Gene marker for identifying rice plants sensitive to photoperiod at flowering
By using the SNP sequences of the Hd1 and Ghd8 genes as gene markers, combined with PCR amplification and sequencing technologies, the sensitivity of rice flowering period to daylight can be rapidly identified, solving the problem of low rice breeding efficiency and realizing an efficient and economical breeding process.
Patent Information
- Application Number
- CN202110012347.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-01-06
- Publication Date
- 2026-06-23
- Estimated Expiration
- 2041-01-06
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene detection and relates to a gene marker for identifying the sensitivity of rice flowering period to sunlight and its application in rice breeding. Background Technology
[0002] The growth period of rice (Oryza sativa L.) refers to the time from germination to seed maturity. Temperature and sunlight in the growing region have a significant impact on the growth period of rice, ranging from 3-4 months to 7-8 months. Furthermore, the length of the growth period is closely related to rice yield.
[0003] Many genes regulate flowering time in rice, with Hd1, Ghd7, and Ghd8 being three major genes. The heading time-regulating gene Hd1 is located on chromosome 6 of rice, encoding 395 amino acids and containing a CCT domain. This gene delays heading under long-day conditions and advances heading under short-day conditions (Yano et al. 1997; Yano et al. 2000). Under long-day conditions, Hd1 promotes Ghd7 expression and forms the Hd1-Ghd7 complex, which binds to the cis-regulatory region of Ehd1, inhibiting Ehd1 expression and lengthening the flowering period. Under short-day conditions, Hd1 competes with the Ghd7 / Ghd8 complex to promote Hd3a / RFT1 expression, thus advancing the flowering period (Nemoto et al. 2016).
[0004] The gene Ghd8 encodes 297 amino acids and is located in the cell nucleus. It is expressed in young leaves, young roots, leaves, leaf sheaths, stems, and young panicles, with the highest expression levels in young leaves and the base of the stem. Its expression pattern is influenced by photoperiod (Feng et al. 2014). Under long-day conditions, Ghd8 delays rice flowering by regulating Ehd1, RFT1, and Hd3a; under short-day conditions, it promotes flowering. Furthermore, Ghd8 upregulates the expression of MOC1, a gene controlling tillering and lateral branching in rice, thereby increasing the number of tillers, primary branches, and secondary branches (Yan et al. 2011). This gene plays a crucial role in photoperiod-regulated flowering, increased rice yield, and chlorophyll synthesis in rice, making it one of the target genes for modern molecular breeding (Feng et al. 2014). Summary of the Invention
[0005] To rapidly breed rice varieties that meet the requirements for day sensitivity during heading / flowering, we designed SNPs targeting the Hd1 and Ghd8 genes, which regulate heading / flowering time. We discovered a specific relationship between these SNPs and day sensitivity during flowering, thus they can serve as gene markers or molecular markers for identifying day sensitivity during flowering. Using these molecular markers, we can rapidly breed target progeny, quickly stabilize families, and quickly select the desired rice varieties that meet the requirements for day sensitivity during flowering. Specifically, this invention includes the following technical solutions.
[0006] A gene marker for identifying the sensitivity of rice flowering period to sunlight includes SNP site sequences selected from the Hd1 gene, SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.
[0007] The aforementioned gene markers may also include SNP site sequences selected from the Ghd8 gene, SEQ ID NO:4 and SEQ ID NO:5.
[0008] Among the above gene markers, when the SNP site sequence of the Hd1 gene is SEQ ID NO:1, it indicates that the flowering period of rice is sensitive to day length, that is, the heading / flowering period of rice is delayed under long-day conditions and advanced under short-day conditions; when the SNP site sequence of the Hd1 gene is SEQ ID NO:2 or SEQ ID NO:3, it indicates that the flowering period of rice is not sensitive to day length, that is, the duration of day length has no significant effect on the heading / flowering period of rice.
[0009] Furthermore, among the above gene markers, when the SNP site sequence of the Ghd8 gene is SEQ ID NO:4, it indicates that the rice flowering period is not sensitive to day length, that is, the day length has no significant effect on the rice heading / flowering period; when the SNP site sequence of the Ghd8 gene is SEQ ID NO:5, it indicates that the rice flowering period is sensitive to day length, that is, the rice heading / flowering period is delayed under long-day conditions and advanced under short-day conditions.
