A castration-resistant prostate cancer nucleic acid aptamer, screening method and application thereof

By screening for nucleic acid aptamers that specifically target castration-resistant prostate cancer, the problem of early detection of castration-resistant prostate cancer has been solved, enabling the possibility of early treatment and improving treatment effectiveness and patient survival rates.

CN114350667BActive Publication Date: 2026-04-28SECOND AFFILIATED HOSPITAL OF COLLEGE OF MEDICINEOF XIAN JIAOTONG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202110475298.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-04-29
Publication Date
2026-04-28
Estimated Expiration
2041-04-29

AI Technical Summary

Technical Problem

Current technologies cannot detect castration resistance in prostate cancer at the early cellular and molecular level, leading to delayed treatment and failing to effectively slow tumor progression and improve patient survival rates.

Method used

We designed and screened nucleic acid aptamers that specifically target castration-resistant prostate cancer. Through random single-stranded DNA library screening, combined with fluorescent substances, radioactive isotope markers, magnetic nanoparticles, or chemical drugs, we achieved high affinity and specific binding to castration-resistant prostate cancer cells.

Benefits of technology

This technology enables early detection of castration-resistant prostate cancer at the cellular and molecular level, providing the possibility of timely adjustment of treatment plans and improving treatment effectiveness and patient survival rates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114350667B_ABST
    Figure CN114350667B_ABST
Patent Text Reader

Abstract

The application discloses castration-resistant prostate cancer nucleic acid aptamer and a screening method and application thereof, the nucleotide sequence of the aptamer comprises a DNA fragment shown in any one of sequence 1 or sequence 2; the aptamer has the advantages of small molecular weight, low immunogenicity, high affinity and the like; in addition, the screening technology adopted by the nucleic acid aptamer is low in cost, can be mass-produced in vitro, is good in repeatability, and is easy to transport and preserve; and the nucleic acid aptamer can be combined with castration-resistant prostate cancer tissue cells with high affinity and high specificity. The nucleic acid aptamer can be used to early detect the castration-resistant state of prostate cancer from the cellular and molecular level, and has important significance for timely adjusting prostate cancer medication and improving prognosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically, it relates to a castration-resistant prostate cancer nucleic acid aptamer, its screening method, and its application. Background Technology

[0002] Prostate cancer is a malignant tumor of the genitourinary system that seriously threatens the health of men in my country. In the early stages, most prostate cancer patients respond to androgen deprivation therapy. However, after a 3-5 year remission period, approximately 20% of patients will progress from hormone-dependent prostate cancer (ADPC) to castration-resistant prostate cancer (CRPC). CRPC patients are highly susceptible to bone metastasis, resulting in a low 5-year survival rate. Currently, the internationally recognized clinical diagnostic criteria for CRPC are: post-castration serum testosterone levels <50 ng / dL and accompanied by: 1) biochemical progression: three consecutive PSA elevations within one week with PSA >2 ng / ml; or 2) radiographic progression: the appearance of new metastatic lesions; or 3) worsening of patient symptoms. Therefore, the diagnosis of CRPC, both domestically and internationally, is still at the clinical manifestation level and cannot detect the castration-resistant state of prostate cancer at a microscopic level in its early stages. In the early stages of prostate cancer developing into CRPC, early detection at the cellular and molecular level and the provision of effective treatment can slow tumor progression, prolong patient survival, and improve end-stage quality of life.

[0003] Aptamers are oligonucleotides with specific two-dimensional or three-dimensional structures formed by the folding of short-stranded RNA or single-stranded DNA (ssDNA). Similar to antibodies, aptamers can bind to their corresponding targets with high affinity and high specificity. Furthermore, aptamers possess unique advantages such as small molecular weight, low immunogenicity, high tissue permeability, and high stability. Based on these advantages, nucleic acid aptamers have broad application prospects for early tumor diagnosis and targeted therapy. Currently, no nucleic acid aptamers specifically targeting the castration-resistant state of prostate cancer have been reported. Summary of the Invention

[0004] In view of this, the present invention addresses the problems existing in the prior art by providing a castration-resistant prostate cancer nucleic acid aptamer, its screening method and application, providing a new approach and experimental basis for early screening of castration-resistant prostate cancer at the cellular and molecular level.

[0005] To address the aforementioned technical problems, this invention discloses a castration-resistant prostate cancer nucleic acid aptamer, wherein the nucleotide sequence of the aptamer comprises a DNA fragment represented by either Sequence 1 or Sequence 2.

