotypically and functionally similar. Studies with TCR-transgenic systems indicate that relatively high-affinity interactions of αβTCR with self-peptide agonists presented on thymic epithelial cells are required to efficiently generate TReg cells in a CD28 -dependent manner (Apostolou et al., 2002; Jordan et al., 2001; Tai et al., 2005; Walker et al., 2003). As a result, intrathymic TReg cells utilize a diverse TCR repertoire (Bluestone and Abbas, 2003) skewed toward autoantigen recognition. Recently, it was reported Hassall's corpuscles express thymic stromal lymphopoietin (TSLP), which activates thymic dendritic cells to induce the proliferation of TReg cells (Watanabe et al., 2005). Alternatively, TReg cells can be expanded extrathymically through differences in self-peptide exposure and cytokine milieu (i.e.: transforming growth factor-[3 (TGF-β) and IL-10) (Apostolou and von Boehmer, 2004; Belghith et al., 2003;Roncarolo et al., 2001; Weiner, 2001).

[0145] The observation that TReg cells are deficient in patients with multiple sclerosis, type 1 diabetes, rheumatoid arthritis (Ehrenstein et al., 2004; Lindley et al., 2005; Viglietta et al., 2004) has raised hope that treatment of these and other autoimmune diseases may rest with the restoration of TReg cells (Bluestone, 2005). In contrast, the elimination of TReg cells may play a significant role in enhancing cancer immunotherapeutic approaches by releasing the breaks on antitumor T cell responses and inducing limited local autoimmunity (Sakaguchi et al., 2001). Finally, TReg cells may play a critical role in the establishment of tolerance following allogenic organ transplant thereby minimizing rejection mediated by GvHD (Gregori et al., 2005; Hoffmann and Edinger, 2006; Touraine et al., 2005).

[0146] As with most cellular based therapies, the major obstacle for the utilization of TReg cells in the treatment of autoimmunity is the ability to generate them in large numbers to realize therapeutic effectiveness. Currently, the OP9-DL1 coculture system does not support the generation of large numbers of TReg cells from progenitor T cells. Given the role of TSLP in the generation of TReg cells (Watanabe et al., 2005), it is unclear whether the absence of TReg cells in the OP9-DL1 coculture system is due to a deficiency of OP9 cells to produce TSLP.

[0147] Regardless, stem cell transplantation for the treatment of severe autoimmunity is gaining momentum (Bluestone, 2005; Gregori et al., 2005; Sykes and Nikolic, 2005) with the development of human / immunodeficient mouse models of alloreaction (Thomsen et al., 2005), methods to expand regulatory T cell populations (Kretschmer et al., 2005) and to engineer stem cells and progenitor T cells to express self-antigen (Alderuccio et al., 2003).

[0148] Accordingly, the present application provides a method of treating or preventing an autoimmune disease comprising administering an effective amount of a progenitor T cell differentiated from the engineered iPSCs disclosed herein to an animal thereof.244904-2225-06372701586-000167WOPTAtorney Docket: 701586-000167WOPT

[0149] Genetic Diseases

[0150] As mentioned previously, the therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein, may be transfected with a desired gene. Such cells can be used for treatment of genetic diseases. Hematopoietic cell-related genetic diseases can be treated by grafting the cellular composition with cells transfected with a gene that can make up for the deficiency or the abnormality of the gene causing the diseases. For example, a normal wild type gene that causes a disease such as β-thalassemia (Mediterranean anemia), sickle cell anemia, ADA deficiency, recombinase deficiency, recombinase regulatory gene deficiency and the like, can be transferred into the therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein, by homologous or random recombination and the cells can be grafted into a patient. Further, a cellular composition comprising normal T cells free from abnormalities of genes (from a suitable donor) can be used for treatment.

[0151] Another application of gene therapy permits the use of a drug in a high concentration, which is normally considered to be dangerous, by providing drug resistance to normal T cells by transferring a drug resistant gene into the cells. In particular, it is possible to carry out the treatment using an anticancer drug in high concentration by transferring a gene having drug resistance against the anticancer drug, e.g., a multiple drug resistant gene, therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein, in a cellular composition of the application.

[0152] Diseases other than those relating to the hematopoietic system can be treated by using the cellular compositions comprising therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein, in so far as the diseases relate to a deficiency of secretory proteins such as hormones, enzymes, cytokines, growth factors and the like. A deficient protein can be induced and expressed by transferring a gene encoding a target protein into therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein, under the control of a suitable promoter. The expression of the protein can be controlled to obtain the same activity as that obtained by the natural expression in vivo.

[0153] It is also possible to insert a gene encoding a ribozyme, an antisense nucleic acid or the like (e.g., short-interfering RNA) or another suitable gene into therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein, to control expression of a specific gene product in the cells or to inhibit susceptibility to diseases. For example, therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein, can be subjected to gene modification to express an antisense nucleic acid, siRNA, or a ribozyme, which can prevent growth of hematic pathogens such as HIV, HTLV-I, HTLV-II and the like in therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein. In an embodiment, therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein, of a cellular composition of the application are created which express known inhibitory genes of HIV replication, such as RNA decoys or the Tat- or Rev-responsive elements, or a dominant negative mutant of the Rev trans-activator protein.254904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT Kits

[0154] Another aspect of the present disclosure relates to kits or pharmaceutical packages comprising the engineered iPSCs, or therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs disclosed herein, or both. In some embodiments, another aspect of the technology is a kit for producing therapeutic cells (i.e., T or NK cells) differentiated from the engineered iPSCs from a subject, e.g., for personalized medicine. In some embodiments, the kit also comprises reagents and / or materials for differentiation of the engineered iPSCs into a therapeutic cell type.