[0010] When using rice genomic DNA as a template for PCR amplification of the SNP site sequence of the Hd1 gene, the primer pair used is:
[0011] Forward primer: TTGCGACAGTAAAAAAGATATTGG (SEQ ID NO:6);
[0012] Reverse primer: TCAGAACCATGGAACAGTACCATAG (SEQ ID NO:7).
[0013] When using rice genomic DNA as a template for PCR amplification of the SNP site sequence of the Ghd8 gene, the primer pair used is:
[0014] Forward primer: AATATTGTTTGTCAAGCACCGGTG (SEQ ID NO:8);
[0015] Reverse primer: ATTGCTCTTTCTCAACTGGATTC (SEQ ID NO:9).
[0016] The aforementioned gene markers can be used to construct a detection model to identify the sensitivity of rice flowering period to daylight.
[0017] Therefore, a second aspect of the present invention is to provide a detection model for identifying the sensitivity of rice flowering period to sunlight, which includes the above-mentioned criteria for judging the sensitivity of rice flowering period to sunlight.
[0018] The aforementioned detection model can be input into a computer, gene detection device such as an ABI 3730 sequencer or an Illumina sequencer, or a gene sequencing platform through programming or mathematical software packages.
[0019] A third aspect of the present invention is to provide a kit for identifying gene markers for rice flowering period sensitivity to daylight, comprising primers SEQ ID NOs:6-7 and / or SEQ ID NOs:8-9.
[0020] Another aspect of the present invention is to provide the use of the above-mentioned gene markers, detection models, and kits in rice variety breeding.
[0021] The gene markers constructed in this invention can accurately predict the extent to which the heading / flowering period of the tested rice is affected by the length of daylight by identifying the sensitivity of rice flowering period to daylight. This effectively guides the breeding of rice varieties and the rapid stabilization of families, and allows for the rapid elimination of rice varieties that do not meet the requirements for daylight sensitivity. This greatly improves the spatiotemporal efficiency of rice breeding and has significant economic implications. Detailed Implementation
[0022] To screen rice varieties that meet the requirements for sensitivity to daylight during heading / flowering, we focused our research on detecting genes (Hd1 and Ghd8 genes) that affect the heading and flowering period of rice. Combining the already determined sensitivity of rice varieties to daylight during heading / flowering, we identified relevant gene markers by sequencing genes and comparing SNP locus sequences.
[0023] In this article, "gene markers" may also be referred to as "molecular markers".
[0024] For the sake of brevity, the "sensitivity of rice to daylight during heading / flowering" can be abbreviated as "photoperiodic response," which generally reflects the strength of the regulation of heading / flowering by the Hd1 and Ghd8 genes, or whether they have the function of regulating heading / flowering.
[0025] SNP stands for Single Nucleotide Polymorphism, which refers to the polymorphism of a nucleic acid sequence caused by changes in a single nucleotide base (including single base conversion, transversion, and single base insertion / deletion, etc.), which is well known in this technical field.
[0026] Compared to traditional rice breeding methods, selecting rice plants using molecular markers offers numerous advantages. Firstly, traditional breeding relies on observing progeny traits, requiring multiple generations and often taking years. Molecular marker-assisted selection provides more stable and reliable results than traditional inoculation experiments. This method allows for rapid purification of offspring, leading to genetic stability. Furthermore, molecular marker identification allows for sampling at the seedling stage, DNA extraction, PCR amplification, and sequencing to identify corresponding SNPs, pinpointing target plants, eliminating others, and improving individual selection efficiency. This meets the needs of high-throughput molecular marker-assisted breeding, enabling the industrialization of molecular breeding.
[0027] By using molecular markers that can predict the sensitivity of flowering period to sunlight, genotypes can be quickly determined through gene testing during the seedling stage, which helps to select the donor and recipient varieties needed for breeding, thereby accelerating the breeding process, improving the efficiency of rice breeding, greatly saving time, labor and land use costs, and significantly increasing land utilization. The spatiotemporal efficiency and economic significance of breeding are obvious.