[0006] Preferably, the DNA sequence of the nucleic acid aptamer can selectively link fluorescent substances, radioactive isotope markers, magnetic nanoparticles, chemical drugs, or biotin-streptavidin.

[0007] Preferably, the DNA sequence of the nucleic acid aptamer is methylated, thiolated, aminated, or phosphorylated at a certain position.

[0008] Preferably, the nucleic acid aptamer exhibits good targeting affinity and specificity for castration-resistant prostate cancer cells.

[0009] Preferably, the nucleic acid aptamer can specifically bind to castration-resistant prostate cancer cells.

[0010] Preferably, the nucleic acid aptamer can specifically recognize and bind to castration-resistant prostate cancer tissue.

[0011] This invention also discloses a method for screening nucleic acid aptamers for castration-resistant prostate cancer, comprising the following steps:

[0012] Step 1: Design and synthesize a random single-stranded DNA library and upstream and downstream primers, the sequences of which are as follows:

[0013] Random DNA library:

[0014] 5'-TGCGGCAGTTGAAGCAAGGC(N40)ACGGCAGCACCAGAGAACCA;

[0015] Upstream primer: 5'-TGCGGCAGTTGAAGCAAGGC-3';

[0016] Downstream primer: 5'-TGGTTCTCTGGTGCTGCCGT-3';

[0017] The 5' end of the upstream primer was labeled with FAM, and the 5' end of the downstream primer was labeled with biotin.

[0018] DNA libraries and primers were synthesized using a solid-phase phosphorylated amide method and purified by HPLC.

[0019] Step 2, Template DNA Extraction

[0020] Take a 2OD random single-stranded DNA library, dissolve it thoroughly in 1.2mL of sterile double-distilled water and 0.3mL of binding buffer, denature at 95℃ for 5min, and then in an ice bath for 10min;

[0021] Cell suspensions of hormone-dependent prostate cancer cell line LNCap and castration-resistant prostate cancer cell line C4-2 were prepared separately and subjected to ultrasonic disruption for 60 min. The pretreated cell suspensions were then incubated with random DNA library solution at 37 °C with shaking for 2 h. After washing with sterile PBS, an equal volume of phenol-chloroform-isoamyl alcohol solvent was added and mixed well, followed by centrifugation. The inorganic liquid at the top was transferred and an equal volume of phenol-chloroform-isoamyl alcohol solvent was added again and mixed well. This process was repeated 2-3 times.

[0022] Add 1 / 10 volume of sodium acetate and an equal volume of isopropanol to the obtained product, mix well, freeze at -20℃ for 3 hours, centrifuge, add 75% alcohol pre-cooled at -20℃, centrifuge again, add sterile double-distilled water to resuspend the precipitate, and mix thoroughly.

[0023] Step 3, Target DNA Extraction

[0024] Using the DNA extracted in step 2 as a template, PCR amplification was performed. 1 / 10 volume of sodium acetate and an equal volume of isopropanol were added to the PCR product and mixed well. The mixture was then frozen at -20°C for 3 hours, centrifuged, and the precipitate was resuspended in 75% alcohol pre-cooled at -20°C. After centrifugation, the precipitate was resuspended in Buffer I buffer, boiled in a water bath for 10 minutes, and then quickly transferred to ice for 30 minutes.

[0025] Transfer 50 μL of streptavidin magnetic bead suspension, let it stand on a magnetic separator for 1 min, discard the supernatant, add Buffer I buffer and shake thoroughly to resuspend, magnetically separate, then shake thoroughly to resuspend with the DNA solution that has been in an ice bath for 30 min, magnetically separate, transfer the supernatant and add 1 / 10 volume of sodium acetate and an equal volume of isopropanol, mix well, freeze at -20℃ for 3 h, centrifuge, add pre-cooled 75% ethanol at -20℃ again to resuspend, centrifuge, and the white precipitate is the single-stranded DNA obtained in this round of screening;

[0026] Step 4, screening of nucleic acid aptamers

[0027] Using the single-stranded DNA obtained in step 3 as the library and DNA template for the next round of screening, the operation of step 3 is repeated. Each repetition is one round of screening, and a total of 14 rounds of screening are performed. The white precipitate obtained in the last round is the target DNA, i.e., the nucleic acid aptamer.

