A genetically engineered bacterium and its application

Abstract

The present invention discloses a genetically engineered bacterium, which is an engineered bacterium constructed by expressing CYP gene, ferredoxin gene, ferredoxin reductase gene and dehydrogenase gene in cells; wherein, the amino acid sequence encoded by the CYP gene is as shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.9 or SEQ ID NO.11. The present invention also discloses the application of the genetically engineered bacterium in the preparation of calcifediol and / or calcitriol. When the engineered bacterium of the present invention is applied to the synthesis of calcifediol and calcitriol, the yields are significantly improved. When it is applied to industrial production, the cost is lower, and the reaction has high specificity, mild reaction conditions and environmental friendliness, meeting the industrial production requirements of calcifediol and calcitriol.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a genetically engineered bacterium and its application in the synthesis of calcidiol and calcitriol. Background Art

[0002] Calcitriol, also known as calciol and dihydrocholecalciferol, is the active form of vitamin D3 in the human body and is also a hormone in the body, playing an important role in regulating the concentrations of blood calcium and blood phosphorus. Calcitriol was developed by Roche and was launched in Switzerland in 1978 and first registered in China in 1988. Calcitriol increases the absorption of calcium ions in the intestine, thereby increasing the calcium level in the blood, and can also increase the release of calcium in the bone to increase the blood calcium level. According to its mechanism of action, it can be clinically used to treat hypocalcemia, hypoparathyroidism (adults), osteomalacia, rickets (infants and young children), chronic kidney disease, renal osteopathy, osteoporosis, and prevent osteoporosis caused by glucocorticoids. The chemical structural formula of calcitriol is shown as follows:

[0003]

[0004] Currently, the synthesis of calcitriol mainly uses chemical synthesis and microbial fermentation methods. Chemical synthesis needs to consider regioselectivity and stereoselectivity to specifically introduce hydroxyl groups at positions C1 and C25, with a relatively high reaction difficulty and a complex process. For example, in chemical synthesis, starting from vitamin D as the raw material, it requires multiple steps such as esterification protection, cyclization, oxidation, ring opening, and purification. Additionally, multiple steps of group protection and deprotection are required, using photochemical reactions, ring opening, and isomerization. The steps are cumbersome, the separation and purification are complex, and the yield is relatively low, at about 10%.

[0005] Calcifediol, also known as 25-hydroxyvitamin D3 [25(OH)VD3], is a biologically active derivative of vitamin D3. The concentration of 25-hydroxyvitamin D3 in human plasma tissue is within a stable range, namely 10 - 40 ng / mL. The metabolism of 25(OH)VD3 in the human body is regulated by the body's calcium balance. When the demand for calcium ions increases, a large amount of 1α,25(OH)VD3 needs to be produced, and the rate of subsequent 1α-hydroxylation of 25(OH)VD3 also increases. When calcium is abundant and the demand decreases, 25(OH)VD3 is mainly degraded through 24-hydroxylation. Animal experiments have shown that calcifediol has obvious effects on metabolic bone diseases such as osteoporosis, rickets, and osteomalacia. It can also be used to treat hypocalcemia caused by hemodialysis. It can also be used as a raw material for health foods and feed additives, and has a wide range of applications in the fields of health foods, pharmaceuticals, and feed additives. Currently, calcifediol can be synthesized by chemical methods, but chemical synthesis methods have disadvantages such as many reaction steps, low conversion rates, and complex separation and purification processes, which are not conducive to large-scale industrial production. In recent years, with the screening of enzyme-producing strains and the development of genetically engineered bacteria, the microbial conversion of vitamin D3 to produce calcifediol has become a research hotspot. The production of calcifediol by microbial conversion has the advantages of low production cost, high reaction specificity, mild reaction conditions, and environmental friendliness, and is the research focus for future production of calcifediol.

[0006] To solve many problems in chemical synthesis, it is very necessary to develop new production processes. There are reports in the prior art that vitamin D3 (VD3) can be used as a substrate, and through the catalysis of P450 enzymes, a hydroxyl group can be selectively introduced at the C25 position to synthesize calcifediol (25-hydroxyvitamin D3); or two hydroxyl groups can be selectively introduced at the C1 and C25 positions to synthesize calcitriol (1α,25-dihydroxyvitamin D3). For example, Biochem. Biophys. Res. Commun., 320, 156 - 164, 2004 reported that P450 enzyme (CYP105A1) can catalyze VD3 to obtain calcifediol and calcitriol, as shown below:

[0007]

[0008] It was reported in Patent US 8,148,119B2 that VDH (VD hydroxylase, Sequence 2) derived from Pseudonocardia autotrophica could catalyze the synthesis of calcidiol from VD3. By co-expressing VDH and thcCD (ferredoxin gene thcC and ferredoxin reductase gene thcD) in Rhodococcus erythropolis or Escherichia coli, the yield of calcidiol was increased. However, the yield of calcidiol was still very low. It can be seen from Figures 10 and 11 of this patent that the yield should be less than 250 μg / mL (calculated based on a 50% conversion rate of VD3). Tamura et al. (ChemBioChem 2013, 14, 2284-2291) modified the P450 enzyme derived from Pseudonocardia autotrophica (performed mutations such as T107A) and expressed it heterologously in Rhodococcus. By adding nisin to increase the cell membrane permeability and reduce the mass transfer resistance of the substrate VD3, the yield of calcidiol obtained by catalyzing VD3 for 2 hours could reach 573 μg / mL. However, the yield of calcidiol still needed to be improved. Journal of Fermentation and Bioengineering, Vol. 78, No. 5, 380-382, 1994 reported that Amycolata autotrophica microorganisms could catalyze VD3 to obtain both calcidiol and calcitriol simultaneously. Among them, the highest amount of calcidiol was 137 μg / ml, and the highest amount of calcitriol was 24.3 μg / ml. The yield of calcitriol was very low.

[0009] Therefore, finding a suitable method to increase the yields of calcidiol and calcitriol is the key to the industrial production of calcidiol and calcitriol. Summary of the Invention

[0010] The technical problem to be solved by the present invention is to provide a genetically engineered bacterium and its application, aiming at the defects such as low yield in the existing methods for preparing calcidiol and calcitriol. When the genetically engineered bacterium of the present invention is applied to the synthesis of calcidiol and / or calcitriol, the yields of the obtained calcidiol and / or calcitriol are significantly increased. When it is applied to industrial production, the cost is lower, the reaction specificity is high, the reaction conditions are mild, and it is environmentally friendly, meeting the industrial production requirements of calcidiol and calcitriol.

[0011] The present inventors have studied a large number of CYPs (cytochrome P450 superfamily) in the prior art and screened a large number of electron transfer systems. After a large number of experiments, it was unexpectedly found that when a specific CYP was combined with a specific electron transfer system and a dehydrogenase was transformed into a specific host bacterium, the resulting genetically engineered bacterium was used to produce calcidiol and / or calcitriol, and the yield of the obtained calcidiol and / or calcitriol was very high.

[0012] In a first aspect of the present invention, there is provided a genetically engineered bacterium, which is an engineered bacterium constructed by expressing a CYP gene, a ferredoxin gene, a ferredoxin reductase gene, and a dehydrogenase gene in a cell; wherein, the amino acid sequence encoded by the CYP gene is as shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.9 or SEQ ID NO.11, or a sequence having 98%, preferably 99% or more homology with it (i.e., the foregoing sequences).

[0013] Preferably, the amino acid sequence encoded by the ferredoxin gene is as shown in SEQ ID NO.21 or a sequence having 98%, preferably 99% or more homology with it, and the amino acid sequence encoded by the ferredoxin reductase gene is as shown in SEQ ID NO.23 or a sequence having 98%, preferably 99% or more homology with it.

[0014] Preferably, the amino acid sequence encoded by the ferredoxin gene is as shown in SEQ ID NO.25 or a sequence having 98%, preferably 99% or more homology with it, and the amino acid sequence encoded by the ferredoxin reductase gene is as shown in SEQ ID NO.27 or a sequence having 98%, preferably 99% or more homology with it.

[0015] In the present invention, the sequence having 98%, preferably 99% or more homology means that there are several amino acid or nucleotide insertions, deletions or substitutions in the sequence. Since it is well known in the art that a ferredoxin can be paired with more than one ferredoxin reductase, those skilled in the art can infer that a ferredoxin can be paired with any one of the ferredoxin reductases having an amino acid / nucleotide sequence homology of 98% or more, preferably 99% or more.

[0016] In the present invention, the order of these genes generally does not need to be limited.

[0017] Preferably, the cell is Escherichia coli, preferably E. coli BL21(DE3), C2566 or Rosseta.

[0018] Preferably, the nucleotide sequence of the CYP gene is as shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.10 or SEQ ID NO.12.

[0019] Preferably, the nucleotide sequence of the ferredoxin gene is as shown in SEQ ID NO.22 or a sequence having 98%, preferably 99% or more homology therewith, and the nucleotide sequence of the ferredoxin reductase gene is as shown in SEQ ID NO.24 or a sequence having 98%, preferably 99% or more homology therewith.

[0020] Preferably, the nucleotide sequence of the ferredoxin gene is as shown in SEQ ID NO.26 or a sequence having 98%, preferably 99% or more homology therewith, and the nucleotide sequence of the ferredoxin reductase gene is as shown in SEQ ID NO.28 or a sequence having 98%, preferably 99% or more homology therewith.

[0021] Preferably, the dehydrogenase generally includes an enzyme capable of reducing coenzyme NAD + to carry out a reduction reaction, such as glucose dehydrogenase, alcohol dehydrogenase and / or formate dehydrogenase. Among them, the glucose dehydrogenase can preferably be the glucose dehydrogenase with the NCBI accession number NP_388275.1; among them, the alcohol dehydrogenase can preferably be the alcohol dehydrogenase with the Genbank accession number BAN05992.1; among them, the formate dehydrogenase can preferably be the formate dehydrogenase with the Genbank accession number XP_001525545.1.

[0022] Preferably, in the genetically engineered bacterium, the CYP gene, the ferredoxin gene, the ferredoxin reductase gene and the dehydrogenase gene are located on a recombinant expression vector, or the CYP gene, the ferredoxin gene, the ferredoxin reductase gene and the dehydrogenase gene are integrated into the genome.

[0023] Preferably, the backbone of the recombinant expression vector is plasmid pBAD, pRSFDuet1, pACYCDuet1, pET21a and / or pET28a.

[0024] Preferably, the CYP gene, the ferredoxin gene, the ferredoxin reductase gene and the dehydrogenase gene are located on the same recombinant expression vector.

[0025] Preferably, the CYP gene, the ferredoxin gene, the ferredoxin reductase gene and the dehydrogenase gene are located on different recombinant expression vectors, preferably on two or three recombinant expression vectors.

[0026] In a preferred embodiment of the present invention, the CYP gene and the ferredoxin gene are located on the same recombinant expression vector, and are constructed into, for example, pRSFDuet1-CYP6-AciFdx; the ferredoxin reductase gene and the dehydrogenase gene are located on another recombinant expression vector, and are constructed into, for example, pACYCDuet1-AciFdR-GDH; in addition, another recombinant expression vector such as pBAD-CYP6 can be included to increase the expression level of CYP6; in addition, the promoter of the expression cassette of the dehydrogenase gene, such as the T7 promoter (generally the promoter is located upstream of the gene, but if there are other genes upstream, it is downstream of other genes), can be further deleted on the recombinant expression vector containing the ferredoxin reductase gene and the dehydrogenase gene (for example, pACYCDuet1-AciFdR-GDH), for example, constructed into pACYCDuet1-AciFdR-GDH-DT7 to reduce the expression of the dehydrogenase gene.

[0027] In a preferred embodiment of the present invention, the CYP gene and the dehydrogenase gene are located on the same recombinant expression vector, and the ferredoxin gene and the ferredoxin reductase gene are located on another recombinant expression vector.

[0028] In a preferred embodiment of the present invention, the CYP gene, the ferredoxin gene and the ferredoxin reductase gene are located on the same recombinant expression vector, and the dehydrogenase gene is located on another recombinant expression vector.

[0029] In a preferred embodiment of the present invention, the CYP gene is located on a recombinant expression vector, and is constructed into, for example, pBAD-CYP6 or pRSFDuet1-CYP6, and the dehydrogenase gene, the ferredoxin gene and the ferredoxin reductase gene are located on another recombinant expression vector.

[0030] Preferably, the dehydrogenase gene is a low-expression dehydrogenase gene.

[0031] In the present invention, the "low expression" has the meaning commonly understood in the art, generally referring to an expression level lower than the normal level.

[0032] The second aspect of the present invention provides a gene combination, which contains a CYP gene, a ferredoxin gene, a ferredoxin reductase gene and a dehydrogenase gene; wherein, the amino acid sequence encoded by the CYP gene is as shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.9 or SEQ ID NO.11 or a sequence having 98% preferably 99% or more homology therewith.

[0033] Preferably, the amino acid sequence encoded by the ferredoxin gene is as shown in SEQ ID NO.21 or a sequence having 98%, preferably 99% or more homology thereto, and the amino acid sequence encoded by the ferredoxin reductase gene is as shown in SEQ ID NO.23 or a sequence having 98%, preferably 99% or more homology thereto.

[0034] Preferably, the amino acid sequence encoded by the ferredoxin gene is as shown in SEQ ID NO.25 or a sequence having 98%, preferably 99% or more homology thereto, and the amino acid sequence encoded by the ferredoxin reductase gene is as shown in SEQ ID NO.27 or a sequence having 98%, preferably 99% or more homology thereto.

[0035] In the present invention, the order of these genes generally does not need to be limited.

[0036] Preferably, the CYP gene, the ferredoxin gene, the ferredoxin reductase gene and the dehydrogenase gene are located on the same recombinant expression vector.

[0037] Preferably, the recombinant expression vector is a multi-recombinant expression vector, preferably a dual-recombinant expression vector or a triple-recombinant expression vector, and the CYP gene, the ferredoxin gene, the ferredoxin reductase gene and the dehydrogenase gene are located on different recombinant expression vectors, preferably on two or three recombinant expression vectors.

[0038] In a preferred embodiment of the present invention, the CYP gene and the ferredoxin gene are located on the same recombinant expression vector, such as pRSFDuet1-CYP6-AciFdx; the ferredoxin reductase gene and the dehydrogenase gene are located on another recombinant expression vector, such as pACYCDuet1-AciFdR-GDH; in addition, another recombinant expression vector such as pBAD-CYP6 may be included to increase the expression level of CYP6; in addition, the promoter of the expression cassette of the dehydrogenase gene, such as the T7 promoter (generally the promoter is located upstream of the gene, but if there are other genes upstream of it, it is downstream of other genes), may be deleted from the recombinant expression vector containing the ferredoxin reductase gene and the dehydrogenase gene (such as pACYCDuet1-AciFdR-GDH), such as constructing pACYCDuet1-AciFdR-GDH-DT7 to reduce the expression of the dehydrogenase gene.

[0039] In a preferred embodiment of the present invention, the CYP gene and the dehydrogenase gene are located on the same recombinant expression vector, and the ferredoxin gene and the ferredoxin reductase gene are located on another recombinant expression vector.

[0040] In a preferred embodiment of the present invention, the CYP gene, the ferredoxin gene, and the ferredoxin reductase gene are located on the same recombinant expression vector, and the dehydrogenase gene is located on another recombinant expression vector.

[0041] In a preferred embodiment of the present invention, the CYP gene is located on a recombinant expression vector, such as pBAD-CYP6 or pRSFDuet1-CYP6; the dehydrogenase gene, the ferredoxin gene, and the ferredoxin reductase gene are located on another recombinant expression vector.

[0042] In the present invention, the multiple recombinant expression vectors generally refer to the expression of multiple genes on multiple recombinant expression vectors in the same host.

[0043] Preferably, the backbone of the recombinant expression vector is plasmid pBAD, pRSFDuet1, pACYCDuet1, pET21a, and / or pET28a.

[0044] Preferably, the nucleotide sequence of the CYP gene is preferably as shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.10, or SEQ ID NO.12.

[0045] Preferably, the nucleotide sequence of the ferredoxin gene is as shown in SEQ ID NO.22 or a sequence having 98% preferably 99% or more homology thereto, and the nucleotide sequence of the ferredoxin reductase gene is as shown in SEQ ID NO.24 or a sequence having 98% preferably 99% or more homology thereto.

[0046] Preferably, the nucleotide sequence of the ferredoxin gene is as shown in SEQ ID NO.26 or a sequence having 98% preferably 99% or more homology thereto, and the nucleotide sequence of the ferredoxin reductase gene is as shown in SEQ ID NO.28 or a sequence having 98% preferably 99% or more homology thereto.

[0047] Preferably, the dehydrogenase is glucose dehydrogenase, alcohol dehydrogenase, and / or formate dehydrogenase. Among them, the glucose dehydrogenase can preferably be the glucose dehydrogenase with the NCBI accession number NP_388275.1; among them, the alcohol dehydrogenase can preferably be the alcohol dehydrogenase with the Genbank accession number BAN05992.1; among them, the formate dehydrogenase can preferably be the formate dehydrogenase with the Genbank accession number XP_001525545.1.

[0048] Preferably, the dehydrogenase gene is a low-expression dehydrogenase gene.

[0049] The third aspect of the present invention provides a recombinant expression vector or a combination of recombinant expression vectors comprising the gene combination as described in the second aspect of the present invention.

[0050] The fourth aspect of the present invention provides the use of the gene combination as described in the second aspect of the present invention or the recombinant expression vector or the combination of recombinant expression vectors as described in the third aspect of the present invention in the preparation of a genetically engineered bacterium for producing calcidiol and / or calcitriol.

[0051] The fifth aspect of the present invention provides the use of the genetically engineered bacterium as described in the first aspect of the present invention in the preparation of calcidiol and / or calcitriol.

[0052] Preferably, in the above use, the genetically engineered bacterium catalyzes the hydroxylation reaction of vitamin D3 to obtain the calcidiol and / or calcitriol.