[0028] In one embodiment, when the present invention identifies gene markers for rice flowering period sensitivity to sunlight and their applications are provided in the form of a kit, the kit may, in addition to various primers, include at least one of the following items: a carrying tool, the space of which is divided into defined spaces for accommodating one or more containers, 96-well plates or strips, such as kits, vials, test tubes, and the like, each containing a single component for the method of the present invention; and an instruction manual, which may be written on the vials, test tubes, and the like, or on a separate piece of paper, or on the outside or inside of the container, such as a paper document with an operation demonstration video app download window, such as a QR code, or the instruction manual may also be in multimedia form, such as a CD, USB flash drive, cloud storage, etc.
[0029] The following examples illustrate the technical effects of the present invention through the screening and verification of gene markers related to the sensitivity of rice flowering period to daylight intensity. It should be understood that the following examples are for illustrative purposes only and are not intended to limit the scope of the invention.
[0030] Unless otherwise specified (e.g., explicitly stated as volume percentage or proportion), all percentages mentioned in the embodiments refer to mass percentages.
[0031] Example
[0032] Instruments: PCR instrument, ABI 3730 sequencer.
[0033] Rice gene donor: The rice variety used in the experiment was donated by the Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences.
[0034] Example 1: Screening of Hd1 gene markers affecting rice flowering period sensitivity to daylight
[0035] 1. The screening of SNP sites in the Hd1 gene includes the following steps:
[0036] 1) Extract genomic DNA from the rice plants to be tested;
[0037] 2) Use primers selected from the table below to perform PCR amplification of rice genomic DNA;
[0038] Primer name Primer sequence (5'-3') Serial Number Hd1-F TTGCGACAGTAAAAAAGATATTGG SEQ ID NO:6 Hd1-R TCAGAACCATGGAACAGTACCATAG SEQ ID NO:7
[0039] The PCR reaction system, in 20 μl increments, consisted of: 2 μl of 10X PCR reaction buffer, 0.8 μl of 25 mM MgSO4, 2 μl of 2 mM dNTPs, 1.2 μl each of 5 μM forward primer (-F) and reverse primer (-R), 20 ng of genomic DNA, 0.4 μl of KOD-Plus polymerase, and ddH2O added to bring the total volume to 20 μl.
[0040] The PCR reaction conditions were as follows: 94℃ pre-denaturation for 2 minutes, 94℃ denaturation for 15 seconds, 55℃ annealing for 30 seconds, 68℃ extension for 1 minute, for a total of 35 cycles; and 68℃ incubation for 5 minutes.
[0041] 3) The PCR product of the SNP site sequence of gene Hd1 was purified and then sequenced using a 3730 sequencer.
[0042] 4) Based on the confirmed sensitivity of rice varieties to daylight during heading / flowering, classify and statistically analyze the genotypes measured, and summarize the genotypes corresponding to the sensitivity, i.e., gene molecular markers.
[0043] The selected SNP site sequences of the Hd1 gene include:
[0044] Hd1-WT (with adjustment function)
[0045] TTGCGACAGTAAAAAAGATATTGGAAGTTTTTCTTATGTATGTAAAATTAAATTAA GCCCATCTATATATCATTGCAGGGTCTCTGACACCTGCAATCTCCTTATGATTCGCATATTTCAGTGACCATTTGCCGATTCCATCTCAGATATCTTTCTCATCAATGGAGGCGGGTAT AGTACCAGACAGCACGGTGATAGATATGCCAAATTCCAGAATCCTGACACCTGCTGGAGCAATCAATCTCTTCTCAGGTCCCTCGCTTCAGATGTCCCTTCACTTCAGCTCCATG GACAGGGAGGCCAGGGTGCTCAGGTACAGGGAGAAGAAGAAGGCCAGGAAGTTTGAGAAGACAATACGTTATGAAACAAGAAAGGCGTATGCAGAGGCACGACCCCGGATC AAGGGCCGTTTCGCCAAGAGATCAGATGTGCAGATCGAAGTGGACCAGATGTTCTCC ACTGCAGCTCTATCTGACGGTAGCTATGGTACTGTTCCATGGTTCTGA(SEQ ID NO:1).
