Anti-mesothelin eribulin antibody-drug conjugates and methods of use

By using an anti-mesothelin antibody conjugate with eribulin (ADC), highly specific targeted delivery and killing of mesothelin carcinoma tissues are achieved, solving the problem of inaccurate eribulin delivery in existing technologies, improving treatment efficiency and reducing toxicity to normal cells.

CN114729042BActive Publication Date: 2026-03-03EISAI R&D MANAGEMENT CO LTD
View PDF 24 Cites 0 Cited by

Patent Information

Application Number
CN202080076659.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-11-07
Filing Date
2020-11-06
Publication Date
2026-03-03
Estimated Expiration
2040-11-06

AI Technical Summary

Technical Problem

Existing technologies have difficulty in targeting and delivering eribulin to cancerous tissues that express mesothelin, and traditional chemotherapy agents have significant toxicity to normal tissues, limiting their therapeutic efficacy.

Method used

Develop anti-mesothelin antibodies or antigen-binding fragments conjugates (ADCs) with eribulin, which are linked through cleavable linkers to achieve highly specific binding to mesothelin and internalization in target cells, releasing eribulin for killing.

Benefits of technology

It improves the targeting of eribulin to cancer cells, reduces its toxicity to normal cells, enhances its anti-tumor activity, and reduces off-target cytotoxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114729042B_ABST
    Figure CN114729042B_ABST
Patent Text Reader

Abstract

Disclosed are antibodies, antigen-binding fragments, and conjugates (e.g., antibody-drug conjugates, such as conjugates comprising eribulin) that bind to mesothelin. The present disclosure is further directed to methods and compositions for treating cancer by administering the compositions provided herein.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This disclosure claims priority to U.S. Provisional Patent Application No. 62 / 932,373, filed November 7, 2019, which is incorporated herein by reference in its entirety.

[0002] This disclosure relates to anti-mesothelin antibodies and their antigen-binding fragments, as well as conjugates such as antibody-drug conjugates (ADCs), such as those containing eribulin, and their use in the treatment and diagnosis of cancers expressing mesothelin and / or suitable for treatment by disrupting microtubules or by administering the compositions disclosed herein.

[0003] Cancer is a leading cause of morbidity and mortality worldwide, with approximately 14 million new cases and 8.2 million cancer-related deaths in 2012. The most common causes of cancer death are: lung cancer (1.59 million deaths); liver cancer (745,000 deaths); stomach cancer (723,000 deaths); colorectal cancer (694,000 deaths); breast cancer (521,000 deaths); and esophageal cancer (400,000 deaths). The number of new cancer cases is projected to rise by approximately 70% over the next two decades, reaching approximately 22 million new cancer cases annually (World Cancer Report 2014).

[0004] Mesothelin (a glycosylphosphatidylinositol (GPI)-anchored cell surface protein) has become an attractive target for antibody-based cancer therapies due to its high expression in various cancer types, including mesothelioma, ovarian cancer, and pancreatic cancer (Tang et al. (2013) Anticancer Agents Med. Chem. 13(2):276-80). Although a full understanding of the biological function of mesothelin is lacking, it has been shown to play a role in tumor adhesion and metastasis in mesothelin gene knockout mice that do not show any detectable phenotype (Bera and Pastan (2000) Mol. Cell Biol. 20(8):2902-6; Rump et al. (2004) J. Biol. Chem. 279(10):9190-8). Mesothelin is also thought to contribute to resistance to certain forms of chemotherapy and to promote tumor progression by having a proliferative effect on cells (Bharadwaj et al. (2011) Mol. Cancer. [Molecular Cancer] 10:106; Li et al. (2008) Mol. Cancer Ther. [Molecular Cancer Therapeutics] 7(2):286-96).

[0005] Recent studies have shown that mesothelin can act as a major regulator of epithelial-mesenchymal metastasis (EMT), a process closely associated with cancer metastasis and recurrence (He et al. (2017). Mol Cancer. [Molecular Cancer] 16:63). Without being bound by theory, it is believed that inhibition of mesothelin (e.g., via anti-mesothelin antibodies, antigen-binding fragments, and / or ADC binding) can reduce EMT by inducing the reverse process of mesenchymal-epithelial metastasis (MET) through inhibition of TGF-β (transforming growth factor β) signaling. Conversely, it is believed that overexpression of mesothelin can drive EMT by inducing a cancer stem cell-like phenotype associated with tumor progression and adverse treatment response (He et al. (2017). Mol Cancer. [Molecular Cancer] 16:63; Koyama et al. (2017). J. Clin. Invest. [Journal of Clinical Research] 127(4):1254-1270).

[0006] A common challenge in cancer therapy is the limited therapeutic index of chemotherapy agents, which result in significant toxicity to normal tissues and thus limit their therapeutic efficacy. One approach to achieving higher specificity in targeting cancer cells is to deliver cytotoxic effects to cells expressing certain tumor-specific antigens using antibodies, while preserving normal cells expressing much lower levels of the antigens or none at all (Awwad et al., Pharmaceuticals (2018) 10(3); Lambert and Berkenblit (2018) 69:191-207). Such tumor-specific targeting can be used to increase antitumor activity and reduce off-target cytotoxicity of the therapeutic agent. Antibodies targeting tumor-specific antigens can deliver cytotoxic effects through a variety of mechanisms, including inhibiting the biological activity of the antigens, inducing immune effector activity, and / or inducing antibody-dependent cytotoxicity (Hendrinks et al., International Review of Cell and Molecular Biology (2017); Therapeutic Antibody Engineering (2012):163-196,459-595).

[0007] Antibody-based therapies, which select tumor-specific antigens, can involve the specific expression of antigens by tumor cells and the stable killing of tumor cells expressing those antigens. High levels of mesothelin have been found in several human cancers, including lung cancer, ovarian cancer, pancreatic cancer, and gastric cancer (Hassan et al., Eur. J. Cancer [European Journal of Cancer] (2008) 44(1):46-53; Hassan et al., J. Clin. Oncol. [Journal of Clinical Oncology] (2016) 34(34):4171-4179). Mesothelin expression has also been found in drug-resistant cancers, such as lung cancer with KRAS and STK11 mutations and poor clinical response to checkpoint blockade immunotherapy, and HER2-negative gastric cancer. Furthermore, the correlation between mesothelin expression and overall survival in patients with lung adenocarcinoma and those with gastric cancer metastases has been reported, suggesting that high mesothelin expression may be a predictor of poor clinical outcomes (Kachala et al. (2014) Clin. Cancer. Res. 20(4):1020-1028; Han et al. (2017) J. Pathol. Transl. Med. 51(2):122-128). The prevalence of mesothelin expression in human cancers and its association with poor clinical outcomes makes mesothelin a potential target for tumor antigen-specific drug delivery methods, such as antibody-mediated approaches. Antibodies conjugated with cytotoxic compounds such as chemotherapeutic agents have also been investigated to enhance the cytotoxic activity of antibody-based drug delivery to tumor cells. However, there is still a need for suitable antibodies and / or ADCs that provide a combination of effective tumor targeting, on-target effects, bystander killing, and / or reduced off-target effects.

[0008] Eribulin is a synthetic analogue of the macrocyclic compound leucospirin B, and has previously been shown to be a potent inhibitor of tubulin polymerization, microtubule assembly, and tubulin-dependent GTP hydrolysis. Tubulin constitutes a dynamic filamentous cytoskeleton protein called microtubules, which participate in a variety of important cellular functions, including intracellular migration and transport, cell signaling, maintenance of cell shape, and cell division. The rapid division rate of cancer cells makes them particularly sensitive to the blockage of tubulin function. Therefore, leucospirin B and eribulin have shown significant anticancer activity in vitro and in vivo (Tan et al. (2009) Clin Cancer Res. 15(12):4213-4219; Vahdat et al. (2009) J. Clin. Oncol. 27(18):2954-2961). Eribulin mesylate (eribulin mesylate) is currently marketed under the brand name Halaven. TM It is sold for the treatment of patients with refractory metastatic breast cancer.

[0009] While the use of eribulin has been reported in the art (including in the context of ADCs), there remains a need for better targeted delivery of eribulin to specific tissues, such as cancerous tissues expressing mesothelin. Similarly, there remains a need in the art for improved mesothelin-binding antibodies with superior properties, for example, in their ability to bind antigens and / or efficiently deliver payloads (such as eribulin) to target cells or tissues expressing mesothelin.

[0010] In various embodiments, this disclosure partially provides novel antibodies and antigen-binding fragments that can be used alone, linked to one or more other agents (e.g., ADCs), or as part of a larger macromolecule (e.g., a bispecific antibody, a multispecific antibody, alone or as part of a multispecific antibody loaded in the form of an ADC) and administered as part of a pharmaceutical composition or combination therapy. In some embodiments, the antibody or antigen-binding fragment is humanized. In some embodiments, the antibody or antigen-binding fragment contains a minimal sequence derived from a non-human immunoglobulin and retains the reactivity of the non-human antibody while exhibiting less immunogenicity in humans. In some embodiments, the antibody and antigen-binding fragment may be suitable for treating human cancer patients.

[0011] In various embodiments, this disclosure more specifically relates to antibodies and antibody-drug conjugates capable of binding to and / or killing tumor cells. In various embodiments, the ADC complex is also capable of internalization into target cells after binding. ADC compounds comprising a linker that links the eribulin drug portion to the antibody portion are disclosed. The antibody portion may be a full-length antibody or an antigen-binding fragment.