[0053] The sixth aspect of the present invention provides a method for preparing calcidiol and / or calcitriol, the preparation method comprising the following steps: in the presence of a reaction solvent, oxidized coenzyme NAD + / NADP + and a hydrogen donor, the genetically engineered bacterium as described in the first aspect of the present invention is used to catalyze the hydroxylation reaction of vitamin D3.

[0054] Preferably, the vitamin D3 is vitamin D3 pre-dissolved with a co-solvent; the co-solvent preferably includes one or more of DMSO, Tween 80, Triton X100, methanol, ethanol, and DMF (N,N-dimethylformamide).

[0055] Preferably, the preparation method further includes the step of adding hydroxypropyl-β-cyclodextrin to the reaction solvent before the hydroxylation reaction; the mass-volume percentage of hydroxypropyl-β-cyclodextrin in the reaction system is preferably 0.05%, 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, or 0.4%.

[0056] Preferably, the temperature of the reaction is 20-33 °C, such as 22 °C, 25 °C, 28 °C, or 30 °C. The inventors found during the experiment that when the temperature is not within the range specified in the present invention, the yield of the obtained product will decrease.

[0057] Preferably, the pH of the reaction is 6.0-8.0, such as 6.2, 6.6, 7.0, 7.4, or 7.8. The inventors found during the experiment that when the pH is not within the range specified in the present invention, the yield of the obtained product will decrease.

[0058] Preferably, the enzyme activity concentration of the genetically engineered bacterium is 4750 U / L to 94900 U / L, preferably 14940 U / L to 18980 U / L, such as 17420 U / L.

[0059] Preferably, the concentration of vitamin D3 is 0.5 g / L - 3 g / L, such as 1.0 g / L, 1.2 g / L, 1.4 g / L, 1.6 g / L or 1.8 g / L. The inventors found during the experiment that when the concentration of VD3 is too high, it cannot be dissolved or may inhibit the enzyme activity due to substrate, and the reaction is incomplete; while when the concentration of VD3 is too low, the yield of the obtained product is also very low.

[0060] Preferably, the NAD + / NADP + , the hydrogen donor and vitamin D3 are added to the reaction system by a batch addition method.

[0061] Preferably, the molar ratio of NAD + / NADP + to the vitamin D3 is 0.001:1 to 0.5:1, such as 0.1:1.

[0062] Preferably, the genetically engineered bacterium exists in the form of a bacterial sludge of the genetically engineered bacterium or an extract of the bacterial sludge of the genetically engineered bacterium.

[0063] Preferably, the hydrogen donor is glucose, isopropanol or formate; more preferably, when the dehydrogenase expressed in the genetically engineered bacterium is alcohol dehydrogenase, the hydrogen donor is isopropanol; when the dehydrogenase expressed in the genetically engineered bacterium is glucose dehydrogenase, the hydrogen donor is glucose; when the dehydrogenase expressed in the genetically engineered bacterium is formate dehydrogenase, the hydrogen donor is formate.

[0064] In one aspect of the present invention, a crude enzyme solution is also provided, which can be obtained by washing, homogenizing and breaking the genetically engineered bacterium described in the first aspect of the present invention. In a preferred embodiment of the present invention, the engineered bacterium can be washed twice with 0.1 M pH 7.4 phosphate buffer, and then homogenized and broken under low temperature and high pressure according to the ratio of engineered bacterium: buffer (i.e., 0.1 M pH 7.4 phosphate buffer) = 1:5 (w / v). The precipitate is removed by centrifugation of the broken solution, and the supernatant obtained is the crude enzyme solution containing various recombinant enzymes.

[0065] In the present invention, the CYP is Cytochrome P450 oxidase.

[0066] The positive and progressive effects of the present invention are as follows:

[0067] When the genetically engineered bacterium of the present invention is applied to the synthesis of calcifediol and calcitriol, the yields of the obtained calcifediol and / or calcitriol are both significantly increased. When it is applied to industrial production, the cost is lower, and the reaction has high specificity, mild reaction conditions, and environmental friendliness, meeting the industrial production requirements of calcifediol and calcitriol. In a preferred embodiment of the present invention, when the strain is applied to the synthesis of calcifediol, the yield can reach 1.024 g / L; in another preferred embodiment of the present invention, when the strain is applied to the synthesis of calcitriol, the yield can reach 0.719 g / L; in another preferred embodiment of the present invention, by adding the substrate vitamin D3, NAD + / NADP + , hydrogen donor and in a batchwise addition manner, the yield of calcifediol can reach 5.9 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 It is a graph of the time and concentration of the synthesis of calcifediol by the batchwise addition method of the substrate.

[0069] Figure 2 It is the detection result after reacting for 6 hours in the synthesis of calcifediol by the batchwise addition method of the substrate.

[0070] Figure 3 It is the spectrum of the VD3 reference substance in part 9.6 of Example 9.

[0071] Figure 4 It is the spectrum of the calcifediol reference substance in part 9.6 of Example 9.

[0072] Figure 5 It is the spectrum of the calcitriol reference substance in part 9.6 of Example 9. DETAILED DESCRIPTION OF THE INVENTION

[0073] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the described examples. The experimental methods without specific conditions noted in the following examples are carried out according to conventional methods and conditions, or selected according to the product instructions.

[0074] pET21a, pET28a, pRSFDuet1, pACYCDuet1, pBAD were purchased from Novagen; DpnI enzyme, NdeI enzyme, HindIII enzyme were purchased from Thermo Fisher; ExnaseⅡ enzyme was purchased from Nanjing Novozymes Biotechnology Co., Ltd.; E. coli BL21(DE3) competent cells were purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.; NAD + / NADH was purchased from Shenzhen Bontai Bioengineering Co., Ltd.; plasmid extraction kit was purchased from Shanghai Bioengineering Co., Ltd.; vitamin D3 (VD3) was purchased from Shanghai Demo Pharmaceutical Technology Co., Ltd.; calcifediol and calcitriol were purchased from the National Standard Material Network.

[0075] The HPLC analysis method of the product is:

[0076] Chromatographic conditions: Poroshell EC-C18 (4.0 μm, 4.6 × 150 mm); detection wavelength: 265 nm; flow rate: 1 mL / min; column temperature: 35°C; injection volume: 10 μL. Gradient elution program: 0–8 min, H₂O:acetonitrile = 85:15 (v / v); 8–20 min, H₂O:acetonitrile = 0:100 (v / v); 20–21 min, H₂O:acetonitrile = 85:15 (v / v); 21–27 min, H₂O:acetonitrile = 85:15 (v / v).

[0077] Example 1 Screening of Cytochrome P450 Enzymes (CYP, Cytochrome P450 proteins)

[0078] 1.1 Acquisition and expression of CYP

[0079] CYP genes were synthesized based on the gene sequences encoding the cytochrome P450 enzymes listed in Table 1 below (SEQ ID NOs. 2, 4, 6, 8, 10, 12, 14, and 16, respectively, with amino acid sequences as shown in SEQ ID NOs. 1, 3, 5, 7, 9, 11, 13, and 15). The gene synthesis company was Suzhou Jinweizhi Biotechnology Co., Ltd. (Building C3, Bionano Technology Park, 218 Xinghu Street, Suzhou Industrial Park).

[0080] Table 1

[0081]

[0082] LB liquid culture medium composition: peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L, dissolved in deionized water and fixed to volume, sterilized at 121 °C for 20 min, and set aside.

[0083] The synthesized CYP genes were connected to the pET28a vector, with the enzyme cutting sites NdeI & HindIII, and the enzyme-linked vectors were transformed into the host E. coli BL21 (DE3) competent cells to obtain the engineered strain containing the CYP gene.

[0084] After the engineered bacteria containing the CYP gene were activated by streak plating on a petri dish, single colonies were picked and inoculated into 5 ml of LB liquid medium containing 50 μg / ml kanamycin, and cultured with shaking at 37°C for 12 h. Transferred at an inoculation amount of 2% (v / v) to 50 ml of fresh LB liquid medium also containing 50 μg / ml kanamycin, and cultured with shaking at 37°C until OD 600 When it reached about 0.8, IPTG was added to a final concentration of 0.1 mM, and induced at 25°C for 22 h. After the culture was completed, the culture solution was centrifuged at 10,000 rpm for 10 min, the supernatant was discarded, and the cells were collected to obtain the cytochrome P450 enzyme cell paste.

[0085] Example 2 Acquisition and Expression of CYP Electron Transfer Chain Genes

[0086] During the CYP reaction, NAD(P)H is required to provide electrons, and at the same time an electron transfer chain is required to transfer electrons. According to the gene sequences SEQ ID NO.18, 20, 22, 24, 26, 28 of the enzymes shown by the amino acid sequences of SEQ ID NO.17, 19, 21, 23, 25, 27 in Table 2 below, 3 sets of CYP electron transfer chain genes were synthesized by total gene synthesis. Among them, Adx (adrenodoxin) is adrenodoxin, AdR (adrenodoxin reductase) is adrenodoxin reductase, Fdx (ferredoxin) is ferredoxin, and FdR (ferredoxin reductase) is ferredoxin reductase.

[0087] Table 2

[0088] Enzyme number Gene source NCBI accession number Amino acid sequence Nucleotide sequence boAdx Bos taurus BAA00362.1 SEQ ID NO.17 SEQ ID NO.18 boAdR Bos taurus BAA11921.1 SEQ ID NO.19 SEQ ID NO.20 AciFdx Acinetobacter sp.OC4 BAE78451.1 SEQ ID NO.21 SEQ ID NO.22 AciFdR Acinetobacter sp.OC4 BAE78453.1 SEQ ID NO.23 SEQ ID NO.24 SpiFdx Spinacia oleracea AAA34028.1 SEQ ID NO.25 SEQ ID NO.26 SpiFdR Spinacia oleracea CAA30791.1 SEQ ID NO.27 SEQ ID NO.28

[0089] The synthesized genes related to the electron transfer chain were ligated to the pET21a vector at the restriction enzyme sites NdeI&HindIII, and the ligated vector was transformed into the host E. coli BL21(DE3) competent cells to obtain engineered strains containing each gene.

[0090] After the engineered bacteria containing each electron transfer chain gene were activated by streak plating on a petri dish, single colonies were picked and inoculated into 5 ml of LB liquid medium containing 100 μg / ml ampicillin, and cultured with shaking at 37°C for 12 h. Transferred at an inoculation amount of 2% (v / v) to 50 ml of fresh LB liquid medium also containing 100 μg / ml ampicillin, and cultured with shaking at 37°C until OD 600When it reached about 0.8, IPTG was added to a final concentration of 0.1 mM, and induction culture was carried out at 25 °C for 16 h. After the culture was completed, the culture solution was centrifuged at 10000 rpm for 10 min, the supernatant was discarded, and the bacterial cells were collected, thus obtaining the bacterial muds of boAdx and boAdR, AciFdx and AciFdR, and SpiFdx and SpiFdR respectively.

[0091] Example 3 Acquisition and Expression of Glucose Dehydrogenase (GDH) Gene

[0092] According to the glucose dehydrogenase gene sequence from Bacillus subtilis 168 (NCBI accession number NP_388275.1), the glucose dehydrogenase gene was fully synthesized.

[0093] The glucose dehydrogenase gene was ligated to pET21a at the restriction enzyme sites NdeI&HindIII. The ligated vector was transformed into the host E. coli BL21(DE3) competent cells to obtain an engineered strain containing the glucose dehydrogenase gene. After the engineered bacteria containing the glucose dehydrogenase gene were activated by streaking on a petri dish, a single colony was picked and inoculated into 5 ml of LB liquid medium containing 100 μg / ml ampicillin, and cultured with shaking at 37 °C for 12 h. Transferred to 50 ml of fresh LB liquid medium containing 100 μg / ml ampicillin at an inoculation amount of 2% (v / v), and shaken at 37 °C until OD 600 When it reached about 0.8, IPTG was added to a final concentration of 0.5 mM, and induction culture was carried out at 18 °C for 16 h. After the culture was completed, the culture solution was centrifuged at 10000 rpm for 10 min, the supernatant was discarded, and the bacterial cells (i.e., the glucose dehydrogenase bacterial mud) were collected and stored in a -20 °C refrigerator for later use.

[0094] Example 4 In Vitro Synthesis of Calcifediol and Calcitriol by Cytochrome P450 Enzyme

[0095] The bacterial muds of each cytochrome P450 enzyme described in Example 1, the bacterial muds of SpiFdx and SpiFdR prepared in Example 2, and the bacterial mud of glucose dehydrogenase prepared in Example 3 were each washed twice with 0.1 M phosphate buffer at pH 7.4. Then, the bacterial muds were homogenized and crushed under low temperature and high pressure according to the ratio of bacterial mud:buffer (i.e., 0.1 M phosphate buffer at pH 7.4) = 1:5 (w / v). The precipitate was removed by centrifugation of the crushed solution, and the resulting supernatant was the crude enzyme solution containing each recombinant enzyme.

[0096] CO difference spectroscopy was used to determine the concentration of crude enzyme solutions of each CYP (cytochrome P450). Method: Transfer 1 mL of crude enzyme solution of each cytochrome P450 to two 10 mL centrifuge tubes, labeled as control and sample tubes. Bring the sample to a fume hood. First, fill one centrifuge tube with water. Insert the CO2 line into the water and adjust the three-way valve to a CO outflow rate of approximately one bubble per second. Add 1 mg of sodium dithionite powder to each control and sample tubes, inverting them repeatedly to completely dissolve the sodium dithionite and mix thoroughly. Transfer the liquid from each control and sample tube to a cuvette and scan the absorbance at 400-500 nm on a UV spectrophotometer.

[0097] Enzyme concentration calculation:

[0098] C P450 =(ΔA450-ΔA490) / (ε 450 L)

[0099] in:

[0100] C P450 , the concentration of P450 enzyme in the measured sample, unit: nmol / mL;

[0101] ΔA450, A450 样品 -A450 对照 The difference between

[0102] ΔA490, A490 样品 -A490 对照 The difference between

[0103] ε 450 , P450 molar absorption coefficient is 0.091mL / nmol -1 cm -1 .

[0104] L, optical path, 1 cm.

[0105] The measurement results are shown in Table 3 below:

[0106] 80 μL of each CYP crude enzyme solution, 100 μL of SpiFdx crude enzyme solution, 50 μL of SpiFdR crude enzyme solution, 15 μL of GDH crude enzyme solution, and the final concentration of substrate VD3 was 100 mg / L (pre-dissolved in methanol, the concentration of VD3 mother solution was 10 g / L), NAD + The final concentration was 1 mM, and the final concentration of glucose was 3 mM. Finally, 0.1 M pH 7.4 phosphate buffer was added to a final volume of 300 μL. The reaction was incubated at 30°C and 220 rpm for 6 h. The reaction solution was extracted three times with equal volumes of ethyl acetate, and the concentrations of substrate and product were analyzed by HPLC. The results of in vitro calcifediol / calcitriol synthesis by each CYP are shown in Table 3.

[0107] Table 3

[0108]

[0109]

[0110] *: Theoretical yields of calcifediol or calcitriol when the CYP crude enzyme solution concentration is calibrated to that of the CYP6 crude enzyme solution

[0111] As can be seen from Table 3, only CYP6 can simultaneously obtain relatively high yields of calcifediol and calcitriol. Among them, when the CYP4 crude enzyme solution concentration is calibrated to that of the CYP6 crude enzyme solution, the yield of calcifediol synthesized by CYP6 is comparable to that of CYP4, and at the same time, the yield of calcitriol synthesized by CYP6 is significantly higher than that of CYP4. In addition, when the CYP1, CYP2, and CYP5 crude enzyme solution concentrations are calibrated to that of the CYP6 crude enzyme solution, the yields of calcifediol synthesized by CYP1, CYP2, and CYP5 are significantly higher than that of CYP4.

[0112] Example 5 Selection of the CYP6 electron transfer system

[0113] The volumes of each component in the 300 μL reaction system are as shown in Example 4, but the SpiFdx and SpiFdR bacterial slurries in the reaction system are replaced with the AciFdx and AciFdR bacterial slurries prepared in Example 2, or replaced with the boAdx and boAdR bacterial slurries prepared in Example 2, and the reaction is carried out at 30 °C and 220 rpm for 6 h. When different electron transfer systems are used for CYP6, the results of in vitro synthesis of calcifediol / calcitriol are shown in Table 4.

[0114] Table 4

[0115] Calcifediol (mg / L) Calcitriol (mg / L) AciFdx + AciFdR 40.9 42.2 BoAdx + BoAdR 14.6 0 SpiFdx + SpiFdR 35.6 28.8

[0116] As can be seen from Table 4, AciFdx and AciFdR can obtain relatively high yields of calcifediol and calcitriol. Therefore, AciFdx and AciFdR are selected as the electron transfer system.

[0117] Example 6 Construction of the KXRG strain

[0118] In order to construct CYP6, AciFdx, AciFdR, and GDH in one strain, the present invention uses 2 dual-expression vectors to tandemly connect the four genes on two plasmids and co-express them in one host bacterium to construct the KXRG strain.

[0119] 6.1 Construction of the pRSFDuet1-CYP6-AciFdx plasmid

[0120] Using the original plasmid pET28a-CYP6 as a template and CYP6-F and CYP6-R as primers, the target fragment ΔCYP6 was amplified. Using the pRSFDuet1 plasmid as a template and RSF-1F and RSF-1R as primers, the vector fragment RSF1 with a 15-bp homologous arm at the 5' end and a 15-bp homologous arm at the 3' end with CYP6 and a 15-bp homologous arm at the 3' end and a 15-bp homologous arm at the 5' end with CYP6 was amplified by PCR. The PCR products were digested with Dpn1 at 37 °C for 2 hours. After the reaction was completed, ΔCYP6 and RSF1 were recombined with the recombinase Exnase II at 37 °C for 0.5 hours. The recombinant products were transformed into competent C2566 cells and spread on LB medium containing 50 μg / mL kanamycin and cultured overnight at 37 °C to obtain the BL21-pRSFDuet1-CYP6 transformant. The BL21-pRSFDuet1-CYP6 transformant was picked and inoculated into 5 ml of LB liquid medium containing 50 μg / mL kanamycin and cultured with shaking at 37 °C for 6 h. The pRSFDuet1-CYP6 plasmid was extracted using the plasmid extraction kit of Sangon Biotech (Shanghai) Co., Ltd. The above primers and their sequences are shown in Table 5 (F represents the forward primer and R represents the reverse primer).

