Methods for modulating calcium ion channel activity and uses thereof

By modifying the amino acid clusters at the carboxyl terminus of L-type calcium channel proteins to regulate L-type calcium channel activity, the problem of sudden changes in calcium ion concentration that may be caused by existing methods has been solved, thus achieving safe and effective treatment for cardiovascular diseases.

CN111068052BActive Publication Date: 2026-04-24PEKING UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN201811230866.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2018-10-22
Publication Date
2026-04-24
Estimated Expiration
2038-10-22

AI Technical Summary

Technical Problem

Existing methods and drugs for regulating L-type calcium ion channels may cause sudden changes in calcium ion concentration when treating cardiovascular diseases, leading to serious conditions such as myocardial infarction or stroke, and the regulatory mechanism is not fully understood.

Method used

The activity of L-type calcium channel proteins can be regulated by adjusting the negatively charged amino acid clusters at positions 2061-2064 of the C-terminus of L-type calcium channel proteins, especially by phosphorylating or dephosphorylating serine at positions 2062 and/or 2063. Specific kinases or phosphatases can be used to modify or inhibit these proteins, thereby altering their charged properties to control calcium ion influx.

Benefits of technology

It provides a safer and more effective way to regulate calcium ion channel activity, reduce calcium ion overload, lower the risk of cardiovascular disease, avoid serious complications caused by sudden changes in calcium ion concentration, and improve the controllability and safety of treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN111068052B_ABST
    Figure CN111068052B_ABST
Patent Text Reader

Abstract

The present application provides a method for regulating calcium ion influx of myocardial cells by modifying any one or more of the amino acid residues in the combination of ESSE at positions 2061-2064 in the amino acid sequence corresponding to SEQ ID No. 1 of the mammalian L-type calcium channel protein, and a calcium channel regulator. The present application also provides a pharmaceutical composition for treating cardiovascular diseases, which comprises a regulator of any one or more of the amino acid residues in the combination of ESSE at positions 2061-2064 in the amino acid sequence corresponding to SEQ ID No. 1 of the mammalian L-type calcium channel protein. The present application also provides a method for screening potential substances for treating cardiovascular diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology, disease treatment, and pharmaceuticals. Specifically, this invention relates to methods and modulators for regulating calcium ion channels, and methods and pharmaceutical compositions thereof for treating calcium ion channel-related diseases. Background Technology

[0002] L-type calcium channels are voltage-gated calcium channels, mainly distributed on cardiomyocytes and cardiovascular smooth muscle cells, and are the primary pathway for calcium ion influx during cardiomyocyte excitation. Cardiac contraction is mediated by a process called excitation-contraction coupling in cardiomyocytes. Specifically, the sinoatrial node generates an electrical excitation-action potential, which is transmitted through the cell membrane. L-type calcium channels on the ventricular myocyte membrane sense this action potential and open, allowing extracellular calcium ions to enter the cell. This activates calcium channels on the sarcoplasmic reticulum, causing a large release of calcium ions from this calcium reservoir, leading to an increase in cytoplasmic calcium concentration. The released calcium ions in the cytoplasm cause myofibrils to slide, resulting in cell contraction and thus cardiac contraction.

[0003] L-type calcium channels exhibit multiple regulatory mechanisms, with the carboxyl terminus playing a crucial role in regulating their opening activity and current magnitude. Studies have demonstrated that under physiological conditions, L-type calcium channels regulate their activity by modulating post-translational modifications, such as phosphorylation levels. Under conditions like oxidative stress, L-type calcium channel phosphorylation increases under the regulation of G protein-coupled receptors (GPCRs), leading to increased calcium ion influx into cells. Therefore, under oxidative stress conditions, such as myocardial ischemia, infarction, or pathological conditions like hypertension-induced cardiac hypertrophy and heart failure, increased L-type calcium channel activity often results in increased calcium ion influx, leading to calcium overload in cardiomyocytes. Calcium overload triggers a series of severe cardiomyocyte injuries.

[0004] Due to the aforementioned important roles, L-type calcium channels have become the most pharmacologically significant channels. Different regulatory mechanisms of L-type calcium channels have been discovered, and they are used clinically to treat cardiovascular diseases such as hypertension, coronary heart disease, and angina pectoris. However, existing treatments and drugs may cause sudden changes in intracellular calcium ion concentration, leading to rapid changes in blood pressure and potentially causing serious conditions such as myocardial infarction or stroke.

[0005] The regulatory mechanism of L-type calcium ion channels is not yet fully understood, and their active sites and related mechanisms require further investigation. New and effective methods and drugs for regulating L-type calcium ion channels are also needed in this field. Summary of the Invention

[0006] Through in-depth research, the inventors of this application have discovered for the first time that the core region of the negatively charged amino acid cluster at positions 2061-2064 (2061ESSE2064) at the C-terminus of L-type calcium channel protein is of great significance to the activity of L-type calcium channel protein. The existence of this conserved sequence plays an important role in the regulation of L-type calcium channel protein activity. Furthermore, by modifying the properties of serine at position 2009 in rat-derived L-type calcium channel protein (corresponding to serine at position 2063 in human L-type calcium channel protein), the inventors demonstrated that modifying this sequence to affect phosphorylation and alter the charged properties of the negatively charged amino acid cluster can significantly affect the calcium ion influx controlled by L-type calcium channel protein. Therefore, the inventors provide a method and drug for treating cardiovascular diseases by modifying the charged properties of the negatively charged amino acid cluster at positions 2061-2064 at the C-terminus of L-type calcium channel protein and altering the phosphorylation level of serine within it.

[0007] Specifically, the present invention provides a method for regulating calcium ion influx in mammalian cardiomyocytes, comprising modifying one or any combination of amino acid residues in ESSE at positions 2061-2064 of the amino acid sequence of the L-type calcium channel protein corresponding to SEQ ID No. 1. In one aspect of the invention, the modification is a modification of serine (S) at positions 2062 and / or 2063 of the amino acid sequence of the L-type calcium channel protein corresponding to SEQ ID No. 1.

[0008] L-type calcium channel proteins (Voltage-dependent L-type calcium channels) are widely distributed in various cell types, including smooth muscle cells, cardiomyocytes, and neurons, and are the main channel proteins regulating calcium ion influx. In cardiomyocytes, they are responsible for calcium release and regulate cardiomyocyte contraction and heart rate. In mammals, both the protein and encoding nucleic acid sequences of L-type calcium channel proteins are highly conserved. The gene encoding the human L-type calcium channel protein (UniProt ID: Q13936) is (Ensembl: ENST00000344100). The gene encoding the rat L-type calcium channel protein (UniProt ID: P22002) is (Ensembl: ENSRNOG00000007090). The gene encoding the mouse L-type calcium channel protein (UniProt ID: Q 01815) is (Ensembl: ENSMUST00000075591). In L-type calcium channel proteins, the ESSE amino acid cluster at positions 2061-2064 in the amino acid sequence corresponding to human SEQ ID No. 1 is highly conserved across species. The ESSE amino acid cluster corresponds to positions 2007-2010 in the amino acid sequence corresponding to rat SEQ ID No. 2.

[0009] In one aspect of the invention, the modification in the above method alters the charged properties of the amino acid residues of the ESSE at positions 2061-2064. Methods known in the art for altering the charged properties of one or more amino acid residues on a protein can be employed, such as chemical modifications including acidification or substitution of amino acid residues.

[0010] In one aspect of the invention, the modification described in the above method refers to phosphorylation modification, specifically phosphorylation modification of serine residues at positions 2062 and / or 2063. The modification can be performed using methods known in the art for phosphorylating a specific amino acid on a protein. Phosphorylation modification includes phosphorylation with a protein kinase or dephosphorylation with a phosphatase. Phosphorylation with a protein kinase involves the transfer of the phosphate group of ATP to a serine residue of the substrate protein via kinase catalysis. Dephosphorylation with a phosphatase refers to the process of removing the phosphate group from phosphorylated serine residues through hydrolysis by a phosphatase.

[0011] In one aspect of the invention, the ESSE at positions 2061-2064 is phosphorylated, and in particular, the phosphorylation kinase of the serine at positions 2062 and / or 2063 is an oxikinase.

[0012] In one aspect of the invention, the ESSE at positions 2061-2064 is dephosphorylated, and the phosphatase for dephosphorylating the serine at positions 2062 and / or 2063 is oxiphatase.

[0013] In this patent, oxikinase refers to a kinase that regulates the phosphorylation of amino acid residues in the core region of the negatively charged amino acid cluster (2061ESSE2064) at the carboxyl terminus of L-type calcium channel proteins under oxidative stress.

[0014] In this patent, oxiphatase refers to a phosphatase that regulates the dephosphorylation of amino acid residues in the core region of the negatively charged amino acid cluster (2061ESSE2064) at the carboxyl terminus of L-type calcium channel proteins under oxidative stress conditions.

[0015] In one aspect of the invention, the method further includes regulating the kinase or phosphatase in the following manner:

[0016] a. Kinase or phosphatase inhibitors, such as interfering RNA or its precursor that interferes with the expression of the kinase or phosphatase, or specific antibodies against the kinase or phosphatase, or mutant kinase or phosphatase proteins or their coding sequences that cause decreased activity.

[0017] b. The kinase or phosphatase agonist; or

[0018] c. Overexpress the kinase or phosphatase.

[0019] The kinase or phosphatase inhibitor refers to a reagent that can affect the activity of a kinase or phosphatase, thereby affecting the activity of L-type calcium channels. The reagent may include small molecule compounds or complexes, or large molecule active ingredients such as proteins and nucleic acids.