[0155] In some embodiments, the kit can also comprise reagents and / or culture media and / or growth factors for carrying out the cell differentiation and / or cell propagation.Definitions

[0156] For convenience, certain terms employed in the entire application (including the specification, examples, and appended claims) are collected here. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0157] The term “isolated” as used herein means that the progenitor cell has been separated or purified from cellular or biological material found with the cells in their native environment. It thus distinguishes the cells from how they exist in nature.

[0158] The term “a cell” or “the cell” includes a plurality of cells.

[0159] The term “T / NK progenitor cell’ as used herein means a T cell that is capable of maturing into a mature T cell or lymphocyte. A mature T cell includes CD4+ and CD8+ T cells. A lymphocyte includes CD56+NK cells.

[0160] Negative and positive selection methods known in the art may be used for enrichment of the progenitor cells. For example, cells can be sorted based on cell surface antigens using a fluorescence activated cell sorter, or magnetic beads which bind cells with certain cell surface antigens. Negative selection columns can be used to remove cells expressing lineage specific surface antigens.

[0161] As used herein, the term “T cell,” refers to a type of lymphocyte that matures in the thymus. T cells play an important role in cell-mediated immunity and are distinguished from other lymphocytes, such as B cells, by the presence of a T-cell receptor on the cell surface. T cells may either be isolated or obtained from a commercially available source. “T cell” includes all types of immune cells expressing CD3 including T-helper cells (CD4+ cells), cytotoxic T-cells (CD8+ cells), natural killer T-cells, T-regulatory cells (Treg) and gamma-delta T cells. A“cytotoxic cell” includes CD8+ T cells, natural-killer (NK) cells, and neutrophils, which cells are capable of mediating cytotoxicity responses. Non-limiting examples of commercially available T-cell lines include lines BCL2 (AAA) Jurkat (ATCC® CRL-2902™), BCL2 (S70A) Jurkat (ATCC® CRL-2900™), BCL2 (S87A) Jurkat (ATCC® CRL-2901™), BCL2 Jurkat (ATCC® CRL-2899™), Neo Jurkat (ATCC® CRL-2898™), TALL- 104 cytotoxic human T cell line (ATCC # CRL-11386). Further examples include but are not limited to mature T-cell lines, e g., such as Deglis, EBT-8, HPB-MLp-W, HUT 78, HUT 102, Karpas 384, Ki 225, My-La, Se-Ax,264904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT SKW-3, SMZ-1 and T34; and immature T-cell lines, e.g., ALL-SIL, Bel3, CCRF-CEM, CML-T, DND-41, DU.528, EU-9, HD-Mar, HPB-ALL, H-SB2, HT-1, JK-TI, Jurkat, Karpas 45, KE-37, KOPT-Ki, K-TI, L-KAW, Loney, MAT, MOLT-1, MOLT 3, MOLT-4, MOLT 13, MOLT- 16, MT-1, MT-ALL, P12 / Ichikawa, Peer, PER0117, PER-255, PL-382, PFI-285, RPMI-8402, ST-4, SUP-TI to T14, TALL-1, TALL-101, TALL- 103 / 2, TALL- 104, TALL- 105, TALL- 106, TALL- 107, TALL- 197, TK-6, TLBR-1, -2, -3, and -4, CCRF-HSB-2 (CCL-120.1), J. RT3-T3.5 (ATCC TIB-153), J45.01 (ATCC CRL-1990), J. CaM1.6 (ATCC CRL-2063), RS4;11 (ATCC CRL-1873), CCRF-CEM (ATCC CRM-CCL-119); and cutaneous T-cell lymphoma lines, e.g., HuT78 (ATCC CRM-TIB-161), MJ[G11] (ATCC CRL-8294), HuT102 (ATCC TIB-162). Null leukemia cell lines, including but not limited to REH, NALL-1, KM-3, L92-221, are another commercially available source of immune cells, as are cell lines derived from other leukemias and lymphomas, such as K562 erythroleukemia, THP-1 monocytic leukemia, U937 lymphoma, HEL erythroleukemia, HL60 leukemia, HMC-1 leukemia, KG-1 leukemia, U266 myeloma. Non-limiting exemplary sources for such commercially available cell lines include the American Type Culture Collection, or ATCC, (see world wide web at address: atcc.org / ) and the German Collection of Microorganisms and Cell Cultures (see world wide web at address: dsmz.de / ).

[0162] The term “chimeric antigen receptors (CARs)” as used herein may be referred to as artificial T-cell receptors, chimeric T-cell receptors, or chimeric immune-receptors, for example, and encompass engineered receptors that graft an artificial specificity onto a particular immune effector cell. The CARs may be employed to impart the specificity of a monoclonal antibody onto a T cell, thereby allowing a large number of specific T cells to be generated, for example, in use for adoptive cell therapy. In specific embodiments, the CARs direct specificity of the cell to a tumor associated antigen, for example. In some embodiments, the CARs comprise an intracellular activation domain, a transmembrane domain and an extracellular domain comprising a tumor associated antigen binding region. In particular aspects, CARs comprise fusions of single-chain variable fragments (scFv) derived from monoclonal antibodies, fused to CD3-zeta transmembrane and endodomain. In other aspects, CARs comprise fusions of fibronectin type III domains, fused to CD3 -zeta transmembrane and endodomain. The specificity of other CARs designs may be derived from ligands of receptors (e.g., peptides) or from Dectins. In particular embodiments, one can target malignant B cells by redirecting the specificity of T cells using a chimeric immunoreceptor specific for the B-lineage molecule, BCMA. In certain cases, the CARs comprise domains for additional co-stimulatory signaling, such as CD3-zeta, FcR, CD27, CD28, CD137, DAP 10, and / or 0X40. In some cases molecules can be co-expressed with the CAR.