[0121] Table 5

[0122] Primer name Sequence (5' to 3') CYP6-F CATATGGCACTGACCACCACCGGTAC (SEQ ID NO.29) CYP6-R AAGCTTAGGCCGGTGCACCCGGTGT (SEQ ID NO.30) Fdx-F GAAGGAGATATA CATATGGGTCAGATTACC (SEQ ID NO.31) Fdx-R CAGACTCGAGGGTACCAAGCTTACATCTGAA (SEQ ID NO.32) RSF-1F CACCGGCCTAAGCTTGCGGCCGCATAATGC (SEQ ID NO.33) RSF-1R GGTCAGTGCCATATGGGATCCTGGCTGTGG (SEQ ID NO.34) RSF-2F ATGTAAGCTTGGTACCCTCGAGTCTGGTAA (SEQ ID NO.35) RSF-2R TAATCTGACCCATATGTATATCTCCTTC (SEQ ID NO.36)

[0123] The PCR amplification system is shown in Table 6 below:

[0124] Table 6 PCR amplification system

[0125] Reagent Dosage (μL) 2×PCR buffer (containing high-fidelity enzyme) 25 Forward primer 1 Reverse primer 1 Template 1 Deionized water 22

[0126] The PCR amplification program is shown in Table 7 below:

[0127] Table 7 PCR amplification program

[0128]

[0129] Using the original plasmid pET21a-AciFdx as a template and Fdx-F and Fdx-R as primers, the target fragment ΔAciFdx was amplified. Using the pRSFDuet1-CYP6 plasmid extracted above as a template and RSF-2F and RSF-2R as primers, a vector fragment RSF2 with a 15-bp homologous arm at the 5'-end to the 3'-end of AciFdx and a 15-bp homologous arm at the 3'-end to the 5'-end of AciFdx was amplified by PCR. The PCR product was digested with Dpn1 enzyme at 37°C for 2 hours. After the reaction, the ΔAciFdx and RSF2 fragments were recombined with the recombinase ExnaseⅡ at 37°C for 0.5 hour. The recombinant product was transformed into competent C2566 cells and spread on LB medium containing 50 μg / mL kanamycin and cultured overnight at 37°C to obtain the BL21-pRSFDuet1-CYP6-AciFdx transformant. A single colony of BL21-pRSFDuet1-CYP6-AciFdx transformant was inoculated into 5 ml of LB liquid medium containing 50 μg / mL kanamycin and cultured with shaking at 37°C for 6 h. The plasmid was extracted to obtain the pRSFDuet1-CYP6-AciFdx plasmid. The plasmid extraction was performed using the plasmid extraction kit from Sangon Biotech (Shanghai) Co., Ltd. The primers and their sequences are shown in Table 5. The PCR amplification system and amplification program are the same as those in Tables 6 and 7.

[0130] 6.2 Construction of pACYCDuet1-AciFdR-GDH plasmid

[0131] Using the original plasmid pET21a-AciFdR as a template and FdR-F and FdR-R as primers, the target fragment ΔAciFdR was amplified. Using the pACYCDuet1 plasmid as a template and ACYC-1F and ACYC-1R as primers, a vector fragment ACYC1 with a 15-bp homologous arm at the 5'-end to the 3'-end of AciFdR and a 15-bp homologous arm at the 3'-end to the 5'-end of AciFdR was amplified by PCR. The amplified ΔAciFdR and ACYC1 fragments were digested with Dpn1 enzyme at 37°C for 2 hours. After the reaction, the ΔAciFdR and ACYC1 were recombined with the recombinase ExnaseⅡ at 37°C for 0.5 hour. The recombinant product was transformed into competent C2566 cells and spread on LB medium containing 50 μg / mL chloramphenicol and cultured overnight at 37°C to obtain the BL21-pACYCDuet1-AciFdR transformant. A single colony of BL21-pACYCDuet1-AciFdR transformant was inoculated into 5 ml of LB liquid medium containing 50 μg / mL chloramphenicol and cultured with shaking at 37°C for 6 h. The pACYCDuet1-AciFdR plasmid was extracted. The plasmid extraction was performed using the plasmid extraction kit from Sangon Biotech (Shanghai) Co., Ltd. The primers and their sequences are shown in Table 8. The PCR amplification system and amplification program are the same as those in Tables 6 and 7.

[0132] Table 8

[0133] Primer name Sequence (5' to 3') FdR-F CCAGGATCCGAATTCCATATGCAGACCATTG (SEQ ID NO.37) FdR-R CTGTTCGACTTAAGAAGCTTAACCCATCAG (SEQ ID NO.38) GDH-F GAAGGAGATATA CATATGTATCCGGATTTA(SEQ ID NO.39) GDH-R CTTTACCAGACTCGAGTCGAGTCATTAACCGC(SEQ ID NO.40) ACYC-1F GGTTAAGCTT CTTAAGTCGAACAGAAAG(SEQ ID NO.41) ACYC-1R TCTGCATATG GAATTCGGATCCTGGCT(SEQ ID NO.42) ACYC-2F AATGACTCGA CTCGAGTCTGGTAAAGAAAC(SEQ ID NO.43) ACYC-2R AATCCGGATA CATATGTATATCTCCTTC(SEQ ID NO.44)

[0134] Using pET21a-GDH as a template and GDH-F and GDH-R as primers, the target gene ΔGDH was amplified. Using the pACYCDuet1-AciFdR plasmid extracted above as a template and ACYC-2F and ACYC-2R as primers, a vector fragment ACYC2 with a 15-bp homologous arm at the 5' end and a 15-bp homologous arm at the 3' end with respect to the 3' end of GDH was amplified. The amplified ΔGDH and ACYC2 fragments were digested with Dpn1 enzyme at 37°C for 2 hours. After the reaction, ΔAciFdR and ACYC2 were recombined with the recombinase ExnaseⅡ at 37°C for 0.5 hour. The recombinant product was transformed into competent C2566 cells and spread on LB medium containing 50 μg / mL chloramphenicol, and cultured overnight at 37°C to obtain the BL21-pACYCDuet1-AciFdR-GDH transformant. A single colony of the BL21-pACYCDuet1-AciFdR-GDH transformant was inoculated into 5 ml of LB liquid medium containing 50 μg / mL chloramphenicol, shaken and cultured at 37°C for 6 h, and the plasmid was extracted to obtain the pACYCDuet1-AciFdR-GDH plasmid. The plasmid extraction was carried out using the plasmid extraction kit from Sangon Biotech (Shanghai). The PCR amplification system and amplification program were the same as those in Table 6 and Table 7. The primers and their sequences are shown in Table 8.

[0135] Construction of strain 6.3KXRG01

[0136] The above-prepared pRSFDuet1-CYP6-AciFdx and pACYCDuet1-AciFdR-GDH plasmids were co-transformed into the host E. coli BL21(DE3) competent cells, spread on LB medium containing 50 μg / ml kanamycin and 50 μg / ml chloramphenicol, and cultured overnight at 37°C to obtain the engineered strain KXRG01 containing four genes CYP6, AciFdx, AciFdR, and GDH.

[0137] A single colony of the engineered strain KXRG01 was inoculated into 5 ml of LB liquid medium containing 100 μg / ml ampicillin, 50 μg / ml kanamycin and 50 μg / ml chloramphenicol, shaken and cultured at 37°C for 12 h. Transferred to 50 ml of fresh LB liquid medium containing 50 μg / ml kanamycin and 50 μg / ml chloramphenicol at an inoculation amount of 2% (v / v), and shaken at 37°C until OD 600When it reaches about 0.8, add IPTG to a final concentration of 0.5 mM and induce culture at 22 °C for 22 h. After the culture is completed, centrifuge the culture solution at 10,000 rpm for 10 min, discard the supernatant, collect the bacterial cells (i.e., obtain the KXRG01 bacterial sludge), and store it in a -20 °C refrigerator for later use.

[0138] 6.4 Construction of KXRG02 Strain

[0139] Using the original plasmid pET28a-CYP6 as a template and CYP6-F2 and CYP6-R2 as primers, amplify the target fragment ΔCYP6-2. Using the pBAD plasmid as a template and BAD-F and BAD-R as primers, amplify the vector fragment BAD with a 15-bp homologous arm at the 5' end and the 3' end of CYP6 and a 15-bp homologous arm at the 3' end and the 5' end of CYP6. Digest the amplified ΔCYP6-2 and BAD fragments with Dpn1 enzyme at 37 °C for 2 h. After the reaction, recombine ΔCYP6-2 and BAD with the recombinase ExnaseⅡ at 37 °C for 0.5 h, and transform the recombinant product into C2566 competent cells. Coat them on an LB medium containing 100 μg / mL ampicillin and culture overnight at 37 °C to obtain the BL21-pBAD-CYP6 transformant. Pick the BL21-pBAD-CYP6 transformant and inoculate it into 5 ml of LB liquid medium containing 100 μg / mL ampicillin, culture it with shaking at 37 °C for 6 h, extract the plasmid, and obtain the pBAD-CYP6 plasmid. The plasmid extraction uses the plasmid extraction kit from Sangon Biotech (Shanghai). The primers and their sequences are shown in Table 9. The PCR amplification system and amplification program are the same as those in Tables 6 and 7.

[0140] Table 9

[0141] Primer Name Sequence (5' to 3') CYP6-F2 CATATGGCACTGACCACCACCG(SEQ ID NO.45) CYP6-R2 AAGCTTAGGCCGGTGCACCCGG(SEQ ID NO.46) BAD-F CACCGGCCTAAGCTTGGCTGTTTTGGCGGA(SEQ ID NO.47) BAD-R GGTCAGTGCCATATGGGATCCCCATCGATC(SEQ ID NO.48)

[0142] Co-transform the plasmids pRSFDuet1-CYP6-AciFdx, pACYCDuet1-AciFdR-GDH, and pBAD-CYP6 into the host E. coli BL21(DE3) competent cells, coat them on an LB medium containing 100 μg / mL ampicillin, 50 μg / ml kanamycin, and 50 μg / ml chloramphenicol, and culture overnight at 37 °C to obtain the genetically engineered bacterium KXRG02 with overexpressed CYP6.

[0143] Inoculate a single colony of the engineered strain KXRG02 into 5 ml of LB liquid medium containing 100 μg / ml ampicillin, 50 μg / ml kanamycin, and 50 μg / ml chloramphenicol, and culture it with shaking at 37 °C for 12 h. Transfer it to 50 ml of fresh LB liquid medium containing 100 μg / ml ampicillin, 50 μg / ml kanamycin, and 50 μg / ml chloramphenicol at an inoculation amount of 2% (v / v), and shake it at 37 °C until the OD 600 reaches about 0.8. Then add arabinose to a final concentration of 2 g / L and IPTG to a final concentration of 0.5 mM, and induce the culture at 22 °C for 22 h. After the culture is completed, centrifuge the culture solution at 10,000 rpm for 10 min, discard the supernatant, collect the bacterial cells (i.e., obtain the KXRG02 bacterial sludge), and store it in a -20 °C refrigerator for later use.

[0144] 6.5 Construction of the KXRG03 strain

[0145] Delete the T7 promoter of the GDH expression cassette on the pACYCDuet1-AciFdR-GDH plasmid to reduce the expression level of GDH. Specifically: Use the pACYCDuet1-AciFdR-GDH plasmid as a template and perform PCR with DT7-F and DT7-R as primers. The PCR amplification system and amplification program are the same as those in Table 6 and Table 7. The primers and their sequences are shown in Table 10.

[0146] Table 10

[0147] Primer Name Sequence (5' to 3') DT7-F CCGCATAATCCCATCTTAGTATATTAGTTAG(SEQ ID NO.49) DT7-R TACTAAGATGGGATTATGCGGCCGTGTACAA(SEQ ID NO.50)

[0148] Digest the PCR product with Dpn1 enzyme at 37 °C for 2 h. After the reaction is completed, transform the PCR product into competent C2566 cells, coat it on LB medium containing 100 μg / mL ampicillin, and culture it at 37 °C overnight. Pick the transformants and inoculate them into 5 ml of LB liquid medium containing 100 μg / mL ampicillin, and culture them with shaking at 37 °C for 6 h. Extract the plasmid to obtain the pACYCDuet1-AciFdR-GDH-DT7 plasmid. The plasmid extraction is carried out using the plasmid extraction kit from Sangon Biotech (Shanghai).

[0149] Co-transform the pRSFDuet1-CYP6-AciFdx, pACYCDuet1-AciFdR-GDH-DT7, and pBAD-CYP6 plasmids into the host E. coli BL21(DE3) competent cells, coat them on LB medium containing 100 μg / mL ampicillin, 50 μg / ml kanamycin, and 50 μg / ml chloramphenicol, and culture them at 37 °C overnight to obtain the genetically engineered strain KXRG03 with overexpressed CYP6 and downregulated GDH expression.

[0150] Inoculate a single colony of the engineered strain KXRG03 into 5 ml of LB liquid medium containing 100 μg / ml ampicillin, 50 μg / ml kanamycin, and 50 μg / ml chloramphenicol, and culture it with shaking at 37 °C for 12 h. Transfer it to 50 ml of fresh LB liquid medium containing 100 μg / ml ampicillin, 50 μg / ml kanamycin, and 50 μg / ml chloramphenicol at an inoculation amount of 2% (v / v), and shake it at 37 °C until the OD 600 reaches about 0.8. Then add arabinose to a final concentration of 2 g / L and IPTG to a final concentration of 0.5 mM, and induce the culture at 22 °C for 22 h. After the culture is completed, centrifuge the culture solution at 10,000 rpm for 10 min, discard the supernatant, collect the bacterial cells (i.e., obtain the KXRG03 bacterial sludge), and store it in a -20 °C refrigerator for later use.

[0151] Example 7 Determination of Bacterial Cell Enzyme Activity

[0152] Homogenize the KXRG01 bacterial sludge, KXRG02 bacterial sludge, and KXRG03 bacterial sludge in Example 6 with 50 mM phosphate buffer at pH 7.4 at a ratio of 1:10, centrifuge to collect the supernatant, and use it for enzyme activity determination.

[0153] In a 2.5 mL reaction system, add 100 μL of 125 mM glucose, 50 μL of 25 mM NADH, 100 μL of 25 mM MgCl2, 100 μL of 146 mM VD3, 100 μL of enzyme solution, 0.125 g of hydroxypropyl-β-cyclodextrin, and 2050 μL of 50 mM phosphate buffer at pH 7.4. React on a shaker at 30 °C and 200 rpm for 60 min. Take 200 μL of the reaction solution, add 400 μL of absolute ethanol, shake for 5 min, then add 400 μL of acetonitrile, centrifuge, filter the supernatant, and detect it by HPLC. Calculate the enzyme activity according to the standard curve of calcifediol. The results are shown in Table 10-1 below.

[0154] The definition of enzyme activity is: under specific conditions (30 °C, pH 7.4), the amount of enzyme required to convert 1 nanomole of substrate or produce 1 nanomole of product within 1 minute is one activity unit (U).

[0155] Table 10-1

[0156]

[0157]

[0158] Example 8 Synthesis of Calcifediol / Calcitriol by KXRG Strains

[0159] Weigh 2 g of the bacterial sludge of KXRG01, KXRG02, and KXRG03 prepared in Example 6 (it can be calculated from Example 7 that the enzyme activities of KXRG01, KXRG02, and KXRG03 are 747 U / g, 871 U / g, and 949 U / g of bacterial sludge respectively. Therefore, the enzyme activity concentrations of KXRG01, KXRG02, and KXRG03 in this example are 14,940 U / L, 17,420 U / L, and 18,980 U / L respectively), add the substrate VD3 to a final concentration of 1 g / L (pre-dissolved in methanol, the concentration of the VD3 mother liquor is 10 g / L), add glucose at 3 times the molar equivalent of the substrate (i.e., the final concentration is 1.4 g / L), add NAD at 0.1 times the molar equivalent of the substrate + (i.e., the final concentration is 0.17 g / L), and finally add 0.1 M PBS 7.4 to a final volume of 100 mL. React at 220 rpm and 28 °C for 14 h. The results are shown in Table 11.

[0160] As can be seen from Table 11, when using the three strains of KXRG01, KXRG02, and KXRG03, calcidiol with a relatively high yield can be synthesized, and the yields are all above 335 mg / L; at the same time, the three strains of KXRG01, KXRG02, and KXRG03 can all synthesize calcitriol with a relatively high yield, and the yields are all above 78 mg / L, and the yields of calcitriol synthesized by KXRG02 and KXRG03 are as high as above 152 mg / L. Among them, when using KXRG03 as a catalyst, the yields of calcidiol and calcitriol are the highest. Therefore, KXRG03 is selected as a catalyst for condition optimization in subsequent experiments.

[0161] Table 11

[0162] Calcifediol (mg / L) Calcitriol (mg / L) KXRG01 335 78 KXRG02 361 152 KXRG03 393 188

[0163] Example 9 Process Optimization of the Synthesis of Calcidiol / Calcitriol by KXRG03

[0164] 9.1 Selection of Cosolvent

[0165] Weigh 2 g of the KXRG03 bacterial sludge, add the substrate VD3 to a final concentration of 1 g / L (pre-dissolved in different cosolvents, the concentration of the VD3 mother liquor is 10 g / L), add glucose at 3 times the molar equivalent of the substrate (i.e., the final concentration is 1.4 g / L), add NAD at 0.1 times the molar equivalent of the substrate + (i.e., the final concentration is 0.17 g / L), and finally add 0.1 M PBS 7.4 to a final volume of 100 mL. React at 220 rpm and 28 °C for 14 h. The effects of different cosolvents on the synthesis of calcidiol / calcitriol are shown in Table 12.