[0012] In some embodiments, the antibody or antigen-binding fragment disclosed herein comprises: three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:1 (HCDR1), SEQ ID NO:2 (HCDR2), and SEQ ID NO:3 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:4 (LCDR1), SEQ ID NO:5 (LCDR2), and SEQ ID NO:6 (LCDR3), as defined by the Kabat numbering system (Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991))); or three heavy chain complementarity-determining regions (HCDRs) containing SEQ ID NO:7 (HCDR1), SEQ ID NO:8 (HCDR2), and SEQ ID NO:9 (HCDR3). The amino acid sequence of NO:9 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:10 (LCDR1), SEQ ID NO:11 (LCDR2), and SEQ ID NO:12 (LCDR3), as identified by the IMGT numbering system (International Immunogenetic Information System). Defined as )).

[0013] In some embodiments, the antibody or antigen-binding fragment disclosed herein comprises three heavy chain complementarity-determining regions (HCDRs) derived from the heavy chain variable region comprising the amino acid sequence of SEQ ID NO:13; and three light chain complementarity-determining regions (LCDRs) derived from the light chain variable region comprising the amino acid sequence of SEQ ID NO:14.

[0014] In some embodiments, the antibody or antigen-binding fragment disclosed herein is an anti-mesothelin antibody or antigen-binding fragment. In various embodiments, the antibody or antigen-binding fragment comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:13; and a light chain variable region comprising the amino acid sequence of SEQ ID NO:14 or a sequence at least 90% identical to the disclosed sequence. In various embodiments, the antibody or antigen-binding fragment comprises: a human IgG1 heavy chain constant region comprising the amino acid sequence of SEQ ID NO:15; and a human Igκ light chain constant region comprising the amino acid sequence of SEQ ID NO:16. In various embodiments, the antibody or antigen-binding fragment comprises the heavy chain amino acid sequence of SEQ ID NO:17 and the light chain amino acid sequence of SEQ ID NO:18.

[0015] In various embodiments, the antibody or antigen-binding fragment disclosed herein comprises: three heavy chain complementarity-determining regions (HCDRs) containing amino acid sequences encoded by the nucleic acid sequences of SEQ ID NO:19 (HCDR1), SEQ ID NO:20 (HCDR2), and SEQ ID NO:21 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing amino acid sequences encoded by the nucleic acid sequences of SEQ ID NO:22 (LCDR1), SEQ ID NO:23 (LCDR2), and SEQ ID NO:24 (LCDR3), as defined by the Kabat numbering system; or three heavy chain complementarity-determining regions (HCDRs) containing amino acid sequences encoded by the nucleic acid sequences of SEQ ID NO:25 (HCDR1), SEQ ID NO:26 (HCDR2), and SEQ ID NO:27 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing amino acid sequences encoded by the nucleic acid sequences of SEQ ID NO:28 (LCDR1), SEQ ID NO:29 (LCDR2), and SEQ ID NO:21 (HCDR3). The amino acid sequence encoded by the nucleic acid sequence NO:30 (LCDR3) is as defined by the IMGT numbering system.

[0016] In various embodiments, the antibody or antigen-binding fragment comprises: a heavy chain variable region comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:31; and a light chain variable region comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:32. In various embodiments, the antibody or antigen-binding fragment comprises: a heavy chain constant region comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:33; and a light chain constant region comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:34. In various embodiments, the antibody or antigen-binding fragment comprises: a heavy chain comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:35; and a light chain comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:36.

[0017] In some embodiments, the antibody or antigen-binding fragment is a full-length antibody. In some embodiments, the antibody or antigen-binding fragment is a monospecific antibody or antigen-binding fragment, a bispecific antibody or antigen-binding fragment, or a multispecific antibody or antigen-binding fragment. In some embodiments, the antibody or antigen-binding fragment is a single-chain variable fragment (scFv) or a Fab fragment.

[0018] In various embodiments, the antibody or antigen-binding fragment is conjugated to a therapeutic agent, such as one or more small molecules and / or other antibody or antigen-binding fragments. In some embodiments, the therapeutic agent is eribulin. In some embodiments, the antibody or antigen-binding fragment is 345A12-HC15-LC4.

[0019] In various embodiments, the ADC disclosed herein includes formula (I):

[0020] Ab-(LD) p (I)

[0021] in

[0022] Ab is an antibody or antigen-binding fragment capable of binding to mesothelin and comprising: three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:1 (HCDR1), SEQ ID NO:2 (HCDR2), and SEQ ID NO:3 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:4 (LCDR1), SEQ ID NO:5 (LCDR2), and SEQ ID NO:6 (LCDR3), as defined by the Kabat numbering system; or three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:7 (HCDR1), SEQ ID NO:8 (HCDR2), and SEQ ID NO:9 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:10 (LCDR1), SEQ ID NO:11 (LCDR2), and SEQ ID NO:12 (LCDR3), as defined by the IMGT numbering system;

[0023] D represents a therapeutic agent, such as eribulin;

[0024] L is a pyrolytic linker that covalently connects Ab to D; and

[0025] p is an integer from 1 to 8.

[0026] In some embodiments, p is an integer from 1 to 6. In some embodiments, p is 2 or 6.

[0027] In some embodiments, the ADC includes a cleavable adapter comprising a cleavable portion that is positioned such that, upon cleavage, any portion of the adapter or antibody or antigen-binding fragment does not remain bound to a therapeutic agent (e.g., eribulin). In some embodiments, the cleavable adapter comprises a cleavable peptide portion that can be cleaved by an enzyme (e.g., cathepsin B). In some embodiments, the cleavable portion comprises a cleavable peptide portion, such as an amino acid unit, like Val-Cit. In some embodiments, the amino acid unit comprises valine-citrulline (Val-Cit).

[0028] In some embodiments, the cleavable linker includes at least one spacer subunit containing at least one PEG portion. In some embodiments, the spacer subunit or linker includes (PEG)2. In some embodiments, the spacer subunit is linked to the antibody portion via a maleimide (Mal) portion (“Mal-spacer subunit”). In some embodiments, the Mal-spacer subunit is attached to the antibody or antigen-binding fragment via a cysteine ​​residue (e.g., an LCcys80 residue on the antibody). In some embodiments, the Mal-spacer subunit is attached to a cysteine ​​residue (e.g., LCcys80) in the light chain variable region of the antibody or antigen-binding fragment. In some embodiments, p is 2, such that two -LD portions are attached to the antibody or antigen-binding fragment. In some embodiments, each -LD portion is attached to a cysteine ​​residue (e.g., LCcys80) in the light chain variable region of the antibody or antigen-binding fragment. In some embodiments, the cysteine ​​residue is LCcys80, which is the cysteine ​​residue at amino acid position 80 in the light chain variable region of the antibody or antigen-binding fragment according to the Kabat numbering system. In some embodiments, the cleavable adapter includes a Mal-spacer subunit and a cleavable peptide portion, wherein the cleavable peptide portion includes Val-Cit. In some embodiments, the Mal-spacer subunit links an antibody or antigen-binding fragment to the cleavable portion.

[0029] In some embodiments, the Mal-spacer subunit comprises at least one PEG portion. In some embodiments, the adapter comprises Mal-(PEG)2. In some embodiments, the Mal-spacer subunit links an antibody portion to a cleavable portion in the adapter. In some embodiments, the cleavable portion in the adapter is a cleavable peptide portion, such as an amino acid unit. In some embodiments, the adapter comprises Mal-(PEG)2-Val-Cit.

[0030] In some embodiments, the cleavable portion of the ADC binds directly to eribulin, or a spacer unit connects the cleavable portion in the adapter to the eribulin drug portion, and cleavage of the conjugate releases eribulin from the antibody or antigen-binding fragment and the adapter.

[0031] In some embodiments, the spacer subunit connecting the cleavable portion to the eribulin drug portion is self-ablating. In some embodiments, the self-ablating spacer subunit comprises p-aminobenzyloxycarbonyl (pAB). In some embodiments, the pAB spacer subunit connects the cleavable portion to the eribulin drug portion via a C-35 amine. In some embodiments, the cleavable portion is a cleavable peptide portion, such as an amino acid unit. In some embodiments, the cleavable linker comprises Val-Cit-pAB. In some embodiments, the linker comprises Val-Cit-pAB and a PEG spacer subunit that binds the linker to the antibody portion via a Mal portion. In some embodiments, the linker comprises Mal-(PEG)2-Val-Cit-pAB.

[0032] In various embodiments, the antibody or antigen-binding fragment of the ADC comprises a human heavy chain and light chain variable region framework, or a human heavy chain and light chain variable region framework having one or more reversion mutations. In various embodiments, the antibody or antigen-binding fragment of the ADC comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:13 or at least 90% identical to the amino acid sequence of SEQ ID NO:13; and a light chain variable region comprising the amino acid sequence of SEQ ID NO:14 or at least 90% identical to the amino acid sequence of SEQ ID NO:14. In various embodiments, the antibody or antigen-binding fragment of the ADC comprises: a human IgG1 heavy chain constant region comprising the amino acid sequence of SEQ ID NO:15; and a human Igκ light chain constant region comprising the amino acid sequence of SEQ ID NO:16. In various embodiments, the antibody or antigen-binding fragment of the ADC comprises the heavy chain amino acid sequence of SEQ ID NO:17 and the light chain amino acid sequence of SEQ ID NO:18.

[0033] In various embodiments, the ADC has equation (I):

[0034] Ab-(LD) p (I)

[0035] in

[0036] Ab is an antibody or antigen-binding fragment capable of binding to mesothelin and comprising: three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:1 (HCDR1), SEQ ID NO:2 (HCDR2), and SEQ ID NO:3 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:4 (LCDR1), SEQ ID NO:5 (LCDR2), and SEQ ID NO:6 (LCDR3), as defined by the Kabat numbering system; or three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:7 (HCDR1), SEQ ID NO:8 (HCDR2), and SEQ ID NO:9 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:10 (LCDR1), SEQ ID NO:11 (LCDR2), and SEQ ID NO:12 (LCDR3), as defined by the IMGT numbering system;

[0037] D stands for Eriblin;

[0038] L is a pyrolytic linker containing Mal-(PEG)2-Val-Cit-pAB; and

[0039] p is an integer from 1 to 8, for example, p is an integer from 2 to 6 or from 3 to 4.