[0020] In another aspect of the invention, the kinase or phosphatase inhibitor is an interfering RNA or its precursor that interferes with expression. Interfering RNA induces efficient and specific degradation of homologous mRNA through double-stranded RNA (dsRNA), thereby reducing or even eliminating the expression of the target gene. One way to administer interfering RNA in vivo is through its precursor, such as short hairpin RNA (shRNA) comprising two short inverted repeat sequences.

[0021] In another aspect of the invention, the kinase or phosphatase inhibitor is a mutant kinase or phosphatase protein or its coding sequence that results in decreased or lost activity. The mutant protein can compete with the normal protein, thereby reducing the activity of the normal protein. The mutant protein can be expressed in the target tissue or cell by means of a vector (carrying the gene for the mutant protein and / or its expression factor) that is expressible in the target tissue or cell.

[0022] In one aspect of the invention, the modification of any one or more amino acid residues in the ESSE sequence at positions 2061-2064 of the L-type calcium channel protein corresponding to the amino acid sequence of SEQ ID No. 1 refers to point mutation of the amino acid residues. Methods known in the art for point mutation of a specific amino acid in a protein can be used. For example, the desired change can be introduced into a DNA fragment (which can be a genome or a plasmid) encoding the target amino acid residue using methods such as PCR, including adding / changing bases to encode the required amino acid residue after mutation, and then the modified DNA fragment can be introduced into the target cell or tissue to add a new protein or replace the wild-type protein.

[0023] In another aspect of the invention, the modification is a point mutation of the serine residues at positions 2062 and / or 2063 of the L-type calcium channel protein. The point mutation involves replacing the serine residue with a non-electrone amino acid, such as a neutral or electronegative amino acid (i.e., a nonpolar or basic amino acid), including glycine (Gly), alanine (Ala), valine (Val), leucine (Leu), isoleucine (Ile), phenylalanine (Phe), tryptophan (Trp), tyrosine (Tyr), and methionine (Met). Preferably, the serine residue is mutated to alanine or isoleucine. For example, a plasmid containing a nucleic acid fragment encoding serine at position 2062 and / or position 2063 of an L-type calcium channel protein can be obtained by cloning. The base TCT encoding the serine can be replaced with ATT. The plasmid can then be transfected into target cells, thereby introducing a mutant L-type calcium channel protein with isoleucine at position 2062 and / or position 2063 into the target cells.

[0024] In this invention, the mammal can be any mammal, including but not limited to rodents (such as ground squirrels, mice, and rats), lagomorphs (rabbits), carnivores (felids and canines), even-toed ungulates (bovids and suidae), perissodactyls (equines), or primates and apes (humans or monkeys). The mammal is preferably a human, mouse, or rat.

[0025] The method for regulating calcium ion influx in mammalian cardiomyocytes provided by this invention can be used in vitro, including regulation of isolated cells or tissues.

[0026] The present invention also provides the use of a reagent that modifies one or any combination of amino acid residues in ESSE at positions 2061-2064 of the amino acid sequence corresponding to the L-type calcium channel protein of SEQ ID No. 1 in the preparation of a medicament for regulating calcium ion influx in mammalian cardiomyocytes. In one aspect of the invention, the reagent is a reagent that modifies serine at positions 2062 and / or 2063 therein.

[0027] In one aspect of the invention, in the above-described methods and uses, the reagent used to modify the ESSE at positions 2061-2064 of the amino acid sequence corresponding to the L-type calcium channel protein (SEQ ID No. 1), particularly modifying the serine at positions 2062 and / or 2063, is a reagent specifically modifying said sites. A specific modification reagent refers to a reagent that modifies only said sites, or a reagent that has no modifying activity on amino acid residues at other sites, particularly serine residues at other sites, or whose modifying activity is significantly less than that on the serine at positions 2062 and / or 2063. For example, it is an enzyme that specifically affects the phosphorylation or dephosphorylation of serine at positions 2062 and / or 2063, or the level thereof. Another example is a reactant used for point mutation of the serine at position 2062 (such as primers for obtaining mutant nucleic acid fragments, plasmids containing mutant nucleic acid fragments, etc.).

[0028] In another aspect of the invention, the reagent used above is a reagent that alters the charged properties of the amino acid residues of the ESSE at positions 2061-2064, for example, a reagent that chemically modifies the amino acid residues, including acidification.

[0029] In another aspect of the invention, the reagent used above is a phosphorylation-modifying reagent, particularly a reagent that phosphorylates serine residues at positions 2062 and / or 2063, such as a protein kinase or phosphatase. In another aspect of the invention, the reagent is a phosphorylation-modifying oxikinase (oxidative stress protein kinase) of ESSE at positions 2061-2064, particularly of serine residues at positions 2062 and / or 2063. In another aspect of the invention, the reagent is an oxiphatase (oxidative stress phosphatase) that dephosphorylates ESSE at positions 2061-2064. In yet another aspect of the invention, the reagent is:

[0030] a. Kinase or phosphatase inhibitors, such as interfering RNA or its precursor that interferes with the expression of the kinase or phosphatase, or specific antibodies against the kinase or phosphatase, or mutant kinase or phosphatase proteins or their coding sequences that cause decreased activity.

[0031] b. Kinase or phosphatase agonists; or

[0032] c. Reagents used for overexpressing the kinase or phosphatase.

[0033] In one aspect of the invention, an L-type calcium channel regulator is provided, which is a reagent that specifically modifies one or any combination of multiple amino acid residues in the ESSE sequence corresponding to positions 2061-2064 of the amino acid sequence of the L-type calcium channel protein, which corresponds to the amino acid sequence of SEQ ID No. 1. In another aspect of the invention, the L-type calcium channel regulator is a reagent that specifically modifies serine residues at positions 2062 and / or 2063 of the amino acid sequence of the L-type calcium channel protein, which corresponds to the amino acid sequence of SEQ ID No. 1.

[0034] In another aspect of the invention, the aforementioned L-type calcium channel regulator is a specific phosphorylation modifier, particularly a reagent that specifically phosphorylates serine residues at positions 2062 and / or 2063, such as oxikinase or oxiphatase. In yet another aspect of the invention, the reagent is:

[0035] a. Kinase or phosphatase inhibitors, such as interfering RNA or its precursor that interferes with the expression of the kinase or phosphatase, or specific antibodies against the kinase or phosphatase, or mutant kinase or phosphatase proteins or their coding sequences that cause decreased activity.

[0036] b. Kinase or phosphatase agonists; or

[0037] c. Overexpression of the aforementioned kinase or phosphatase.

[0038] In another aspect of the invention, the aforementioned L-type calcium channel regulator is a mammalian L-type calcium channel protein in which one or both of the serine residues at positions 2062 and 2063 of the amino acid sequence corresponding to SEQ ID No. 1 (human origin) are mutated to nonpolar amino acids. In another aspect of the invention, the serine residues at positions 2062 and 2063 of the amino acid sequence corresponding to SEQ ID No. 1 are mutated to nonpolar or basic amino acids, preferably to isoleucine or alanine.

[0039] Therefore, in one aspect of the present invention, a mammalian L-type calcium channel protein is provided, wherein any one or both of the serine residues at positions 2062 and 2063 of the amino acid sequence corresponding to SEQ ID No. 1 (human origin) are mutated to nonpolar amino acids. In one aspect of the present invention, wherein the serine residues at positions 2062 and 2063 of the amino acid sequence corresponding to SEQ ID No. 1 are mutated to nonpolar or basic amino acids, preferably to isoleucine or alanine.

[0040] This invention also provides a method for treating cardiovascular diseases by modifying one or any combination of amino acid residues in the ESSE sequence of the mammalian L-type calcium channel protein, corresponding to positions 2061-2064 of SEQ ID No. 1. This invention further provides the use of a reagent that modifies one or any combination of amino acid residues in the ESSE sequence of the mammalian L-type calcium channel protein, corresponding to positions 2061-2064 of SEQ ID No. 1, in the preparation of a medicament for treating cardiovascular diseases.

[0041] The present invention also provides a pharmaceutical composition for treating cardiovascular diseases. The present invention provides a novel pharmaceutical composition for treating cardiovascular diseases, comprising a therapeutically effective amount of a reagent comprising one or any combination of multiple amino acid residues from the ESSE sequence of the modified mammalian L-type calcium channel protein, corresponding to positions 2061-2064 of SEQ ID No. 1.

[0042] The reagents used in the above-described methods and pharmaceutical compositions for treating cardiovascular diseases of the present invention that modify the properties of ESSEs corresponding to amino acid sequences 2061-2064 of the L-type calcium channel protein in mammals as described in SEQ ID No. 1 include reagents that modify serines at positions 2062 and / or 2063 of the L-type calcium channel protein sequence corresponding to amino acid sequences SEQ ID No. 1, particularly reagents that specifically modify these sequences, as defined above.

[0043] In this invention, the cardiovascular diseases are selected from: atrial and ventricular arrhythmias, heart failure (including congestive heart failure, diastolic heart failure, systolic heart failure, and acute heart failure), Prinzmetto (variant) angina, stable and unstable angina, exercise-induced angina, congestive heart disease, local ischemia, recurrent ischemia, reperfusion injury, myocardial infarction, acute coronary syndrome, peripheral artery disease, and pulmonary hypertension.

[0044] This invention also provides a method for screening potential substances for treating cardiovascular diseases, comprising the steps of:

[0045] (1) Obtain mammalian cells expressing L-type calcium channel proteins and administer the test substance to be screened; and

[0046] (2) Detect whether the serine residues at positions 2062 and / or 2063 of the amino acid sequence corresponding to the L-type calcium channel protein of the mammalian cell are phosphorylated.