[0166] As can be seen from Table 12, the solubilizing agents such as DMSO, Tween 80, Triton X100, methanol, ethanol, and DMF all have good effects. The yields of calcidiol are all above 105 mg / L, and the yields of calcitriol are all above 131 mg / L. Moreover, when using methanol, ethanol, or DMF, the yield of calcidiol is as high as above 335 mg / L, and the yield of calcitriol is as high as above 255 mg / L. Among them, when using methanol as the solubilizing agent, the yields of calcidiol and calcitriol are the highest. Therefore, methanol is selected as the solubilizing agent in subsequent experiments.

[0167] Table 12

[0168] Calcifediol (mg / L) Calcitriol (mg / L) DMSO 346 191 Tween 80 105 131 Triton X100 257 245 Methanol 389 267 Ethanol 335 255 DMF (N,N-Dimethylformamide) 367 259

[0169] 9.2 Selection of the Concentration of Hydroxypropyl-β-Cyclodextrin (HP-β-CD)

[0170] Weigh 2 g of KXRG03 bacterial sludge, add different concentrations of HP-β-CD (which acts as a solubilizing agent), add the substrate VD3 to a final concentration of 1 g / L (pre-dissolved in methanol, the concentration of the VD3 stock solution is 10 g / L), add glucose at 3 times the molar equivalent of the substrate (i.e., the final concentration is 1.4 g / L), add NAD at 0.1 times the molar equivalent of the substrate + (i.e., the final concentration is 0.17 g / L), and add 0.1 M PBS 7.4 to a final volume of 100 mL. React at 220 rpm and 28 °C for 14 h. The influence of the HP-β-CD concentration on the synthesis of calcidiol / calcitriol is shown in Table 13.

[0171] As can be seen from Table 13, the yields of calcidiol and calcitriol are already relatively high when the concentration of HP-β-CD is 0. When the concentration of HP-β-CD is increased, the yields of calcidiol and calcitriol also increase. When adding HP-β-CD at a final concentration of 0.25% (mass / volume ratio), the yields of calcidiol and calcitriol are the highest. Therefore, the addition amount of HP-β-CD at a final concentration of 0.25% is selected in subsequent experiments.

[0172] Table 13

[0173] HP-β-CD Concentration (%, mass / volume) Calcifediol (mg / L) Calcitriol (mg / L) 0 324 129 0.05 355 159 0.1 344 325 0.15 345 382 0.2 335 415 0.25 328 494 0.3 279 437 0.4 272 447

[0174] 9.3 Selection of Temperature

[0175] Weigh 2 g of KXRG03 bacterial sludge, add HP-β-CD at a final concentration of 0.25%, add the substrate VD3 to a final concentration of 1 g / L (pre-dissolved in methanol, the concentration of the VD3 stock solution is 10 g / L), add glucose at 3 times the molar equivalent of the substrate (i.e., the final concentration is 1.4 g / L), add NAD at 0.1 times the molar equivalent of the substrate +(i.e., the final concentration is 0.17 g / L), add 0.1 M PBS 7.4 buffer to a final volume of 100 mL. React at 220 rpm for 14 h under different temperature conditions. The effect of temperature on the synthesis of calcidiol / calcitriol is shown in Table 14.

[0176] As can be seen from Table 14, with the continuous increase of the reaction temperature, the yields of both calcidiol and calcitriol are relatively high; and when the temperature is 22 °C, the yields of calcidiol and calcitriol are the highest. Therefore, 22 °C is selected as the reaction temperature in subsequent experiments.

[0177] Table 14

[0178] Temperature (°C) Calcifediol (mg / L) Calcitriol (mg / L) 20 318 571 22 322 595 25 288 510 28 308 513 30 366 506 33 441 316

[0179] 9.4 Selection of pH

[0180] Weigh 2 g of KXRG03 bacterial sludge, add the substrate VD3 to a final concentration of 1 g / L (pre-dissolved in methanol, the concentration of the VD3 mother liquor is 10 g / L), add glucose at 3 times the molar equivalent of the substrate (i.e., the final concentration is 1.4 g / L), and add NAD at 0.1 times the molar equivalent of the substrate + (i.e., the final concentration is 0.17 g / L), add HP-β-CD with a final concentration of 0.25%, and add 0.1 M PBS with different pH values to a final volume of 100 mL. React at 220 rpm and 22 °C for 14 h under different pH conditions. The effect of the pH of the reaction system on the yield of calcidiol / calcitriol is shown in Table 15.

[0181] As can be seen from Table 15, with the continuous increase of pH, the yields of both calcidiol and calcitriol are relatively high, and when the pH is in the range of 6.2 - 8.0, the yields of calcidiol and calcitriol tend to be stable. The yield of calcidiol is basically in the range of 268 - 302 mg / L, and the yield of calcitriol is basically in the range of 458 - 622 mg / L. Among them, when the pH is 7.4, the yields of calcidiol and calcitriol are the highest. Therefore, pH 7.4 is selected as the reaction condition in subsequent experiments.

[0182] Table 15

[0183]

[0184]

[0185] 9.5 Selection of Substrate Concentration

[0186] Weigh 2 g of KXRG03 bacterial sludge, add different concentrations of the substrate VD3 (pre-dissolved in methanol, the concentration of the VD3 mother liquor is 10 g / L), add glucose at 3 times the molar equivalent of the substrate, and add NAD at 0.1 times the molar equivalent of the substrate +(i.e., the final concentration is 0.17 g / L), add HP-β-CD with a final concentration of 0.25%, and finally add 0.1 M PBS7.4 buffer to a final volume of 100 mL. React at 220 rpm and 22 °C for 14 h. The concentrations of synthesized calcifediol / calcitriol at different reaction substrate concentrations are shown in Table 16.

[0187] Table 16

[0188]

[0189] The results show that when the substrate concentration increases to more than 1.4 g / L, the amount of produced calcitriol decreases, while the amount of calcifediol increases, indicating that as the concentration increases, the product mainly exists in the form of calcifediol. When the concentration of substrate VD3 is 1.8 g / L, the concentration of glucose reaches 2.5 g / L, and the concentration of NAD + reaches 0.31 g / L, the yield of calcifediol is as high as 1024 mg / L; when the concentration of substrate VD3 is 1.4 g / L, the concentration of glucose reaches 2.0 g / L, and the concentration of NAD + reaches 0.24 g / L, the yield of calcitriol is as high as 719 mg / L.