[0040] In some embodiments, p is an integer from 1 to 6. In some embodiments, p is 2 or 6.

[0041] In various embodiments, the antibody or antigen-binding fragment of the ADC (e.g., the ADC described above) comprises a human heavy chain and light chain variable region framework, or a human heavy chain and light chain variable region framework having one or more reversion mutations. In various embodiments, the antibody or antigen-binding fragment of the ADC comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:13 or at least 90% identical to SEQ ID NO:13; and a light chain variable region comprising the amino acid sequence of SEQ ID NO:14 or at least 90% identical to SEQ ID NO:14. In various embodiments, the antibody or antigen-binding fragment of the ADC comprises: a human IgG1 heavy chain constant region comprising the amino acid sequence of SEQ ID NO:15; and a human Igκ light chain constant region comprising the amino acid sequence of SEQ ID NO:16. In various embodiments, the antibody or antigen-binding fragment of the ADC comprises the heavy chain amino acid sequence of SEQ ID NO:17 and the light chain amino acid sequence of SEQ ID NO:18.

[0042] In various embodiments, the ADC has Equation I:

[0043] Ab-(LD) p (I)

[0044] Wherein Ab is an antibody or antigen-binding fragment, wherein the antibody or antigen-binding fragment is capable of binding to mesothelin and includes a heavy chain variable region, the heavy chain variable region including the amino acid sequence of SEQ ID NO:13; and a light chain variable region, the light chain variable region including the amino acid sequence of SEQ ID NO:14;

[0045] D stands for Eriblin;

[0046] L is a pyrolytic linker containing Mal-(PEG)2-Val-Cit-pAB; and

[0047] p is an integer from 1 to 8, for example, p is an integer from 2 to 6 or from 3 to 4.

[0048] In some embodiments, p is an integer from 1 to 6. In some embodiments, p is 2 or 6.

[0049] In some embodiments, the antibody or antigen-binding fragment of the ADC comprises a human IgG1 heavy chain constant region and a human Igκ light chain constant region. In some embodiments, the antibody or antigen-binding fragment comprises: an IgG1 heavy chain constant region comprising the amino acid sequence of SEQ ID NO:15; and an Igκ light chain constant region comprising the amino acid sequence of SEQ ID NO:16. In some embodiments, the antibody or antigen-binding fragment comprises: a heavy chain comprising the amino acid sequence of SEQ ID NO:17; and a light chain comprising the amino acid sequence of SEQ ID NO:18.

[0050] In various embodiments, this document provides pharmaceutical compositions comprising the antibody, antigen-binding fragment, conjugate, and / or ADC composition described herein. In some embodiments, the pharmaceutical composition comprises one or more antibodies or antigen-binding fragments described herein and / or one or more ADCs and at least one pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises multiple copies of the antibody, antigen-binding fragment, and / or ADC. In some embodiments, the pharmaceutical composition comprises multiple copies of the ADC disclosed herein, wherein the average p-value of the ADC is from about 1 to about 6. In some embodiments, the average p-value of the ADC in the composition is from about 1.7 or 2 or about 6.

[0051] In various embodiments, this document provides therapeutic use of the antibodies, antigen-binding fragments, conjugates, and / or ADC compositions, for example, in treating cancer. In some aspects, this disclosure provides a method of treating cancers expressing an antigen targeted by an antibody portion of an antibody, antigen-binding fragment, and / or conjugate, or ADC, such as mesothelin. In some aspects, this disclosure provides a method of killing tumor cells or cancer cells or inhibiting their proliferation by administering a therapeutically effective amount of the antibodies, antigen-binding fragments, conjugates, and / or ADCs and / or any of them described herein. In some embodiments, the cancer is a mesothelin-expressing cancer, such as mesothelioma, breast cancer, cervical cancer, colorectal cancer, endometrial cancer, head and neck cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer), ovarian cancer (e.g., serous or clear cell ovarian cancer), pancreatic cancer, prostate cancer, kidney cancer, gastric cancer, thyroid cancer, urethral cancer, uterine cancer, bile duct cancer, or leukemia.

[0052] In some aspects, this disclosure provides for use against the antibodies, antigen-binding fragments, conjugates, and / or ADC compounds and compositions described herein, for example, to determine whether a subject with or suspected of having cancer (e.g., mesothelin-expressing cancer) will respond to treatment with an agent targeting mesothelin, such as the antibody or antibody-binding fragment, conjugate, or ADC disclosed herein. In some embodiments, the method includes providing a biological sample from a subject; contacting the sample with an antibody or antigen-binding fragment disclosed herein; and detecting the binding of the antibody or antigen-binding fragment to one or more cancer cells in the sample.

[0053] In some other aspects, this disclosure provides pharmaceutical compositions comprising an antibody or antibody-binding fragment, conjugate, and / or ADC, and pharmaceutically acceptable diluents, carriers, and / or excipients. Methods for generating the disclosed antibody or antibody-binding fragment, conjugate, or ADC compounds and compositions are also provided.

[0054] In some embodiments, a nucleic acid sequence encoding an antibody or antigen-binding fragment, conjugate, or ADC disclosed herein is provided. One or more nucleic acids may be in the form of isolated nucleic acids, incorporated into a nucleic acid contained in an isolated vector, and / or in the form of an antibody or antigen-binding fragment expressed by a cell population under conditions suitable for generating an antibody or antigen-binding fragment. Attached Figure Description

[0055] Figure 1 This demonstrates the specific reactivity of immune serum against human mesothelin detected by flow cytometry.

[0056] Figure 2 This demonstrates the specific reactivity of culture supernatant to human mesothelin detected by ELISA.

[0057] Figure 3This shows the In-Fusion PCR amplification of anti-mesothelin antibody by gel electrophoresis.

[0058] Figure 4 Showing the anti-mesothelin clone used for In-Fusion cloning and expression.

[0059] Figure 5 This is a summary of 48 purified Rb-hu-xi anti-mesothelin antibodies.

[0060] Figure 6 In vitro cell-based efficacy results are presented for the anti-mesothelin-AuF conjugate.

[0061] Figure 7 This demonstrates the epitope binning characterization of anti-mesothelin antibodies.

[0062] Figure 8 The results of DSC analysis of the humanized 345A12 antibody are shown. Thermal analysis of the 345A12F(ab')2 fragment was performed at a scan rate of 100 °C / hour in the range of 25–100 °C.

[0063] Figure 9 This demonstrates the stability of MORAb-109(345A12-HC15-LC4-VCP-Eribulin)(DAR2) in various matrices.

[0064] Figure 10A and Figure 10B The antitumor effect was demonstrated in a human non-small cell lung cancer (NSCLC) NCI-H2110 xenograft model treated with either 2.5 mg / kg of 345A12-HC1-LC2-diOH eribulin dimer ADC or 2.5 mg / kg of 102A6A2-HC1-LC2-diOH eribulin dimer ADC. Figure 10A ) and weight changes ( Figure 10B (Research M109-004-2016).

[0065] Figure 11A and Figure 11B The results show the use of 345A12-HC1-LC2-diOH iribulin dimer ADC (5, 10, 15 or 20 mg / kg) ( Figure 11A ) or 345A12-HC15-LC4-diOH eribulin dimer ADC (5, 10 or 20 mg / kg) Figure 11B Changes in body weight in female CD-1 mice treated with ) (Study M109-006-2017).

[0066] Figure 12A and Figure 12BThe antitumor effect was demonstrated in a human NSCLC NCI-H2110 xenograft model treated with either 2.5 mg / kg of 345A12-HC10-LC4-diOH eribulin dimer ADC or 2.5 mg / kg of 345A12-HC15-LC4-diOH eribulin dimer ADC. Figure 12A ) and weight changes ( Figure 12B (Research M109-007-2017).

[0067] Figure 13A and Figure 13B This demonstrates the antitumor effect in a human gastric cancer NCI-N87 xenograft model treated with MORAb-109 (DAR2 or DAR6). Figure 13A ) and weight changes ( Figure 13B (Research M109-010-2018).

[0068] Figure 14A and Figure 14B The antitumor effect was demonstrated in a human mesothelioma HAY xenograft model treated with MORAb-109 (DAR2 or DAR6) or eribulin. Figure 14A ) and weight changes ( Figure 14B (Research M109-010-2018).

[0069] Figure 15A and Figure 15B The antitumor effects were demonstrated in a human mesothelioma PDX model (Meso7212) treated with MORAb-109 (DAR6) or eribulin. Figure 15A ) and weight changes ( Figure 15B ).

[0070] Figure 16A and Figure 16B The antitumor effects shown in a human mesothelioma PDX model (Meso7212) treated with different DAR species of MORAb-109 or eribulin. Figure 16A ) and weight changes ( Figure 16B ).

[0071] Figure 17 This study demonstrates the in vitro efficacy (IC50) of different cell lines for interstitial nerve protein (MSLN) expression compared to eribulin and MORAb-109 (DAR2 and DAR6). 50 Correlation analysis was performed among all 51 cell lines and a subgroup of cell lines with higher mesothelin expression levels (FACS staining with mean fluorescence intensity (MFI) equal to or >80). Subgroups excluded cell lines with lower mesothelin expression levels (FACS staining with MFI <80).