[0047] In the method for screening potential substances for treating cardiovascular diseases, if phosphorylation modification of serine at position 2062 and / or position 2063 in mammalian cells is found in the method, the test substance is considered a potential substance for treating cardiovascular diseases.

[0048] In one aspect of the invention, the method further includes the step of: (3) detecting the calcium ion flow in the mammalian cells.

[0049] In the method for screening potential substances for treating cardiovascular diseases, if phosphorylation modification of serine at position 2062 and / or position 2063 in mammalian cells is found in the method, and the calcium ion flow in the mammalian cells changes, then the test substance is considered a potential substance for treating cardiovascular diseases.

[0050] This invention also provides a method for screening oxikiase or oxiphotase in mammals, comprising the steps of:

[0051] (1) Obtain mammalian cells expressing L-type calcium channel proteins and the target kinase or phosphatase; and

[0052] (2) Detect whether the expression of the kinase or phosphatase changes under hypoxic conditions, and whether the serine residues at positions 2062 and / or 2063 of the amino acid sequence corresponding to the L-type calcium channel protein in SEQ ID No. 1 are phosphorylated.

[0053] In the method for screening mammalian oxikiase or oxiphotase, if phosphorylation modification of serine residues at positions 2062 and / or 2063 of mammalian cells is found in the method, it indicates that the kinase or phosphatase to be tested is a potential oxikiase or oxiphotase for hypoxic stress.

[0054] In one aspect of the invention, the method further includes the step of: (3) detecting the calcium ion flow in the mammalian cells.

[0055] In the method for screening oxikiase or oxiphotase, if phosphorylation modification of serine at position 2062 and / or position 2063 of mammalian cells is found in the method, and the calcium ion flux of the mammalian cells changes, then the kinase or phosphatase to be tested is a potential oxikiase or oxiphotase for hypoxic stress.

[0056] Contributions of this invention:

[0057] Through in-depth research, the inventors have discovered for the first time that the core region of the negatively charged amino acid cluster at positions 2007-2010 (2007ESSE2010) at the C-terminus of L-type calcium channel proteins plays a crucial role in the activity of L-type calcium channel proteins. The C-terminus of L-type calcium channel proteins is an important structural domain regulating their function, and it is widely distributed with phosphokinases, phosphatases, and regulatory protein interaction sites. Through protein sequence analysis of the C-terminus of L-type calcium channel proteins, the inventors found that the ESSE amino acid cluster at positions 2061-2064 of the human L-type calcium channel protein exhibits high conservation across species. These amino acids at positions 2061-2064 are negatively charged amino acids under physiological conditions. Specifically, glutamic acid (E) at positions 2007 and 2010 is an acidic amino acid, meaning that under physiological conditions, the carboxyl group of the glutamic acid side chain dissociates and carries a negative charge. Serine (S) at positions 2008 and 2009 is an important phosphorylation modification site; the phosphorylated serine also carries a negative charge on its side chain under physiological conditions. Therefore, positions 2007-2010 are conserved, consisting of four consecutive negatively charged amino acid clusters. The presence of this conserved sequence plays an important role in regulating the activity of L-type calcium channel proteins.

[0058] Building upon the aforementioned research, the inventors further discovered that adjusting the properties of serine at position 2009 in this sequence, particularly by mutating it to alter the phosphorylation modification and change the charged properties of the negatively charged amino acid cluster, significantly impacts the calcium ion influx mediated by L-type calcium channel proteins. Specifically, mutating serine at position 2009 to isoleucine, a nonpolar amino acid (hydrophobic amino acid) with no charge, not only deprives the negatively charged side chain of the phosphorylated serine at that position of being phosphorylated, but also changes the distribution of the four consecutive negative charges at positions 2007-2010, thus altering the charged properties of the conserved negatively charged amino acid cluster. After this change in the charged properties of the negatively charged cluster, the L-type calcium channel protein is less easily activated, and its activity is inhibited. Therefore, the inventors have provided a method to regulate L-type calcium channel proteins and affect calcium ion channel activity by altering the charged properties of the negatively charged amino acid cluster at positions 2007 to 2010 at the carboxyl terminus of the L-type calcium channel protein and changing the phosphorylation level of serine within it, thereby providing a method and drug for treating cardiovascular diseases.

[0059] L-type calcium channels are widely distributed on the surface of cardiovascular system cells, making them excellent drug targets for cardiovascular diseases. Currently, widely used drugs for treating hypertension and coronary heart disease, such as dihydropyridine calcium channel inhibitors, have active ingredients that are L-type calcium channel inhibitors. Their mechanism of action involves binding to the pore region of L-type calcium channels, directly reducing calcium ion influx. The inhibitors do not affect the channel's activation or inactivation activity, i.e., they do not change the channel's voltage sensitivity. However, the widespread inhibitory effect of calcium ion inhibitors on L-type calcium channels also raises a series of problems. Because calcium ion inhibitors directly reduce cellular calcium ion influx, initial administration and dose reduction need to be gradual to prevent sudden changes in intracellular calcium ion concentration, which could lead to rapid changes in blood pressure and serious conditions such as myocardial infarction or stroke.

[0060] This invention proposes a treatment approach targeting the alteration of the activation properties of L-type calcium channels, which differs from traditional calcium ion inhibitor therapy and improves the controllability of intracellular calcium ion concentration. In most pathological conditions, such as hypertension, coronary heart disease, and myocardial ischemia, cardiomyocytes are under oxidative stress. Under these conditions, L-type calcium channels are significantly activated; that is, even in a resting state, the probability of channel opening is higher, increasing cellular calcium leakage and raising the basal calcium ion concentration, thus triggering symptoms. Therefore, if the channel sensitivity of L-type calcium channels can be modulated at this time, rather than simply reducing the amount of calcium ion influx into the channels, the intracellular calcium ion concentration can be controlled more effectively and safely, thereby achieving a therapeutic effect.

[0061] Current research on the regulation of L-type calcium ion channels focuses on controlling the magnitude of their channel current (the number of calcium ions flowing into the cell through the channel). Therefore, the discovery in this invention of influencing the channel activation properties by regulating the negatively charged amino acid clusters at the carboxyl terminus of L-type calcium ion channels provides a novel, controllable, more effective, and safer mechanism and direction for the treatment of cardiovascular diseases. Attached Figure Description

[0062] Figure 1 This image shows the structural alignment of L-type calcium channel proteins and their primary sequence analysis across species. The protein sequences of the α subunits of L-type calcium channels from humans, rats, and mice were obtained from the Uniprot database. Secondary structure markers were also obtained from the Uniprot database.

[0063] Figure 2 Phosphorylation analysis diagram of the ESSE primary sequence of L-type calcium channel amino acid clusters.

[0064] Figure 3The comparison shows the activation curves of wild-type and mutant L-type calcium channels overexpressed in HEK239T cells. Conductance (G) at different voltages (V) was calculated from calcium current-voltage data. The conductance was normalized to its corresponding maximum conductance (Gmax), and the Mortzmann equation G / Gmax=1 / (1+exp((Vhalf-V) / k)) was fitted to all points to calculate the half-activation voltage (Vhalf), which is the voltage value corresponding to G / Gmax equal to 0.5 in the curve. The half-activation voltage of the wild-type (white circle) L-type calcium channel was -10mV, while the half-activation voltage of the mutant L-type calcium channel corresponding to the mutation of serine at position 2009 in the amino acid sequence of SEQ ID No. 2 to isoleucine (S2009I) was -4mV. This means that compared to the wild-type, the mutant channel activation curve shifted to the right (towards depolarization). This indicates that, under the same voltage, wild-type channels are more easily activated and opened than mutant channels, resulting in more calcium ions entering the cell through these channels in the same amount of time. Detailed Implementation

[0065] The following examples further illustrate the essence and beneficial effects of the present invention. These examples are for illustrative purposes only and are not intended to limit the invention. Experimental methods in the following examples, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0066] Example 1: Materials and Methods

[0067] Animal materials

[0068] Sprague Dawley rats were purchased from Viton Lever Beijing Laboratory Animal Technology Co., Ltd. All rats used in the experiments were adult males weighing 200-250 grams. All animal experiments were approved by the Peking University Laboratory Animal Welfare and Use Committee.

[0069] Gene cloning and vector construction

[0070] Rat L-type calcium channel protein α subunit ( Figure 1 The coding sequences of the α subunit (shown as an example) and the β subunit (expression helper subunit) were amplified from a cDNA library of rat cardiomyocytes using chain reaction (PCR). The α subunit nucleic acid sequence was ligated into the pIRES-EGFP vector via NheI / XhoI restriction enzyme sites. The β subunit nucleic acid sequence was ligated into the pIRES-TdTomato vector via NheI / XhoI (New England Biolabs, UK) restriction enzyme sites.

[0071] The overexpression vector pIRES-EGFP was obtained by inserting the IRES nucleic acid sequence EcoRI / BamHI into pEGFP-C1 (Clontech, USA). The EGFP nucleic acid sequence in the pIRES-EGFP vector was replaced with the TdTomato nucleic acid sequence by double digestion with NheI / BsrGI to obtain the pIRES-TdTomato vector.

[0072] The mutation of serine at position 2009 in the amino acid sequence of the α subunit of rat L-type calcium channel protein (SEQ ID No. 2) to isoleucine was achieved by overlap PCR. The codon TCT encoding the serine at position 2009 was replaced with ATT, and a point mutation was introduced by synthesizing primers.