[0028] Preferably, the preparation method of the binding buffer is as follows: Weigh 23.83g Hepes, 43.87g NaCl, 1.87g KCl, 0.83g anhydrous CaCl2, and 1.02g MgCl2·6H2O respectively, dissolve them separately in sterile double-distilled water, mix them together, adjust the pH to 7.4 with hydrochloric acid, and finally make up the volume to 1000mL with sterile double-distilled water.

[0029] Preferably, the preparation method of Buffer I is as follows: Tris-HCl, EDTA solution and NaCl are mixed to make the component concentrations reach 10 mmol / L Tris-HCl, 1 mmol / L EDTA and 1 mol / L NaCl respectively. Finally, 1 mL Tween-20 is added and mixed thoroughly, and the pH is adjusted to 7.4.

[0030] In a third aspect of the invention, there is the use of a castration-resistant prostate cancer nucleic acid aptamer in the detection of castration-resistant prostate cancer tissue cells.

[0031] Compared with the prior art, the present invention can achieve the following technical effects:

[0032] The present invention discloses a castration-resistant prostate cancer nucleic acid aptamer, which has advantages such as small molecular weight, low immunogenicity, and high affinity compared with traditional antibodies. In addition, the screening technology used for the nucleic acid aptamer of the present invention is low cost, can be mass-produced in vitro, has good reproducibility, and is easy to transport and store.

[0033] The nucleic acid aptamer of this invention can bind to castration-resistant prostate cancer cells with high affinity and high specificity. Utilizing this nucleic acid aptamer allows for early detection of castration resistance in prostate cancer at the cellular and molecular level, which is of great significance for timely adjustment of prostate cancer medication and improvement of prognosis. Attached Figure Description

[0034] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are used to explain the invention, but do not constitute an undue limitation of the invention. In the drawings:

[0035] Figure 1 The screening process for nucleic acid aptamers in this embodiment of the invention is shown. The peak shapes represent the binding status of the screening products and target cells in the 4th, 8th, 11th and 14th rounds, where A is CRPC-1 and B is CRPC-2.

[0036] Figure 2 This is a schematic diagram of the secondary structure of nucleic acid aptamer CRPC-1 in an embodiment of the present invention;

[0037] Figure 3 This is a schematic diagram of the secondary structure of the nucleic acid aptamer CRPC-2 in an embodiment of the present invention;

[0038] Figure 4 The figures show the dissociation constant curves of nucleic acid aptamers CRPC-1 and CRPC-2 in this embodiment of the invention, where A represents CRPC-1 and B represents CRPC-2.

[0039] Figure 5In this embodiment of the invention, flow cytometry was used to detect the targeting affinity of nucleic acid aptamers CRPC-1 and CRPC-2 for castration-resistant prostate cancer cells, where A is CRPC-1 and B is CRPC-2.

[0040] Figure 6 In this embodiment of the invention, cell immunofluorescence staining was used to detect the targeting affinity of nucleic acid aptamers CRPC-1 and CRPC-2 for castration-resistant prostate cancer cells;

[0041] Figure 7 In this embodiment of the invention, tissue immunofluorescence staining was used to detect the targeting specificity of nucleic acid aptamer CRPC-1 on castration-resistant prostate cancer tissue;

[0042] Figure 8 Aptamer, a molecular probe in this embodiment of the invention. CRPC-1 - MR imaging detection of castration-resistant prostate cancer cells using GoldMag. Detailed Implementation

[0043] The following will describe the implementation of the present invention in detail with reference to the embodiments, so as to fully understand how the present invention uses technical means to solve technical problems and achieve technical effects and to implement it accordingly.

[0044] This invention discloses a specific nucleic acid aptamer for castration-resistant prostate cancer, which helps to solve the current problem of untimely detection and delayed treatment of castration-resistant prostate cancer. It is also simpler to prepare, more stable, and easier to preserve and transport than traditional antibodies.

[0045] This invention uses flow cytometry to monitor the screening process of nucleic acid aptamers. Castration-resistant prostate cancer cells C4-2 were used as target cells, and hormone-dependent prostate cancer cells LNCaP were used as negative selection cells. The results showed that with increasing screening rounds, the fluorescence intensity of the nucleic acid aptamers binding to the target cells gradually increased, indicating that the nucleic acid aptamers screened in this invention can specifically bind to the target cells, and the binding ability gradually increases with the number of screening rounds. By the 14th round of screening, the binding of the nucleic acid aptamers to the target cells tended to saturate.