[0072] Figure 18A -C indicates the antitumor effect in a human gastric cancer NCI-N87 xenograft model treated with different doses of MORAb-109 (DAR2) ranging from 5 mg / kg to 25 mg / kg. Figure 18A and Figure 18B ) and weight changes ( Figure 18C ).

[0073] Figure 19 The concentrations (μg / mL) of total and intact MORAb-109(DAR2) in mice with NCI-N87 tumors are shown after treatment with different doses of MORAb-109(DAR2) ranging from 5 mg / kg to 25 mg / kg.

[0074] Figure 20A and Figure 20B The antitumor effect was demonstrated in a human ovarian cancer OVCAR-3-A1-T1 xenograft model treated with MORAb-109 (DAR2) (5 mg / kg) or eribulin (0.1 or 3.2 mg / kg). Figure 20A ) and weight changes ( Figure 20B ).

[0075] Figure 21A and Figure 21B The antitumor effect was demonstrated in a human NSCLC PDX model (LC-F-25) treated with MORAb-109 (DAR2) (10 mg / kg) or eribulin (0.1 or 3.2 mg / kg). Figure 21A ) and weight changes ( Figure 21B ).

[0076] Figure 22A and Figure 22B The antitumor effect was demonstrated in a human NSCLC PDX model (LXFA-737) treated with MORAb-109 (DAR2) (10 mg / kg) or eribulin (0.2 or 3.2 mg / kg). Figure 22A ) and weight changes ( Figure 22B ).

[0077] Figure 23A and Figure 23B The antitumor effect was demonstrated in a human gastric cancer NCI-N87 xenograft model treated with a single dose of 10 mg / kg MORAb-109 (DAR2 or DAR6) (3 mice / group). Figure 23A ) and weight changes ( Figure 23B ).

[0078] Figure 24A and Figure 24B The levels of MORAb-109(DAR2) in plasma samples from mice carrying NCI-N87 tumors were shown to be lower after treatment with a single dose of 10 mg / kg MORAb-109 (DAR2 or DAR6). Figure 24A ) or MORAb-109 (DAR6) ( Figure 24B ) of DAR.

[0079] Figure 25A and Figure 25B MORAb-109(DAR2) on NCI-N87 gastric cancer cells (shown) Figure 25A ) or BAY 94-9343 ( Figure 25B Cytotoxicity (kill rate %) of the anti-MSLN ADC was assessed alone and in the presence of the unconjugated antibody.

[0080] As measured by luciferase assay Figure 26A and Figure 26B Display MORAb-109 (DAR2) and 345A12-HC15-LC4 ( Figure 26A Or BAY 94-9343 and anetumab ( Figure 26B ADCC activity was measured. ADCC activity was calculated using the relative area under the curve (AUC).

[0081] Figure 27 Stability analysis of anti-MSLN ADC, MORAb-109(DAR2), and BAY 94-9343 in mouse and human plasma.

[0082] Figure 28A and Figure 28B The antitumor effects were demonstrated in a human gastric cancer NCI-N87 xenograft model treated with MORAb-109 (DAR2) (5 mg / kg), BAY 94-9343 (5 mg / kg), or eribulin (1 mg / kg). Figure 28A ) and weight changes ( Figure 28B ).

[0083] Figure 29A and Figure 29B The antitumor effects were demonstrated in a human mesothelioma HAY xenograft model treated with MORAb-109 (DAR2) (5 mg / kg), BAY 94-9343 (5 mg / kg), or eribulin (1 mg / kg). Figure 29A ) and weight changes ( Figure 29B ).

[0084] Figure 30A and Figure 30BThe antitumor effects were demonstrated in a human mesothelioma PDX model (Meso7212) treated with MORAb-109 (DAR2) (10 mg / kg), BAY 94-9343 (10 mg / kg), eribulin (1 mg / kg), or DM4 (0.3 mg / kg). Figure 30A ) and weight changes ( Figure 30B ).

[0085] Figure 31A and Figure 31B The antitumor effects were demonstrated in a human NSCLC PDX model (LXFA-586) treated with MORAb-109 (DAR2) (25 mg / kg), BAY 94-9343 (DAR approx. 4) (25 mg / kg), or eribulin (3.2 mg / kg). Figure 31A ) and weight changes ( Figure 31B ).

[0086] Figure 32A and Figure 32B The antitumor effects were demonstrated in a human NSCLC PDX model (LXFL-529) treated with MORAb-109(DAR2) (25 mg / kg), MORAb-109(DAR2) (12.5 mg / kg), MORAb-109(DAR2) (12.5 mg / kg, QWx3), BAY 94-9343 (DAR approx. 4) (12.5 mg / kg), or eribulin (3.2 mg / kg). Figure 32A ) and weight changes ( Figure 32B ). Detailed Implementation

[0087] The disclosed compositions and methods can be more readily understood by referring to the following detailed description, which forms part of this disclosure, in conjunction with the accompanying drawings. It should be understood that, unless the context otherwise indicates, the terminology used herein is for the purpose of describing particular embodiments by way of example and is not intended to limit the claimed compositions and methods.

[0088] Throughout this document, descriptions relate to compositions and methods of using such compositions. When this disclosure describes or claims features or embodiments associated with a composition, such features or embodiments equally apply to methods of using the composition. Similarly, when this disclosure describes or claims features or embodiments associated with methods of using the composition, such features or embodiments equally apply to the composition.

[0089] When a range of values ​​is indicated, it includes embodiments using any particular value within that range. Furthermore, references to values ​​stated by range include every value within that range. All ranges include their endpoints and are composable. When a value is indicated as an approximation by the preceding use of "about," it should be understood that the particular value forms another embodiment. Unless the context explicitly indicates otherwise, references to a particular numerical value include at least that particular value. Unless otherwise indicated regarding its specific use, the use of "or" means "and / or." All references cited herein are incorporated by reference for any purpose. In the event of any conflict between the references and this specification, this specification shall prevail.

[0090] It should be understood that some features of the compositions and methods disclosed herein, described in the case of individual embodiments for clarity, may also be provided in combination with individual embodiments. Conversely, various features of the disclosed compositions and methods, described in the case of individual embodiments for simplicity, may also be provided individually or in any sub-combination.

[0091] definition

[0092] Throughout this specification and claims, various terms related to the described aspects are used. Unless otherwise indicated, such terms will be given their ordinary meaning in the art. Other specially defined terms will be interpreted in a manner consistent with the definitions provided herein.

[0093] As used herein, the singular forms “a / an” and “the” include the plural forms unless the context explicitly indicates otherwise.

[0094] As will be apparent to those skilled in the art from the teachings contained herein, in the context of numerical values ​​and ranges, the terms "about" or "approximately" refer to values ​​or ranges that are close to or approximately equal to the stated values ​​or ranges so that the embodiments can be performed as intended, such as values ​​or ranges of nucleic acids or peptides having the desired amount in the reaction mixture. Therefore, these terms cover values ​​beyond those resulting from systematic errors. In some embodiments, "about" means a numerical quantity ±10%.

[0095] The terms “antibody-drug conjugate,” “antibody conjugate,” “conjugate,” “immunoconjugate,” and “ADC” are used interchangeably and refer to therapeutic compounds (e.g., the eribulin portion) that are conjugated to an antibody moiety and defined by the following general formula: Ab-(LD). p(Formula I), where Ab is the antibody portion (e.g., an antibody or anti-specific binding fragment), L is the linker portion, D is the drug portion (e.g., an eribulin drug portion), and p is the number of drug portions based on the antibody portion. In an ADC containing an eribulin drug portion, "p" refers to the number of eribulin portions linked to the antibody portion. In some embodiments, the linker L may include a cleavable portion that can be directly linked to the antibody portion and linked to a therapeutic compound, or the cleavable portion may be linked to either or both of the antibody portion and the therapeutic compound via a spacer subunit. In some embodiments, when the spacer subunit links the cleavable portion to the therapeutic compound, it is a self-ablating spacer subunit.

[0096] The term "antibody" in its broadest sense refers to an immunoglobulin molecule that recognizes and specifically binds to a target such as a protein, polypeptide, carbohydrate, polynucleotide, lipid, or a combination of the foregoing via at least one antigen recognition site within the variable region of an immunoglobulin molecule. The heavy chain of an antibody consists of a heavy chain variable domain (VH) and a heavy chain constant domain (CH). The light chain consists of a light chain variable domain (VL) and a light chain constant domain (CL). For the purposes of this application, the mature heavy and light chain variable domains each contain three complementarity-determining regions (CDR1, CDR2, and CDR3) within four framework regions (FR1, FR2, FR3, and FR4) arranged from the N-terminus to the C-terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. An "antibody" can be naturally occurring or artificial, such as a monoclonal antibody produced using conventional hybridoma techniques. The term "antibody" includes full-length monoclonal antibodies and full-length polyclonal antibodies, as well as antibody fragments such as Fab, Fab', F(ab')2, and Fv, and single-chain antibodies. Antibodies can be any of the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or their subclasses (e.g., isotypes IgG1, IgG2, IgG3, and IgG4). The term further encompasses human antibodies, chimeric antibodies, humanized antibodies, and any modified immunoglobulin molecule containing an antigen recognition site, provided it exhibits the desired biological activity.

[0097] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous population of antibodies, meaning that the individual antibodies constituting that population are identical except for the possible small number of naturally occurring mutations. Monoclonal antibodies are highly specific for a single antigenic epitope. In contrast, conventional (polyclonal) antibody formulations typically comprise multiple antibodies that target or are specific to different epitopes. The modifier "monoclonal" indicates the characteristic of an antibody obtained from a substantially homogeneous population of antibodies and should not be construed as requiring the antibody to be produced by any particular method. For example, monoclonal antibodies used according to this disclosure may be manufactured by a hybridoma method first described by Kohler et al. (1975) Nature 256:495, or by a recombinant DNA method (see, for example, U.S. Patent No. 4,816,567). Monoclonal antibodies can also be isolated from autophagosome antibody libraries using techniques described, for example, those described in Clackson et al. (1991) Nature 352:624-8 and Marks et al. (1991) J. Mol. Biol. 222:581-97.