[0163] As used herein, the term "gene" includes a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression. Those in the art will readily recognize that nucleic acid molecules can be double-stranded molecules and that reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand. Thus, in defining a polymorphic site, reference to an adenine, a thymine (uridine), a cytosine, or a guanine at a particular site on the plus (sense) strand of a nucleic acid molecule is also intended to include the thymine (uridine), adenine,274904-2225-06372701586-000167WOPTAtorney Docket: 701586-000167WOPT guanine, or cytosine (respectively) at the corresponding site on a minus (antisense) strand of a complementary strand of a nucleic acid molecule. Thus, reference can be made to either strand and still comprise the same polymorphic site and an oligonucleotide can be designed to hybridize to either strand. Throughout this specification, in identifying a polymorphic site, reference is made to the sense strand, only for the purpose of convenience. As used herein, the term "gene" or "recombinant gene" refers to a nucleic acid molecule comprising an open reading frame and including at least one exon and (optionally) an intron sequence. The term "intron" refers to a DNA sequence present in a given gene which is spliced out during mRNA maturation.

[0164] As used herein, the term "nucleic acid" refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, derivatives, variants and analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double -stranded polynucleotides. Deoxyribonucleotides include deoxyadenosine, deoxycytidine, deoxyguanosine, and deoxythymidine. For purposes of clarity, when referring herein to a nucleotide of a nucleic acid, which can be DNA or RNA, the terms "adenosine", "cytosine", "guanosine", and thymidine" are used. It is understood that if the nucleic acid is RNA, a nucleotide having a uracil base is uridine. The term "nucleotide" or nucleic acid as used herein is intended to refer to ribonucleotides, deoxyribonucleotides, acylic derivatives of nucleotides, and functional equivalents thereof, of any phosphorylation state.Functional equivalents of nucleotides are those that act as substrates for a polymerase as, for example, in an amplification method. Functional equivalents of nucleotides are also those that can be formed into a polynucleotide that retains the ability to hybridize in a sequence specific manner to a target polynucleotide. As used herein, the term "polynucleotide" includes nucleotides of any number. A polynucleotide includes a nucleic acid molecule of any number of nucleotides including single -stranded RNA, DNA or complements thereof, double-stranded DNA or RNA, and the like.

[0165] The term "polymorphism" refers to the coexistence of more than one form of a gene or portion thereof. A portion of a gene of which there are at least two different forms, i.e., two different nucleotide sequences, is referred to as a "polymorphic region of a gene". A polymorphic region can be a single nucleotide, the identity of which differs in different alleles. A "polymorphic gene" refers to a gene having at least one polymorphic region.

[0166] The term "genotype" refers to the specific allelic composition of an entire cell or a certain gene, whereas the term "phenotype” refers to the detectable outward manifestations of a specific genotype.

[0167] The term “variant”, “variance”, “mutation” or “polymorphism” are used interchangeably herein and as used herein with respect to nucleic acid sequence refers to a difference in nucleic acid sequence in the population. Polymorphisms are sometimes referred to as “single nucleotide polymorphism” or “SNP” can be synonymous or non-synonymous. Synonymous polymorphisms when present in the coding region typically do not result in an amino acid change. Non-synonymous polymorphism when present in the coding region alter one or more codons resulting in an amino acid replacement in the amino acid chain. Such mutations and polymorphisms can be either heterozygous or homozygous within an individual.284904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT Homozygous individuals have identical alleles at one or more corresponding loci on homologous chromosomes. While heterozygous individuals have two different alleles at one or more corresponding loci on homologous chromosomes. A polymorphism is thus said to be "allelic," in that, due to the existence of the polymorphism, some members of a species carry a gene with one sequence (e.g., the original or wild-type "allele"), whereas other members can have an altered sequence (e.g., the variant or, mutant "allele"). In the simplest case, only one mutated variant of the sequence can exist, and the polymorphism is said to be diallelic. For example, if the two alleles at a locus are indistinguishable in their effects on the organism, then the individual is said to be homozygous at the locus under consideration. If the two alleles at a locus are distinguishable because of their differing effects on the organism, then the individual is said to be heterozygous at the locus. In the present application, typographically, alleles are distinguished “+” or Using these symbols, homozygous individuals are + / +, or - / - or two of the same symbol, for example A / A, G / G, T / T and C / C. Heterozygous individuals are + / - or two different symbols, for example A / G, A / T. A / C, G / T etc. The occurrence of alternative mutations can give rise to tri-allelic and tetra-allelic polymorphisms, etc. An allele can be referred to by the nucleotide(s) that comprise the mutation. In some instances a “silent mutation” is a synonymous codon change, or silent SNP is one that does not result in a change of amino acid due to the degeneracy of the genetic code. A substitution that changes a codon coding for one amino acid to a codon coding for a different amino acid (i.e., a non-synonymous codon change) is referred to as a missense mutation. A nonsense mutation results in a type of non-synonymous codon change in which a stop codon is formed, thereby leading to premature termination of a polypeptide chain and a truncated protein. A read-through mutation is another type of non-synonymous codon change that causes the destruction of a stop codon, thereby resulting in an extended polypeptide product. While SNPs can be bi-, tri-, or tetra-allelic, the vast majority of the SNPs are bi-allelic, and are thus often referred to as "bi-allelic markers", or "di-allelic markers".

[0168] The term “expression” as used herein refers to interchangeably to the expression of a polypeptide or protein or expression of a polynucleotide or expression of a gene. Expression also refers to the expression of pre-translational modified and post-translationally modified proteins, as well as expression of pre-mRNA molecules, alternatively spliced and mature mRNA molecules. Expression of a polynucleotide can be determined, for example, by measuring the production of RNA transcript molecules, for example messenger RNA (mRNA) transcript levels. Expression of a protein or polypeptide can be determined, for example, by immunoassay using an antibody(ies) that bind with the polypeptide.

[0169] The term "encode" as it is applied to polynucleotides refers to a polynucleotide which is said to "encode" a polypeptide or protein if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed to produce the RNA which can be translated into an amino acid sequence to generate the polypeptide and / or a fragment thereof. The antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.294904-2225-06372701586-000167WOPTAtorney Docket: 701586-000167WOPT

[0170] The term “endogenously expressed” or “endogenous expression” refers to the expression of a gene product at normal levels and under normal regulation for that cell type.