[0046] This invention discloses a castration-resistant prostate cancer nucleic acid aptamer, the aptamer having a nucleotide sequence composition comprising a DNA fragment shown in either Sequence 1 or Sequence 2.

[0047] Sequence 1:

[0048] 5'-GGATGACGCTCGGATGCCACTACGAGAGCGGTTGTATTTCGAGTGTAAAAGTGTCACCAGCACGTGGCAAACCGTCTGGG-3';

[0049] Sequence 2:

[0050] 5'-AGGCAGACGCCAACGAGGAGGTTGGAGTCTCGTCTGGTTTCCGGATTGAATAGTTCAGGCAAACGCCAGCATCCATGAGC-3'.

[0051] The DNA sequence of this nucleic acid aptamer can selectively link fluorescent substances, radioactive isotope markers, magnetic nanoparticles, chemical drugs, or biotin-streptavidin.

[0052] The DNA sequence of a nucleic acid aptamer is methylated, thiolated, aminated, or phosphorylated at a specific location.

[0053] Regardless of the type of modification, all the above-mentioned nucleic acid aptamer sequences have similar molecular conformations, physicochemical properties, and targeting capabilities to the original nucleic acid aptamer, and can be used to detect castration-resistant prostate cancer tissue cells.

[0054] Example 1: Screening of specific nucleic acid aptamers for castration-resistant prostate cancer

[0055] (1) Design and synthesize random single-stranded DNA libraries and upstream and downstream primers.

[0056] Design and synthesize a random single-stranded DNA library containing 20 nucleotides at both ends and 40 nucleotides in the middle, with the following sequence:

[0057] TGCGGCAGTTGAAGCAAGGC(N40)ACGGCAGCACCAGAGAACCA;

[0058] Upstream primer: 5'-TGCGGCAGTTGAAGCAAGGC-3';

[0059] Downstream primer: 5'-TGGTTCTCTGGTGCTGCCGT-3';

[0060] The 5' end of the upstream primer was labeled with FAM, and the 5' end of the downstream primer was labeled with biotin.

[0061] DNA libraries and primers were synthesized using a solid-phase phosphite amide method and purified by HPLC.

[0062] (2) Template DNA extraction

[0063] Take a 2OD random single-stranded DNA library, dissolve it thoroughly in 1.2mL of sterile double-distilled water and 0.3mL of 5×binding buffer (23.83g Hepes, 43.87g NaCl, 1.87g KCl, 0.83g anhydrous CaCl2, 1.02g MgCl2·6H2O, pH adjusted to 7.4 with hydrochloric acid, and volume brought to 1000mL with sterile double-distilled water), denature at 95℃ for 5min, and incubate on ice for 10min; prepare cell suspensions of hormone-dependent prostate cancer cell line LNCap and castration-resistant prostate cancer cell line C4-2, respectively, and sonicate them for 60min. Incubate the pretreated cell suspensions with the random DNA library solution at 37℃ with shaking for 2h, wash with sterile PBS, add an equal volume of phenol-chloroform-isoamyl alcohol (phenol, chloroform, isoamyl alcohol volume ratio of 125:24:1) solvent, mix well, and centrifuge. The centrifuged liquid separated into three layers: a clear inorganic liquid layer on top, a white protein layer in the middle, and an oily organic layer at the bottom. The upper inorganic liquid was transferred and an equal volume of phenol-chloroform-isoamyl alcohol (phenol, chloroform, isoamyl alcohol volume ratio 125:24:1) was added and mixed thoroughly. This process was repeated 2-3 times. 1 / 10 volume of sodium acetate (3 mol / L) and an equal volume of isopropanol were added to the resulting product and mixed thoroughly. The mixture was then frozen at -20°C for 3 hours, centrifuged, and an appropriate amount of pre-cooled 75% ethanol at -20°C was added. After centrifugation, the precipitate was resuspended in sterile double-distilled water and mixed thoroughly.