[0098] The monoclonal antibodies described herein specifically include “chimeric” antibodies, wherein a portion of the heavy chain and / or light chain is identical or homologous to the corresponding sequence in an antibody derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to the corresponding sequence in an antibody derived from another species or belonging to another antibody class or subclass; provided that they specifically bind to the target antigen and / or exhibit the desired biological activity.

[0099] As used herein, the term "chimeric antibody" refers to an antibody in which the amino acid sequence of the immunoglobulin molecule is derived from two or more species. In some cases, the variable regions of both the heavy and light chains correspond to the variable regions of an antibody derived from one species with the desired specificity, affinity, and activity, while the constant regions are homologous to antibodies derived from another species (e.g., humans) to minimize the immune response in the latter species.

[0100] As used herein, the term "humanized antibody" refers to an antibody form containing sequences derived from both non-human (e.g., rabbit) and human antibodies. Such antibodies are chimeric antibodies containing minimal sequences derived from non-human immunoglobulins. Generally, humanized antibodies will contain substantially all of at least one and typically two variable domains, wherein all or substantially all of the hypervariable loops correspond to the variable domains of the non-human immunoglobulin and all or substantially all of the frame (FR) regions are variable domains of the human immunoglobulin sequence. Humanized antibodies may also, where appropriate, contain at least a portion of the immunoglobulin constant region (Fc), typically at least a portion of the constant region of a human immunoglobulin. Humanized antibodies can be further modified by substitution of residues within the Fv frame regions and / or by replacing non-human residues to improve and optimize antibody specificity, affinity, and / or activity.

[0101] As used herein, the terms “antigen-binding fragment,” “antigen-binding domain,” or “antigen-binding moiety” of an antibody refer to one or more fragments of an antibody or protein that retain the ability to specifically bind to an antigen (e.g., mesothelin). Antigen-binding fragments may also retain the ability to be internalized into cells expressing the antigen. In some embodiments, antigen-binding fragments also retain immune effector activity. It has been shown that fragments of full-length antibodies can perform the antigen-binding function of full-length antibodies. Examples of binding fragments encompassed within the terms “antigen-binding fragment,” “antigen-binding domain,” or “antigen-binding portion” of an antibody include (i) a Fab fragment, a monovalent fragment consisting of VL, VH, CL, and CH1 domains; (ii) an F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by disulfide bridging at a hinge region; (iii) an Fd fragment consisting of VH and CH1 domains; (iv) an Fv fragment consisting of VL and VH domains of a single arm of the antibody; (v) a dAb fragment containing a single variable domain, such as a VH domain (see, for example, Ward et al. (1989) Nature 341:544-6; and International Publication No. WO 1990 / 005144); and (vi) a separated complementarity-determining region (CDR). Furthermore, although the two domains VL and VH of the Fv fragment are encoded by independent genes, they can be conjugated using recombination methods by synthetic linkers that enable them to be manufactured as single protein chains, where the VL and VH regions pair to form a monovalent molecule (called a single-stranded Fv (scFv)). See, for example, Bird et al. (1988) Science 242:423-6; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-83. Such single-chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" or "antigen-binding portion" of antibody, and are known in the art to be exemplary types of binding fragments that, upon binding, can be internalized into cells (see, for example, Zhu et al. (2010) 9:2131-41; He et al. (2010) J Nucl. Med. [Journal of Nuclear Medicine] 51:427-32; and Fitting et al. (2015) MAbs 7:390-402). In some embodiments, scFv molecules may be incorporated into fusion proteins. Other forms of single-chain antibodies, such as biantibodies, are also covered.Biantibodies are bivalent, bispecific antibodies in which the VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow pairing between the two domains on the same chain. This forces these domains to pair with complementary domains on another chain, resulting in two antigen-binding sites (see, for example, Holliger et al. (1993) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 90:6444-8; and Poljak et al. (1994) Structure [Structure] 2:1121-3). Antigen-binding fragments are obtained using conventional techniques known to those skilled in the art, and are screened for utility (e.g., binding affinity, internalization) in the same manner as intact antibodies. Antigen-binding fragments can be prepared by cleaving the intact protein, for example by protease or chemical cleavage.

[0102] As used herein with respect to antibody or antigen-binding fragments, "internalization" refers to the ability of an antibody or antigen-binding fragment to cross the cell's lipid bilayer membrane and enter the internal compartments (i.e., "internalization") after binding to a cell, typically into the degradation compartments within the cell. For example, an internalizing anti-mesothelin antibody is an antibody that can enter the cell after binding to mesothelin on the cell membrane. In some embodiments, the antibody or antigen-binding fragment used in the ADCs disclosed herein targets cell surface antigens (e.g., mesothelin) via an internalizing antibody or an internalizing antigen-binding fragment (allowing the ADC to transfer across the cell membrane after antigen binding).

[0103] As used herein, the term “mesothelin” or “MSLN” refers to any naturally occurring form of human mesothelin (MSLN). This term encompasses full-length mesothelin (e.g., NCBI reference sequence: AAC50348.1) and any form of human mesothelin produced by cell processing. The term also encompasses variants of naturally occurring mesothelin, including, but not limited to, splice variants, allelic variants, and alloforms. Mesothelin can be isolated from humans or produced recombinantly or synthetically. The term may also encompass any synthetic variants to which anti-mesothelin antibodies (e.g., the antibodies disclosed herein) and / or antigen-binding fragments can specifically bind.

[0104] The term "anti-mesothelin antibody" or "antibody that specifically binds to mesothelin" refers to any form of antibody or fragment thereof that specifically binds to mesothelin, and encompasses monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, and biologically functional antibody fragments, provided that such biologically functional antibody fragments specifically bind to mesothelin. In some embodiments, the anti-mesothelin antibody used in the ADCs disclosed herein is an internalizing antibody or an internalizing antibody fragment. 345A12 (e.g., 345A12-HC15-LC4) and 102A6A2 are exemplary internalizing human mesothelin antibodies. As used herein, the terms "specific," "specifically binding," and "specifically binding" refer to the selective binding of an antibody to a target antigen epitope. The binding specificity of an antibody can be tested by comparing binding to an appropriate antigen with binding to an unrelated antigen or a mixture of antigens under a given set of conditions. An antibody is considered specific if it binds to an appropriate antigen with an affinity at least 2, 5, 7, 10, or more times greater than that with an unrelated antigen or a mixture of antigens. "Specific antibodies" or "target-specific antibodies" are antibodies that bind only to the target antigen (e.g., mesothelin) but do not bind (or show very little binding) to other antigens.

[0105] The term "epitope" refers to a portion of an antigen that can be recognized and specifically bound by an antibody. When the antigen is a polypeptide, the epitope can be formed from consecutive amino acids or discontinuous amino acids adjacent to each other via the tertiary folding of the polypeptide. Epitopes bound by antibodies can be identified using any epitope localization technique known in the art, including X-ray crystallography for epitope identification (which involves direct visual inspection of the antigen-antibody complex), monitoring the binding of the antibody to fragments or mutant variants of the antigen, or monitoring the solvent accessibility of different portions of the antibody and antigen. Exemplary strategies for mapping antibody epitopes include, but are not limited to, array-based oligopeptide scanning, restriction proteolysis, site-directed mutagenesis, high-throughput mutagenesis mapping, hydrogen-deuterium exchange, and mass spectrometry (see, for example, Gershoni et al. (2007) 21:145-56; and Hager-Braun and Tomer (2005) Expert Rev. Proteomics 2:745-56).

[0106] Competitive binding and epitope clustering can also be used to identify antibodies that share the same or overlapping epitopes. Competitive binding can be assessed using cross-blocking analysis, such as the analysis described in "Antibodies, A Laboratory Manual," Cold Spring Harbor Laboratory, Harlow and Lane (1st edition 1988, 2nd edition 2014). In some embodiments, competitive binding is identified when, in a cross-blocking analysis, the antibody or binding protein tested reduces the binding of a reference antibody or binding protein (e.g., binding proteins containing a CDR and / or those variable domains identified in Tables 1-3) to a target antigen (such as mesothelin) by at least about 50% (e.g., 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%, or higher, or any percentage between thereof). In some embodiments, competitive binding may be attributed to shared or similar (e.g., partially overlapping) epitopes, or due to steric hindrance where the antibody or binding protein binds at a neighboring epitope (see, for example, Tzartos, Methods in Molecular Biology (Morris, ed., Vol. 66, pp. 55-66)). In some embodiments, competitive binding may be used to sort groups of binding proteins that share similar epitopes. For example, competitively binding proteins may be “boxed” into groups of binding proteins with overlapping or neighboring epitopes, while non-competitive binding proteins may be grouped into different groups of binding proteins that do not have overlapping or neighboring epitopes.

[0107] The term "k" on "or "k a "" refers to the association rate constant of antibodies and antigens to form antibody / antigen complexes. This rate can be determined using standard analyses such as surface plasmon resonance, biolayer interferometry, or ELISA.

[0108] The term "k" off "or "k d "" refers to the dissociation rate constant of the antibody from the antibody / antigen complex. This rate can be determined using standard analyses such as surface plasmon resonance, biolayer interferometry, or ELISA.