[0171] The terms “patient”, “subject” and “individual” are used interchangeably herein, and refer to an animal, particularly a human, to whom treatment including prophylaxis treatment is provided. The term “subject” as used herein refers to human and non-human animals. The term “non-human animals” and “non-human mammals” are used interchangeably herein includes all vertebrates, e.g., mammals, such as non-human primates, (particularly higher primates), sheep, dog, rodent (e.g. mouse or rat), guinea pig, goat, pig, cat, rabbits, cows, and non-mammals such as chickens, amphibians, reptiles etc. In one embodiment, the subject is human. In another embodiment, the subject is an experimental animal or animal substitute as a disease model.

[0172] The term “tissue” refers to a group or layer of similarly specialized cells which together perform certain special functions. The term “tissue-specific” refers to a source or defining characteristic of cells from a specific tissue.

[0173] As used herein, the term “donor” refers to a subject to which an organ, tissue or cell to be transplanted is harvested from.

[0174] As used herein, the term “recipient” refers to a subject which will receive a transplanted organ, tissue or cell.

[0175] The term “allograft” refers to a transplanted cell, tissue, or organ derived from a different animal of the same species.

[0176] The term “effective amount” includes within its meaning a sufficient amount of a pharmacological composition to provide the desired effect. For example, an effective amount using the methods as disclosed herein would be considered as the amount sufficient to reduce a symptom of cancer or an autoimmune disease by at least 10%. Further, an effective amount as used herein would also include an amount sufficient to prevent or delay the development of a symptom experienced by a subject, or alter the course of a symptom disease (for example but not limited to, slow the progression or development of at least one symptom experienced by a subject with the disease), or reverse at least one symptom experienced by a subject with the disease of interest.

[0177] The term “polynucleotide” as used herein, refers to single- or double-stranded polymer of deoxyribonucleotide, ribonucleotide bases or known analogies of natural nucleotides, or mixtures thereof. The term includes reference to the specified sequence as well as to the sequence complementary thereto, unless otherwise indicated. The term “polypeptide” means a polymer made up of amino acids linked together by peptide bonds. The terms “polypeptide” and “protein” are used interchangeably herein, although for the purposes for the present disclosure, a polypeptide may constitute a portion or the full length protein.

[0178] In the context of this specification, the term “activity” as it pertains to a protein, polypeptide or polynucleotide means any cellular function, action, effect of influence exerted by the protein, polypeptide or polynucleotide, either by nucleic acid sequence or fragment thereof, or by the protein or polypeptide itself or any fragment thereof.304904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT

[0179] The term "nucleic acid" or "oligonucleotide" or "polynucleotide" used herein can mean at least two nucleotides covalently linked together. As will be appreciated by those in the art, the depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. As will also be appreciated by those in the art, many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. As will also be appreciated by those in the art, a single strand provides a probe for a probe that can hybridize to the target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions.

[0180] The term “statistically significant" or “significantly" refers to statistical significance and generally means a two standard deviation (2 SD) below normal, or lower, concentration of the marker. The term refers to statistical evidence that there is a difference. It is defined as the probability of making a decision to reject the null hypothesis when the null hypothesis is actually true. The decision is often made using the p-value.

[0181] The term “standard deviation” is a measure of the dispersion of a set of data from its mean. The more spread apart the data, the higher the deviation. Standard deviation is calculated as the square root of variance and can be calculated by one of ordinary skill in the art.

[0182] The term "cell culture medium" (also referred to herein as a "culture medium" or "medium") as referred to herein is a medium for culturing cells containing nutrients that maintain cell viability and support proliferation. The cell culture medium may contain any of the following in an appropriate combination: salt(s), buffer(s), amino acids, glucose or other sugar(s), antibiotics, serum or serum replacement, and other components such as peptide growth factors, etc. The appropriate cell culture media, for a particular cell type, is known to those skilled in the art.

[0183] As used herein, the terms "administering," and "introducing" are used interchangeably, and refer to the placement of a population of cells as defined herein into a subject by a method or route which results in at least partial localization of the population of cells at a desired site, such as, e.g. the blood or a tumor site. A population of cells as defined herein can be administered by any appropriate route which results in an effective treatment in the subject.

[0184] The term “transplantation” as used herein refers to introduction of new cells (e.g. a population of cells as defined herein), tissues, or organs into a host (i.e. transplant recipient or transplant subject)

[0185] The term “genetically modified” cell, e.g. a genetically modified population of pluripotent stem cells, or iPSC as disclosed herein as used herein refers to a population of pluripotent stem cells, such as ES cells or iPSC as disclosed herein into which an exogenous nucleic acid has been introduced by a process involving the hand of man (or a descendant of such a cell that has inherited at least a portion of the nucleic acid). The nucleic acid may for example contain a sequence that is exogenous to the cell, it may contain native sequences (e.g., sequences naturally found in the cells) but in a non-naturally occurring arrangement (e.g., a coding region linked to a promoter from a different gene), or altered versions of native sequences. The process of transferring the nucleic into the cell is referred to as 314904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT “transducing a cell” and can be achieved by any suitable technique. Suitable techniques include calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using a viral vector. In some embodiments the polynucleotide or a portion thereof is integrated into the genome of the cell. The nucleic acid may have subsequently been removed or excised from the genome, provided that such removal or excision results in a detectable alteration in the cell relative to an unmodified but otherwise equivalent cell.

[0186] The term “transduction” as used herein refers to the use of viral particles to introduce new genetic material into a cell

[0187] The term “transfection” as used herein refers the use of chemical methods, most often lipid containing vesicles, to introduce new genetic material into a cell

[0188] The term “transformation” as used herein refers to when a cell becomes functionally abnormal in the process of malignancy, often obtaining a new capacity to multiply indefinitely or under new circumstances.