[0064] (3) Target DNA extraction

[0065] Using the DNA extracted in step (2) as a template, PCR amplification was performed (C4-2 cell genome was used as the PCR template for positive selection, and LNCap cell genome was used as the PCR template for negative selection). 1 / 10 volume of sodium acetate (3 mol / L) and an equal volume of isopropanol were added to the PCR product and mixed thoroughly. The mixture was then frozen at -20°C for 3 hours, centrifuged, and the precipitate was resuspended in pre-cooled 75% ethanol at -20°C. After centrifugation, the precipitate was resuspended in Buffer I buffer (Buffer I buffer preparation method: mix Tris-HCl, EDTA solution, and NaCl to achieve a concentration of 10 mmol / L Tris-HCl, 1 mmol / L EDTA, and 1 mol / L NaCl, respectively, and finally add 1 mL of Tween-20 and mix thoroughly, adjusting the pH to 7.4). The mixture was boiled in a water bath for 10 minutes, and then quickly transferred to ice for 30 minutes. Transfer 50 μL of streptavidin magnetic bead suspension and let it stand on a magnetic separator for 1 min (this operation will be referred to as "magnetic separation" from now on). Discard the supernatant, add an appropriate amount of Buffer I buffer, vortex thoroughly to resuspend, and perform magnetic separation. Then, vortex thoroughly to resuspend the DNA solution that has been in an ice bath for 30 min, and perform magnetic separation again. Transfer the supernatant, add 1 / 10 volume of sodium acetate (3 mol / L) and an equal volume of isopropanol, mix well, and freeze at -20℃ for 3 h. Centrifuge, add an appropriate amount of pre-chilled 75% ethanol at -20℃ to resuspend, centrifuge again, and the white precipitate is the single-stranded DNA obtained in this round of screening. This is used as the library and DNA template for the next round of screening. Repeat the above "target DNA extraction" steps. Each repetition constitutes one round of screening, and a total of 14 rounds of screening are performed. The white precipitate obtained in the last round is the target DNA, i.e., the nucleic acid aptamer. The screening process of nucleic acid aptamers is monitored using flow cytometry. Figure 1 As shown.

[0066] (4) Nucleic acid aptamer identification

[0067] The DNA products obtained from the final round of screening were amplified and purified by PCR. The PCR products were ligated into the pTOPO vector and transformed into competent E. coli DH5α cells for amplification. Sixty single clones were randomly selected and cultured in LB medium for 12 hours, followed by bacterial PCR. The PCR products were identified by nucleic acid gel electrophoresis. The bacterial samples showing clear target bands were sequenced. After comparative analysis of the sequencing results, the following two single-stranded DNA sequences were finally obtained, which are the nucleic acid aptamers that can be used to detect castration-resistant prostate cancer tissue cells in this embodiment.

[0068] Sequence 1 (named CRPC-1):

[0069] 5'-GGATGACGCTCGGATGCCACTACGAGAGCGGTTGTATTTCGAGTGTAAAAGTGTCACCAGCACGTGGCAAACCGTCTGGG-3';

[0070] Sequence 2 (named CRPC-2):

[0071] 5'-AGGCAGACGCCAACGAGGAGGTTGGAGTCTCGTCTGGTTTCCGGATTGAATAGTTCAGGCAAACGCCAGCATCCATGAGC-3'.

[0072] Predicting the secondary structure of nucleic acid aptamers using RNA structure (http: / / rna.urmc.rochester.edu / RNAstructureWeb / ), such as... Figure 2 and 3 As shown.

[0073] FAM fluorescent groups were labeled at the 5' end of nucleic acid aptamers, and the equilibrium dissociation constant Kd of the aptamers was obtained using a single-point adsorption assay. The equilibrium dissociation constants of the nucleic acid aptamers were calculated by simulating a curve using the formula Y = Bmax × X / (Kd + X), with the geometric mean of flow cytometry fluorescence as the ordinate and the aptamer concentration as the abscissa, according to the equation. The results showed that the equilibrium dissociation constants of the nucleic acid aptamers were all within the nanomolar range, and the equilibrium dissociation constant of CRPC-1 was smaller than that of CRPC-2. Figure 4 As shown.

[0074] Example 2: Detection of the specificity of specific nucleic acid aptamers for castration-resistant prostate cancer

[0075] (1) Flow cytometry detection of cell specificity of nucleic acid aptamers

[0076] Human prostate cancer cell lines LNCap and C4-2 were cultured using standard methods. Prostate cancer cells in logarithmic growth phase were digested with 0.25% trypsin, centrifuged at 800 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in flow cytometry washing buffer. The cells were centrifuged at 1000 rpm for 5 min, blocked with fetal bovine serum at 37°C for 30 min, and thoroughly resuspended in 200 pmol FAM-labeled aptamer CRPC-1 / CRPC-2 solution. The cells were incubated on ice for 30 min, and the specific binding of each cell line to the two aptamers was detected by flow cytometry. The results are as follows: Figure 5 As shown.