[0046] Hd1 - 2bp (deletion of 2bp, no or weak regulatory function)
[0047] TTGCGACAGTAAAAAAGATATTGGAAGTTTTTCTTATGTATGTAAAATTAAATTAA GCCCATCTATATATCATTGCAGGGTCTCTGACACCTGCAATCTCCTTATGATTCGCATATTTCAGTGACCATTTGCCGATTCCATCTCAGATATCT(Deletion of TT) CTCATCAATGGAGGCGGGTATAGTACCAGACAGCACGGTGATAGATATGCCAAATTCCAGAATCCTGACACCTGCTGGAGCAATCAATCTCTTCTCAGGTCCCTCGCTTCAGATGT CCCTTCACTTCAGCTCCATGGACAGGGAGGCCAGGGTGCTCAGGTACAGGGAGAAG AAGAAGGCCAGGAAGTTTGAGAAGACAATACGTTATGAAACAAGAAAGGCGTATGCAGAGGCACGACCCCGGATCAAGGGCCGTTTCGCCAAGAGATCAGATGTGCAGATCGAAGTGGACCAGATGTTCTCCACTGCAGCTCTATCTGACGGTAGCTATGGTACTGTTCCATGGTTCTGA(SEQ IDNO:2).
[0048] Hd1 - 4bp (Deletion of 4bp, no or weak regulatory function)
[0049] TTGCGACAGTAAAAAAGATATTGGAAGTTTTTCTTATGTATGTAAAATTAAATTAA GCCCATCTATATATCATTGCAGGGTCTCTGACACCTGCAATCTCCTTATGATTCGCATATTTCAGTGACCATTTGCCGATTCCATCTCAGATATCTTTCTCATCAATGGAGGCGGGTAT AGTACCAGACAGCACGGTGATAGATATGCCAAATTCCAGAATCCTGACACCTGCTGG AGCAATCAATCTCTCTCAGGTCCCTCGCTTCAGATGTCCCTTCACTTCAGCTCCATGGACAGGGAGGCCAGGGTGCTCAGGTCAGGGAGAAGAAGAAGGCCAGGAAGTTTG AGAAGACAATACGTTATGAAAC (missing AAGA) AAGGCGTATGCAGAGGCACGACCCCGGATCAAGGGCCGTTTCGCCAAGAGATCAGATGTGCAGATCGAAGTGGACCAGATGTTCTCCACTGCAGCTCTATCTGACGGTAGCTATG GTACTGTTCCATGGTTCTGA (SEQ ID NO: 3).
[0050] 2. Determination of gene markers for the Hd1 gene
[0051] We sequenced the Hd1 gene in 21 rice materials and found that some of them were sensitive to day length during heading / flowering, indicating that their genotypes have a regulatory function. The correspondence between day length sensitivity during heading / flowering and genotype is shown in Table 1.
[0052] Table 1: SNPs of the Hd1 gene in 21 rice materials and their relationship with daylight sensitivity at heading / flowering stage.
[0053] variety genotype Photoperiodic response SNP HP341 No function Insensitive 4bp missing GP134 No function Insensitive 4bp missing HP407 No function Insensitive 4bp missing GP3 No function Insensitive 4bp missing HP119 No function Insensitive 4bp missing HP486 No function Insensitive 4bp missing GP77 No function Insensitive 2bp missing GP22 No function Insensitive 2bp missing XA384 No function Insensitive 2bp missing HP263 No function Insensitive 2bp missing GP62 No function Insensitive 2bp missing GP536 No function Insensitive 2bp missing HP396 Functional sensitive WT HP327 Functional sensitive WT Guanglu Dwarf 4 Functional sensitive WT HP492 Functional sensitive WT Koshihikari Functional sensitive WT GP551 Functional sensitive WT Airborne 131 Functional sensitive WT HP314 Functional sensitive WT HP45 Functional sensitive WT
[0054] As shown in Table 1, the SNP sequence shown in SEQ ID NO:1 (wild-type WT) of the Hd1 gene indicates that the heading / flowering period of the rice variety is sensitive to sunlight; the SNP sequence shown in SEQ ID NO:2 lacking two bases "TT" and the SNP sequence shown in SEQ ID NO:3 lacking four bases "AAGA" indicate that the heading / flowering period of the rice variety is not sensitive to sunlight.