[0190] 9.6 Synthesis of calcifediol by adding substrates in batches

[0191] Weigh 2 g of KXRG03 bacterial sludge, add HP-β-CD with a final concentration of 0.25%, and the substrate vitamin D3 is added in batches (this method was not used in the previous experiments). Specifically: each time, add VD3 with a final concentration of 2.5 g / L (prepared with methanol, the concentration of the VD3 stock solution is 50 g / L), and a total of 3 batches are added until the final concentration of VD3 reaches 7.5 g / L. Each time the substrate is added, add glucose 3 times the molar equivalent of the substrate (i.e., 0.35 g), and 0.1 times the molar equivalent of the substrate of NAD + (i.e., 0.043 g). Finally, add 0.1 M PBS7.4 buffer to a final volume of 100 mL. React at 220 rpm and 22 °C, and take samples regularly to detect the concentrations of the substrate and the product. The detection results after 6 hours of reaction are as Figure 2 , the retention time of 18.650 min is VD3, 10.840 min is calcifediol, and 9.040 min is calcitriol. Among them, the spectra of VD3, calcifediol, and calcitriol reference substances are as Figure 3 , 4 and 5. From Figure 3 - 5It can be seen that the retention time of the VD3 reference substance is 19.020 min, the retention time of the calcifediol reference substance is 10.920 min, and the retention time of the calcitriol reference substance is 9.078 min. It can be seen that under these synthesis conditions, the main product obtained is calcifediol, and the amount of calcitriol is very small. The results of the batchwise fed-batch synthesis of calcifediol are as Figure 1 shown. By adding VD3 in 3 batches, the yield of calcifediol continuously increases over time, and its yield can reach 5.9 g / L when the reaction time reaches 7 hours. SEQUENCE LISTING <110> Shanghai Yikele Bio-pharmaceutical Technology Co., Ltd. <120> A genetically engineered bacterium and its application <130> P19013608C <160> 50 <170> PatentIn version 3.5 <210> 1 <211> 210 <212> PRT <213> Streptomyces griseolus <400> 1 Met Thr Asp Thr Ala Thr Thr Pro Gln Thr Thr Asp Ala Pro Ala Phe 1 5 10 15 Pro Ser Asn Arg Ser Cys Pro Tyr Gln Leu Pro Asp Gly Tyr Ala Gln 20 25 30 Leu Arg Asp Thr Pro Gly Pro Leu His Arg Val Thr Leu Tyr Asp Gly 35 40 45 Arg Gln Ala Trp Val Val Thr Lys His Glu Ala Ala Arg Lys Leu Leu 50 55 60 Gly Asp Pro Arg Leu Ser Ser Asn Arg Thr Asp Asp Asn Phe Pro Ala 65 70 75 80 Thr Ser Pro Ala Phe Glu Ala Val Arg Glu Ser Pro Gln Ala Phe Ile 85 90 95 Gly Leu Asp Pro Pro Glu His Gly Thr Arg Arg Arg Met Thr Ile Ser 100 105 110 Glu Phe Thr Val Lys Arg Ile Lys Gly Met Arg Pro Glu Val Glu Glu 115 120 125 Val Val His Gly Phe Leu Asp Glu Met Leu Ala Ala Gly Pro Thr Ala 130 135 140 Asp Leu Val Ser Gln Phe Ala Leu Pro Val Pro Ser Met Val Ile Cys 145 150 155 160 Arg Leu Leu Gly Val Pro Tyr Ala Asp His Glu Phe Phe Gln Asp Ala 165 170 175 Ser Lys Arg Leu Val Gln Ser Thr Asp Ala Gln Ser Ala Leu Thr Ala 180 185 190 Arg Asn Asp Leu Ala Gly Tyr Leu Asp Gly Leu Ile Thr Gln Phe Gln 195 200 205 Thr Glu 210 <210> 2 <211> 1228 <212> DNA <213> Streptomyces griseolus <400> 2 catatgaccg ataccgcaac caccccgcag accacagatg caccggcatt tccgagcaat 60 cgtagctgtc cgtatcagct gccggatggt tatgcccagc tgcgtgatac cccaggtccg 120 ctgcatcgtg ttaccctgta tgatggtcgt caggcatggg ttgtgaccaa acatgaagca 180 gcacgtaaac tgctgggtga tccacgtctg tcttcaaatc gcactgatga taattttccg 240 gcaacaagcc cggcatttga agcagttcgt gaatctccgc aggcatttat tggtctggac 300 ccgccggaac atggtacacg tcgtcgtatg accattagtg aatttacagt taaacgtatt 360 aaaggtatgc gtccagaagt tgaagaagtt gttcatggtt ttctggatga aatgctggca 420 gcaggtccga ccgcagattt agtgagtcag tttgcactgc cggttccgag catggttatt 480 tgtcgcctgc tgggtgtgcc gtatgcagat catgaatttt tccaggatgc aagtaaacgt 540 ttagttcagt ctacagatgc acagtcagcc ctgacagcac gtaatgatct ggcaggttat 600 ctggatggtc tgattaccca gtttcagacc gaaccgggtg caggtctggt gggtgcactg 660 gtggcagatc agctggcaaa tggtgaaatt gatcgtgaag aactgattag caccgccatg 720 ctgctgctga ttgcaggtca tgaaaccaca gcaagtatga ccagcctgag tgttattacc 780 ctgctggatc atcctgaaca gtatgcagca ctgcgtgcag atcgcagcct ggttcctggt 840 gcagttgaag aactgctgcg ttatctggca attgcagata ttgcaggtgg tcgtgttgca 900 accgctgata ttgaagttga aggtcagctg attcgtgcag gtgaaggtgt tattgttgtt 960 aatagtattg ctaatcgtga tggtaccgtt tatgaagatc cggatgcact ggatattcat 1020 cgtagtgcac gtcatcatct ggcttttggt tttggtgttc atcagtgtct gggtcagaat 1080 ctggcacgcc tggaactgga agttattctg aatgcactga tggatcgtgt tccgaccctg 1140 cgtctggcag ttccggttga acagctggtt ctgcgtccgg gtactaccat tcagggtgtt 1200 aatgaactgc cggttacctg gtaagctt 1228 <210> 3 <211> 403 <212> PRT <213> Bacillus megaterium <400> 3 Met Asn Pro Lys Ala Val Lys Arg Glu Asn Arg Tyr Ala Asn Leu Ile 1 5 10 15 Pro Met Gln Glu Ile Lys Ser Val Glu Gln Gln Leu Tyr Pro Phe Asp 20 25 30 Ile Tyr Asn Ser Leu Arg Gln Glu Ala Pro Ile Arg Tyr Asp Glu Ser 35 40 45 Arg Asn Cys Trp Asp Val Phe Asp Tyr Glu Thr Val Lys Tyr Ile Leu 50 55 60 Lys Asn Pro Ser Leu Phe Ser Ser Lys Arg Ala Met Glu Glu Arg Gln 65 70 75 80 Glu Ser Ile Leu Met Met Asp Pro Pro Lys His Thr Lys Leu Arg Asn 85 90 95 Leu Val Asn Lys Ala Phe Thr Pro Arg Ala Ile Gln His Leu Glu Gly 100 105 110 His Ile Glu Glu Ile Ala Asp Tyr Leu Leu Asp Glu Val Ser Ser Lys 115 120 125 Glu Lys Phe Asp Ile Val Glu Asp Phe Ala Gly Pro Leu Pro Ile Ile 130 135 140 Val Ile Ala Glu Leu Leu Gly Val Pro Ile Gln Asp Arg Ala Leu Phe 145 150 155 160 Lys Lys Tyr Ser Asp Asp Leu Val Ser Gly Ala Glu Asn Asn Ser Asp 165 170 175 Glu Ala Phe Ala Lys Met Met Gln Lys Arg Asn Glu Gly Val Ile Phe 180 185 190 Leu Gln Gly Tyr Phe Lys Glu Ile Ile Ala Glu Arg Gln Gln Asn Lys 195 200 205 Gln Glu Asp Leu Ile Ser Leu Leu Leu Glu Ala Glu Ile Asp Gly Glu 210 215 220 His Leu Thr Glu Glu Glu Val Leu Gly Phe Cys Ile Leu Leu Leu Val 225 230 235 240 Ala Gly Asn Glu Thr Thr Thr Asn Leu Ile Thr Asn Gly Val Arg Tyr 245 250 255 Met Thr Glu Asp Val Asp Val Gln Asn Glu Val Arg Arg Asp Ile Ser 260 265 270 Leu Val Pro Asn Leu Val Glu Glu Thr Leu Arg Tyr Tyr Pro Pro Ile 275 280 285 Gln Ala Ile Gly Arg Ile Ala Ala Glu Asp Val Glu Leu Gly Glu Cys 290 295 300 Lys Ile Lys Arg Gly Gln Gln Val Ile Ser Trp Ala Ala Ser Ala Asn 305 310 315 320 Arg Asp Ser Ala Lys Phe Glu Trp Pro Asp Thr Phe Val Val His Arg 325 330 335 Lys Thr Asn Pro His Val Ser Phe Gly Phe Gly Ile His Phe Cys Leu 340 345 350 Gly Ala Pro Leu Ala Arg Met Glu Gly Lys Ile Ala Phe Thr Lys Leu 355 360 365 Leu Glu Lys Gly Gly Phe Ser Lys Val Gln Asn Gln Ser Leu Lys Pro 370 375 380 Ile Asp Ser Pro Phe Val Phe Gly Val Lys Lys Tyr Glu Ile Ala Phe 385 390 395 400 Asn Asn Ala <210> 4 <211> 1219 <212> DNA <213> Bacillus megaterium <400> 4 catatgaatc cgaaagccgt gaaacgcgaa aatcgctatg ccaacctgat tccgatgcag 60 gaaattaaaa gcgttgaaca gcagctgtat ccgtttgata tttataatag cctgcgtcag 120 gaagcaccga ttcgttatga tgaatcacgt aattgttggg atgtttttga ttatgaaaca 180 gttaaatata ttctgaaaaa tccgtcactg tttagctcta aacgtgcgat ggaagaacgc 240 caggaatcaa ttctgatgat ggacccgccg aaacacacca aactgcgtaa tctggttaat 300 aaagcgttta cccctcgtgc cattcagcat ctggaaggcc atattgaaga aatcgccgat 360 tatctgctgg atgaagtgag tagcaaagaa aaatttgata ttgttgaaga ttttgcaggt 420 ccgctgccga ttattgttat tgcggaactg ctgggcgttc cgattcagga tcgtgcgctg 480 tttaaaaaat atagcgatga tctggtgagc ggcgccgaaa ataattcaga tgaagcattt 540 gcaaaaatga tgcagaaacg taatgaaggt gtgatttttc tgcagggcta ttttaaagaa 600 attattgccg aacgtcagca gaataagcag gaagatctga ttagtctgct gctggaagcc 660 gaaattgatg gtgaacatct gacagaagaa gaagttctgg gtttttgtat tctgctgctg 720 gttgccggta atgaaaccac aaccaatctg attacaaatg gcgttcgtta tatgacggaa 780 gatgtcgatg ttcagaatga agtgcgccgt gatatttcac tggtgcctaa tttagttgaa 840 gaaacactga gatattatcc tcccattcag gcaataggta gaatcgcagc cgaagatgtt 900 gaattaggtg aatgtaaaat taaacgtggc cagcaggtga ttagctgggc ggcatctgca 960 aatcgtgata gcgcaaaatt tgaatggccg gatacctttg ttgttcatcg taaaaccaat 1020 ccgcatgtta gctttggttt tggcattcat ttttgtctgg gggcaccgct ggcgcgtatg 1080 gaaggcaaaa ttgcctttac caaactgtta gaaaaaggtg gtttttctaa agttcagaat 1140 cagagcctga aaccaattga tagcccgttt gttttcggtg tgaagaaata tgagatagca 1200 tttaataacg cgtaagctt 1219 <210> 5 <211> 507 <212> PRT <213> Mus musculus <400> 5 Met Thr Gln Ala Val Lys Leu Ala Ser Arg Val Phe His Arg Ile His 1 5 10 15 Leu Pro Leu Gln Leu Asp Ala Ser Leu Gly Ser Arg Gly Ser Glu Ser 20 25 30 Val Leu Arg Ser Leu Ser Asp Ile Pro Gly Pro Ser Thr Leu Ser Phe 35 40 45 Leu Ala Glu Leu Phe Cys Lys Gly Gly Leu Ser Arg Leu His Glu Leu 50 55 60 Gln Val His Gly Ala Ala Arg Tyr Gly Pro Ile Trp Ser Gly Ser Phe 65 70 75 80 Gly Thr Leu Arg Thr Val Tyr Val Ala Asp Pro Thr Leu Val Glu Gln 85 90 95 Leu Leu Arg Gln Glu Ser His Cys Pro Glu Arg Cys Ser Phe Ser Ser 100 105 110 Trp Ala Glu His Arg Arg Arg His Gln Arg Ala Cys Gly Leu Leu Thr 115 120 125 Ala Asp Gly Glu Glu Trp Gln Arg Leu Arg Ser Leu Leu Ala Pro Leu 130 135 140 Leu Leu Arg Pro Gln Ala Ala Ala Gly Tyr Ala Gly Thr Leu Asp Asn 145 150 155 160 Val Val Arg Asp Leu Val Arg Arg Leu Arg Arg Gln Arg Gly Arg Gly 165 170 175 Ser Gly Leu Pro Gly Leu Val Leu Asp Val Ala Gly Glu Phe Tyr Lys 180 185 190 Phe Gly Leu Glu Ser Ile Gly Ala Val Leu Leu Gly Ser Arg Leu Gly 195 200 205 Cys Leu Glu Ala Glu Val Pro Pro Asp Thr Glu Thr Phe Ile His Ala 210 215 220 Val Gly Ser Val Phe Val Ser Thr Leu Leu Thr Met Ala Met Pro Asn 225 230 235 240 Trp Leu His His Leu Ile Pro Gly Pro Trp Ala Arg Leu Cys Arg Asp 245 250 255 Trp Asp Gln Met Phe Ala Phe Ala Gln Arg His Val Glu Leu Arg Glu 260 265 270 Gly Glu Ala Ala Met Arg Asn Gln Gly Lys Pro Glu Glu Asp Met Pro 275 280 285 Ser Gly His His Leu Thr His Phe Leu Phe Arg Glu Lys Val Ser Val 290 295 300 Gln Ser Ile Val Gly Asn Val Thr Glu Leu Leu Leu Ala Gly Val Asp 305 310 315 320 Thr Val Ser Asn Thr Leu Ser Trp Thr Leu Tyr Glu Leu Ser Arg His 325 330 335 Pro Asp Val Gln Thr Ala Leu His Ser Glu Ile Thr Ala Gly Thr Arg 340 345 350 Gly Ser Cys Ala His Pro His Gly Thr Ala Leu Ser Gln Leu Pro Leu 355 360 365 Leu Lys Ala Val Ile Lys Glu Val Leu Arg Leu Tyr Pro Val Val Pro 370 375 380 Gly Asn Ser Arg Val Pro Asp Arg Asp Ile Arg Val Gly Asn Tyr Val 385 390 395 400 Ile Pro Gln Asp Thr Leu Val Ser Leu Cys His Tyr Ala Thr Ser Arg 405 410 415 Asp Pro Thr Gln Phe Pro Asp Pro Asn Ser Phe Asn Pro Ala Arg Trp 420 425 430 Leu Gly Glu Gly Pro Thr Pro His Pro Phe Ala Ser Leu Pro Phe Gly 435 440 445 Phe Gly Lys Arg Ser Cys Ile Gly Arg Arg Leu Ala Glu Leu Glu Leu 450 455 460 Gln Met Ala Leu Ser Gln Ile Leu Thr His Phe Glu Val Leu Pro Glu 465 470 475 480 Pro Gly Ala Leu Pro Ile Lys Pro Met Thr Arg Thr Val Leu Val Pro 485 490 495 Glu Arg Ser Ile Asn Leu Gln Phe Val Asp Arg 500 505 <210> 6 <211> 1531 <212> DNA <213> Mus musculus <400> 6 catatgaccc aggcagttaa actggcatca cgtgtttttc atcgtattca tctgccgctg 60 cagctggatg catcactggg tagccgcggt agcgaaagtg ttctgcgtag tctgagtgat 120 attccgggtc cgagcacact gtcattttta gcagaactgt tttgtaaagg tggtctgtcc 180 cgtctgcatg aactgcaggt tcatggtgca gcacgttatg gtccgatttg gagtggtagc 240 tttggtacac tgcgtaccgt ttatgttgca gatccgaccc tggttgaaca gctgctgcgt 300 caggaaagcc attgtcctga acgttgtagc ttttcttctt gggcagaaca tcgtcgccgt 360 catcagcgtg catgtggtct gctgacagca gatggtgaag aatggcagcg tctgcgtagt 420 ctgctggcac cgctgttact gcgtccgcag gcagcagcag gctatgcggg tacactggat 480 aatgttgttc gtgatctggt gcgccgcctg cgtcgtcagc gtggtcgtgg tagtggtctg 540 ccgggtctgg ttctggatgt tgcaggtgaa ttttataaat ttggtctgga aagcattggt 600 gcagttctgt taggtagccg tctgggttgt ctggaagccg aagttccgcc ggatacagaa 660 acctttattc atgcagttgg ttcagttttt gttagcaccc tgttaacaat ggcaatgccg 720 aattggttac atcatctgat tccgggtccg tgggcacgtc tgtgtcgtga ttgggatcag 780 atgtttgcat ttgcccagcg ccatgttgaa ttacgtgaag gtgaagcagc aatgcgtaat 840 cagggtaaac cagaagaaga tatgccgtct ggtcatcatc tgacccattt tctgtttcgt 900 gaaaaagtta gtgttcagag cattgttggt aatgttaccg aactgctgct ggcaggtgtt 960 gataccgtga gtaataccct gtcatggacc ctgtatgaac tgagtagaca tccggatgtt 1020 cagaccgctc tgcatagtga aattacagca ggtacacgtg gcagctgtgc acatccgcat 1080 ggtacagcgc tgagtcagct gccgctgctg aaagcagtga ttaaagaagt tctgcgtctg 1140 tatccggttg ttccgggtaa tagtcgtgtg ccggatcgtg atattcgtgt tggtaattat 1200 gttattccgc aggataccct ggttagtctg tgtcattatg ccacctcacg tgatccgacc 1260 cagtttcctg atccgaatag ttttaatccg gcccgttggc tgggtgaagg tccgaccccg 1320 catccgtttg ccagcctgcc gtttggtttt ggtaaacgta gctgtattgg tcgccgtctg 1380 gcagaactgg aactgcagat ggcactgagt cagattctga cccattttga agtgctgccg 1440 gaaccgggtg cactgccgat taaaccgatg acccgtacag ttctggttcc ggaacgtagt 1500 attaatctgc agtttgttga tcgttaagct t 1531 <210> 7 <211> 403 <212> PRT <213> Pseudonocardia autotrophica <400> 7 Met Ala Leu Thr Thr Thr Gly Thr Glu Gln His Asp Leu Phe Ser Gly 1 5 10 15 Thr Phe Trp Gln Asn Pro His Pro Ala Tyr Ala Ala Leu Arg Ala Glu 20 25 30 Asp Pro Val Arg Lys Leu Ala Leu Pro Asp Gly Pro Val Trp Leu Leu 35 40 45 Thr Arg Tyr Ala Asp Val Arg Glu Ala Phe Val Asp Pro Arg Leu Ser 50 55 60 Lys Asp Trp Arg His Thr Leu Pro Glu Asp Gln Arg Ala Asp Met Pro 65 70 75 80 Ala Thr Pro Thr Pro Met Met Ile Leu Met Asp Pro Pro Asp His Thr 85 90 95 Arg Leu Arg Lys Leu Val Gly Arg Ser Phe Thr Val Arg Arg Met Asn 100 105 110 Glu Leu Glu Pro Arg Ile Thr Glu Ile Ala Asp Gly Leu Leu Ala Gly 115 120 125 Leu Pro Thr Asp Gly Pro Val Asp Leu Met Arg Glu Tyr Ala Phe Gln 130 135 140 Ile Pro Val Gln Val Ile Cys Glu Leu Leu Gly Val Pro Ala Glu Asp 145 150 155 160 Arg Asp Asp Phe Ser Ala Trp Ser Ser Val Leu Val Asp Asp Ser Pro 165 170 175 Ala Asp Asp Lys Asn Ala Ala Met Gly Lys Leu His Gly Tyr Leu Ser 180 185 190 Asp Leu Leu Glu Arg Lys Arg Thr Glu Pro Asp Asp Ala Leu Leu Ser 195 200 205 Ser Leu Leu Ala Val Ser Asp Glu Asp Gly Asp Arg Leu Ser Gln Glu 210 215 220 Glu Leu Val Ala Met Ala Met Leu Leu Leu Ile Ala Gly His Glu Thr 225 230 235 240 Thr Val Asn Leu Ile Gly Asn Gly Val Leu Ala Leu Leu Thr His Pro 245 250 255 Asp Gln Arg Lys Leu Leu Ala Glu Asp Pro Ser Leu Ile Ser Ser Ala 260 265 270 Val Glu Glu Phe Leu Arg Phe Asp Ser Pro Val Ser Gln Ala Pro Ile 275 280 285 Arg Phe Thr Ala Glu Asp Val Thr Tyr Ser Gly Val Thr Ile Pro Ala 290 295 300 Gly Glu Met Val Met Leu Gly Leu Ala Ala Ala Asn Arg Asp Ala Asp 305 310 315 320 Trp Met Pro Glu Pro Asp Arg Leu Asp Ile Thr Arg Asp Ala Ser Gly 325 330 335 Gly Val Phe Phe Gly His Gly Ile His Phe Cys Leu Gly Ala Gln Leu 340 345 350 Ala Arg Leu Glu Gly Arg Val Ala Ile Gly Arg Leu Phe Ala Asp Arg 355 360 365 Pro Glu Leu Ala Leu Ala Val Gly Leu Asp Glu Leu Val Tyr Arg Glu 370 375 380 Ser Thr Leu Val Arg Gly Leu Ser Arg Met Pro Val Thr Met Gly Pro 385 390 395 400 Arg Ser Ala <210> 8 <211> 1219 <212> DNA <213> Pseudonocardia autotrophica <400> 8 catatggcac tgaccaccac cggtaccgaa cagcatgatt tatttagtgg taccttttgg 60 cagaatccgc atccggccta tgcagcactg cgtgctgaag atccggttcg taaactggca 120 ctgccggatg gtccggtttg gctgctgacc cgttatgcag atgttcgtga agcatttgtt 180 gatccgcgtc tgagcaaaga ttggcgtcat accctgccgg aagatcagcg tgcagatatg 240 ccggcaacac cgaccccgat gatgattctg atggacccgc cggatcatac ccgtctgcgt 300 aaactggttg gtcgtagctt taccgttcgt cgtatgaatg aactggaacc gcgtattact 360 gaaattgcag atggtctgct ggcaggtctg ccgaccgatg gtccggttga tctgatgcgt 420 gaatatgcat ttcagattcc ggttcaggtg atttgtgaac tgctgggtgt tccggcagaa 480 gatcgtgatg attttagcgc ctggagcagc gttctggttg atgatagccc ggcagatgat 540 aaaaatgcag caatgggtaa actgcatggt tatctgagtg atctgctgga acgtaaacgt 600 accgaaccgg atgatgcact gctgagcagc ctgctggcag ttagcgatga agatggtgat 660 cgtctgagcc aggaagaact ggttgctatg gcaatgctgc tgctgattgc aggtcatgaa 720 accaccgtta atctgattgg taatggtgtt ctggcactgc tgacccatcc ggatcagcgt 780 aaactgctgg cagaagatcc gtctctgata tctagtgccg ttgaggaatt tctgcgcttt 840 gatagccccg tgagtcaggc gccgatccgg tttactgctg aggatgtaac atatagcggc 900 gtgaccattc cggctggaga aatggtgatg ctgggccttg ccgcagcgaa ccgtgacgca 960 gattggatgc ccgaacctga ccgtctggat ataacgcggg atgcatcagg tggtgttttc 1020 tttggtcatg gtattcattt ttgtctgggt gcacagctgg cacgtctgga aggtcgtgtt 1080 gcaattggtc gtctgtttgc agatcgtccg gaactggcac tggcggttgg tctggatgaa 1140 ctggtttatc gtgaaagtac cctggttcgt ggtctgagcc gcatgccggt tacaatgggt 1200 ccgcgtagcg cataagctt 1219 <210> 9 <211> 403 <212> PRT <213> Pseudonocardia ammonioxydans <400> 9 Met Ala Leu Thr Thr Thr Gly Thr Glu Gln His Asp Leu Phe Ser Gly 1 5 10 15 Ala Phe Trp Gln Asp Pro His Pro Ala Tyr Thr Ala Leu Arg Asp Glu 20 25 30 Glu Pro Val Arg Lys Val Ala Leu Pro Asp Gly Glu Ala Trp Leu Ile 35 40 45 Thr Arg Tyr Ala Asp Val Arg Glu Ala Phe Val Asp Pro Arg Leu Ser 50 55 60 Lys Asp Trp Arg Tyr