[0189] The term “vector,” as used herein, refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as “expression vectors.” The vector can optionally include exogenous genetic material that allow for the expression of the transgene, for example, can comprise homology arms that allow insertion of the transgene.

[0190] The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrastemal injection and infusion. The phrases "systemic administration," "administered systemically", "peripheral administration" and "administered peripherally" as used herein mean the administration of a population of iT cells or iNK cells and / or compound and / or other material other than directly into the pulmonary system, e.g., lungs or airways, such that it enters the animal's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.

[0191] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0192] The phrase "pharmaceutically acceptable carrier" as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject agents from one organ, or portion 324904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation, or be biologically inert.

[0193] A “reporter gene” as used herein encompasses any gene that is genetically introduced into a cell that adds to the phenotype of the stem cell. Reporter genes as disclosed in this invention are intended to encompass fluorescent, enzymatic and resistance genes, but also other genes which can easily be detected by persons of ordinary skill in the art. In some embodiments of the invention, reporter genes are used as markers for the identification of particular stem cells, cardiovascular stem cells and their differentiated progeny.

[0194] As used herein, "proliferating" and "proliferation" refers to an increase in the number of cells in a population (growth) by means of cell division. Cell proliferation is generally understood to result from the coordinated activation of multiple signal transduction pathways in response to the environment, including growth factors and other mitogens. Cell proliferation may also be promoted by release from the actions of intra- or extracellular signals and mechanisms that block or negatively affect cell proliferation.

[0195] The term “enriching” is used synonymously with “isolating” cells, means that the yield (fraction) of cells of one type is increased over the fraction of other types of cells as compared to the starting or initial cell population. Preferably, enriching refers to increasing the percentage by about 10%, by about 20%, by about 30%, by about 40%, by about 50% or greater than 50% of one type of cell in a population of cells as compared to the starting population of cells.

[0196] The term "substantially pure", with respect to a particular cell population, refers to a population of cells that is at least about 75%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% pure, with respect to the cells making up a total cell population. Recast, the terms "substantially pure" or "essentially purified", with regard to a preparation of one or more partially and / or terminally differentiated cell types, refer to a population of cells that contain fewer than about 30%, or about 20%, more preferably fewer than about 15%, 10%, 8%, 7%, most preferably fewer than about 5%, 4%, 3%, 2%, 1%, or less than 1%, of cells that are not T / NK progenitor cells as disclosed herein.

[0197] The terms “lower”, “reduced”, “reduction” or “decrease” or “inhibit” are all used herein generally to mean a decrease by a statistically significant amount. However, for avoidance of doubt, “lower”, “reduced”, “reduction” or “decrease” or “inhibit” means a decrease by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (i.e. absent level as compared to a reference sample), or any decrease between 10-100% as compared to a reference level.

[0198] The terms “increased” ‘increase” or “enhance” or “higher” are all used herein to generally mean an increase by a statically significant amount; for the avoidance of any doubt, the terms “increased”, “increase” or “enhance” or “higher” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or 334904-2225-06372701586-000167WOPTAtorney Docket: 701586-000167WOPT up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5 -fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level.

[0199] By an “increase” in the expression or activity of a gene or protein is meant a positive change in protein or polypeptide or nucleic acid level or activity in a cell, a cell extract, or a cell supernatant. For example, such an increase may be due to increased RNA stability, transcription, or translation, or decreased protein degradation. Preferably, this increase is at least 5%, at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 80%, at least about 100%, at least about 200%, or even about 500% or more over the level of expression or activity under control conditions.

[0200] As used herein the term "comprising" or "comprises" is used in reference to compositions, methods, and respective component(s) thereof, that are essential to the disclosure, yet open to the inclusion of unspecified elements, whether essential or not. Accordingly, compositions or methods "comprising" one or more recited elements may include other elements not specifically recited. The terms “comprising” means “including principally, but not necessary solely”. Furthermore, variation of the word “comprising”, such as “comprise” and “comprises”, have correspondingly varied meanings. The term “consisting essentially” means “including principally, but not necessary solely at least one”, and as such, is intended to mean a “selection of one or more, and in any combination.” In the context of the specification, the term “comprising” means “including principally, but not necessary solely”.Furthermore, variation of the word “comprising”, such as “comprise” and “comprises”, have correspondingly varied meanings.

[0201] As used herein the term "consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the disclosure.

[0202] The term "consisting of refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[0203] As used in this specification and the appended claims, the singular forms “a,” "an," and "the" include plural references unless the context clearly dictates otherwise. Thus for example, references to "the method" includes one or more methods, and / or steps of the type described herein and / or which will become apparent to those persons skilled in the art upon reading this disclosure and so forth. Thus, the use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one” but is also consistent with the meaning of “one or more”, “at least one” and “one or more than one.”

[0204] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The term “about” when used in connection with percentages can mean ±1%.. The present disclosure is further explained in detail by the following, including the Examples, but the scope of the disclosure should not be limited thereto.344904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT

[0205] Although any known methods, devices, and materials may be used in the practice or testing of the invention, the methods, devices, and materials in this regard are disclosed herein.