[0077] The results showed that both CRPC-1 and CRPC-2 could specifically bind to the castration-resistant prostate cancer cell line C4-2 with high binding fluorescence intensity, but could not bind to the hormone-dependent prostate cancer cell line LNCap. The results indicate that the two selected aptamers have good targeting affinity and specificity for CRPC cells.

[0078] (2) Cell immunofluorescence staining to detect the cell specificity of nucleic acid aptamers

[0079] Similarly, prostate cancer cells in logarithmic growth phase, LNCap and C4-2, were seeded into 20 mm laser confocal microscopy culture dishes and cultured in a cell culture incubator. When the cells fully extended and reached approximately 75% of the bottom area of ​​the culture dish, the supernatant was discarded, and the cells were washed with PBS. 4% paraformaldehyde was added for fixation for 15 min, followed by blocking with 5% BSA at room temperature for 1 h. After washing with PBS, 200 pmol of FAM-labeled nucleic acid aptamer CRPC-1 / CRPC-2 solution was added, and the mixture was incubated at 4°C in the dark for 6-8 h. DAPI (DAPI to PBS solution at a volume ratio of 1:1000) was added for 5 min to stain the cell nuclei. After mounting, the slides were observed under a laser confocal fluorescence microscope to determine the fluorescence display ratio of each cell type. The results are as follows: Figure 6 As shown.

[0080] The results showed that obvious fluorescent markers were visible on the surface of C4-2 cells, while no specific fluorescence was observed on the surface of LNCap cells. This indicates that the selected nucleic acid aptamers can specifically bind to castration-resistant prostate cancer cells.

[0081] (3) Detection of tissue specificity of nucleic acid aptamers by immunofluorescence staining

[0082] Clinical benign prostatic hyperplasia tissue, early prostate cancer tissue, and castration-resistant prostate cancer tissue were collected and fixed in 4% paraformaldehyde. After routine dehydration, clearing, paraffin embedding, and preparation of paraffin tissue blocks, they were cut into 4μm thick sections. After antigen retrieval, 5% BSA was added to the tissue sections to completely cover them, and the sections were blocked at room temperature for 1 hour. Then, a solution of nucleic acid aptamers labeled with the FAM fluorescent group was added to the tissue sections, and the sections were incubated overnight at 4°C in the dark. DAPI (1:1000) was added and incubated at room temperature for 5 minutes to stain cell nuclei. After mounting, the sections were observed under a laser confocal fluorescence microscope to determine the fluorescence display ratio of the three prostate pathological tissues. The results are as follows: Figure 7 As shown.

[0083] The results showed that the nucleic acid aptamers could specifically stain castration-resistant prostate cancer tissue, but the staining of benign prostatic hyperplasia tissue and early prostate cancer tissue was not obvious. The results indicate that the selected nucleic acid aptamers can specifically recognize and bind to castration-resistant prostate cancer tissue.

[0084] Example 3: MR imaging detection of castration-resistant prostate cancer cells using molecular probes constructed by co-coupling nucleic acid aptamers and gold magnetic nanoparticles.

[0085] (1) The molecular probe Aptamer was constructed by co-coupling the nucleic acid aptamer CRPC-1 with gold magnetic nanoparticles. CRPC-1 -GoldMag

[0086] Shake the GoldMag™-CS magnetic nanoparticle suspension thoroughly. Add 200 μL of the suspension to 500 μL of coupling buffer and vortex to mix. Incubate at room temperature for 30 min by rotation and then magnetically separate for 5 min. Take 50 μL each of the thiol-modified nucleic acid aptamer CRPC-1 and the random DNA library, add 500 μL of coupling buffer to each, mix thoroughly, and then add to the gold magnetic nanoparticles. Incubate at 37°C and 220 rpm for 30 min and then magnetically separate. Wash and resuspend the coupling products with 500 μL of PBST buffer, then magnetically separate and discard the supernatant. After washing with PBS, resuspend the coupling products with 600 μL of blocking buffer and block at 37°C and 220 rpm for 1 h. Repeat washing and magnetic separation with PBS. Prepare the control molecular probe ssDNA-GoldMag (ssDNA is random single-stranded DNA) using the same method.