[0073] The primer sequences involved in the above cloning are as follows:

[0074] L-type calcium channel α subunit forward (F) and reverse (R) primers:

[0075] F: CTAGCTAGCATGATTCGGGGCCTTCGCTCAG

[0076] R: CCGCTCGAGCTACAGGTTGCTGACATAGGACCTGC

[0077] Primer sequences for point mutation:

[0078] S2009I_F:CGGAGTCCATTGAGAAACTCAACAGCAG

[0079] S2009I_R:AGTTTCTCAATGGACTCCGCCCCCTC

[0080] L-type calcium channel β subunit forward (F) and reverse (R) primers:

[0081] F: CTAGCTAGCATGCTTGACAGGCAGTTGGTGTCTTC

[0082] R:ACGCGTCGACTCATTGGCGGATGTATACATCCCTG

[0083] Cell culture and protein overexpression

[0084] HEK293T cells were cultured in DMEM (ThermoFisher Scientific, USA) containing 10% fetal bovine serum in a 5% CO2 environment. One hour before transfection, cells were transferred to serum-free Opti-MEM (GibcoBRL, USA) and transfected using Lipo2000 (ThermoFisher Scientific USA) plasmids containing the α-subunit pIRES-EGFP and the β-subunit pIRES-Tdtomato plasmid, with each plasmid transfected at a dose of 2 μg. Eight hours after transfection, cells were transferred to serum-containing medium and cultured for another 24 hours for subsequent experiments. Co-transfected cells were observed and screened using an inverted confocal laser microscope LSM710 (Carl Zeiss, Germany) system.

[0085] Electrophysiology

[0086] This experiment used an Axon 200B patch-clamp amplifier, a Digidata 1440A digital-to-analog converter, and Clampex 6 software to acquire and record electrophysiological stimulation and signals. The ambient temperature was 25℃. The glass electrodes used had an intracellular resistance of 2-4 MΩ. Cells expressing both the LCCα subunit (containing EGFP) and the β subunit (containing td-tomato) were selected for recording under a Zeiss LSM 710 confocal microscope. The intracellular recording solution was prepared (mM) as follows: 120 CsCl, 20 TEA-Cl, 5 EGTA, 10 HEPES, 1 MgCl2·6H2O, 5 MgATP, and CsOH adjusted to pH 7.2. The external solution formulation (mM) was: 137 NaCl, 5.4 KCl, 1.2 MgCl2·6H2O, 20 HEPES, 1.2 NaH2PO4·2H2O, 10 BaCl2, 10 glucose, and NaOH adjusted to pH 7.3-7.4. After the electrode was immersed in the solution, a high-resistance (>GΩ) seal was achieved between the electrode and the cell using a negative pressure attachment method. Then, a weak positive pressure was applied to the electrode tube to rupture the cell membrane. After rupture, the cell membrane potential was clamped at -70 mV, and stimulation was applied from -70 mV to 70 mV in 10 mV steps. The current signal was acquired at a frequency of 2 kHz. Data were analyzed using pClamp 10.2 software.

[0087] Example 2: L-type calcium channel protein sequence analysis

[0088] The protein structure and primary sequence of L-type calcium channel proteins in humans, rats, and mice were analyzed. For example... Figure 1As shown, the four subunits of the L-type calcium channel are represented by I-IV. Each subunit contains six transmembrane helices, represented by 1-6. The loop portion between the fifth and sixth helices is the voltage-sensing region. The carboxyl-terminal portion is located intracellularly; this domain is abbreviated as dCT. The amino acid cluster ESSE, corresponding to positions 2061-2064 in the amino acid sequence of human SEQ ID No. 1 (positions 2007-2010 in the amino acid sequence of rat SEQ ID No. 2), is located at the carboxyl terminus of the channel. Primary sequence analysis revealed that this amino acid cluster ESSE is conserved among humans, rats, and mice.

[0089] Example 3: Phosphorylation analysis of the primary sequence of L-type calcium channel amino acid cluster ESSE.

[0090] The primary sequence of the rat L-type calcium channel carboxyl-terminal domain (amino acids 1506-2169) protein was obtained from Uniprot and analyzed using the sequence and structure-based protein phosphorylation analysis algorithm (NetPhos2.0).

[0091] like Figure 2 As shown, primary sequence analysis revealed high levels of phosphorylation at serine positions 2008 and 2009 (corresponding to the amino acid sequence of SEQ ID No. 2), with scores of 0.722 and 0.784, respectively. A score above 0.2 indicates a low level of phosphorylation under physiological conditions.

[0092] Example 4: Cell model showing the effect of serine mutation at position 2009 (corresponding to isoleucine) in the amino acid sequence of SEQ ID No. 2 in rats on L-type calcium channel activity.

[0093] The gene for rat L-type calcium channels was inserted into an expression vector and overexpressed in HEK209T cells. The activation curve of the L-type calcium channels was detected using whole-cell patch-clamp technology. With increasing voltage, the channels opened, extracellular calcium ions flowed into the cytoplasm through the channels, and the channels were activated. The number of voltage-gated channels activated varied under different voltages.

[0094] like Figure 3 As shown. Figure 3 This is the conductivity curve of an L-type calcium channel as a function of voltage, i.e., the channel activation curve. As voltage increases, the number of open channels on the cell membrane gradually increases, leading to an increase in conductivity. The channel activation curve of the S2009I mutant (serine at position 2009 is mutated to isoleucine) shifts to the right.

[0095] This indicates that when serine at position 2009 is mutated to isoleucine, the channel requires a higher voltage to activate. In other words, at the same voltage, the mutant channel has a lower probability of opening than the wild type, and its activity is inhibited.

[0096] Example 5, a cell model, shows the effect of a serine mutation at position 2009 (corresponding to alanine) in the amino acid sequence of SEQ ID No. 2 in rats on L-type calcium channel activity.

[0097] Using the same method as in Example 5, tests revealed that the activation curve of the S2009A (serine at position 2009 mutated to alanine) mutant channel was similar to that of the S2009I mutant, shifting to the right. This indicates that when serine at position 2009 is mutated to alanine, under the same voltage, the probability of the mutant channel opening is lower than that of the wild type, and channel activity is inhibited.

[0098] Therefore, in the 2007-2010 negatively charged amino acid cluster, phosphorylated serine is mutated into alanine, a nonpolar amino acid with a smaller side chain, which changes the negatively charged nature of the amino acid cluster and inhibits channel activity.

[0099] in conclusion

[0100] Through in-depth research, the inventors have discovered for the first time that positions 2007-2010 in rat calcium channel protein (corresponding to positions 2061-2064 in human L-type calcium channel protein) are conserved, consisting of four consecutive negatively charged amino acid clusters. The presence of this conserved sequence plays an important role in regulating the activity of L-type calcium channel protein.

[0101] Building upon the aforementioned research, the inventors further discovered and demonstrated that adjusting the properties of serine at position 2009, particularly by mutating it to alter the phosphorylation modification and change the charged properties of the negatively charged amino acid cluster, significantly affects calcium ion influx. Therefore, the inventors provide a method and drug for treating cardiovascular diseases by modifying the charged properties of the negatively charged amino acid cluster at the carboxyl terminus of L-type calcium channel proteins and changing the phosphorylation level of serine within it, thereby affecting the activity of calcium ion channels.

[0102] This invention proposes a treatment approach targeting the alteration of the activation properties of L-type calcium channels, which differs from traditional calcium ion inhibitor therapy and improves the controllability of intracellular calcium ion concentration. In most pathological conditions, such as hypertension, coronary heart disease, and myocardial ischemia, cardiomyocytes are under oxidative stress. Under these conditions, L-type calcium channels are significantly activated; that is, even in the resting state, the probability of channel opening is higher, leading to increased cellular calcium leakage and elevated basal calcium ion concentration, thus triggering symptoms. Therefore, if the channel sensitivity of L-type calcium channels can be modulated at this time, rather than simply reducing the amount of calcium ion influx into the channels, intracellular calcium ion concentration can be controlled more effectively and safely, thereby achieving a therapeutic effect.

[0103] Current research on the regulation of L-type calcium ion channels focuses on controlling the channel current (the number of calcium ions flowing into the cell through the channel). Therefore, the discovery in this invention of influencing the channel activation properties by regulating the negatively charged amino acid clusters at the carboxyl terminus of L-type calcium ion channels provides a novel, controllable, more effective, and safer disease treatment mechanism and direction.

[0104] The foregoing description of the present invention should not be construed as limiting it. Unless otherwise indicated, the present invention will be practiced using conventional techniques such as organic chemistry, polymer chemistry, and biotechnology, and it is obvious that the invention can be implemented in other ways besides those specifically described in the foregoing description and examples. Other aspects and modifications within the scope of the invention will be apparent to those skilled in the art. Many changes and variations are possible based on the teachings of the present invention, and therefore fall within the scope of the invention.