[0206] In some embodiments, the present application may be defined in any of the following paragraphs:1. A genetically engineered induced pluripotent stem cell (iPSC), comprising:a. a biallelic disruption of endogenous beta-2 -microglobulin (B2M);b. an exogenous nucleic acid encoding an HLA-E protein integrated at the endogenous B2M genomic locus, the fusion protein being expressed by the iPSC;c. a biallelic disruption of the class II transactivator (CIITA) gene; andd. an exogenous nucleic acid encoding a CD47 protein integrated at the CIITA genomic locus,wherein the genetically engineered iPSC exhibits reduced immunogenicity and is capable of long-term engraftment following transplantation into an allogeneic recipient.2. The genetically engineered iPSC of paragraph 1, wherein the iPSC does not express B2M.3. The genetically engineered iPSC of any of the preceding paragraphs, wherein disruption of B2M prevents transcriptional activation of MHC class I genes.4. The genetically engineered iPSC of any of the preceding paragraphs, wherein disruption of the CIITA gene prevents transcriptional activation of MHC class II genes.5. The genetically engineered iPSC of any of the preceding paragraphs, wherein the iPSC does not express HLA-A, HLA-B, and HLA-C.6. The genetically engineered iPSC of any of the preceding paragraphs, wherein the iPSC does not express HLA-DR, HLA-DP, and HLA-DQ.7. The genetically engineered iPSC of any of the preceding paragraphs, wherein the HLA-E protein is operably linked to an endogenous B2M regulatory element.8. The genetically engineered iPSC of any of the preceding paragraphs, wherein the nucleic acid encoding a CD47 protein is constitutively expressed.9. The genetically engineered iPSC of any of the preceding paragraphs, wherein the nucleic acid encoding an HLA-E protein comprises a sequence of SEQ ID NO: 7.10. The genetically engineered iPSC of any of the preceding paragraphs, wherein the nucleic acid encoding a CD47 protein comprises a sequence of SEQ ID NO: 8.11. The genetically engineered iPSC of any of the preceding paragraphs, wherein the genetic modifications are introduced using CRISPR / Cas9-mediated genome editing.354904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT 12. The genetically engineered iPSC of any of the preceding paragraphs, wherein a guide RNA targets exon 1 of the endogenous B2M gene to mediate homologous recombination of the nucleic acid encoding an HLA-E protein.13. The genetically engineered iPSC of any of the preceding paragraphs, wherein a guide RNA targets exon 1 of the CIITA gene to mediate insertion of the nucleic acid encoding a CD47 protein.14. The genetically engineered iPSC of any of the preceding paragraphs, wherein the iPSC is not capable of being detected by a T-cell.15. The genetically engineered iPSC of any of the preceding paragraphs, wherein the iPSC is not capable of being detected by a natural killer (NK)-cell.16. The genetically engineered iPSC of any of the preceding paragraphs, further comprising a nucleic acid sequence encoding an HLA-G protein.17. The genetically engineered iPSC of any of the preceding paragraphs, wherein the nucleic acid sequence encoding an HLA-G protein is expressed in the B2M locus.18. A method of producing a hypoimmunogenic iPSC, comprising:a. introducing into an iPSC a CRISPR / Cas9 system comprisingi. a guide RNA targeting exon 1 of the endogenous B2M gene and a donor nucleic acid comprising a nucleic acid sequence encoding an HLA-E protein flanked by homology arms corresponding to the B2M locus, andii. a guide RNA targeting exon 1 of the CIITA gene and a donor nucleic acid comprising a nucleic acid sequence encoding a CD47 protein;b. selecting iPSCs comprising a biallelic insertion of the nucleic acid sequence encoding an HLA-E protein and a biallelic disruption of endogenous B2M and a biallelic disruption of CIITA and insertion of the nucleic acid sequence encoding a CD47 protein.19. The method of any of the preceding paragraphs, wherein the iPSC does not express B2M.20. The method of any of the preceding paragraphs, wherein disruption of B2M prevents transcriptional activation of MHC class I genes.21. The method of any of the preceding paragraphs, wherein disruption of the CIITA gene prevents transcriptional activation of MHC class II genes.22. The method of any of the preceding paragraphs, wherein the iPSC does not express HLA-A, HLA-B, and HLA-C.364904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT 23. The method of any of the preceding paragraphs, wherein the iPSC does not express HLA-DR, HLA-DP, and HLA-DQ.24. The method of any of the preceding paragraphs, wherein the HLA-E protein is operably linked to an endogenous B2M regulatory element.25. The method of any of the preceding paragraphs, wherein the nucleic acid encoding a CD47 protein is constitutively expressed.26. The method of any of the preceding paragraphs, wherein the nucleic acid encoding an HLA-E protein comprises a sequence of SEQ ID NO: 7.27. The method of any of the preceding paragraphs, wherein the nucleic acid encoding a CD47 protein comprises a sequence of SEQ ID NO: 8.28. The method of any of the preceding paragraphs, wherein a guide RNA targets exon 1 of the endogenous B2M gene to mediate homologous recombination of the nucleic acid encoding an HLA-E protein.29. The method of any of the preceding paragraphs, wherein a guide RNA targets exon 1 of the CIITA gene to mediate insertion of the nucleic acid encoding a CD47 protein.30. The method of any of the preceding paragraphs, wherein the guide RNA comprises a sequence selected from SEQ ID NOs 1-6.31. The method of any of the preceding paragraphs, wherein the iPSC is not capable of being detected by a T-cell.32. The method of any of the preceding paragraphs, wherein the iPSC is not capable of being detected by a natural killer (NK)-cell.33. The method of any of the preceding paragraphs, further comprising the step of differentiating the iPSC into a different cell type.34. The method of any of the preceding paragraphs, further comprising a nucleic acid sequence encoding an HLA-G protein.35. The method of any of the preceding paragraphs, wherein the nucleic acid sequence encoding an HLA-G protein is expressed in the B2M locus.36. A method of reducing immune-mediated rejection of transplanted cells, comprising:a. differentiating the iPSC of any of the preceding paragraphs into a therapeutic cell type;and374904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT b. transplanting the differentiated cells into a human subject,wherein the transplanted cells evade T-cell, natural killer cell, and macrophage-mediated immune responses.37. A method of reducing immune-mediated rejection of transplanted cells, comprising:a. differentiating the iPSC produced by the method of any of the preceding paragraphs into a therapeutic cell type; andb. transplanting the differentiated cells into a human subject,wherein the transplanted cells evade T-cells and natural killer cells.38. The method of any of the preceding paragraphs, wherein the therapeutic cell type is selected from the group consisting of lung basal cells, T cells, NK cells, hematopoietic cells, epithelial cells, and tissue progenitor cells.39. The method of any of the preceding paragraphs, wherein the iPSCs cells are autologous to the subject receiving the transplanted differentiated cells.40. The method of any of the preceding paragraphs, wherein the iPSCs cells are allogenic to the subject receiving the transplanted differentiated cells.41. The method of any of the preceding paragraphs, wherein the transplanted differentiated cells have an increased engraftment rate as compared to an appropriate control.42. The method of any of the preceding paragraphs, wherein the subjects receiving the transplanted differentiated cells have a decreased risk of host versus graft disease as compared to an appropriate control.