[0109] Term "K" D "K" refers to the equilibrium dissociation constant of a specific antibody-antigen interaction. D via k a / k d The rate can be calculated using standard analyses such as surface plasmon resonance, biolayer interferometry, or ELISA.

[0110] The terms "p" or "drug load," "drug:antibody ratio," or "drug to antibody ratio," or "DAR," refer to the number of drug portions per antibody moiety, i.e., the drug load per antibody or antigen-binding fragment (Ab) in the ADC of formula (I), or the number of -LD portions. In an ADC containing an eribulin drug portion, "p" refers to the number of eribulin portions linked to the antibody moiety. For example, if two eribulin portions are linked to the antibody moiety, then p = 2. In a composition containing multiple copies of an ADC of formula (I), "average p" refers to the average number of -LD portions per antibody or antigen-binding fragment in the ADC population, also known as "average drug load."

[0111] The term "connector" or "connector part" is used herein to refer to any chemical part that can covalently link a pharmaceutical part of a compound, typically such as eribulin, to another part, such as an antibody part. A connector may be readily available for or substantially resistant to acid-induced cleavage, peptidase-induced cleavage, light-based cleavage, esterase-induced cleavage, and / or disulfide bond cleavage, under conditions that keep the compound or antibody active.

[0112] The term "pharmaceutical" is used herein to refer to a compound, a mixture of compounds, a biological macromolecule, or an extract made from biological materials. The terms "therapeutic agent" or "drug" refer to a pharmaceutical agent capable of modulating biological processes and / or possessing biological activity. The eribulin monomer described herein is an exemplary therapeutic agent.

[0113] The terms "chemotherapy agent" or "anticancer agent" are used herein to refer to all agents that are effective in treating cancer regardless of their mechanism of action. Inhibition of metastasis or angiogenesis is often a characteristic of chemotherapy agents. Chemotherapy agents include antibodies, biomolecules, and small molecules as described herein, and encompass eribulin. Chemotherapy agents can be cytotoxic agents or cell growth inhibitors. The term "cell growth inhibitor" refers to an agent that inhibits or suppresses cell growth and / or cell proliferation. The term "cytotoxic agent" refers to a substance that causes cell death primarily by interfering with the expression activity and / or function of cells.

[0114] As used herein, the term "eribulin" or "eribulin monomer" refers to a synthetic analogue of leptospirin B, a macrocyclic compound originally isolated from the marine sponge *Halichondria okadais*. Eribulin is a microtubule dynamics inhibitor, believed to bind to tubulin and induce cell cycle arrest at the G2 / M phase by inhibiting the mitotic spindle assembly. The term "eribulin mesylate" refers to the product marketed under the trade name Halaven. TMCommercially available eribulin mesylates. Exemplary eribulin analogues include those shown and described in U.S. Patent Nos. 6,214,865 and 6,653,341, which are incorporated herein by reference with respect to the disclosed eribulin structures and methods for synthesizing such structures.

[0115] As used herein, the term "eleibulin dimer" refers to a dimer form of eleibulin, wherein two eleibulin monomers are linked directly or through a chemical linker (e.g., a secondary amine, a dihydroxy secondary amine) via covalent or non-covalent bonds. In some embodiments, the eleibulin dimer may consist of two eleibulin monomers covalently linked at the C-34 position by a secondary amine, or two eleibulin monomers covalently linked at the C-35 position by a dihydroxy secondary amine. The eleibulin dimer composed of two eleibulin monomers covalently linked at the C-34 position by a secondary amine may be referred to herein as "desOH eleibulin dimer". The eleibulin dimer composed of two eleibulin monomers covalently linked at the C-35 position by a dihydroxy secondary amine may be referred to herein as "diOH eleibulin dimer". The term "eribulin dimer pharmaceutical fraction" refers to an ADC or a component of a composition that provides the structure of an eribulin dimer, such as an ADC of formula (I) or an eribulin dimer (D) component in a composition comprising -LD. In some embodiments, desOH eribulin dimers and / or diOH eribulin dimers provide improved conjugability compared to other eribulin dimer forms.

[0116] As used herein, the term "nostocin" refers to nostocin-1, a macrocyclic lactone compound originally isolated from the cyanobacterium genus *Nostoc*, or any synthetic analog thereof that retains anti-tubulin activity. Exemplary nostocin analogs include those shown and described in International Publication No. WO 2017 / 136769, for all the nostocin structures disclosed therein and the methods for synthesizing such structures, which are incorporated herein by reference. The term "nostocin pharmaceutical part" refers to an ADC or component of a composition having a nostocin structure.

[0117] The term "homology" refers to a molecule that exhibits homology with another molecule by having, for example, the same or similar sequence of chemical residues at corresponding positions.

[0118] As used herein, the term “inhibit or inhibition of” means a reduction in a measurable amount and may include, but does not require, complete prevention or inhibition.

[0119] The term "bystander killing" or "bystander effect" refers to the killing of target-negative cells in the presence of target-positive cells, where no killing of target-negative cells is observed in the absence of target-positive cells. Cell-to-cell contact, or at least the proximity between target-positive and target-negative cells, enables bystander killing. This type of killing can be distinguished from "off-target killing," which refers to the indiscriminate killing of target-negative cells. Off-target killing can be observed in the absence of target-positive cells.

[0120] The term "cancer" refers to a physiological condition in mammals characterized by uncontrolled cell growth in a population of cells. Examples of cancer include, but are not limited to, carcinomas, lymphomas, blastomas, sarcomas, and leukemias. Specific examples of such cancers include cancers that express mesothelin, such as mesothelioma, breast cancer, cervical cancer, colorectal cancer, endometrial cancer, head and neck cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer), ovarian cancer (e.g., serous carcinoma, clear cell carcinoma, or epithelial ovarian cancer), pancreatic cancer, prostate cancer, kidney cancer, stomach cancer, thyroid cancer, urethral carcinoma, uterine cancer, bile duct cancer, or leukemia.

[0121] The terms “tumor” and “necrotic tumor” refer to any benign or malignant mass of tissue caused by excessive growth or proliferation of cells, including precancerous lesions.

[0122] The term "tumor cell" refers to a single cell or a population of cells derived from a tumor, including non-tumorigenic cells and cancer stem cells. When referring only to tumor cells that lack the capacity for renewal and differentiation, the term "tumor cell" as used herein is modified by the term "non-tumorigenic" to distinguish those tumor cells from cancer stem cells.

[0123] The terms “subject” and “patient” are used interchangeably herein to refer to any animal, such as any mammal, including but not limited to humans, non-human primates, rodents, etc. In some embodiments, the mammal is a mouse. In some embodiments, the mammal is a human.

[0124] "Pharmaceutical composition" means a formulation which is permitted to administer an active ingredient and subsequently provides the intended biological activity and / or achieves a therapeutic effect of one or more active ingredients, and which does not contain any additional components that would have unacceptable toxicity to the subject administering the formulation. Pharmaceutical compositions may be sterile.

[0125] "Drug excipients" include substances such as adjuvants, carriers, pH adjusters and buffers, tension modifiers, wetting agents, preservatives, etc.

[0126] "Pharmaceutical acceptable" means approved or permitted by a U.S. federal or state regulatory agency, or listed in the United States Pharmacopeia or other generally recognized pharmacopoeia as suitable for use in animals and more specifically for human use.

[0127] For example, the “effective amount” of antibodies, antigen-binding fragments, and / or ADCs disclosed herein is an amount sufficient to perform the specifically stated purpose (e.g., to produce a therapeutic effect upon administration, such as reducing tumor growth rate or tumor volume, reducing cancer symptoms, or certain other indicators of therapeutic efficacy). The effective amount can be determined in a conventional manner associated with the stated purpose. The term “therapeutic effective amount” refers to the amount of antibody, antigen-binding fragment, and / or ADC that effectively treats a subject’s disease or disorder. In the case of cancer, a therapeutically effective amount of antibody, antigen-binding fragment, and / or ADC can reduce the number of cancer cells, reduce tumor size, inhibit (e.g., slow or stop) tumor metastasis, inhibit (e.g., slow or stop) tumor growth, and / or alleviate one or more symptoms. A “preventative effective amount” refers to the amount that effectively achieves the desired preventative outcome at the necessary dose and time period. Typically, because the preventative dose is administered to the subject before or in an early stage of the disease, the preventative effective amount will be less than the therapeutic effective amount.

[0128] As used herein, the terms "treatment" or "therapeutic" and grammatically related terms refer to any improvement in any outcome of a disease, such as prolonged survival, lower morbidity, and / or reduced side effects caused by alternative treatment modalities. As readily understood in the art, a treatment procedure encompasses, but does not require, the complete eradication of the disease. As used herein, "treatment / treat" means the administration of the described antibody, antigen-binding fragment, and / or ADC to a subject, such as a patient. Treatment can be curative, healing, relief, mitigation, alteration, remedy, improvement, amelioration, modification, or influence of a condition, its symptoms, or a predisposition to the condition (e.g., cancer). In some embodiments, in addition to treating a subject with a condition, the compositions disclosed herein may be provided prophylactically to prevent or reduce the likelihood of developing the condition.

[0129] In some embodiments, labeled antibodies, antigen-binding fragments, and / or ADCs are used. Suitable “labels” include radionuclides, enzymes, receptors, cofactors, inhibitors, fluorescent portions, chemiluminescent portions, magnetic particles, etc.

[0130] As used herein, “protein” means at least two covalently linked amino acids. This term encompasses polypeptides, oligopeptides, and peptides. In some embodiments, two or more covalently linked amino acids are linked by peptide bonds. Proteins may consist of naturally occurring amino acids and peptide bonds, for example, when proteins are recombinantly produced using an expression system and host cells. Alternatively, proteins may include synthetic amino acids (e.g., homophenylalanine, citrulline, ornithine, and leucine). “Recombinant protein” is a protein produced using recombinant technology, employing any techniques and methods known in the art, i.e., by expressing recombinant nucleic acids. Methods and techniques for producing recombinant proteins are well known in the art.