[0105] Unless otherwise specified, the temperature unit "degree" in this article refers to Celsius, or °C. sequence list <110> Beijing University <120> Methods and applications for regulating calcium ion channel activity <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2221 <212> PRT <213> people() <400> 1 Met Val Asn Glu Asn Thr Arg Met Tyr Ile Pro Glu Glu Asn His Gln 1 5 10 15 Gly Ser Asn Tyr Gly Ser Pro Arg Pro Ala His Ala Asn Met Asn Ala 20 25 30 Asn Ala Ala Ala Gly Leu Ala Pro Glu His Ile Pro Thr Pro Gly Ala 35 40 45 Ala Leu Ser Trp Gln Ala Ala Ile Asp Ala Ala Arg Gln Ala Lys Leu 50 55 60 Met Gly Ser Ala Gly Asn Ala Thr Ile Ser Thr Val Ser Ser Thr Gln 65 70 75 80 Arg Lys Arg Gln Gln Tyr Gly Lys Pro Lys Lys Gln Gly Ser Thr Thr 85 90 95 Ala Thr Arg Pro Pro Arg Ala Leu Leu Cys Leu Thr Leu Lys Asn Pro 100 105 110 Ile Arg Arg Ala Cys Ile Ser Ile Val Glu Trp Lys Pro Phe Glu Ile 115 120 125 Ile Ile Leu Leu Thr Ile Phe Ala Asn Cys Val Ala Leu Ala Ile Tyr 130 135 140 Ile Pro Phe Pro Glu Asp Asp Ser Asn Ala Thr Asn Ser Asn Leu Glu 145 150 155 160 Arg Val Glu Tyr Leu Phe Leu Ile Ile Phe Thr Val Glu Ala Phe Leu 165 170 175 Lys Val Ile Ala Tyr Gly Leu Leu Phe His Pro Asn Ala Tyr Leu Arg 180 185 190 Asn Gly Trp Asn Leu Leu Asp Phe Ile Ile Val Val Val Gly Leu Phe 195 200 205 Ser Ala Ile Leu Glu Gln Ala Thr Lys Ala Asp Gly Ala Asn Ala Leu 210 215 220 Gly Gly Lys Gly Ala Gly Phe Asp Val Lys Ala Leu Arg Ala Phe Arg 225 230 235 240 Val Leu Arg Pro Leu Arg Leu Val Ser Gly Val Pro Ser Leu Gln Val 245 250 255 Val Leu Asn Ser Ile Ile Lys Ala Met Val Pro Leu Leu His Ile Ala 260 265 270 Leu Leu Val Leu Phe Val Ile Ile Ile Tyr Ala Ile Ile Gly Leu Glu 275 280 285 Leu Phe Met Gly Lys Met His Lys Thr Cys Tyr Asn Gln Glu Gly Ile 290 295 300 Ala Asp Val Pro Ala Glu Asp Asp Pro Ser Pro Cys Ala Leu Glu Thr 305 310 315 320 Gly His Gly Arg Gln Cys Gln Asn Gly Thr Val Cys Lys Pro Gly Trp 325 330 335 Asp Gly Pro Lys His Gly Ile Thr Asn Phe Asp Asn Phe Ala Phe Ala 340 345 350 Met Leu Thr Val Phe Gln Cys Ile Thr Met Glu Gly Trp Thr Asp Val 355 360 365 Leu Tyr Trp Val Asn Asp Ala Val Gly Arg Asp Trp Pro Trp Ile Tyr 370 375 380 Phe Val Thr Leu Ile Ile Ile Gly Ser Phe Phe Val Leu Asn Leu Val 385 390 395 400 Leu Gly Val Leu Ser Gly Glu Phe Ser Lys Glu Arg Glu Lys Ala Lys 405 410 415 Ala Arg Gly Asp Phe Gln Lys Leu Arg Glu Lys Gln Gln Leu Glu Glu 420 425 430 Asp Leu Lys Gly Tyr Leu Asp Trp Ile Thr Gln Ala Glu Asp Ile Asp 435 440 445 Pro Glu Asn Glu Asp Glu Gly Met Asp Glu Glu Lys Pro Arg Asn Met 450 455 460 Ser Met Pro Thr Ser Glu Thr Glu Ser Val Asn Thr Glu Asn Val Ala 465 470 475 480 Gly Gly Asp Ile Glu Gly Glu Asn Cys Gly Ala Arg Leu Ala His Arg 485 490 495 Ile Ser Lys Ser Lys Phe Ser Arg Tyr Trp Arg Arg Trp Asn Arg Phe 500 505 510 Cys Arg Arg Lys Cys Arg Ala Ala Val Lys Ser Asn Val Phe Tyr Trp 515 520 525 Leu Val Ile Phe Leu Val Phe Leu Asn Thr Leu Thr Ile Ala Ser Glu 530 535 540 His Tyr Asn Gln Pro Asn Trp Leu Thr Glu Val Gln Asp Thr Ala Asn 545 550 555 560 Lys Ala Leu Leu Ala Leu Phe Thr Ala Glu Met Leu Leu Lys Met Tyr 565 570 575 Ser Leu Gly Leu Gln Ala Tyr Phe Val Ser Leu Phe Asn Arg Phe Asp 580 585 590 Cys Phe Val Val Cys Gly Gly Ile Leu Glu Thr Ile Leu Val Glu Thr 595 600 605 Lys Ile Met Ser Pro Leu Gly Ile Ser Val Leu Arg Cys Val Arg Leu 610 615 620 Leu Arg Ile Phe Lys Ile Thr Arg Tyr Trp Asn Ser Leu Ser Asn Leu 625 630 635 640 Val Ala Ser Leu Leu Asn Ser Val Arg Ser Ile Ala Ser Leu Leu Leu 645 650 655 Leu Leu Phe Leu Phe Ile Ile Ile Phe Ser Leu Leu Gly Met Gln Leu 660 665 670 Phe Gly Gly Lys Phe Asn Phe Asp Glu Met Gln Thr Arg Arg Ser Thr 675 680 685 Phe Asp Asn Phe Pro Gln Ser Leu Leu Thr Val Phe Gln Ile Leu Thr 690 695 700 Gly Glu Asp Trp Asn Ser Val Met Tyr Asp Gly Ile Met Ala Tyr Gly 705 710 715 720 Gly Pro Ser Phe Pro Gly Met Leu Val Cys Ile Tyr Phe Ile Ile Leu 725 730 735 Phe Ile Cys Gly Asn Tyr Ile Leu Leu Asn Val Phe Leu Ala Ile Ala 740 745 750 Val Asp Asn Leu Ala Asp Ala Glu Ser Leu Thr Ser Ala Gln Lys Glu 755 760 765 Glu Glu Glu Glu Lys Glu Arg Lys Lys Leu Ala Arg Thr Ala Ser Pro 770 775 780 Glu Lys Lys Gln Glu Leu Val Glu Lys Pro Ala Val Gly Glu Ser Lys 785 790 795 800 Glu Glu Lys Ile Glu Leu Lys Ser Ile Thr Ala Asp Gly Glu Ser Pro 805 810 815 Pro Ala Thr Lys Ile Asn Met Asp Asp Leu Gln Pro Asn Glu Asn Glu 820 825 830 Asp Lys Ser Pro Tyr Pro Asn Pro Glu Thr Thr Gly Glu Glu Asp Glu 835 840 845 Glu Glu Pro Glu Met Pro Val Gly Pro Arg Pro Arg Pro Leu Ser Glu 850 855 860 Leu His Leu Lys Glu Lys Ala Val Pro Met Pro Glu Ala Ser Ala Phe 865 870 875 880 Phe Ile Phe Ser Ser Asn Asn Arg Phe Arg Leu Gln Cys His Arg Ile 885 890 895 Val Asn Asp Thr Ile Phe Thr Asn Leu Ile Leu Phe Phe Ile Leu Leu 900 905 910 Ser Ser Ile Ser Leu Ala Ala Glu Asp Pro Val Gln His Thr Ser Phe 915 920 925 Arg Asn His Ile Leu Phe Tyr Phe Asp Ile Val Phe Thr Thr Ile Phe 930 935 940 Thr Ile Glu Ile Ala Leu Lys Ile Leu Gly Asn Ala Asp Tyr Val Phe 945 950 955 960 Thr Ser Ile Phe Thr Leu Glu Ile Ile Leu Lys Met Thr Ala Tyr Gly 965 970 975 Ala Phe Leu His Lys Gly Ser Phe Cys Arg Asn Tyr Phe Asn Ile Leu 980 985 990 Asp Leu Leu Val Val Ser Val Ser Leu Ile Ser Phe Gly Ile Gln Ser 995 1000 1005 Ser Ala Ile Asn Val Val Lys Ile Leu Arg Val Leu Arg Val Leu Arg 1010 1015 1020 Pro Leu Arg Ala Ile Asn Arg Ala Lys Gly Leu Lys His Val Val Gln 1025 1030 1035 1040 Cys Val Phe Val Ala Ile Arg Thr Ile Gly Asn Ile Val Ile Val Thr 1045 1050 1055 Thr Leu Leu Gln Phe Met Phe Ala Cys Ile Gly Val Gln Leu Phe Lys 1060 1065 1070 Gly Lys Leu Tyr Thr Cys Ser Asp Ser Ser Lys Gln Thr Glu Ala Glu 1075 1080 1085 Cys Lys Gly Asn Tyr Ile Thr Tyr Lys Asp Gly Glu Val Asp His Pro 1090 1095 1100 Ile Ile Gln Pro Arg Ser Trp Glu Asn Ser Lys Phe Asp Phe Asp Asn 1105 1110 1115 1120 Val Leu Ala Ala Met Met Ala Leu Phe Thr Val Ser Thr Phe Glu Gly 1125 1130 1135 Trp Pro Glu Leu Leu Tyr Arg Ser Ile Asp Ser His Thr Glu Asp Lys 1140 1145 1150 Gly Pro Ile Tyr Asn Tyr Arg Val Glu Ile Isolation 1155 1160 1165 Tyr Ile Ile Ile Ala Phe Phe Met Met Asn Ile Phe Val Gly Phe 1170 1175 1180 Val Ile Val Thr Phe Gln Gln Gly Gly Glu Glu Tyr Lys Asn Cys 1185 1190 1195 1200 Glu Leu Asp Lys Asn Gln Arg Gln Cys Val Glu Tyr Ala Leu Lys Ala 1205 1210 1215 Arg Pro Leu Arg Arg Tyr Ile Pro Lys Asn Gln His Gln Tyr Lys Val 1220 1225 1230 Trp Tyr Val Val Asn Ser Thr Tyr Phe Glu Tyr Leu Met Phe Val Leu 1235 1240 1245 There is no such thing as a Gly Gln Ser. 1250 1255 1260 Cys Leu Phe Lys Ile Ala Met Asn Ile Leu Asn Met Leu Phe Thr Gly 1265 1270 1275 1280 Leu Phe Thr Val Glu Met Ile Leu Lys Leu Ile Ala Phe Lys Pro Lys 1285 1290 1295 Gly Tyr Phe Ser Asp Pro Trp Asn Val Phe Asp Phe Leu Ile Val Ile 1300 1305 1310 Gly Ser Ile Ile Asp Val Ile Leu Ser Glu Thr Asn His Tyr Phe Cys 1315 1320 1325 Asp Ala Trp Asn Thr Phe Asp Ala Leu Ile Val Val Gly Ser Ile Val 1330 1335 1340 Asp Ile Ala Ile Thr Glu Val Asn Pro Ala Glu His Thr Gln Cys Ser 1345 1350 1355 1360 Pro Ser Met Asn Ala Glu Glu Asn Ser Arg Ile Ser Ile Thr Phe Phe 1365 1370 1375 Arg Leu Phe Arg Val Met Arg Leu Val Lys Leu Leu Ser Arg Gly Glu 1380 1385 1390 Gly Ile Arg Thr Leu Leu Trp Thr Phe Ile Lys Ser Phe Gln Ala Leu 1395 1400 1405 Pro Tyr Val Ala Leu Leu Ile Val Met Leu Phe Phe Ile Tyr Ala Val 1410 1415 1420 Ile Gly Met Gln Val Phe Gly Lys Ile Ala Leu Asn Asp Thr Thr Glu 1425 1430 1435 1440 Ile Asn Arg Asn Asn Asn