Arg Leu Pro Glu Asp Gln Arg Ala Gly Gln Pro 65 70 75 80 Ala Ala Pro Thr Pro Met Met Ile Leu Met Asp Pro Pro Asp His Thr 85 90 95 Arg Leu Arg Lys Leu Val Ser Arg Ser Phe Thr Val Arg Arg Met Asn 100 105 110 Glu Leu Arg Pro Arg Val Glu Glu Ile Ala Gln Glu Leu Leu Asp Arg 115 120 125 Leu Pro Ser Glu Gly Thr Val Asp Leu Met Arg Glu Tyr Ala Phe Gln 130 135 140 Val Pro Val Leu Val Ile Cys Glu Leu Leu Gly Leu Pro Ala Glu Asp 145 150 155 160 Arg Asp Asp Phe Ser Ala Trp Ser Ser Val Met Val Asp Glu Ser Pro 165 170 175 Ala Glu Glu Lys Phe Ala Ala Met Gly Lys Leu His Gly Tyr Leu Thr 180 185 190 Glu Leu Leu Glu Arg Lys Arg Thr Glu Pro Asp Glu Ala Leu Leu Ser 195 200 205 Ser Leu Leu Ala Val Ser Asp Met Asp Gly Asp Arg Leu Ser Ser Glu 210 215 220 Glu Leu Val Ala Met Ala Met Leu Leu Leu Ile Ala Gly His Glu Thr 225 230 235 240 Thr Val Asn Leu Ile Gly Asn Gly Val Leu Ala Leu Leu Thr His Pro 245 250 255 Glu Gln Arg Ala Gln Leu Ala Ala Asp Pro Ser Leu Ile Thr Ser Ala 260 265 270 Val Glu Glu Phe Leu Arg Phe Glu Ser Pro Val Ser Asn Ala Pro Met 275 280 285 Arg Phe Thr Ser Glu Asp Val Thr Tyr Ser Gly Val Thr Ile Pro Ala 290 295 300 Gly Ser Thr Val Met Leu Gly Leu Ala Ala Ala Asn Arg Asp Pro Glu 305 310 315 320 Trp Ala Glu Arg Pro Glu Glu Leu Asp Leu Gly Arg Asp Ser Ser Ala 325 330 335 Gly Val Phe Phe Gly His Gly Ile His Phe Cys Leu Gly Ala Gln Leu 340 345 350 Ala Arg Asn Glu Gly Arg Ala Ala Ile Gly Met Leu Leu Glu Gln Arg 355 360 365 Pro Glu Leu Ala Leu Ala Val Ala Pro Glu Glu Leu Thr Tyr Arg Arg 370 375 380 Ser Ser Leu Val Arg Gly Leu Thr Ser Met Pro Val Val Ala Gly Pro 385 390 395 400 Ala Ala Arg <210> 10 <211> 1219 <212> DNA <213> Pseudonocardia autotrophica <400> 10 catatggcac tgaccaccac cggtaccgaa cagcatgatt tatttagcgg tgcattttgg 60 caagatccgc atccggcata taccgcactg cgtgatgaag aaccggttcg taaagttgca 120 ctgccggatg gtgaagcatg gctgattaca cgttatgcag atgttcgtga agcgtttgtt 180 gatccgcgtc tgagtaaaga ttggcgttat cgtctgccgg aagatcagcg cgccggccag 240 ccggcagcac cgaccccgat gatgattctg atggacccgc cggatcatac ccgtctgcgt 300 aaactggttt cacgttcatt taccgttcgt cgtatgaatg aactgcgccc gcgtgttgaa 360 gaaattgcac aggaactgct ggatcgcctg ccgagtgaag gtacagttga tctgatgcgt 420 gaatatgcat ttcaggttcc ggttctggtt atttgtgaac tgctgggtct gccggcagaa 480 gatcgtgatg attttagcgc atggagtagt gttatggttg atgaaagccc ggcagaagaa 540 aaatttgctg caatgggtaa actgcatggt tatctgaccg aactgctgga acgtaaacgt 600 accgaacctg atgaagcact gctgtcttca ctgctggcgg tgagcgatat ggatggtgat 660 cgcctgtctt cagaagaact ggttgcaatg gcaatgctgc tgctgattgc aggtcatgaa 720 acgaccgtta atctgattgg taatggtgtg ctggccctgc tgacgcatcc ggaacagcgt 780 gctcagctgg cagccgatcc atctctgatt acctctgcag tagaagaatt tctgcgtttt 840 gaatctccgg ttagcaatgc accgatgcgt tttaccagcg aagatgtgac ctattctggt 900 gtgaccattc cggcgggtag taccgttatg ctgggtctgg ccgccgcgaa tcgtgatccg 960 gaatgggcag aacgtccgga agaactggat ctgggtcgtg atagttctgc cggtgttttc 1020 tttggtcatg gtattcattt ttgtctgggt gcccagctgg cacgtaatga aggtcgtgca 1080 gcaattggta tgctgctgga acagcgtccg gaactggccc tggcagttgc accggaagaa 1140 ctgacctatc gtcgtagctc tctggttcgt ggtctgacct ctatgccggt tgttgcaggt 1200 ccggcagcac gttaagctt 1219 <210> 11 <211> 402 <212> PRT <213> Pseudonocardia sp. P2 <400> 11 Met Ala Leu Thr Thr Thr Gly Thr Glu Thr His Asp Leu Phe Ser Gly 1 5 10 15 Asp Phe Trp Thr Asp Pro His Pro Ala Tyr Ala Ala Leu Arg Thr Glu 20 25 30 Glu Pro Val Arg Glu Leu Ala Leu Pro Asp Gly Lys Val Trp Leu Ile 35 40 45 Ser Arg Tyr Ala Asp Val Arg Ala Ala Phe Val Asp Pro Arg Leu Ser 50 55 60 Lys Asp Trp Arg Tyr Arg Leu Pro Ala Asp Gln Arg Glu Gly Gln Pro 65 70 75 80 Ala Ala Pro Ile Pro Met Met Ile Leu Met Asp Pro Pro Asp His Thr 85 90 95 Arg Leu Arg Lys Leu Val Gly Arg Ser Phe Thr Val Arg Arg Met Asn 100 105 110 Asp Leu Gln Pro Arg Val Glu Glu Ile Thr Gln Glu Leu Leu Asp Ala 115 120 125 Leu Pro Ala Ala Gly Pro Val Asp Leu Met Arg Gln Tyr Ala Phe Leu 130 135 140 Val Pro Val Leu Val Ile Cys Glu Leu Leu Gly Leu Pro Ala Glu Asp 145 150 155 160 Arg Asp Lys Phe Ser Ala Trp Ser Ser Val Leu Val Asp Asp Ser Pro 165 170 175 Gln Glu Glu Lys Phe Ala Ala Met Gly Ser Leu Asn Gly Tyr Leu Ala 180 185 190 Glu Leu Ile Glu Arg Lys Arg Thr Glu Pro Asp Asp Ala Leu Leu Ser 195 200 205 Gly Leu Leu Ala Val Ser Asp Met Asp Gly Asp Arg Leu Ser Ser Glu 210 215 220 Glu Leu Val Ala Met Ala Thr Leu Leu Leu Ile Ala Gly His Glu Thr 225 230 235 240 Thr Val Asn Leu Ile Gly Asn Gly Val Leu Ala Leu Leu Thr His Pro 245 250 255 Glu Gln His Ala Arg Leu Lys Ala Asp Pro Ser Leu Ile Asn Ser Ala 260 265 270 Val Glu Glu Phe Leu Arg Phe Glu Ser Pro Val Ser Asn Ala Pro Met 275 280 285 Arg Phe Ala Ser Glu Asp Val Glu Tyr Ser Gly Val Thr Ile Pro Ala 290 295 300 Gly Ser Thr Val Met Leu Gly Leu Ala Ala Ala Asn Arg Asp Pro Glu 305 310 315 320 Trp Leu Ala Asp Pro Asp Arg Leu Asp Ile Thr Arg Asp Ser Ser Ser 325 330 335 Gly Val Phe Phe Gly His Gly Ile His Phe Cys Leu Gly Ala Gln Leu 340 345 350 Ala Arg Thr Glu Gly Arg Val Ala Ile Gly Lys Leu Ile Ala Gln Arg 355 360 365 Pro Asp Leu Ala Leu Ala Val Asp Pro Ser Glu Leu Val Tyr Arg Arg 370 375 380 Ser Thr Leu Val Arg Gly Leu Ser Arg Leu Pro Val Thr Pro Gly Ala 385 390 395 400 Pro Ala <210> 12 <211> 1216 <212> DNA <213> Pseudonocardia sp. P2 <400> 12 catatggcac tgaccaccac cggtaccgaa acccatgatt tatttagtgg tgatttttgg 60 acagatccgc atccggccta tgcagcactg cgtacagaag aaccggttcg tgaactggcc 120 ctgccggatg gtaaagtttg gctgattagt cgttatgcag atgttcgtgc agcatttgtt 180 gatccgcgtc tgagtaaaga ttggcgttat cgtctgccgg cagatcagcg tgaaggtcag 240 ccggcagcac cgattccgat gatgattctg atggacccgc cggatcatac ccgtctgcgt 300 aaactggttg gtcgtagttt taccgttcgc cgtatgaatg atctgcagcc gcgcgttgaa 360 gaaattaccc aggaactgct ggatgcactg ccggcagcgg gtccggttga tctgatgcgc 420 cagtatgcat ttctggttcc ggttctggtt atttgtgaac tgctgggtct gccggcagaa 480 gatcgtgata aatttagtgc atggagtagc gttctggttg atgatagccc gcaggaagaa 540 aaatttgcag caatgggttc tctgaatggt tatctggcag aactgattga acgtaaacgc 600 accgaaccgg atgatgcact gctgagcggt ctgctggcag ttagcgatat ggatggtgat 660 cgtctgagca gcgaagaact ggttgcaatg gcaaccctgc tgctgattgc aggtcatgaa 720 accactgtga atctgattgg taatggtgtt ctggcactgc tgacccatcc ggaacagcat 780 gcacgtctga aagcagatcc gagcctgatt aattctgcag ttgaagaatt tctgcgtttt 840 gaaagcccgg ttagtaatgc accgatgcgt tttgcaagtg aagatgttga atatagcggt 900 gttaccattc cggcaggtag taccgttatg ctgggtctgg cagcagcaaa tcgcgatccg 960 gaatggctgg ctgatccgga tcgtctggat attacccgtg atagcagtag tggtgttttc 1020 tttggtcatg gtattcattt ttgtctgggt gcacagctgg cacgtaccga aggtcgtgtt 1080 gcaattggta aactgattgc acagcgtcct gatctggcac tggcggttga tccgtctgaa 1140 ctggtttatc gtcgttcaac cctggttcgt ggtctgagtc gtctgccggt tacaccgggt 1200 gcaccggcct aagctt 1216 <210> 13 <211> 398 <212> PRT <213> Pseudonocardia autotrophica <400> 13 Met Ala Pro Thr Thr Thr Ser Gly Leu Glu Leu Phe Asp Gly Pro Phe 1 5 10 15 Trp Ser Asp Pro Tyr Pro Ala Tyr Ala Glu Leu Arg Ala Asp Glu Pro 20 25 30 Val Arg Arg Leu Asp Leu Pro Asp Gly Pro Met Trp Ile Ile Ala Arg 35 40 45 Tyr Glu Asp Ala Arg Ala Ala Phe Val Asp Ala Arg Phe Ser Lys Asp 50 55 60 Trp Arg Tyr Thr Leu Arg Ala Asp Gln Arg Ala Ala Met Pro Ala Ala 65 70 75 80 Pro Thr Pro Met Met Leu Leu Leu Asp Pro Pro Asp His Thr Arg Leu 85 90 95 Arg Lys Leu Val Ser Arg Ser Phe Thr Ala Arg Arg Met Ala Gly Leu 100 105 110 Arg Pro Arg Val Gln Glu Ile Ala Asp Asp Leu Leu Ala Asp Leu Pro 115 120 125 Ala Gly Gly Thr Val Asp Leu Met Ala His Tyr Ala Phe Leu Leu Pro 130 135 140 Val Arg Val Ile Cys Glu Leu Leu Gly Val Pro Leu Glu Asp Arg Asp 145 150 155 160 Asp Phe Gly Arg Trp Ser Ser Thr Met Ile Asp Glu Ser Pro Gln Asp 165 170 175 Glu Lys Phe Ala Ala Ser Gln Lys Leu Ser Glu Tyr Leu Ala Gly Leu 180 185 190 Ile Asp Arg Lys Arg Thr Glu Pro Asp Asp Ala Leu Leu Ser Ala Leu 195 200 205 Thr Gln Val Ser Asp Glu Asp Met Asp Ala Leu Ser Gln Glu Glu Leu 210 215 220 Val Ala Met Ala Met Leu Leu Leu Ile Ala Gly His Glu Thr Thr Val 225 230 235 240 Asn Leu Ile Gly Asn Gly Ile Leu Gly Leu Leu Thr His Pro Glu Gln 245 250 255 Arg Glu Ile Leu Ala Asp Lys Pro Glu Leu Trp Pro Ser Ala Val Glu 260 265 270 Glu Phe Leu Arg Trp Asp Ser Pro Val Thr Asn Ala Pro Val Arg Phe 275 280 285 Ala Ala Glu Asp Val Glu Val Ala Gly Thr Thr Ile Pro Glu Gly Ala 290 295 300 Val Val Met Leu Gly Ile Ala Ala Ala Asn Arg Asp Asp Ala Arg Phe 305 310 315 320 Ala Asp Ala Ala Arg Leu Asp Val Ser Arg Asp Asp Arg Gly His Leu 325 330 335 Ala Phe Gly Tyr Gly Leu His His Cys Leu Gly Ala Pro Leu Ala Arg 340 345 350 Ile Glu Gly Glu Val Ala Leu Arg Ser Leu Phe Thr Ala Arg Pro Asp 355 360 365 Met Ala Leu Ala Ala Ser Asp Leu Thr His Arg Arg Ser Thr Leu Arg 370 375 380 Arg Gly Val Thr Glu Leu Pro Val Arg Leu Gly Glu Pro Ala 385 390 395 <210> 14 <211> 1204 <212> DNA <213> Pseudonocardia autotrophica <400> 14 catatggcac cgaccaccac ctcaggcctg gaactgtttg atggtccgtt ttggagtgat 60 ccgtatccgg cctatgccga actgcgtgca gatgaaccgg ttcgtcgtct ggatctgccg 120 gatggtccga tgtggattat tgcacgttat gaagatgcac gtgcagcatt tgttgatgca 180 cgttttagca aagattggcg ttataccctg cgtgcagatc agcgtgcagc aatgccggct 240 gcaccgacac cgatgatgct gctgctggac ccgccggatc atacccgtct gcgcaaactg 300 gttagtcgta gttttaccgc acgtcgcatg gcaggtctgc gtccgcgcgt tcaggaaatt 360 gcagatgatc tgctggcaga tctgccggca ggcggtaccg ttgatctgat ggcacattat 420 gcatttctgc tgccggttcg tgttatttgt gaactgctgg gtgttccgct ggaagatcgt 480 gatgattttg gtcgttggag cagtaccatg attgatgaat ctccgcagga tgaaaaattt 540 gcagcatcac agaaactgag cgaatatctg gcaggcctga ttgatcgtaa acgtacagaa 600 cctgatgatg cgctgctgag tgcactgacc caggtgagtg atgaagatat ggatgcgctg 660 tctcaggaag aactggtggc aatggccatg ctgctgctga ttgcaggtca tgaaaccacc 720 gttaatctga ttggtaatgg tattctggga ctgctgaccc atccggaaca gcgtgaaatt 780 ctggcagata aaccggaact gtggccttca gccgttgaag aatttctgcg ttgggatagc 840 ccggtgacaa atgcaccggt tcgctttgct gcagaagatg ttgaagttgc aggtacaacc 900 attccggaag gtgcagttgt tatgctgggt attgcagcag caaatcgtga tgatgcgcgt 960 tttgcagatg cagcacgtct ggatgtttct cgtgatgatc gcggtcatct ggcatttggt 1020 tatggtctgc atcattgtct gggtgcgccg ctggcacgta ttgaaggtga agttgcactg 1080 cgcagcctgt ttaccgcgcg tccggatatg gcactggcag ccagtgatct gacccatcgt 1140 cgttcaaccc tgcgtcgtgg tgttaccgaa ctgccggttc gtctgggtga accggcataa 1200 gctt 1204 <210> 15 <211> 402 <212> PRT <213> Pseudonocardia endophytica <400> 15 Met Thr Val Thr Thr Ile Gly Ser Glu Arg His Glu Leu Phe Glu Gly 1 5 10 15 Ser Phe Phe Ala Asp Pro His Pro Ala Leu Ala Ala Leu Arg Glu His 20 25 30 Asp Pro Val Ser Arg Leu Glu Leu His Gly Gly Thr Thr Trp Leu Leu 35 40 45 Ser Arg His Ala Asp Val Arg Ala Ala Leu Thr Asp Pro Arg Val Ser 50 55 60 Lys Asp Trp Arg Trp Arg Leu Pro Pro Glu Glu Arg Glu Lys His Pro 65 70 75 80 Ala Ala Pro Thr Pro Met Met Ile Leu Met Asp Pro Pro Glu His Thr 85 90 95 Arg Leu Arg Lys Leu Val Ser Arg Ser Phe Thr Val Arg Arg Met Asn 100 105 110 Glu Gln Lys Pro Arg Val Gln Glu Ile Ala Ser Ala Leu Val Ala Asp 115 120 125 Leu Pro Glu Thr Gly Thr Val Asp Leu Met Thr Ala Tyr Ala Phe Gln 130 135 140 Ile Pro Val Tyr Val Ile Cys Glu Met Leu Gly Leu Pro Val Glu Asp 145 150 155 160 Arg Asp Asp Phe Gly Ala Trp Thr Lys Ala Leu Val Asp Asn Ser Gly 165 170 175 Asp Glu Ala Thr Met Gly Ala Met Gly Lys Leu Asn Gly Tyr Leu Gly 180 185 190 Glu Leu Ile Glu Arg Lys Arg Ser Glu Pro Asp Asp Lys Leu Leu Ala 195 200 205 Ala Leu Ile Glu Val Ala Asp Met Asp Gly Asp Arg Leu Ser Pro Asp 210 215 220 Glu Leu Leu Ala Met Thr Met Leu Leu Leu Ile Ala Gly His Glu Thr 225 230 235 240 Thr Val Asn Leu Ile Gly Asn Gly Leu Arg Ala Leu Leu Thr His Pro 245 250 255 Glu Gln His Ala Thr Leu Lys Ala Asp Pro Gly Leu Leu Asp Ser Ala 260 265 270 Val Glu Glu Met Leu Arg Tyr Asp Thr Pro Val Ala Gln Thr Pro Ala 275 280 285 Arg Phe Thr Ser Glu Asp Val Thr Tyr Ser Gly Val Thr Ile Pro Ala 290 295 300 Gly Gln Met Val Met Tyr Ser Leu Ser Ala Ala Asn Arg Asp Pro Arg 305 310 315 320 Trp Val Gln Asp Pro Asp Thr Phe Asp Ile Thr Arg Gln Thr Ser Gly 325 330 335 Ala Ile Tyr Phe Ala His Gly Asn His His Cys Ile Gly Ala Gln Leu 340 345 350 Ala Arg Ile Glu Gly Arg Val Ala Ile Gly Thr Leu Val Ala Asp Arg 355 360 365 Pro Glu Leu Ala Leu Ala Val Asp Pro Ser Glu Leu Gly Tyr Arg Arg 370 375 380 Ser Ser Leu Ile Arg Gly Leu Thr Ser Leu Pro Val Thr Pro Gly Pro 385 390 395 400 Arg Ala <210> 16 <211> 1216 <212> DNA <213> Pseudonocardia endophytica <400> 16 catatgaccg ttaccaccat tggtagtgaa cgtcatgaac tgtttgaagg tagcttcttt 60 gcagatccgc atccggcact ggccgcactg cgtgaacatg atccggttag tcgtctggaa 120 ctgcatggtg gtacaacctg gctgctgagc cgtcatgcag atgttcgtgc agctctgacc 180 gatccgcgcg ttagtaaaga ttggcgctgg cgtctgccgc cggaagaacg tgaaaaacat 240 ccggcagcac cgaccccgat gatgattctg atggaccctc cggaacatac ccgcctgcgt 300 aaactggtga gccgtagctt taccgttcgt cgtatgaatg aacagaaacc gcgtgttcag 360 gaaattgcat cagcgctggt tgctgatctg ccggaaaccg gtaccgttga tctgatgacc 420 gcctatgcat ttcagattcc ggtttatgtg atttgtgaaa tgctgggtct gccggttgaa 480 gatcgtgatg attttggcgc atggaccaaa gcactggttg ataattcagg tgatgaagca 540 actatgggtg cgatgggtaa actgaatggt tatctgggtg aactgattga acgtaaacgc 600 agtgaaccgg atgataaact gctggcggca ctgattgaag ttgctgatat ggatggtgat 660 cgcctgagcc cggatgaact gctggcaatg accatgctgc tgctgattgc aggtcatgaa 720 acaaccgtta atctgattgg taatggtctg cgtgcactgc tgacccatcc ggaacagcat 780 gcgaccctga aagcagatcc gggtctgctg gattcagcag tggaagaaat gctgcgctat 840 gataccccgg ttgcacagac cccggcccgt tttacatcag aagatgttac ctatagtggt 900 gtgaccattc cggcaggtca gatggttatg tatagtctga gcgcagcaaa tcgtgatccg 960 cgttgggttc aagatccgga tacctttgat attacacgtc agaccagtgg tgcgatttat 1020 tttgcacatg gtaatcatca ttgtattggt gcacagctgg cgcgcattga aggtcgcgtt 1080 gcaattggta cactggttgc agatcgtccg gaactggcac tggcggttga tccgagcgaa 1140 ctgggttatc gtcgtagcag cctgattcgt ggtctgacca gtctgccggt tacaccgggt 1200 ccgcgtgcat aagctt 1216 <210> 17 <211> 185 <212> PRT <213> Bos taurus <400> 17 Ala Ala Arg Leu Leu Arg Val Ala Ser Ala Ala Leu Gly Asp Thr Ala 1 5 10 15 Gly Arg Trp Arg Leu Leu Ala Arg Pro Arg Ala Gly Ala Gly Gly Leu 20 25 30 Arg Gly Ser Arg Gly Pro Gly Leu Gly Gly Gly Ala Val Ala Thr Arg 35 40 45 Thr Leu Ser Val Ser Gly Arg Ala Gln Ser Ser Ser Glu Asp Lys Ile 50 55 60 Thr Val His Phe Ile Asn Arg Asp Gly Glu Thr Leu Thr Thr Lys Gly 65 70 75 80 Lys Ile Gly Asp Ser Leu Leu Asp Val Val Val Gln Asn Asn Leu Asp 85 90 95 Ile Asp Gly Phe Gly Ala Cys Glu Gly Thr Leu Ala Cys Ser Thr Cys 100 105 110 His Leu Ile Phe Glu Gln His Ile Phe Glu Lys Leu Glu Ala Ile Thr 115 120 125 Asp Glu Glu Asn Asp Met Leu Asp Leu Ala Tyr Gly Leu Thr Asp Arg 130 135 140 Ser Arg Leu Gly Cys Gln Ile Cys Leu Thr Lys Ala Met Asp Asn Met 145 150 155 160 Thr Val Arg Val Pro Asp Ala Val Ser Asp Ala Arg Glu Ser Ile Asp 165 170 175 Met Gly Met Asn Ser Ser Lys Ile Glu 180 185 <210> 18 <211> 568 <212> DNA <213> Bos taurus <400> 18 catatggccg cacgtctgct gcgtgttgca agcgcagcac tgggtgatac cgcaggtcgt 60 tggcgtctgc tggcacgtcc gcgtgcaggt gcaggtggtc tgcgtggtag ccgtggtccg 120 ggtctgggtg gtggtgcagt tgcaacccgt accctgagcg ttagcggtcg tgcacagagc 180 agcagcgaag ataaaattac cgttcatttt attaatcgtg atggtgaaac cctgaccacc 240 aaaggtaaaa ttggtgatag cctgctggat gttgttgttc agaataatct ggatattgat 300 ggttttggtg catgtgaagg taccctggca tgtagcacct gtcatctgat ttttgaacag 360 catatttttg aaaaactgga agcaattacc gatgaagaaa atgatatgct ggatctggcc 420 tatggtctga ccgatcgtag tcgtctgggt tgtcagattt gtctgaccaa agcaatggat 480 aatatgaccg ttcgtgttcc ggatgcagtt agcgatgcac gtgaaagcat tgatatgggt 540 atgaatagca gcaaaattga ataagctt 568 <210> 19 <211> 497 <212> PRT <213> Bos taurus <400> 19 Ala Pro Arg Cys Trp Arg Trp Trp Pro Trp Ser Ser Trp Thr Arg Thr 1 5 10 15 Arg Leu Pro Pro Ser Arg Ser Ile Gln Asn Phe Gly Gln His Phe Ser 20 25 30 Thr Gln Glu Gln Thr Pro Gln Ile Cys Val Val Gly Ser Gly Pro Ala 35 40 45 Gly Phe Tyr Thr Ala Gln His Leu Leu Lys His His Ser Arg Ala His 50 55 60 Val Asp Ile Tyr Glu Lys Gln Leu Val Pro Phe Gly Leu Val Arg Phe 65 70 75 80 Gly Val Ala Pro Asp His Pro Glu Val Lys Asn Val Ile Asn Thr Phe 85 90 95 Thr Gln Thr Ala Arg Ser Asp Arg Cys Ala Phe Tyr Gly Asn Val Glu 100 105 110 Val Gly Arg Asp Val Thr Val Gln Glu Leu Gln Asp Ala Tyr His Ala 115 120 125 Val Val Leu Ser Tyr Gly Ala Glu Asp His Gln Ala Leu Asp Ile Pro 130 135 140 Gly Glu Glu Leu Pro Gly Val Phe Ser Ala Arg Ala Phe Val Gly Trp 145 150 155 160 Tyr Asn Gly Leu Pro Glu Asn Arg Glu Leu Ala Pro Asp Leu Ser Cys 165 170 175 Asp Thr Ala Val Ile Leu Gly Gln Gly Asn Val Ala Leu Asp Val Ala 180 185 190 Arg Ile Leu Leu Thr Pro Pro Asp His Leu Glu Val Leu Leu Leu Cys 195 200 205 Gln Lys Thr Asp Ile Thr Glu