[0207] It is understood that the foregoing detailed description and the following examples are illustrative only and are not to be taken as limitations upon the scope of the disclosure. Various changes and modifications to the disclosed embodiments, which will be apparent to those of skill in the art, may be made without departing from the spirit and scope of the present disclosure. Further, all patents, patent applications, and publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present disclosure. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure or for any other reason. All statements as to the date or representation as to the contents of these documents are based on the information available to the applicants and do not constitute any admission as to the correctness of the dates or contents of these documents.

[0208] It should be understood that this disclosure is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for 384904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT the purpose of describing particular embodiments only, and is not intended to limit the scope of the present disclosure, which is defined solely by the claims.

[0209] Various embodiments of the disclosure could also include permutations of the various elements recited in the claims as if each dependent claim was a multiple dependent claim incorporating the limitations of each of the preceding dependent claims as well as the independent claims. Such permutations are expressly within the scope of this disclosure.

[0210] While the disclosure has been particularly shown and described with reference to a number of embodiments, it would be understood by those skilled in the art that changes in the form and details may be made to the various embodiments disclosed herein without departing from the spirit and scope of the disclosure and that the various embodiments disclosed herein are not intended to act as limitations on the scope of the claims. All references cited herein are incorporated in their entirety by reference.

[0211] Each of the applications and patents cited in this text, as well as each document or reference cited in each of the applications and patents (including during the prosecution of each issued patent; “application cited documents”), and each of the PCT and foreign applications or patents corresponding to and / or claiming priority from any of these applications and patents, and each of the documents cited or referenced in each of the application cited documents, are hereby expressly incorporated herein by reference and may be employed in the practice of the disclosure. More generally, documents or references are cited in this text, either in a Reference List before the claims, or in the text itself; and, each of these documents or references (“herein cited references”), as well as each document or reference cited in each of the herein cited references (including any manufacturer’s specifications, instructions, etc.), is hereby expressly incorporated herein by reference.

[0212] The disclosure can be understood more fully by reference to the following detailed description and illustrative examples, that are intended to exemplify non-limiting embodiments of the disclosure.EXAMPLES

[0213] The invention is a biological iPSC cell lines that is genetically altered to reduce the immunogenicity of the cell lines to allow for long-term engraftment of iPSC-derived cells and tissues. CRISPR / cas9 was utilized to knockout expression of immunological targets 1) HLA-A, HLA-B, HLA-C, HLA-DR, HLA-DP and HLA-DQ (MHC class I and class II) to prevent T cell-based host vs graft response, while knocking in expression of HLA-E and CD47 to prevent Natural Killer cell and Macrophage based host vs. graft response, respectively. Our invention is unique given the genetic alterations that are perform and the method in which they are derived. First, knockout of HLA-A, B, C and knock in of HLA-E was performed using one CRISPR / cas9 procedure. Guide RNA’s targeting exon 1 of genomic Beta-2 -Microglobulin (B2M) for insertion of synthetic B2M-fused to HLA-E (Note: HLA-A, -B,-C, and -E require B2M to be expressed) while knocking out expression of genomic B2M. In the CRIPSR / cas9 protocol, iPSC’s were nucleofected with donor DNA sequence (DNA plasmid) containing left and right homology arms of genomic B2M with synthetic B2M-HLA-E in between the arms, and 394904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT guide RNA target exon 1 of genomic B2M. iPSC’s were then positively selected for cells containing homologous insertion of HLA-E and knockout of B2M on both chromosomes using polymerase chain reaction (PCR) analyses. Once the 1st genomic edit was made, a separate CRISPR / cas9 edit was performed to knocking out expression of HLA-DR,-DP and-DQ while knocking in CD47. Guide RNAs targeting exon 1 of genomic CIITA gene (Master regulator of HLA-DR,-DP and -DQ) were used to insert constitutively expressed CD47 into exon 1 of CIITA. iPSC’s were positively selected using PCR analyses to confirmed homozygous knockout of CIITA and knock in of CD47. After both CRIPSR / cas9 edits, edited iPSCs were karyotyped to confirm genomic stability. To verify changes in protein expression of gene knockouts and knockins, protein expression was verified using flow cytometry and functionally assessed using killing assay of co-cultures of primary T cells, NK cells and macrophages.404904-2225-06372701586-000167WOPT

Claims

Attorney Docket: 701586-000167WOPT CLAIMS1. A genetically engineered induced pluripotent stem cell (iPSC), comprising:a) a biallelic disruption of endogenous beta-2 -microglobulin (B2M);b) an exogenous nucleic acid encoding an HLA-E protein integrated at the endogenous B2M genomic locus, the fusion protein being expressed by the iPSC;c) a biallelic disruption of the class II transactivator (CIITA) gene; andd) an exogenous nucleic acid encoding a CD47 protein integrated at the CIITA genomic locus,wherein the genetically engineered iPSC exhibits reduced immunogenicity and is capable of longterm engraftment following transplantation into an allogeneic recipient.

2. The genetically engineered iPSC of claim 1, wherein the iPSC does not express B2M.

3. The genetically engineered iPSC of claim 1, wherein disruption of B2M prevents transcriptional activation of MHC class I genes.

4. The genetically engineered iPSC of claim 1, wherein disruption of the CIITA gene prevents transcriptional activation of MHC class II genes.