Phe Gln Thr Phe Pro Gln Ala Val Leu Leu 1445 1450 1455 Leu Phe Arg Cys Ala Thr Gly Glu Ala Trp Gln Asp Ile Met Leu Ala 1460 1465 1470 Cys Met Pro Gly Lys Lys Cys Ala Pro Glu Ser Glu Pro Ser Asn Ser 1475 1480 1485 Thr Glu Gly Glu Thr Pro Cys Gly Ser Ser Phe Ala Val Phe Tyr Phe 1490 1495 1500 Ile Ser Phe Tyr Met Leu Cys Ala Phe Leu Ile Ile Asn Leu Phe Val 1505 1510 1515 1520 Ala Val Ile Met Asp Asn Phe Asp Tyr Leu Thr Arg Asp Trp Ser Ile 1525 1530 1535 Leu Gly Pro His His Leu Asp Glu Phe Lys Arg Ile Trp Ala Glu Tyr 1540 1545 1550 Asp Pro Glu Ala Lys Gly Arg Ile Lys His Leu Asp Val Val Thr Leu 1555 1560 1565 Leu Arg Arg Ile Gln Pro Pro Leu Gly Phe Gly Lys Leu Cys Pro His 1570 1575 1580 Arg Val Ala Cys Lys Arg Leu Val Ser Met Asn Met Pro Leu Asn Ser 1585 1590 1595 1600 Asp Gly Thr Val Met Phe Asn Ala Thr Leu Phe Ala Leu Val Arg Thr 1605 1610 1615 Ala Leu Arg Ile Lys Thr Glu Gly Asn Leu Glu Gln Ala Asn Glu Glu 1620 1625 1630 Leu Arg Ala Ile Ile Lys Lys Ile Trp Lys Arg Thr Ser Met Lys Leu 1635 1640 1645 Leu Asp Gln Val Val Pro Pro Ala Gly Asp Asp Glu Val Thr Val Gly 1650 1655 1660 Lys Phe Tyr Ala Thr Phe Leu Ile Gln Glu Tyr Phe Arg Lys Phe Lys 1665 1670 1675 1680 Lys Arg Lys Glu Gln Gly Leu Val Gly Lys Pro Ser Gln Arg Asn Ala 1685 1690 1695 Leu Ser Leu Gln Ala Gly Leu Arg Thr Leu His Asp Ile Gly Pro Glu 1700 1705 1710 Ile Arg Arg Ala Ile Ser Gly Asp Leu Thr Ala Glu Glu Glu Leu Asp 1715 1720 1725 Lys Ala Met Lys Glu Ala Val Ser Ala Ala Ser Glu Asp Asp Ile Phe 1730 1735 1740 Arg Arg Ala Gly Gly Leu Phe Gly Asn His Val Ser Tyr Tyr Gln Ser 1745 1750 1755 1760 Asp Gly Arg Ser Ala Phe Pro Gln Thr Phe Thr Thr Gln Arg Pro Leu 1765 1770 1775 His Ile Asn Lys Ala Gly Ser Ser Gln Gly Asp Thr Glu Ser Pro Ser 1780 1785 1790 His Glu Lys Leu Val Asp Ser Thr Phe Thr Pro Ser Ser Tyr Ser Ser 1795 1800 1805 Thr Gly Ser Asn Ala Asn Ile Asn Asn Ala Asn Asn Thr Ala Leu Gly 1810 1815 1820 Arg Leu Pro Arg Pro Ala Gly Tyr Pro Ser Thr Val Ser Thr Val Glu 1825 1830 1835 1840 Gly His Gly Pro Pro Leu Ser Pro Ala Ile Arg Val Gln Glu Val Ala 1845 1850 1855 Trp Lys Leu Ser Ser Asn Arg Glu Arg His Val Pro Met Cys Glu Asp 1860 1865 1870 Leu Glu Leu Arg Arg Asp Ser Gly Ser Ala Gly Thr Gln Ala His Cys 1875 1880 1885 Leu Leu Leu Arg Lys Ala Asn Pro Ser Arg Cys His Ser Arg Glu Ser 1890 1895 1900 Gln Ala Ala Met Ala Gly Gln Glu Glu Thr Ser Gln Asp Glu Thr Tyr 1905 1910 1915 1920 Glu Val Lys Met Asn His Asp Thr Glu Ala Cys Ser Glu Pro Ser Leu 1925 1930 1935 Leu Ser Thr Glu Met Leu Ser Tyr Gln Asp Asp Glu Asn Arg Gln Leu 1940 1945 1950 Thr Leu Pro Glu Glu Asp Lys Arg Asp Ile Arg Gln Ser Pro Lys Arg 1955 1960 1965 Gly Phe Leu Arg Ser Ala Ser Leu Gly Arg Arg Ala Ser Phe His Leu 1970 1975 1980 Glu Cys Leu Lys Arg Gln Lys Asp Arg Gly Gly Asp Ile Ser Gln Lys 1985 1990 1995 2000 Thr Val Leu Pro Leu His Leu Val His His Gln Ala Leu Ala Val Ala 2005 2010 2015 Gly Leu Ser Pro Leu Leu Gln Arg Ser His Ser Pro Ala Ser Phe Pro 2020 2025 2030 Arg Pro Phe Ala Thr Pro Pro Ala Thr Pro Gly Ser Arg Gly Trp Pro 2035 2040 2045 Pro Gln Pro Val Pro Thr Leu Arg Leu Glu Gly Val Glu Ser Ser Glu 2050 2055 2060 Lys Leu Asn Ser Ser Phe Pro Ser Ile His Cys Gly Ser Trp Ala Glu 2065 2070 2075 2080 Thr Thr Pro Gly Gly Gly Gly Ser Ser Ala Ala Arg Arg Val Arg Pro 2085 2090 2095 Val Ser Leu Met Val Pro Ser Gln Ala Gly Ala Pro Gly Arg Gln Phe 2100 2105 2110 His Gly Ser Ala Ser Ser Leu Val Glu Ala Val Leu Ile Ser Glu Gly 2115 2120 2125 Leu Gly Gln Phe Ala Gln Asp Pro Lys Phe Ile Glu Val Thr Thr Gln 2130 2135 2140 Glu Leu Ala Asp Ala Cys Asp Met Thr Ile Glu Glu Met Glu Ser Ala 2145 2150 2155 2160 Ala Asp Asn Ile Leu Ser Gly Gly Ala Pro Gln Ser Pro Asn Gly Ala 2165 2170 2175 Leu Leu Pro Phe Val Asn Cys Arg Asp Ala Gly Gln Asp Arg Ala Gly 2180 2185 2190 Gly Glu Glu Asp Ala Gly Cys Val Arg Ala Arg Gly Arg Pro Ser Glu 2195 2200 2205 Glu Glu Leu Gln Asp Ser Arg Val Tyr Val Ser Ser Leu 2210 2215 2220 <210> 2 <211> 2169 <212> PRT <213> Rat() <400> 2 Met Ile Arg Ala Phe Ala Gln Pro Ser Thr Pro Pro Tyr Gln Pro Leu 1 5 10 15 Ser Ser Cys Leu Ser Glu Asp Thr Glu Arg Lys Phe Lys Gly Lys Val 20 25 30 Val His Glu Ala Gln Leu Asn Cys Phe Tyr Ile Ser Pro Gly Gly Ser 35 40 45 Asn Tyr Gly Ser Pro Arg Pro Ala His Ala Asn Met Asn Ala Asn Ala 50 55 60 Ala Ala Gly Leu Ala Pro Glu His Ile Pro Thr Pro Gly Ala Ala Leu 65 70 75 80 Ser Trp Leu Ala Ala Ile Asp Ala Ala Arg Gln Ala Lys Leu Met Gly 85 90 95 Ser Ala Gly Asn Ala Thr Ile Ser Thr Val Ser Ser Thr Gln Arg Lys 100 105 110 Arg Gln Gln Tyr Gly Lys Pro Lys Lys Gln Gly Gly Thr Thr Ala Thr 115 120 125 Arg Pro Pro Arg Ala Leu Leu Cys Leu Thr Leu Lys Asn Pro Ile Arg 130 135 140 Arg Ala Cys Ile Ser Ile Val Glu Trp Lys Pro Phe Glu Ile Ile Ile 145 150 155 160 Leu Leu Thr Ile Phe Ala Asn Cys Val Ala Leu Ala Ile Tyr Ile Pro 165 170 175 Phe Pro Glu Asp Asp Ser Asn Ala Thr Asn Ser Asn Leu Glu Arg Val 180 185 190 Glu Tyr Leu Phe Leu Ile Ile Phe Thr Val Glu Ala Phe Leu Lys Val 195 200 205 Ile Ala Tyr Gly Leu Leu Phe His Pro Asn Ala Tyr Leu Arg Asn Gly 210 215 220 Trp Asn Leu Leu Asp Phe Ile Ile Val Val Val Gly Leu Phe Ser Ala 225 230 235 240 Ile Leu Glu Gln Ala Thr Lys Ala Asp Gly Ala Asn Ala Leu Gly Gly 245 250 255 Lys Gly Ala Gly Phe Asp Val Lys Ala Leu Arg Ala Phe Arg Val Leu 260 265 270 Arg Pro Leu Arg Leu Val Ser Gly Val Pro Ser Leu Gln Val Val Leu 275 280 285 Asn Ser Ile Ile Lys Ala Met Val Pro Leu Leu His Ile Ala Leu Leu 290 295 300 Val Leu Phe Val Ile Ile Ile Tyr Ala Ile Ile Gly Leu Glu Leu Phe 305 310 315 320 Met Gly Lys Met His Lys Thr Cys Tyr Asn Gln Glu Gly Ile Ile Asp 325 330 335 Val Pro Ala Glu Glu Asp Pro Ser Pro Cys Ala Leu Glu Thr Gly His 340 345 350 Gly Arg Gln Cys Gln Asn Gly Thr Val Cys Lys Pro Gly Trp Asp Gly 355 360 365 Pro Lys His Gly Ile Thr Asn Phe Asp Asn Phe Ala Phe Ala Met Leu 370 375 380 Thr Val Phe Gln Cys Ile Thr Met Glu Gly Trp Thr Asp Val Leu Tyr 385 390 395 400 Trp Met Gln Asp Ala Met Gly Tyr Glu Leu Pro Trp Val Tyr Phe Val 405 410 415 Ser Leu Val Ile Phe Gly Ser Phe Phe Val Leu Asn Leu Val Leu Gly 420 425 430 Val Leu Ser Gly Glu Phe Ser Lys Glu Arg Glu Lys Ala Lys Ala Arg 435 440 445 Gly Asp Phe Gln Lys Leu Arg Glu Lys Gln Gln Leu Glu Glu Asp Leu 450 455 460 Lys Gly Tyr Leu Asp Trp Ile Thr Gln Ala Glu Asp Ile Asp Pro Glu 465 470 475 480 Asn Glu Asp Glu Gly Met Asp Glu Asp Lys Pro Arg Asn Met Ser Met 485 490 495 Pro Thr Ser Glu Thr Glu Ser Val Asn Thr Glu Asn Val Ala Gly Gly 500 505 510 Asp Ile Glu Gly Glu Asn Cys Gly Ala Arg Leu Ala His Arg Ile Ser 515 520 525 Lys Ser Lys Phe Ser Arg Tyr Trp Arg Arg Trp Asn Arg Phe Cys Arg 530 535 540 Arg Lys Cys Arg Ala Ala Val Lys Ser Asn Val Phe Tyr Trp Leu Val 545 550 555 560 Ile Phe Leu Val Phe Leu Asn Thr Leu Thr Ile Ala Ser Glu His Tyr 565 570 575 Asn Gln Pro His Trp Leu Thr Glu Val Gln Asp Thr Ala Asn Lys Ala 580 585 590 Leu Leu Ala Leu Phe Thr Ala Glu Met Leu Leu Lys Met Tyr Ser Leu 595 600 605 Gly Leu Gln Ala Tyr Phe Val Ser Leu Phe Asn Arg Phe Asp Cys Phe 610 615 620 Ile Val Cys Gly Gly Ile Leu Glu Thr Ile Leu Val Glu Thr Lys Ile 625 630 635 640 Met Ser Pro Leu Gly Ile Ser Cys Trp Arg Cys Val Arg Leu Leu Arg 645 650 655 Ile Phe Lys Ile Thr Arg Tyr Trp Asn Ser Leu Ser Asn Leu Val Ala 660 665 670 Ser Leu Leu Asn Ser Leu Arg Ser Ile Ala Ser Leu Leu Leu Leu Leu 675 680 685 Phe Leu Phe Ile Ile Ile Phe Ser Leu Leu Gly Met Gln Leu Phe Gly 690 