Ala Ala Leu Gly Ala Leu Arg Gln Ser 210 215 220 Arg Val Lys Thr Val Trp Ile Val Gly Arg Arg Gly Pro Leu Gln Val 225 230 235 240 Ala Phe Thr Ile Lys Glu Leu Arg Glu Met Ile Gln Leu Pro Gly Thr 245 250 255 Arg Pro Met Leu Asp Pro Ala Asp Phe Leu Gly Leu Gln Asp Arg Ile 260 265 270 Lys Glu Ala Ala Arg Pro Arg Lys Arg Leu Met Glu Leu Leu Leu Arg 275 280 285 Thr Ala Thr Glu Lys Pro Gly Val Glu Glu Ala Ala Arg Arg Ala Ser 290 295 300 Ala Ser Arg Ala Trp Gly Leu Arg Phe Phe Arg Ser Pro Gln Gln Val 305 310 315 320 Leu Pro Ser Pro Asp Gly Arg Arg Ala Ala Gly Ile Arg Leu Ala Val 325 330 335 Thr Arg Leu Glu Gly Ile Gly Glu Ala Thr Arg Ala Val Pro Thr Gly 340 345 350 Asp Val Glu Asp Leu Pro Cys Gly Leu Val Leu Ser Ser Ile Gly Tyr 355 360 365 Lys Ser Arg Pro Ile Asp Pro Ser Val Pro Phe Asp Pro Lys Leu Gly 370 375 380 Val Val Pro Asn Met Glu Gly Arg Val Val Asp Val Pro Gly Leu Tyr 385 390 395 400 Cys Ser Gly Trp Val Lys Arg Gly Pro Thr Gly Val Ile Thr Thr Thr 405 410 415 Met Thr Asp Ser Phe Leu Thr Gly Gln Ile Leu Leu Gln Asp Leu Lys 420 425 430 Ala Gly His Leu Pro Ser Gly Pro Arg Pro Gly Ser Ala Phe Ile Lys 435 440 445 Ala Leu Leu Asp Ser Arg Gly Val Trp Pro Val Ser Phe Ser Asp Trp 450 455 460 Glu Lys Leu Asp Ala Glu Glu Val Ser Arg Gly Gln Ala Ser Gly Lys 465 470 475 480 Pro Arg Glu Lys Leu Leu Asp Pro Gln Glu Met Leu Arg Leu Leu Gly 485 490 495 His <210> 20 <211> 1504 <212> DNA <213> Bos taurus <400> 20 catatggccc cgcgttgttg gcgttggtgg ccgtggagta gctggacccg tacccgtctg 60 ccgcctagtc gtagtattca gaattttggt cagcatttta gtacccagga acagaccccg 120 cagatttgtg ttgttggttc aggtccggca ggtttttata cagcacagca tctgctgaaa 180 catcatagtc gtgcacatgt tgatatttat gaaaaacagc tggttccgtt tggtctggtt 240 cgttttggtg ttgcgcctga tcatccggaa gttaaaaatg ttattaatac ctttacccag 300 accgcccgca gtgatcgttg tgccttttat ggtaatgttg aagttggtcg tgatgttacc 360 gttcaggaac tgcaggatgc atatcatgca gttgttctga gttatggtgc agaagatcat 420 caggcactgg atattccagg tgaagaactg ccgggtgtgt ttagtgcacg tgcatttgtt 480 ggttggtata atggtctgcc ggaaaatcgt gaactggcac cggatctgtc atgtgatacc 540 gcagttattc tgggtcaggg taatgtggca ctggatgttg cccgtattct gctgacgccg 600 ccggatcatc tggaagttct gttactgtgc cagaaaaccg atattactga agcagcgctg 660 ggtgccctgc gtcagagtcg tgttaaaacc gtttggattg ttggtcgtcg tggtccgctg 720 caggttgcat ttacaattaa agaactgcgt gaaatgattc agctgccggg tacccgtccg 780 atgttagatc cggctgattt tctgggtctg caggatcgta ttaaagaagc tgcacgtccg 840 cgtaaacgtc tgatggaact gctgctgcgt acagcaaccg aaaaaccggg tgtggaagaa 900 cgtaaacgtc tgatggaact gctgctgcgt acagcaaccg aaaaaccggg tgtggaagaa 900 gcagcacgtc gtgctagtgc tagtcgtgca tggggtctgc gtttctttcg tagtccgcag 960 gcagcacgtc gtgctagtgc tagtcgtgca tggggtctgc gtttctttcg tagtccgcag 960 caggttctgc cgtctccgga tggtcgccgt gcagcaggta ttcgtttagc cgttacacgt 1020 caggttctgc cgtctccgga tggtcgccgt gcagcaggta ttcgtttagc cgttacacgt 1020 ctggaaggta ttggtgaagc aacacgtgca gtgccgaccg gtgatgttga agatctgcct 1080 ctggaaggta ttggtgaagc aacacgtgca gtgccgaccg gtgatgttga agatctgcct 1080 tgtggtctgg ttctgagttc aattggttat aaatctcgtc cgattgatcc atcagttccg 1140 tgtggtctgg ttctgagttc aattggttat aaatctcgtc cgattgatcc atcagttccg 1140 tttgatccga aactgggtgt tgttcctaat atggaaggtc gtgttgttga tgttccgggt 1200 tttgatccga aactgggtgt tgttcctaat atggaaggtc gtgttgttga tgttccgggt 1200 ctgtattgta gtggttgggt gaaacgtggt ccgaccggtg ttattaccac cacaatgacc 1260 ctgtattgta gtggttgggt gaaacgtggt ccgaccggtg ttattaccac cacaatgacc 1260 gatagctttt taaccggtca gattctgctg caggatctga aagcaggtca tctgccgagt 1320 gatagctttt taaccggtca gattctgctg caggatctga aagcaggtca tctgccgagt 1320 ggtccgcgtc cgggtagcgc atttattaaa gcactgctgg atagtcgtgg tgtttggccg 1380 ggtccgcgtc cgggtagcgc atttattaaa gcactgctgg atagtcgtgg tgtttggccg 1380 gttagtttta gtgattggga aaaactggat gcagaagaag ttagccgtgg tcaggcatca 1440 gttagtttta gtgattggga aaaactggat gcagaagaag ttagccgtgg tcaggcatca 1440 ggtaaaccgc gtgaaaaact gttagatccg caggaaatgc tgcgtctgct gggtcattaa 1500 ggtaaaccgc gtgaaaaact gttagatccg caggaaatgc tgcgtctgct gggtcattaa 1500 gctt 1504 gctt 1504 <210> 21 <210> 21 <211> 106 <211> 106 <212> PRT <212> PRT <213> Acinetobacter sp. OC4 <400> 21 Met Gly Gln Ile Thr Phe Ile Ala His Asp Gly Ala Gln Thr Ser Val 1 5 10 15 Ala Ile Glu Ala Gly Lys Ser Leu Met Gln Leu Ala Val Glu Asn Gly 20 25 30 Val Ala Gly Ile Asp Gly Asp Cys Gly Gly Glu Cys Ala Cys Gly Thr 35 40 45 Cys His Val Ile Val Ser Ala Glu Trp Ser Asp Val Ala Gly Thr Ala 50 55 60 Gln Ala Asn Glu Gln Gln Met Leu Glu Met Thr Pro Glu Arg Ala Ala 65 70 75 80 Thr Ser Arg Leu Ala Cys Cys Ile Gln Val Thr Asp Ala Met Asp Gly 85 90 95 Met Thr Val His Leu Pro Glu Phe Gln Met 100 105 <210> 22 <211> 328 <212> DNA <213> Acinetobacter sp. OC4 <400> 22 catatgggtc agattacctt tattgcacat gatggtgcac agaccagcgt tgcaattgaa 60 gcaggtaaaa gcctgatgca gctggcagtt gaaaatggtg ttgcaggtat tgatggtgat 120 tgtggtggtg aatgtgcatg tggtacctgt catgttattg ttagcgcaga atggagcgat 180 gttgcaggta ccgcccaggc aaatgaacag cagatgctgg aaatgacccc ggaacgtgca 240 gcaaccagcc gtctggcatg ttgtattcag gttaccgatg caatggatgg tatgaccgtt 300 catctgccgg aatttcagat gtaagctt 328 <210> 23 <211> 404 <212> PRT <213> Acinetobacter sp. OC4 <400> 23 Met Gln Thr Ile Val Ile Ile Gly Ala Ser His Ala Ala Ala Gln Leu 1 5 10 15 Ala Ala Ser Leu Arg Pro Asp Gly Trp Gln Gly Glu Ile Val Val Ile 20 25 30 Gly Asp Glu Pro Tyr Leu Pro Tyr His Arg Pro Pro Leu Ser Lys Thr 35 40 45 Phe Leu Arg Gly Ala Gln Leu Val Asp Glu Leu Leu Ile Arg Pro Ala 50 55 60 Ala Phe Tyr Gln Lys Asn Gln Ile Glu Phe Arg His Gly Arg Val Val 65 70 75 80 Ala Ile Asp Arg Ala Ala Arg Ser Val Thr Leu Gln Asp Gly Ser Thr 85 90 95 Leu Ala Tyr Asp Gln Leu Ala Leu Cys Thr Gly Ala Arg Val Arg Thr 100 105 110 Val Ser Leu Ala Gly Ser Asp Leu Ala Gly Val His Tyr Leu Arg Asn 115 120 125 Ile Ser Asp Val Gln Ala Ile Gln Pro Phe Val Gln Pro Asn Gly Lys 130 135 140 Ala Val Val Ile Gly Gly Gly Tyr Ile Gly Leu Glu Thr Ala Ala Ala 145 150 155 160 Leu Thr Glu Gln Gly Met Gln Val Val Val Leu Glu Ala Ala Glu Arg 165 170 175 Ile Leu Gln Arg Val Thr Ala Pro Glu Val Ser Asp Phe Tyr Thr Arg 180 185 190 Ile His Arg Glu Gln Gly Val Thr Ile His Thr Gly Val Ser Val Thr 195 200 205 Ala Ile Thr Gly Glu Gly Arg Ala Gln Ala Val Leu Cys Ala Asp Gly 210 215 220 Ser Met Phe Asp Ala Asp Leu Val Ile Ile Gly Val Gly Val Val Pro 225 230 235 240 Asn Ile Glu Leu Ala Leu Asp Ala Gly Leu Gln Val Asp Asn Gly Ile 245 250 255 Val Ile Asp Glu Tyr Cys Arg Thr Ser Ala Pro Glu Ile Val Ala Ile 260 265 270 Gly Asp Cys Ala Asn Ala Phe Asn Pro Ile Tyr Gln Arg Arg Met Arg 275 280 285 Leu Glu Ser Val Pro Asn Ala Asn Glu Gln Ala Lys Ile Ala Ser Ala 290 295 300 Thr Leu Cys Gly Leu Gln Arg Thr Ser Lys Ser Leu Pro Trp Phe Trp 305 310 315 320 Ser Asp Gln Tyr Asp Leu Lys Leu Gln Ile Ala Gly Leu Ser Gln Gly 325 330 335 Tyr Asp Gln Ile Val Ile Arg Gly Asp Val Gln Gln Arg Arg Ser Phe 340 345 350 Ala Ala Phe Tyr Leu Gln Ala Gly Arg Leu Ile Ala Ala Asp Cys Val 355 360 365 Asn Arg Pro Gln Glu Phe Met Leu Ser Lys Lys Leu Ile Thr Ala Gly 370 375 380 Thr Ala Val Asp Pro Leu Arg Leu Ala Asp Glu Ser Ile Ala Val Gln 385 390 395 400 Ala Leu Met Gly <210> 24 <211> 1222 <212> DNA <213> Acinetobacter sp. OC4 <400> 24 catatgcaga ccattgttat tattggtgca agccatgcag cagcacagct ggcagcaagt 60 ctgcgtccgg atggttggca gggtgaaatt gttgttattg gtgatgaacc gtatctgccg 120 tatcatcgtc cgccgctgag caaaaccttt ctgcgtggtg cacagctggt tgatgaactg 180 ctgattcgtc cggcggcctt ttatcagaaa aatcagattg aatttcgtca tggtcgtgtt 240 gttgccattg atcgtgcagc acgtagcgtt accctgcagg atggtagtac cctggcatac 300 gatcagctgg ccctgtgtac cggcgcccgc gttcgtaccg tgagcctggc aggtagtgat 360 ctggcaggcg ttcattatct gcgtaatatt tcagatgttc aggccattca gccgtttgtt 420 cagccgaatg gtaaagcagt tgtgattggt ggtggttata ttggtctgga aaccgcagca 480 gccctgaccg aacagggtat gcaggttgtt gttctggaag cagcagaacg tattctgcag 540 cgtgttaccg ccccggaagt tagcgatttt tatacccgca ttcatcgtga acagggtgtg 600 accattcata caggtgttag tgttaccgca attaccggtg aaggtcgtgc ccaggcagtt 660 ctgtgtgcgg atggtagcat gtttgatgcc gatctggtta ttattggtgt gggtgttgtt 720 ctgtgtgcgg atggtagcat gtttgatgcc gatctggtta ttattggtgt gggtgttgtt 720 ccgaatattg aactggccct ggatgcaggt ctgcaggttg ataatggtat tgttattgat 780 ccgaatattg aactggccct ggatgcaggt ctgcaggttg ataatggtat tgttattgat 780 gaatattgcc gcaccagcgc accggaaatt gttgcaattg gtgattgtgc aaatgcattt 840 gaatattgcc gcaccagcgc accggaaatt gttgcaattg gtgattgtgc aaatgcattt 840 aatccgattt atcagcgccg catgcgtctg gaaagcgttc cgaatgcaaa tgaacaggca 900 aatccgattt atcagcgccg catgcgtctg gaaagcgttc cgaatgcaaa tgaacaggca 900 aaaattgcat cagcaaccct gtgtggtctg cagcgtacca gcaaatcact gccgtggttt 960 aaaattgcat cagcaaccct gtgtggtctg cagcgtacca gcaaatcact gccgtggttt 960 tggagtgatc agtatgatct gaaactgcag attgccggtc tgagccaggg ttatgatcag 1020 tggagtgatc agtatgatct gaaactgcag attgccggtc tgagccaggg ttatgatcag 1020 attgttattc gtggtgatgt gcagcagcgt cgttcatttg cagcatttta tctgcaggca 1080 attgttattc gtggtgatgt gcagcagcgt cgttcatttg cagcatttta tctgcaggca 1080 ggtcgtctga ttgcagcaga ttgtgtgaat cgtccgcagg aatttatgct gagcaaaaaa 1140 ggtcgtctga ttgcagcaga ttgtgtgaat cgtccgcagg aatttatgct gagcaaaaaa 1140 ctgattaccg caggtaccgc agttgatccg ctgcgtctgg cagatgaaag cattgcagtt 1200 ctgattaccg caggtaccgc agttgatccg ctgcgtctgg cagatgaaag cattgcagtt 1200 caggccctga tgggttaagc tt 1222 caggccctga tgggttaagc tt 1222 <210> 25 <211> 147 <212> PRT <213> Spinacia oleracea <400> 25 Met Ala Ala Thr Thr Thr Thr Met Met Gly Met Ala Thr Thr Phe Val Met Ala Ala Thr Thr Thr Thr Met Met Gly Met Ala Thr Thr Phe Val 1 5 10 15 Pro Lys Pro Gln Ala Pro Pro Met Met Ala Ala Leu Pro Ser Asn Thr 20 25 30 Gly Arg Ser Leu Phe Gly Leu Lys Thr Gly Ser Arg Gly Gly Arg Met 35 40 45 Thr Met Ala Ala Tyr Lys Val Thr Leu Val Thr Pro Thr Gly Asn Val 50 55 60 Glu Phe Gln Cys Pro Asp Asp Val Tyr Ile Leu Asp Ala Ala Glu Glu 65 70 75 80 Glu Gly Ile Asp Leu Pro Tyr Ser Cys Arg Ala Gly Ser Cys Ser Ser 85 90 95 Cys Ala Gly Lys Leu Lys Thr Gly Ser Leu Asn Gln Asp Asp Gln Ser 100 105 110 Phe Leu Asp Asp Asp Gln Ile Asp Glu Gly Trp Val Leu Thr Cys Ala 115 120 125 Ala Tyr Pro Val Ser Asp Val Thr Ile Glu Thr His Lys Glu Glu Glu 130 135 140 Leu Thr Ala 145 <210> 26 <211> 444 <212> DNA <213> Spinacia oleracea <400> 26 atggcagcaa ccaccacaac aatgatgggc atggccacca cctttgtccc aaaaccccaa 60 gcaccaccaa tgatggcggc gcttccatcc aacaccggcc gctctttgtt cggactcaag 120 accggtagcc gtggcggaag gatgacaatg gctgcctaca aggtaacctt ggtaacaccc 180 accggtaacg tagagtttca atgcccagac gatgtttaca tcttggatgc tgctgaagaa 240 gaaggcattg acttgcctta ctcatgcaga gctgggtcgt gctcttcatg cgccggaaag 300 cttaagacag gtagtcttaa ccaagatgat cagagttttt tggatgacga tcagatcgat 360 gaaggatggg ttcttacctg tgctgcttac cctgttagtg atgttactat tgagacccac 420 aaggaagagg agcttactgc ctaa 444 <210> 27 <211> 369 <212> PRT <213> Spinacia oleracea <400> 27 Met Thr Thr Ala Val Thr Ala Ala Val Ser Phe Pro Ser Thr Lys Thr 1 5 10 15 Thr Ser Leu Ser Ala Arg Ser Ser Ser Val Ile Ser Pro Asp Lys Ile 20 25 30 Ser Tyr Lys Lys Val Pro Leu Tyr Tyr Arg Asn Val Ser Ala Thr Gly 35 40 45 Lys Met Gly Pro Ile Arg Ala Gln Ile Ala Ser Asp Val Glu Ala Pro 50 55 60 Pro Pro Ala Pro Ala Lys Val Glu Lys His Ser Lys Lys Met Glu Glu 65 70 75 80 Gly Ile Thr Val Asn Lys Phe Lys Pro Lys Thr Pro Tyr Val Gly Arg 85 90 95 Cys Leu Leu Asn Thr Lys Ile Thr Gly Asp Asp Ala Pro Gly Glu Thr 100 105 110 Trp His Met Val Phe Ser His Glu Gly Glu Ile Pro Tyr Arg Glu Gly 115 120 125 Gln Ser Val Gly Val Ile Pro Asp Gly Glu Asp Lys Asn Gly Lys Pro 130 135 140 His Lys Leu Arg Leu Tyr Ser Ile Ala Ser Ser Ala Leu Gly Asp Phe 145 150 155 160 Gly Asp Ala Lys Ser Val Ser Leu Cys Val Lys Arg Leu Ile Tyr Thr 165 170 175 Asn Asp Ala Gly Glu Thr Ile Lys Gly Val Cys Ser Asn Phe Leu Cys 180 185 190 Asp Leu Lys Pro Gly Ala Glu Val Lys Leu Thr Gly Pro Val Gly Lys 195 200 205 Glu Met Leu Met Pro Lys Asp Pro Asn Ala Thr Ile Ile Met Leu Gly 210 215 220 Thr Gly Thr Gly Ile Ala Pro Phe Arg Ser Phe Leu Trp Lys Met Phe 225 230 235 240 Phe Glu Lys His Asp Asp Tyr Lys Phe Asn Gly Leu Ala Trp Leu Phe 245 250 255 Leu Gly Val Pro Thr Ser Ser Ser Leu Leu Tyr Lys Glu Glu Phe Glu 260 265 270 Lys Met Lys Glu Lys Ala Pro Asp Asn Phe Arg Leu Asp Phe Ala Val 275 280 285 Ser Arg Glu Gln Thr Asn Glu Lys Gly Glu Lys Met Tyr Ile Gln Thr 290 295 300 Arg Met Ala Gln Tyr Ala Val Glu Leu Trp Glu Met Leu Lys Lys Asp 305 310 315 320 Asn Thr Tyr Phe Tyr Met Cys Gly Leu Lys Gly Met Glu Lys Gly Ile 325 330 335 Asp Asp Ile Met Val Ser Leu Ala Ala Ala Glu Gly Ile Asp Trp Ile 340 345 350 Glu Tyr Lys Arg Gln Leu Lys Lys Ala Glu Gln Trp Asn Val Glu Val 355 360 365 Tyr <210> 28 <211> 1110 <212> DNA <213> Spinacia oleracea <400> 28 atgaccaccg ctgtcaccgc cgctgtttct ttcccctcta ccaaaaccac ctctctctcc 60 gcccgaagct cctccgtcat ttcccctgac aaaatcagct acaaaaaggt tcctttgtac 120 tacaggaatg tatctgcaac tgggaaaatg ggacccatca gggcccagat cgcctctgat 180 gtggaggcac ctccacctgc tcctgctaag gtagagaaac attcaaagaa aatggaggaa 240 ggcattacag tgaacaagtt taagcctaag accccttacg ttggaagatg tcttcttaac 300 accaaaatta ctggggatga tgcacccgga gagacctggc acatggtttt ttcccatgaa 360 ggagagatcc cttacagaga agggcaatcc gttggggtta ttccagatgg ggaagacaag 420 aatggaaagc cccataagtt gagattgtac tcgatcgcca gcagtgctct tggtgatttt 480 ggtgatgcta aatctgtttc gttgtgtgta aaacgactca tctacaccaa tgacgctgga 540 gagacgatca agggagtctg ctccaacttc ttgtgtgact tgaaacccgg tgctgaagtg 600 aagttaacag gaccagttgg aaaggagatg ctcatgccca aagaccctaa cgcgacaatt 660 atcatgcttg gaactggaac tgggattgct cctttccgtt cattcttgtg gaagatgttc 720 ttcgaaaagc atgatgatta caagtttaac ggcttggctt ggcttttctt gggtgtaccc 780 acaagcagtt ctcttctcta caaagaggaa tttgagaaga tgaaggaaaa ggctccagac 840 aacttcaggc tggattttgc agtgagcaga gagcaaacta acgagaaagg ggagaagatg 900 tacattcaaa cccgaatggc acaatacgca gttgagctat gggaaatgtt gaagaaagat 960 aatacttatt tctacatgtg tggtctcaag ggaatggaaa agggaattga cgacattatg 1020 gtttcattgg ctgctgcaga aggcattgat tggattgaat acaagaggca gttgaagaag 1080 gcagaacaat ggaacgttga agtctactaa 1110 <210> 29 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CYP6-F <400> 29 catatggcac tgaccaccac cggtac 26 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CYP6-R <400> 30 aagcttaggc cggtgcaccc ggtgt 25 <210> 31 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Fdx-F <400> 31 gaaggagata tacatatggg tcagattacc 30 <210> 32 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Fdx-R <400> 32 cagactcgag ggtaccaagc ttacatctga a 31 <210> 33 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RSF-1F <400> 33 caccggccta agcttgcggc cgcataatgc 30 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RSF-1R <400> 34 ggtcagtgcc atatgggatc ctggctgtgg 30 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RSF-2F <400> 35 atgtaagctt ggtaccctcg agtctggtaa 30 <210> 36 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> RSF-2R <400> 36 taatctgacc catatgtata tctccttc 28 <210> 37 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> FdR-F <400> 37 ccaggatccg aattccatat gcagaccatt g 31 <210> 38 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> FdR-R <400> 38 ctgttcgact taagaagctt aacccatcag 30 <210> 39 <211> 30 <212> DNA <213> Artificial Sequence<213> Artificial Sequence <220> <223> GDH-F <400> 39 gaaggagata tacatatgta tccggattta 30 <210> 40 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GDH-R <400> 40 ctttaccaga ctcgagtcga gtcattaacc gc 32 <210> 41 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ACYC-1F <400> 41 ggttaagctt cttaagtcga acagaaag 28 <210> 42 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ACYC-1R <400> 42 tctgcatatg gaattcggat cctggct 27 <210> 43 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ACYC-2F <400> 43 aatgactcga ctcgagtctg gtaaagaaac 30 <210> 44 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ACYC-2R <400> 44 aatccggata catatgtata tctccttc 28 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CYP6-F2 <400> 45 catatggcac tgaccaccac cg 22 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CYP6-R2 <400> 46 aagcttaggc cggtgcaccc gg 22 <210> 47 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> BAD-F <400> 47 caccggccta agcttggctg ttttggcgga 30 <210> 48 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> BAD-R <400> 48 ggtcagtgcc atatgggatc cccatcgatc 30 <210> 49 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> DT7-F <400> 49 ccgcataatc ccatcttagt atattagtta g 31 <210> 50 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> DT7-R <400> 50 tactaagatg ggattatgcg gccgtgtaca a 31