5. The genetically engineered iPSC of claim 1, wherein the iPSC does not express HLA-A, HLA-B, and HLA-C.

6. The genetically engineered iPSC of claim 1, wherein the iPSC does not express HLA-DR, HLA-DP, and HLA-DQ.

7. The genetically engineered iPSC of claim 1, wherein the HLA-E protein is operably linked to an endogenous B2M regulatory element.

8. The genetically engineered iPSC of claim 1, wherein the nucleic acid encoding a CD47 protein is constitutively expressed.

9. The genetically engineered iPSC of claim 1, wherein the nucleic acid encoding an HLA-E protein comprises a sequence of SEQ ID NO: 7.

10. The genetically engineered iPSC of claim 1, wherein the nucleic acid encoding a CD47 protein comprises a sequence of SEQ ID NO: 8.

11. The genetically engineered iPSC of claim 1, wherein the genetic modifications are introduced using CRISPR / Cas9-mediated genome editing.414904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT 12. The genetically engineered iPSC of claim 11, wherein a guide RNA targets exon 1 of the endogenous B2M gene to mediate homologous recombination of the nucleic acid encoding an HLA-E protein.

13. The genetically engineered iPSC of claim 11, wherein a guide RNA targets exon 1 of the CIITA gene to mediate insertion of the nucleic acid encoding a CD47 protein.

14. The genetically engineered iPSC of any of claims 1-13, wherein the iPSC is not capable of being detected by a T-cell.

15. The genetically engineered iPSC of any of claims 1-13, wherein the iPSC is not capable of being detected by a natural killer (NK)-cell.

16. The genetically engineered iPSC of any of claims 1-15, further comprising a nucleic acid sequence encoding an HLA-G protein.

17. The genetically engineered iPSC of any of claims 1-16, wherein the nucleic acid sequence encoding an HLA-G protein is expressed in the B2M locus.

18. A method of producing a hypoimmunogenic iPSC, comprising:a) introducing into an iPSC a CRISPR / Cas9 system comprisingi. a guide RNA targeting exon 1 of the endogenous B2M gene and a donor nucleic acid comprising a nucleic acid sequence encoding an HLA-E protein flanked by homology arms corresponding to the B2M locus, andii. a guide RNA targeting exon 1 of the CIITA gene and a donor nucleic acid comprising a nucleic acid sequence encoding a CD47 protein;b) selecting iPSCs comprising a biallelic insertion of the nucleic acid sequence encoding an HLA-E protein and a biallelic disruption of endogenous B2M and a biallelic disruption of CIITA and insertion of the nucleic acid sequence encoding a CD47 protein.

19. The method of claim 18, wherein the iPSC does not express B2M.

20. The method of claim 18, wherein disruption of B2M prevents transcriptional activation of MHC class I genes.

21. The method of claim 18, wherein disruption of the CIITA gene prevents transcriptional activation of MHC class II genes.

22. The method of claim 18, wherein the iPSC does not express HLA-A, HLA-B, and HLA-C.

23. The method of claim 18, wherein the iPSC does not express HLA-DR, HLA-DP, and HLA-DQ.

24. The method of claim 18, wherein the HLA-E protein is operably linked to an endogenous B2M regulatory element.424904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT 25. The method of claim 18, wherein the nucleic acid encoding a CD47 protein is constitutively expressed.

26. The method of claim 16, wherein the nucleic acid encoding an HLA-E protein comprises a sequence of SEQ ID NO: 7.

27. The method of claim 18, wherein the nucleic acid encoding a CD47 protein comprises a sequence of SEQ ID NO: 8.

28. The method of claim 18, wherein a guide RNA targets exon 1 of the endogenous B2M gene to mediate homologous recombination of the nucleic acid encoding an HLA-E protein.

29. The method of claim 18, wherein a guide RNA targets exon 1 of the CIITA gene to mediate insertion of the nucleic acid encoding a CD47 protein.

30. The method of claim 18, wherein the guide RNA comprises a sequence selected from SEQ ID NOs 1-6.

31. The method of claim 18, wherein the iPSC is not capable of being detected by a T-cell.

32. The method of claim 18, wherein the iPSC is not capable of being detected by a natural killer (NK)- cell.

33. The method of claim 18, further comprising the step of differentiating the iPSC into a different cell type.

34. The method of claim 18, further comprising a nucleic acid sequence encoding an HLA-G protein.

35. The method of claim 34, wherein the nucleic acid sequence encoding an HLA-G protein is expressed in the B2M locus.

36. A method of reducing immune-mediated rejection of transplanted cells, comprising:a) differentiating the iPSC of any of claims 1-17 into a therapeutic cell type; and b) transplanting the differentiated cells into a human subject,wherein the transplanted cells evade T-cell, natural killer cell, and macrophage-mediated immune responses.

37. A method of reducing immune-mediated rejection of transplanted cells, comprising:a) differentiating the iPSC produced by the method of any of claims 18-35 into a therapeutic cell type; andb) transplanting the differentiated cells into a human subject,wherein the transplanted cells evade T-cells and natural killer cells.434904-2225-06372701586-000167WOPTAttorney Docket: 701586-000167WOPT 38. The method of claim 36 or 37, wherein the therapeutic cell type is selected from the group consisting of lung basal cells, T cells, NK cells, hematopoietic cells, epithelial cells, and tissue progenitor cells.

39. The method of claim 36 or 37, wherein the iPSCs cells are autologous to the subject receiving the transplanted differentiated cells.

40. The method of claim 36 or 37, wherein the iPSCs cells are allogenic to the subject receiving the transplanted differentiated cells.

41. The method of any of claims 36-40, wherein the transplanted differentiated cells have an increased engraftment rate as compared to an appropriate control.

42. The method of any of claims 36-41, wherein the subjects receiving the transplanted differentiated cells have a decreased risk of host versus graft disease as compared to an appropriate control.444904-2225-06372701586-000167WOPT