695 700 Gly Lys Phe Asn Phe Asp Glu Met Gln Thr Arg Arg Ser Thr Phe Asp 705 710 715 720 Asn Phe Pro Gln Ser Leu Leu Thr Val Phe Gln Ile Leu Thr Gly Glu 725 730 735 Asp Trp Asn Ser Val Met Tyr Asp Gly Ile Met Ala Tyr Gly Gly Pro 740 745 750 Ser Phe Pro Gly Met Leu Val Cys Ile Tyr Phe Ile Ile Leu Phe Ile 755 760 765 Ser Pro Asn Tyr Ile Leu Leu Asn Leu Phe Leu Ala Ile Ala Val Asp 770 775 780 Asn Leu Ala Asp Ala Glu Ser Leu Thr Ser Ala Gln Lys Glu Glu Glu 785 790 795 800 Glu Glu Lys Glu Arg Lys Lys Leu Ala Arg Thr Ala Ser Pro Glu Lys 805 810 815 Lys Gln Glu Val Met Glu Lys Pro Ala Val Glu Glu Ser Lys Glu Glu 820 825 830 Lys Ile Glu Leu Lys Ser Ile Thr Ala Asp Gly Glu Ser Pro Pro Thr 835 840 845 Thr Lys Ile Asn Met Asp Asp Leu Gln Pro Ser Glu Asn Glu Asp Lys 850 855 860 Ser Pro His Ser Asn Pro Asp Thr Ala Gly Glu Glu Asp Glu Glu Glu 865 870 875 880 Pro Glu Met Pro Val Gly Pro Arg Pro Arg Pro Leu Ser Glu Leu His 885 890 895 Leu Lys Glu Lys Ala Val Pro Met Pro Glu Ala Ser Ala Phe Phe Ile 900 905 910 Phe Ser Pro Asn Asn Arg Phe Arg Leu Gln Cys His Arg Ile Val Asn 915 920 925 Asp Thr Ile Phe Thr Asn Leu Ile Leu Phe Phe Ile Leu Leu Ser Ser 930 935 940 Ile Ser Leu Ala Ala Glu Asp Pro Val Gln His Thr Ser Phe Arg Asn 945 950 955 960 His Ile Leu Phe Tyr Phe Asp Ile Val Phe Thr Thr Ile Phe Thr Ile 965 970 975 Glu Ile Ala Leu Lys Met Thr Ala Tyr Gly Ala Phe Leu His Lys Gly 980 985 990 Ser Phe Cys Arg Asn Tyr Phe Asn Ile Leu Asp Leu Leu Val Val Ser 995 1000 1005 Val Ser Leu Ile Ser Phe Gly Ile Gln Ser Ser Ala Ile Asn Val Val 1010 1015 1020 Lys Ile Leu Arg Val Leu Arg Val Leu Arg Pro Leu Arg Ile Asn Arg 1025 1030 1035 1040 Ala Lys Gly Leu Lys His Val Val Gln Cys Val Phe Val Ala Ile Arg 1045 1050 1055 Thr Ile Gly Asn Ile Val Ile Val Thr Thr Leu Leu Gln Phe Met Phe 1060 1065 1070 Ala Cys Ile Gly Val Gln Leu Phe Lys Gly Lys Leu Tyr Thr Cys Ser 1075 1080 1085 Asp Ser Ser Lys Gln Thr Glu Ala Glu Ser Lys Gly Asn Tyr Ile Thr 1090 1095 1100 Tyr Lys Thr Gly Glu Val Asp His Pro Ile Ile Gln Pro Arg Ser Trp 1105 1110 1115 1120 Glu Asn Ser Lys Phe Asp Phe Asp Asn Val Leu Ala Ala Met Met Ala 1125 1130 1135 Leu Phe Thr Val Ser Thr Phe Glu Gly Trp Pro Glu Leu Leu Tyr Arg 1140 1145 1150 Ser Ile Asp Ser His Thr Glu Asp Lys Gly Pro Ile Tyr Asn Tyr Arg 1155 1160 1165 Val Glu Ile Ser Ile Phe Phe Ile Ile Tyr Ile Ile Ile Ile Ala Phe 1170 1175 1180 Phe Met Met Asn Ile Phe Val Gly Phe Val Ile Val Thr Phe Gln Glu 1185 1190 1195 1200 Gln Gly Glu Gln Glu Tyr Lys Asn Cys Glu Leu Asp Lys Asn Gln Arg 1205 1210 1215 Gln Cys Val Glu Tyr Ala Leu Lys Ala Arg Pro Leu Pro Arg Tyr Ile 1220 1225 1230 Pro Lys Asn Gln His Gln Tyr Lys Val Trp Tyr Val Val Asn Ser Thr 1235 1240 1245 Tyr Phe Glu Tyr Leu Met Phe Val Leu Ile Leu Leu Asn Thr Ile Cys 1250 1255 1260 Leu Ala Met Gln His Tyr Gly Gln Ser Cys Leu Phe Lys Ile Ala Met 1265 1270 1275 1280 Asn Ile Leu Asn Met Leu Phe Thr Gly Leu Phe Thr Val Glu Met Ile 1285 1290 1295 Leu Lys Leu Ile Ala Phe Lys Pro Lys His Tyr Phe Cys Asp Ala Trp 1300 1305 1310 Asn Thr Phe Asp Ala Leu Ile Val Val Gly Ser Ile Val Asp Ile Ala 1315 1320 1325 Ile Thr Glu Val His Pro Ala Glu His Thr Gln Cys Ser Pro Ser Met 1330 1335 1340 Ser Ala Glu Glu Asn Ser Arg Ile Ser Ile Thr Phe Phe Arg Leu Phe 1345 1350 1355 1360 Arg Val Met Arg Leu Val Lys Leu Leu Ser Arg Gly Glu Gly Ile Arg 1365 1370 1375 Thr Leu Leu Trp Thr Phe Ile Lys Ser Phe Gln Ala Leu Pro Tyr Val 1380 1385 1390 Ala Leu Leu Ile Val Met Leu Phe Phe Ile Tyr Ala Val Ile Gly Met 1395 1400 1405 Gln Val Phe Gly Lys Ile Ala Leu Asn Asp Thr Thr Glu Ile Asn Arg 1410 1415 1420 Asn Asn Asn Phe Gln Thr Phe Pro Gln Ala Val Leu Leu Leu Phe Arg 1425 1430 1435 1440 Cys Ala Thr Gly Glu Ala Trp Gln Asp Ile Met Leu Ala Cys Met Pro 1445 1450 1455 Gly Lys Lys Cys Ala Pro Glu Ser Glu Pro Ser Asn Ser Thr Glu Gly 1460 1465 1470 Glu Thr Pro Cys Gly Ser Ser Phe Ala Val Phe Tyr Phe Ile Ser Phe 1475 1480 1485 Tyr Met Leu Cys Ala Phe Leu Ile Ile Asn Leu Phe Val Ala Val Ile 1490 1495 1500 Met Asp Asn Phe Asp Tyr Leu Thr Arg Asp Trp Ser Ile Leu Gly Pro 1505 1510 1515 1520 His His Leu Asp Glu Phe Lys Arg Ile Trp Ala Glu Tyr Asp Pro Glu 1525 1530 1535 Ala Lys Gly Arg Ile Lys His Leu Asp Val Val Thr Leu Leu Arg Arg 1540 1545 1550 Ile Gln Pro Pro Leu Gly Phe Gly Lys Leu Cys Pro His Arg Val Ala 1555 1560 1565 Cys Lys Arg Leu Val Ser Met Asn Met Pro Leu Asn Ser Asp Gly Thr 1570 1575 1580 Val Met Phe Asn Ala Thr Leu Phe Ala Leu Val Arg Thr Ala Leu Arg 1585 1590 1595 1600 Ile Lys Thr Glu Gly Asn Leu Glu Gln Ala Asn Glu Glu Leu Arg Ala 1605 1610 1615 Ile Ile Lys Lys Ile Trp Lys Arg Thr Ser Met Lys Leu Leu Asp Gln 1620 1625 1630 Val Val Pro Pro Ala Gly Asp Asp Glu Val Thr Val Gly Lys Phe Tyr 1635 1640 1645 Ala Thr Phe Leu Ile Gln Glu Tyr Phe Arg Lys Phe Lys Lys Arg Lys 1650 1655 1660 Glu Gln Gly Leu Val Gly Lys Pro Ser Gln Arg Asn Ala Leu Ser Leu 1665 1670 1675 1680 Gln Ala Gly Leu Arg Thr Leu His Asp Ile Gly Pro Glu Ile Arg Arg 1685 1690 1695 Ala Ile Ser Gly Asp Leu Thr Ala Glu Glu Glu Leu Asp Lys Ala Met 1700 1705 1710 Lys Glu Ala Val Ser Ala Ala Ser Glu Asp Asp Ile Phe Arg Arg Ala 1715 1720 1725 Gly Gly Leu Phe Gly Asn His Val Ser Tyr Tyr Gln Ser Asp Ser Arg 1730 1735 1740 Ser Asn Phe Pro Gln Thr Phe Ala Thr Gln Arg Pro Leu His Ile Asn 1745 1750 1755 1760 Lys Thr Gly Asn Asn Gln Ala Asp Thr Glu Ser Pro Ser His Glu Lys 1765 1770 1775 Leu Val Asp Ser Thr Phe Thr Pro Ser Ser Tyr Ser Ser Thr Gly Ser 1780 1785 1790 Asn Ala Asn Ile Asn Asn Ala Asn Asn Thr Ala Leu Gly Arg Phe Pro 1795 1800 1805 His Pro Ala Gly Tyr Ser Ser Thr Val Ser Thr Val Glu Gly His Gly 1810 1815 1820 Pro Pro Leu Ser Pro Ala Val Arg Val Gln Glu Ala Ala Trp Lys Leu 1825 1830 1835 1840 Ser Ser Lys Arg Cys His Ser Arg Glu Ser Gln Gly Ala Thr Val Ser 1845 1850 1855 Gln Asp Met Phe Pro Asp Glu Thr Arg Ser Ser Val Arg Leu Ser Glu 1860 1865 1870 Glu Val Glu Tyr Cys Ser Glu Pro Ser Leu Leu Ser Thr Asp Ile Leu 1875 1880 1885 Ser Tyr Gln Asp Asp Glu Asn Arg Gln Leu Thr Cys Leu Glu Glu Asp 1890 1895 1900 Lys Arg Glu Ile Gln Pro Cys Pro Lys Arg Ser Phe Leu Arg Ser Ala 1905 1910 1915 1920 Ser Leu Gly Arg Arg Ala Ser Phe His Leu Glu Cys Leu Lys Arg Gln 1925 1930 1935 Lys Asp Gln Gly Gly Asp Ile Ser Gln Lys Thr Ala Leu Pro Leu His 1940 1945 1950 Leu Val His His Gln Ala Leu Ala Val Ala Gly Leu Ser Pro Leu Leu 1955 1960 1965 Gln Arg Ser His Ser Pro Ser Thr Phe Pro Arg Pro Arg Pro Thr Pro 1970 1975 1980 Pro Val Thr Pro Gly Ser Arg Gly Arg Pro Leu Gln Pro Ile Pro Thr 1985 1990 1995 2000 Leu Arg Leu Glu Gly Ala Glu Ser Ser Glu Lys Leu Asn Ser Ser Phe 2005 2010 2015 Pro Ser Ile His Cys Ser Ser Trp Ser Glu Glu Thr Thr Ala Cys Ser 2020 2025 2030 Gly Gly Ser Ser Met Ala Arg Arg Ala Arg Pro Val Ser Leu Thr Val 2035 2040 2045 Pro Ser Gln Ala Gly Ala Pro Gly Arg Gln Phe His Gly Ser Ala Ser 2050 2055 2060 Ser Leu Val Glu Ala Val Leu Ile Ser Glu Gly Leu Gly Gln Phe Ala 2065 2070 2075 2080 Gln Asp Pro Lys Phe Ile Glu Val Thr Thr Gln Glu Leu Ala Asp Ala 2085 2090 2095 Cys Asp Met Thr Ile Glu Glu Met Glu Asn Ala Ala Asp Asn Ile Leu 2100 2105 2110 Ser Gly Gly Ala Gln Gln Ser Pro Asn Gly Thr Leu Leu Pro Phe Val 2115 2120 2125 Asn Cys Arg Asp Pro Gly Gln Asp Arg Ala Val Val Pro Glu Asp Glu 2130 2135 2140 Ser Cys Val Tyr Ala Leu Gly Arg Gly Arg Ser Glu Glu Ala Leu Pro 2145 2150 2155 2160 Asp Ser Arg Ser Tyr Val Ser Asn Leu 2165