[0055] Example 2: Screening of Ghd8 gene markers affecting rice flowering period sensitivity to daylight
[0056] 1. The screening of SNP sites in the Ghd8 gene includes the following steps:
[0057] 1) Extract genomic DNA from the rice plants to be tested;
[0058] 2) Use primers selected from the table below to perform PCR amplification of rice genomic DNA;
[0059] Primer name Primer sequence (5'-3') Serial Number Ghd8-F AATATGTTTGTCAAGCACCGGTG SEQ ID NO:8 Ghd8-R ATTGCTCTTTCTCAACTGGATTC SEQ ID NO:9
[0060] The PCR reaction system, in 20 μl increments, consisted of: 2 μl of 10X PCR reaction buffer, 0.8 μl of 25 mM MgSO4, 2 μl of 2 mM dNTPs, 1.2 μl each of 5 μM forward primer (-F) and reverse primer (-R), 20 ng of genomic DNA, 0.4 μl of KOD-Plus polymerase, and ddH2O added to bring the total volume to 20 μl.
[0061] The PCR reaction conditions were as follows: 94℃ pre-denaturation for 2 minutes, 94℃ denaturation for 15 seconds, 55℃ annealing for 30 seconds, 68℃ extension for 1 minute, for a total of 35 cycles; and 68℃ incubation for 5 minutes.
[0062] 3) The PCR product of the SNP site sequence of the Ghd8 gene was purified and then sequenced using a 3730 sequencer.
[0063] 4) Based on the confirmed sensitivity of rice varieties to daylight during heading / flowering, classify and statistically analyze the genotypes measured, and summarize the genotypes corresponding to the sensitivity, i.e., gene molecular markers.
[0064] The selected SNP site sequences of the Ghd8 gene include:
[0065] AATATGTTTGTCAAGCACCGGTGAAAATTTTAGTAACAGCTATATATGTGCAGATT GGATTAATTTTTTTTAGGAAAGCTTGAATATTTTTTTTCAGGCTTCTTATGTTTCACTAAACTTATAGAATTTCTAAAATGAGTACTTGC(C / A) CGCATCCTTGATGCAGAGGTCGGATGTTATTTAATCATGTAGAATATTTGCCCGAGCACAACAGAGGAAATGAATCCAGTTGAGAAAGAGCAAT. Therefore, the two SNP site sequences are as follows:
[0066] Ghd8 gene SNP site 1(C)
[0067] AATATGTTTTTTCAAGCACCGGTGAAAATTTTAGTAACAGCTATATATGTGCAGATT GGATTAATTTTTTTTTAGGAAAGCTTGAATATTTTTTTTCAGGCTTCTTATGTTTCACTAAACTTATAGAATTTCTAAAATGAGTACTTGCCCGCATCCTTGATGCAGAGGTCGGATGTT ATTTAATCATGTAGAATATTTGCCCGAGCACAACAGAGGAAATGAATCCAGTTGAGAAAGAGCAAT (SEQ ID NO: 4).
[0068] Ghd8 gene SNP site 2(A)
[0069] AATATGTTTTTTCAAGCACCGGTGAAAATTTTAGTAACAGCTATATATGTGCAGATT GGATTAATTTTTTTTAGGAAAGCTTGAATATTTTTTTTCAGGCTTCTTATGTTTCACTAAACTTATAGAATTTCTAAAATGAGTACTTGCACGCATCCTTGATGCAGAGGTCGGATGTT ATTTAATCATGTAGAATATTTGCCCGAGCACAACAGAGGAAATGAATCCAGTTGAGAAAGAGCAAT (SEQ ID NO: 5).
[0070] 2. Determination of gene markers for the Ghd8 gene
[0071] The Ghd8 gene in 27 rice materials was sequenced, revealing that some exhibited sensitivity to day length during heading / flowering, indicating strong genotypic regulation. The correspondence between day length sensitivity during heading / flowering and genotype is shown in Table 2.
[0072] Table 2: SNPs of the Ghd8 gene in 27 rice materials and their relationship with daylight sensitivity at heading / flowering stage.