Claims

1. A genetically engineered bacterium, characterized in that, The genetically engineered bacterium is an engineered bacterium constructed by expressing CYP gene, ferredoxin gene, ferredoxin reductase gene and dehydrogenase gene in cells; Among them, the amino acid sequence encoded by the CYP gene is shown in SEQ ID NO. 11, the amino acid sequence encoded by the ferredoxin gene is shown in SEQ ID NO. 21, and the amino acid sequence encoded by the ferredoxin reductase gene is shown in SEQ ID NO. 23; among them, the cell is Escherichia coli.

2. The genetically engineered bacterium according to claim 1, characterized in that, The Escherichia coli is E.coli BL21 (DE3), C2566 or Rosseta.

3. The genetically engineered bacterium according to claim 1, wherein, The nucleotide sequence of the CYP gene is shown in SEQ ID NO. 12, the nucleotide sequence of the ferredoxin gene is shown in SEQ ID NO. 22, and the nucleotide sequence of the ferredoxin reductase gene is shown in SEQ ID NO.

24.

4. The genetically engineered bacterium according to claim 1, wherein The dehydrogenase is glucose dehydrogenase, alcohol dehydrogenase or formate dehydrogenase.

5. The genetically engineered bacterium according to claim 4, characterized in that, The glucose dehydrogenase is the glucose dehydrogenase with the NCBI accession number NP_388275.1, the alcohol dehydrogenase is the alcohol dehydrogenase with the Genbank accession number BAN05992.1, and the formate dehydrogenase is the formate dehydrogenase with the Genbank accession number XP_001525545.

1.

6. The genetically engineered bacterium according to any one of claims 1-5, characterized in that, In the genetically engineered bacterium, the CYP gene, ferredoxin gene, ferredoxin reductase gene and dehydrogenase gene are located on a recombinant expression vector, or the CYP gene, ferredoxin gene, ferredoxin reductase gene and dehydrogenase gene are integrated into the genome.

7. The genetically engineered bacterium according to claim 6, wherein The backbone of the recombinant expression vector is plasmid pBAD, pRSFDuet1, pACYCDuet1, pET21a and / or pET28a; And / or, the CYP gene, ferredoxin gene, ferredoxin reductase gene and dehydrogenase gene are located on the same recombinant expression vector, or the CYP gene, ferredoxin gene, ferredoxin reductase gene and dehydrogenase gene are located on different recombinant expression vectors.

8. The genetically engineered bacterium according to claim 7, characterized in that, The CYP gene, ferredoxin gene, ferredoxin reductase gene and dehydrogenase gene are located on two or three recombinant expression vectors.

9. The genetically engineered bacterium according to claim 8, wherein The CYP gene and the ferredoxin gene are located on the same recombinant expression vector, and the ferredoxin reductase gene and the dehydrogenase gene are located on another recombinant expression vector.

10. Use of a gene combination in the preparation of an Escherichia coli genetically engineered bacterium producing calcidiol and / or calcitriol, wherein the Escherichia coli genetically engineered bacterium overexpresses the gene combination, and the gene combination contains CYP gene, ferredoxin gene, ferredoxin reductase gene and dehydrogenase gene; Among them, The amino acid sequence encoded by the CYP gene is shown in SEQ ID NO. 11, the amino acid sequence encoded by the ferredoxin gene is shown in SEQ ID NO. 21, and the amino acid sequence encoded by the ferredoxin reductase gene is shown in SEQ ID NO.

23.

11. Use of a genetically engineered bacterium as described in any one of claims 1 to 9 in the preparation of calcifediol and / or calcitriol.

12. The application according to claim 11, characterized in that, In the said use, the genetically engineered bacterium catalyzes the hydroxylation reaction of vitamin D3 to obtain the calcifediol and / or calcitriol.

13. A method for preparing calcifediol and / or calcitriol, characterized in that, The preparation method comprises the following steps: in the presence of a reaction solvent, oxidized coenzyme NAD + / NADP + and a hydrogen donor, subjecting the genetically engineered bacterium as described in any one of claims 1 to 10 to catalyze the hydroxylation reaction of vitamin D3.

14. The preparation method according to claim 13, characterized in that, The vitamin D3 is vitamin D3 pre-dissolved with a co-solvent; and / or, the preparation method further includes the step of adding hydroxypropyl-β-cyclodextrin to the reaction solvent before carrying out the hydroxylation reaction; and / or, the temperature of the reaction is 20 - 33 °C; and / or, the pH of the reaction is 6.0 - 8.0; and / or, the enzyme activity concentration of the genetically engineered bacterium is 4750 U / L - 94900 U / L; and / or, the concentration of vitamin D3 is 0.5 g / L - 3 g / L; and / or, said NAD + / NADP + The hydrogen donor and vitamin D3 are added to the reaction system in batches; and / or, said NAD + / NADP + has a molar ratio with said vitamin D3 of (0.001 to 0.5):1; and / or, the genetically engineered bacterium exists in the form of a bacterial sludge of the genetically engineered bacterium or an extract of the bacterial sludge of the genetically engineered bacterium.

15. The preparation method according to claim 14, wherein The co-solvent includes one or more of DMSO, Tween 80, Triton X100, methanol, ethanol, and DMF; and / or, the mass-volume percentage of the hydroxypropyl-β-cyclodextrin in the reaction system is 0.05%, 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, or 0.4%; and / or, the temperature of the reaction is 22 °C, 25 °C, 28 °C, or 30 °C; and / or, the pH of the reaction is 6.2, 6.6, 7.0, 7.4, or 7.8; and / or, the enzyme activity concentration of the genetically engineered bacterium is 14940 U / L - 18980 U / L; and / or, the concentration of vitamin D3 is 1.0 g / L, 1.2 g / L, 1.4 g / L, 1.6 g / L, or 1.8 g / L; and / or, said NAD + / NADP + has a molar ratio with said vitamin D3 of 0.1:

1.

16. The preparation method according to claim 15, characterized in that, The enzyme activity concentration of the genetically engineered bacterium is 17420 U / L.

17. The preparation method according to claim 13, characterized in that, The hydrogen donor is glucose, isopropanol, or formate.

18. The preparation method according to any one of claims 13-17, characterized in that, When the dehydrogenase expressed in the genetically engineered bacterium is alcohol dehydrogenase, the hydrogen donor is isopropanol; when the dehydrogenase expressed in the genetically engineered bacterium is glucose dehydrogenase, the hydrogen donor is glucose; When the dehydrogenase expressed in the genetically engineered bacterium is formate dehydrogenase, the hydrogen donor is formate.

Images