Claims

1. A method for regulating calcium ion influx in mammalian cardiomyocytes, wherein the mammal is a rat or mouse, the method comprising modifying a serine residue in the ESSE of the L-type calcium channel protein of the mammal, specifically modifying the serine residue at position 2009 in the ESSE at positions 2007-2010 of the amino acid sequence corresponding to SEQ ID No. 2, the method being a method for in vitro regulation of calcium ion influx in mammalian cardiomyocytes for non-therapeutic purposes, wherein the modification involves mutating the serine residue to isoleucine or alanine.

2. Use of the reagent for modifying L-type calcium channel protein in the preparation of an in vitro reagent for regulating calcium ion influx in mammalian cardiomyocytes, wherein the mammal is a rat or mouse, and the modification is a modification of the serine in the ESSE of the L-type calcium channel protein of the mammal, specifically a modification of the serine at position 2009 in the ESSE corresponding to positions 2007-2010 of the amino acid sequence of SEQ ID No. 2, and the modification is a mutation of the serine to isoleucine or alanine.

3. A mammalian L-type calcium channel protein, wherein the mammal is a rat, characterized in that, The L-type calcium channel protein sequence is the ESSE sequence of amino acid positions 2007-2010 in SEQ ID No. 2, where the serine at position 2009 is mutated to isoleucine or alanine.

Citation Information

Patent Citations

  • Recombinant cell, method for screening L-type calcium channel conditioning agent, application of reagent in preparation of drug, and drug composition

    CN107815438A

  • Use of p27KIP1 for the prevention and treatment of heart failure

    US20110086089A1

  • Nucleic acid molecules encoding human kinase and phosphatase homologues and uses therefor

    US6500628B1