[0073] variety Gene function strength SNP GP134 weak C GP536 weak C GP39 weak C GP77 weak C HP314 weak C HP38 weak C XA384 weak C XA85 weak C G78 weak C HP91 weak C Koshihikari weak C HP45 weak C HP103 weak C UR28 weak C HP98 weak C GP640 weak C GP567 weak C HP308 weak C HP14 weak C HP11 weak C Airborne 131 weak C Longjing 31 weak C HP119 powerful A HP341 powerful A Guanglu Dwarf 4 powerful A HP492 powerful A HP486 powerful A
[0074] As shown in Table 2, the SNP sequence shown in SEQ ID NO:4 of the Ghd8 gene indicates that the heading / flowering period of the rice variety is not sensitive to sunlight, and the regulatory function of this genotype is weak; the SNP sequence shown in SEQ ID NO:5 indicates that the heading / flowering period of the rice variety is sensitive to sunlight, and the regulatory function of this genotype is strong.
[0075] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make several improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention.
[0076] References:
[0077] 1. Yano, Harushima Y, Nagamura Y et al., Identification of quantitative trait loci controlling heading date in rice using a high-density linkagemap. Theoretical and Applied Genetics, 1997, 95(7): 1025-1032.
[0078] 2.Yano M, Katayose Y, Ashikari M et al.,Hd1,a Major PhotoperiodSensitivity Quantitative Trait Locus in Rice,Is Closely Related to the Arabidopsis Flowering Time Gene CONSTANS.The Plant Cell,2000,12(12):2473-2484.
[0079] 3.Nemoto Y, Nonoue Y, Yano M, Izawa T.Hd1, a CONSTANS ortholog in rice, functions as an Ehd1 repressor through interaction with monocot-specificCCT-domain protein Ghd7. The Plant Journal, 2016, 86(3): 221-233.
[0080] 4. Yan W, Wang P, Chen H et al. A Major QTL, Ghd8, Plays Pleiotropic Roles in Regulating Grain Productivity, Plant Height, and Heading Date in Rice. Molecular Plant, 2011, 4(2): 319-330.
[0081] 5.Feng Z, Zhang L, Yang C et al. EF8 is involved in photoperiodicflowering pathway and chlorophyll biogenesis in rice. Plant Cell Reports, 2014, 33(12): 2003-2014. sequence list <110> Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences <120> Gene markers for identifying rice flowering period sensitivity to daylight. <130> SHPI2010676 <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> 506 <212> DNA <213> Oryza sativa L. <400> 1 ttgcgacagt aaaaaagata ttggaagttt ttctttatgta tgtaaaatta aattaagccc 60 atctatatat cattgcaggg tctctgacac ctgcaatctc cttatgattc gcatatttca 120 gtgaccattt gccgattcca tctcagatat ctttctcatc aatggaggcg ggtatagtac 180 cagacagcac ggtgatagat atgccaaatt ccagaatcct gacacctgct ggagcaatca 240 atctcttctc aggtccctcg cttcagatgt cccttcactt cagctccatg gacagggagg 300 ccagggtgct caggtacagg gagaagaaga aggccaggaa gtttgagaag acaatacgtt 360 atgaaacaag aaaggcgtat gcagaggcac gaccccggat caagggccgt ttcgccaaga 420 gatcagatgt gcagatcgaa gtggaccaga tgttctccac tgcagctcta tctgacggta 480 gctatggtac tgttccatgg ttctga 506 <210> 2 <211> 504 <212> DNA <213> Oryza sativa L. <400> 2 ttgcgacagt aaaaaagata ttggaagttt ttcttatgta tgtaaaatta aattaagccc 60 atctatatat cattgcaggg tctctgacac ctgcaatctc cttatgattc gcatatttca 120 gtgaccatt gccgattcca tctcagatat ctctcatcaa tggaggcggg tatagtacca 180 gacagcacgg tgatagatat gccaaattcc agaatcctga cacctgctgg agcaatcaat 240 ctcttctcag gtccctcgct tcagatgtcc cttcacttca gctccatgga cagggaggcc 300 agggtgctca ggtacaggga gaagaagaag gccaggaagt ttgagaagac atacgttat 360 gaaacaagaa aggcgtatgc agaggcacga ccccggatca agggccgttt cgccaagaga 420 tcagatgtgc agatcgaagt ggaccagatg ttctccactg cagctctatc tgacggtagc 480 tatggtactg ttccatggtt ctga 504 <210> 3 <211> 502 <212> DNA <213> Oryza sativa L. <400> 3 ttgcgacagt aaaaaagata ttggaagtttt