[0087] (2) In vitro investigation of molecular probes for MR imaging of castration-resistant prostate cancer cells

[0088] Prostate cancer cell lines LNCap and C4-2, and the normal human prostate stromal cell line WPMY-1 were seeded into 6-well plates and cultured overnight. Cells were washed three times with PBS, and 10 μL of molecular probes were added to each well. The plates were then incubated for 30 min. Adherent cells were scraped from the wells using a cell scraper and collected into EP tubes. 1 mL of warm agarose gel solution was added to each EP tube, and the mixture was thoroughly mixed and allowed to cool to room temperature until solidified. The EP tubes were then scanned using a T2WI axial scanner with the following parameters: TR 3500 ms, TE 90 ms, FOV 109 mm, slice thickness 2.0 mm, number of slices 8, and an average of 8 acquisitions. After scanning, the MR images were transferred to a post-processing workstation for processing. The signal intensity of each group of samples was measured and compared. The results are as follows: Figure 8 As shown.

[0089] The results showed that the molecular probe Aptamer CRPC-1GoldMag reduced the T2WI signal intensity of castration-resistant prostate cancer cells C4-2, while no significant reduction was observed in the T2WI signal intensity of hormone-dependent prostate cancer cells LNCap (as a cell control group) and normal human prostate stromal cells WPMY-1. Furthermore, the control group molecular probe ssDNA-GoldMag did not reduce the T2WI signal intensity of these cells. These results indicate that Aptamer... CRPC-1 GoldMag has a certain affinity for castration-resistant prostate cancer cells and can be detected by MR imaging.

[0090] The foregoing description illustrates and describes several preferred embodiments of the invention. However, as previously stated, it should be understood that the invention is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the inventive concept described herein through the foregoing teachings or techniques or knowledge in related fields. Any modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the invention should be within the protection scope of the appended claims. <110> The Second Affiliated Hospital of Xi'an Jiaotong University School of Medicine <120> A castration-resistant prostate cancer nucleic acid aptamer, its screening method and application <130> 1 <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 80 <212> DNA <213> Artificial sequence <400> 1 GGATGACGCT CGGATGCCAC TACGAGAGCG GTTTGTATTTC GAGTGTAAAA GTGTCACCAG 60 CACGTGGCAA ACCGTCTGGG 80 <210> 2 <211> 80 <212> DNA <213> Artificial sequence <400> 2 AGGCAGACGC CAACGAGGAG GTTGGAGTCT CGTCTGGTTT CCGGATTGAA TAGTTCAGGC 60 AAACGCCAGC ATCCATGAGC 80

Claims

1. A castration-resistant prostate cancer nucleic acid aptamer, characterized in that, The nucleotide sequence of the aptamer is composed of a DNA fragment shown in either Sequence 1 or Sequence 2.

2. The castration-resistant prostate cancer nucleic acid aptamer according to claim 1, characterized in that, The DNA sequence of the nucleic acid aptamer is selectively linked to fluorescent substances, radioactive isotope markers, magnetic nanoparticles, chemical drugs, or biotin-streptavidin.

3. The castration-resistant prostate cancer nucleic acid aptamer according to claim 1, characterized in that, The DNA sequence of the nucleic acid aptamer is methylated, thiolated, aminated, or phosphorylated at a certain position.

4. The castration-resistant prostate cancer nucleic acid aptamer according to claim 1, characterized in that, The nucleic acid aptamer exhibits good targeting affinity and specificity for castration-resistant prostate cancer cells.

5. The castration-resistant prostate cancer nucleic acid aptamer according to claim 1, characterized in that, The nucleic acid aptamer can specifically bind to castration-resistant prostate cancer cells.

6. The castration-resistant prostate cancer nucleic acid aptamer according to claim 1, characterized in that, The nucleic acid aptamer can specifically recognize and bind to castration-resistant prostate cancer tissue.

7. The use of the castration-resistant prostate cancer nucleic acid aptamer according to any one of claims 1-6 in the preparation of a reagent for detecting castration-resistant prostate cancer tissue cells.

Citation Information

Patent Citations

  • Nucleic acid aptamer and screening method thereof, and application of nucleic acid aptamer in prostate cancer cell strain detection

    CN103642810A

  • Nucleic acid aptamer for detecting human bladder transitional cell carcinoma cells and application of nucleic acid aptamer to preparation of detection preparations

    CN105624166A