[0131] For amino acid sequences, sequence identity and / or similarity can be determined using standard techniques known in the art, including but not limited to the local sequence identity algorithm of Smith and Waterman (1981) Adv. Appl. Math. [Advances in Applied Mathematics] 2:482, the sequence identity alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. [Journal of Molecular Biology] 48:443, and the similarity method retrieval of Pearson and Lipman (1988) Proc. Nat. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 85:2444. Computerized implementations of these algorithms are available at the Wisconsin Genetics Software of the Genetics Computer Group, 575 Science Drive, Madison, Wisconsin. The best-fit sequence procedures (GAP, BESTFIT, FASTA, and TFASTA) in the Package, as described by Devereux et al. (1984) Nucl. Acid Res. 12:387-95, can be used, for example, with the default settings or by testing. In some embodiments, the percentage of consistency is calculated by FastDB based on the following parameters: mismatch penalty 1; gap penalty 1; gap size penalty 0.33; and conjugation penalty 30 (“Current Methods in Sequence Comparison and Analysis”, Macromolecule Sequencing and Synthesis, Selected Methods and Applications, pp. 127-149 (1988), Alan R. Liss, Inc.).

[0132] Typically, the amino acid homology, similarity, or identity between the proteins disclosed herein and their variants, including variants of target antigens (such as mesothelin), variants of tubulin sequences, and variants of antibody variable domains (including single variants of CDRs), is at least 80%, for example, at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, almost 100%, or 100% homology or identity with the sequences described herein.

[0133] Similarly, the "percentage of nucleic acid sequence identity (%)" for the nucleic acid sequences of antibodies and other proteins identified herein is defined as the percentage of nucleotide residues in candidate sequences that are identical to nucleotide residues in the coding sequence of the antigen-binding protein. Specifically, the method utilizes the BLASTN module of WU-BLAST-2 with default parameters set, where the overlap interval and overlap fraction are set to 1 and 0.125, respectively.

[0134] Although the sites or regions where amino acid sequence changes are introduced are predetermined, the mutations themselves do not need to be predetermined. For example, to optimize the efficacy of mutations at a given site, the optimal combination of random mutation induction at target codons or regions can be used to screen for the desired activity of expressed antigen-binding protein CDR variants. Techniques for substitution mutations at predetermined sites in DNA with known sequences are well-known, such as MI3 primer mutation induction and PCR mutation induction.

[0135] Anti-mesothelin antibody and antigen-binding fragment

[0136] In various embodiments, this disclosure relates to antibodies or antigen-binding fragments thereof capable of binding to and / or killing tumor cells (e.g., tumor cells expressing mesothelin), and their use in conjugates and therapeutic compositions.

[0137] In some embodiments, the antibody may be used alone, administered as part of a pharmaceutical composition or combination therapy, and / or administered as the antibody portion of an ADC. In some embodiments, the anti-mesothelin antibody and antigen-binding fragment disclosed herein may be used alone (i.e., in an unconjugated form) and as the antibody portion of an ADC. In some embodiments, the anti-mesothelin antibody and antigen-binding fragment is humanized. In some embodiments, the anti-mesothelin antibody and antigen-binding fragment contains a minimal sequence derived from a non-human immunoglobulin and retains the reactivity of non-human (e.g., rabbit) antibodies while exhibiting less immunogenicity in humans. In some embodiments, the anti-mesothelin antibody and antigen-binding fragment disclosed herein provides one or more of the following improved characteristics compared to one or more anti-mesothelin antibodies known to those skilled in the art: improved stability, reproducibility, aggregation, binding affinity, therapeutic efficacy, off-target toxicity, and / or metabolic properties.

[0138] In various embodiments, the antibody or antigen-binding fragments disclosed herein specifically bind to mesothelin (e.g., as expressed on cancer cells). The antibody or antigen-binding fragments may bind to a target antigen, such as through, for example... The analysis measured the dissociation constant (K). D ≤1 mM, ≤100 nM, or ≤10 nM, or any amount in between. In some embodiments, K D The range is from 1 pM to 500 pM. In some embodiments, K D Between 500 pM and 1 μM, 1 μM and 100 nM, or 100 mM and 10 nM.

[0139] In some embodiments, the antibody portion is a four-chain antibody (also referred to as an immunoglobulin) comprising two heavy chains and two light chains. In some embodiments, the antibody portion is a double-chain half-antibody (one light chain and one heavy chain) or an antigen-binding fragment of an immunoglobulin.

[0140] In some embodiments, the antibody portion is an antibody or an antigen-binding fragment thereof. In some embodiments, the antibody portion is an internalizing antibody or an internalizing antigen-binding fragment thereof. In some embodiments, the internalizing antibody or the internalizing antigen-binding fragment thereof binds to the target cancer antigen expressed on the cell surface and enters the cell after binding. In some embodiments, the eribulin drug portion of the ADC is released from the antibody portion of the ADC after the ADC enters and is present in the cell expressing the target cancer antigen (i.e., after the ADC has been internalized).

[0141] In various embodiments, the antibody or antigen-binding fragments disclosed herein may comprise heavy and light chain variable domains taken from the paired sets listed in Tables 3-5 or a set of six CDR sequences from the paired heavy and light chain sets, such as the sets of CDRs listed in Tables 1-2. In some embodiments, the antibody or antigen-binding fragment further comprises human heavy and light chain frameworks (optionally having one or more reversion mutations to improve binding affinity) and / or human heavy and light chain constant domains or fragments thereof. For example, the antibody or antigen-binding fragment may comprise a human IgG heavy chain constant domain (such as IgG1) and a human κ or λ light chain constant domain. In some embodiments, the antibody or antigen-binding fragment comprises a human immunoglobulin G subtype 1 (IgG1) heavy chain constant domain and a human Igκ light chain constant domain.

[0142] Table 1-10 lists the amino acid and nucleic acid sequences of the exemplary antibodies disclosed herein.

[0143] Table 1. Amino acid sequence of Kabat CDR against anti-mesothelin antibody

[0144]

[0145] Table 2. Amino acid sequence of IMGT CDR against anti-mesothelin antibody

[0146]

[0147] Table 3. Amino acid sequence of the variable region of anti-mesothelin antibody

[0148]

[0149] Table 4. Amino acid sequences of the constant region of anti-mesothelin antibodies

[0150]

[0151] Table 5. Amino acid sequence of the full-length antibody Ig chain against anti-mesothelin.

[0152]

[0153]

[0154] Table 6. Nucleic acid sequences encoding the Kabat CDR against anti-mesothelin antibodies

[0155]

[0156] Table 7. Nucleic acid sequences encoding IMGT CDRs against anti-mesothelin antibodies

[0157]

[0158]

[0159] Table 8. Nucleic acid sequences encoding the variable region against anti-mesothelin antibodies

[0160]

[0161] Table 9. Nucleic acid sequences encoding the constant region against anti-mesothelin antibodies

[0162]

[0163]

[0164] Table 10. Nucleic acid sequences encoding the full-length antibody Ig chain against anti-mesothelin antibodies +

[0165]

[0166]

[0167] + The listed nucleic acid sequences do not include the leader sequence.

[0168] In some embodiments, the antibody or antigen-binding fragment disclosed herein binds to human mesothelin and comprises: three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:1 (HCDR1), SEQ ID NO:2 (HCDR2), and SEQ ID NO:3 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:4 (LCDR1), SEQ ID NO:5 (LCDR2), and SEQ ID NO:6 (LCDR3), as defined by the Kabat numbering system (Kabat, Sequences of Proteins of Immunological Interest).

[0169] In some embodiments, the antibody or antigen-binding fragment disclosed herein binds to human mesothelin and comprises: three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:7 (HCDR1), SEQ ID NO:8 (HCDR2), and SEQ ID NO:9 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:10 (LCDR1), SEQ ID NO:11 (LCDR2), and SEQ ID NO:12 (LCDR3), as defined by the IMGT numbering system.

[0170] In various embodiments, the anti-mesothelin antibody or antigen-binding fragment comprises three heavy chain CDRs and three light chain CDRs, wherein the CDRs include the addition, deletion, or substitution of no more than one, two, three, four, five, or six amino acids: HCDR1 (SEQ ID NO:1 according to Kabat or SEQ ID NO:7 according to IMGT), HCDR2 (SEQ ID NO:2 according to Kabat or SEQ ID NO:8 according to IMGT), HCDR3 (SEQ ID NO:3 according to Kabat or SEQ ID NO:9 according to IMGT); and LCDR1 (SEQ ID NO:4 according to Kabat or SEQ ID NO:10 according to IMGT), LCDR2 (SEQ ID NO:5 according to Kabat or SEQ ID NO:11 according to IMGT), and LCDR3 (SEQ ID NO:6 according to Kabat or SEQ ID NO:12 according to IMGT).

[0171] In some embodiments, the anti-mesothelin antibody or antigen-binding fragment is humanized. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment contains a minimal sequence derived from a non-human immunoglobulin and retains the reactivity of non-human (e.g., rabbit) antibodies while exhibiting less immunogenicity in humans. In some embodiments, compared to one or more alternative anti-mesothelin antibodies, the anti-mesothelin antibody or antigen-binding fragment provides one or more of the following: improved stability, reproducibility, binding affinity, therapeutic efficacy, and / or reduced aggregation levels.