ttcttatgta tgtaaaatta aattaagccc 60 atctatatat cattgcaggg tctctgacac ctgcaatctc cttatgattc gcatatttca 120 gtgaccattt gccgattcca tctcagatat cttctcatc aatggaggcg ggtatagtac 180 cagacagcac ggtgatagat atgccaaatt ccagaatcct gacacctgct ggagcaatca 240 atctcttctc aggtccctcg cttcagatgt cccttcactt cagctccatg gacagggagg 300 ccagggtgct caggtacagg gagaagaaga aggccaggaa gtttgagaag acaatacgtt 360 atgaaacaag gcgtatgcag aggcacgacc ccggatcaag ggccgtttcg ccaagagatc 420 agatgtgcag atcgaagtgg accagatgtt ctccactgca gctctatctg acggtagcta 480 tggtactgtt ccatggttct ga 502 <210> 4 <211> 241 <212> DNA <213> Oryza sativa L. <400> 4 aatatgtttg tcaagcaccg gtgaaaattt tagtaacagc tatatatgtg cagattggat 60 taattttttt taggaaagct tgaatatttt ttttcaggct tcttatgttt cactaaactt 120 atagaatttc taaaatgagt acttgcccgc atccttgatg cagaggtcgg atgttattta 180 atcatgtaga atatttgccc gagcacaaca gaggaaatga atccagttga gaaagagcaa 240 t 241 <210> 5 <211> 241 <212> DNA <213> Oryza sativa L. <400> 5 aatatgtttg tcaagcaccg gtgaaaattt tagtaacagc tatatatgtg cagattggat 60 taattttttt taggaaagct tgaatatttt ttttcaggct tcttatgttt cactaaactt 120 atagaatttc taaaatgagt acttgcacgc atccttgatg cagaggtcgg atgttattta 180 atcatgtaga atatttgccc gagcacaaca gaggaaatga atccagttga gaaagagcaa 240 t 241 <210> 6 <211> 24 <212> DNA <213> Artificial sequence() <400> 6 ttgcgacagt aaaaaagata ttgg 24 <210> 7 <211> 25 <212> DNA <213> Artificial sequence() <400> 7 tcagaaccat ggaacagtac catag 25 <210> 8 <211> twenty three <212> DNA <213> Artificial sequence() <400> 8 aatatgtttg tcaagcaccg gtg 23 <210> 9 <211> twenty three <212> DNA <213> Artificial sequence() <400> 9 attgctcttt ctcaactgga ttc 23
Claims
1. The use of a gene marker in identifying the sensitivity of rice flowering period to daylight, said gene marker comprising gene marker sequences of the Hd1 gene SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, wherein when the gene marker sequence of the Hd1 gene is SEQ ID NO: 1, it indicates that the rice flowering period is sensitive to daylight; when the gene marker sequence of the Hd1 gene is SEQ ID NO: 2 or SEQ ID NO: 3, it indicates that the rice flowering period is not sensitive to daylight.
2. The use as described in claim 1, characterized in that, When using rice genomic DNA as a template for PCR amplification of the Hd1 gene marker, the primer pair used is as follows: Forward primer: TTGCGACAGTAAAAAAGATATTGG (SEQ ID NO: 6); Reverse primer: TCAGAACCATGGAACAGTACCATAG (SEQ ID NO: 7).
3. The use as described in claim 2, characterized in that, The criteria for judging the sensitivity of rice flowering period to sunlight are as follows: when the gene marker sequence of Hd1 gene is SEQ ID NO: 1, it indicates that rice flowering period is sensitive to sunlight; when the gene marker sequence of Hd1 gene is SEQ ID NO: 2 or SEQ ID NO: 3, it indicates that rice flowering period is not sensitive to sunlight.
4. The use as described in claim 3, characterized in that, The judgment criteria are input into a computer, gene detection device, or gene sequencing platform in the form of programming or mathematical software packages.
5. The use of a kit for amplifying gene markers to identify the sensitivity of rice flowering period to daylight, characterized in that, The kit includes primers SEQ ID NO: 6 and SEQ ID NO:
7. When the gene marker sequence is SEQ ID NO: 1, it indicates that the rice flowering period is sensitive to sunlight; when the gene marker sequence is SEQ ID NO: 2 or SEQ ID NO: 3, it indicates that the rice flowering period is not sensitive to sunlight.
6. The use as described in claim 1, characterized in that, The purpose is for rice variety selection.