[0172] In various embodiments, the anti-mesothelin antibody or antigen-binding fragment comprises: a heavy chain variable region containing the amino acid sequence of SEQ ID NO:13 or a sequence at least 90% identical to SEQ ID NO:13; and / or a light chain variable region containing the amino acid sequence of SEQ ID NO:14 or a sequence at least 90% identical to SEQ ID NO:14. In various embodiments, the anti-mesothelin antibody or antigen-binding fragment comprises: a heavy chain constant region containing the amino acid sequence of SEQ ID NO:15 or a sequence at least 90% identical to SEQ ID NO:15; and / or a light chain constant region containing the amino acid sequence of SEQ ID NO:16 or a sequence at least 90% identical to SEQ ID NO:16.

[0173] In various embodiments, the anti-mesothelin antibody or antigen-binding fragment comprises the heavy chain amino acid sequence of SEQ ID NO:17 or a sequence that is at least 90% identical to SEQ ID NO:17; and / or the light chain amino acid sequence of SEQ ID NO:18 or a sequence that is at least 90% identical to SEQ ID NO:18.

[0174] In some embodiments, the anti-mesothelin antibody or antigen-binding fragment includes a human IgG1 heavy chain constant domain and a human Igκ light chain constant domain.

[0175] In various embodiments, the anti-mesothelin antibody or antigen-binding fragment comprises: three heavy chain complementarity-determining regions (HCDRs) containing amino acid sequences encoded by the nucleic acid sequences of SEQ ID NO:19 (HCDR1), SEQ ID NO:20 (HCDR2), and SEQ ID NO:21 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing amino acid sequences encoded by the nucleic acid sequences of SEQ ID NO:22 (LCDR1), SEQ ID NO:23 (LCDR2), and SEQ ID NO:24 (LCDR3), as defined by the Kabat numbering system; or three heavy chain complementarity-determining regions (HCDRs) containing amino acid sequences encoded by the nucleic acid sequences of SEQ ID NO:25 (HCDR1), SEQ ID NO:26 (HCDR2), and SEQ ID NO:27 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing amino acid sequences encoded by the nucleic acid sequences of SEQ ID NO:28 (LCDR1), SEQ ID NO:29 (LCDR2), and SEQ ID NO:21 (HCDR3). The amino acid sequence encoded by the nucleic acid sequence NO:30 (LCDR3) is as defined by the IMGT numbering system.

[0176] In various embodiments, the anti-mesothelin antibody or antigen-binding fragment comprises: a heavy chain variable region containing an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:31; and a light chain variable region containing an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:32.

[0177] In various embodiments, the anti-mesothelin antibody or antigen-binding fragment comprises: a heavy chain constant region containing an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:33; and a light chain constant region containing an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:34.

[0178] In various embodiments, the anti-mesothelin antibody or antigen-binding fragment comprises: a heavy chain comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:35; and a light chain comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO:36.

[0179] In various embodiments, the anti-mesothelin antibody or antigen-binding fragment is 345A12-HC15-LC4.

[0180] The anti-mesothelin antigen-binding domain described herein can be used alone (e.g., as an antibody or antigen-binding fragment), linked to one or more additional pharmaceutical agents (e.g., as an ADC), or as part of a larger macromolecule (e.g., a bispecific antibody or a multispecific antibody).

[0181] In some embodiments, an antibody or antigen-binding fragment is conjugated to a therapeutic agent. In some embodiments, the chemotherapy agent is eribulin. In some embodiments, the chemotherapy agent is eribulin dimer.

[0182] In some embodiments, the antibody or antigen-binding fragment is an antigen-binding domain in a bispecific or multispecific antibody and / or is part of a bispecific or multispecific antibody. In some embodiments, the bispecific or multispecific antibody comprises an antigen-binding domain capable of binding to mesothelin and includes: three HCDRs comprising the amino acid sequences of SEQ ID NO:1 (HCDR1), SEQ ID NO:2 (HCDR2), and SEQ ID NO:3 (HCDR3); and three light chain complementarity-determining regions (LCDRs) comprising the amino acid sequences of SEQ ID NO:4 (LCDR1), SEQ ID NO:5 (LCDR2), and SEQ ID NO:6 (LCDR3), as defined by the Kabat numbering system; or three heavy chain complementarity-determining regions (HCDRs) comprising the amino acid sequences of SEQ ID NO:7 (HCDR1), SEQ ID NO:8 (HCDR2), and SEQ ID NO:9 (HCDR3); and three light chain complementarity-determining regions (LCDRs) comprising the amino acid sequences of SEQ ID NO:10 (LCDR1), SEQ ID NO:11 (LCDR2), and SEQ ID NO:12 (LCDR3), as defined by the IMGT numbering system. In some embodiments, a multispecific antibody includes one or more additional antigen-binding domains, such as against the same antigen (i.e., mesothelin) or against other antigens.

[0183] In some embodiments, the antigen-binding domain is an antigen-binding fragment. In some embodiments, the antigen-binding domain and / or antigen-binding fragment is a single-stranded variable fragment (scFv) or a Fab fragment.

[0184] In some embodiments, the antigen-binding domains (e.g., anti-mesothelin antigen-binding domains) disclosed herein for use alone or as part of a larger macromolecule may include other modifications (e.g., one or more amino acid substitutions, deletions, and / or insertions) while retaining mesothelin binding function.

[0185] Antibody-drug conjugates

[0186] In various embodiments, this document further provides antibody-drug conjugate (ADC) compounds comprising a linker that connects a chemotherapeutic drug portion (e.g., eribulin) to the anti-mesothelin antibody disclosed herein. Antibody-drug conjugate (ADC) compounds may be represented by Formula I:

[0187] Ab-(LD) p (I)

[0188] Where Ab is the internalized anti-mesothelin antibody or its internalized antigen-binding fragment disclosed in this article;

[0189] D stands for Eriblin;

[0190] L is a pyrolytic linker that covalently connects Ab to D; and

[0191] p is an integer from 1 to 8.

[0192] The ADC compounds disclosed herein comprise an antibody moiety (including its antigen-binding fragment) conjugated (e.g., covalently linked via a linker) to a pharmaceutical moiety (e.g., eribulin), wherein the pharmaceutical moiety exhibits cytotoxicity or cell growth inhibition when not conjugated to the antibody moiety. In various embodiments, the pharmaceutical moiety exhibits reduced or no cytotoxicity when bound to the conjugate, but recovers cytotoxicity after lysis of the linker and antibody moiety. In various embodiments, the pharmaceutical moiety exhibits reduced or no bystander-killing activity when bound to the conjugate, but exhibits increased bystander-killing activity after lysis of the conjugate.

[0193] In some embodiments, the ADC compounds disclosed herein selectively deliver an effective dose of the pharmaceutical portion (e.g., eribulin) to cancer cells or tumor tissue expressing an antigen (e.g., mesothelin) targeted by the antibody portion of the ADC. In some embodiments, the disclosed ADC compounds specifically target cancer by delivering eribulin to cells or tissues expressing mesothelin, thus avoiding normal cells or tissues that do not express mesothelin or express mesothelin at lower levels. In some embodiments, the disclosed ADC compounds exhibit improved on-target kill and / or reduced off-target kill compared to ADCs containing alternative antibodies, linkers, and / or pharmaceutical portions, such as BAY 94-9343. In some embodiments, the disclosed ADC compounds exhibit improved ADCC activity retention compared to ADCs containing alternative antibodies, linkers, and / or pharmaceutical portions, such as BAY 94-9343. In some embodiments, the disclosed ADC compounds exhibit improved stability (e.g., plasma stability) compared to ADCs containing alternative antibodies, linkers, and / or pharmaceutical portions, such as BAY 94-9343. In some embodiments, the disclosed ADC compounds have improved antitumor efficacy compared to ADCs containing alternative antibodies, linkers, and / or pharmaceutical motifs, such as BAY 94-9343.

[0194] In some embodiments, the ADC compounds disclosed herein may provide favorable antitumor efficacy at lower doses of eribulin compared to the dose of eribulin when evaluated as a monotherapy (i.e., not conjugated to an antibody moiety). In some embodiments, the tumor-specific targeting of the ADC compounds disclosed herein enhances the antitumor activity of the ADC and / or reduces off-target cytotoxicity compared to eribulin when evaluated as a monotherapy. For example, in some embodiments, the ADC compounds disclosed herein exhibit favorable antitumor activity in which the dose of eribulin is at least 10-fold, at least 15-fold, at least 20-fold, or at least 30-fold lower than the dose of eribulin when evaluated as a monotherapy. In some embodiments, the disclosed ADC compounds demonstrate antitumor activity equivalent to or greater than that of eribulin when evaluated as a monotherapy, while providing improved toxicological or safety characteristics compared to eribulin itself.

[0195] In some embodiments, the linker is stable outside the cell, such that the ADC remains intact when present in extracellular conditions but can cleave upon internalization within a cell (e.g., a cancer cell). In some embodiments, when the ADC enters a cell expressing mesothelin, the eribulin drug portion cleaves from the anti-mesothelin antibody portion, and the cleavage releases the unmodified form of eribulin.

[0196] In some embodiments, the linker includes a cleavable portion that is fixed in place such that, after cleavage, no portion of the linker or antibody portion remains bound to the eribulin drug portion. In some embodiments, the cleavable portion in the linker is a cleavable peptide portion. In some embodiments, compared to ADCs containing alternative linker portions, ADCs containing cleavable peptide portions exhibit lower aggregation levels, improved antibody:drug ratios, increased on-target killing of cancer cells, reduced off-target killing of non-cancer cells, and / or higher drug loading (p). In some embodiments, increased potency and / or cytotoxicity are provided in cancers expressing moderate levels of mesothelin. In some embodiments, the cleavable peptide portion is enzymatically cleavable, and the linker is an enzymatically cleavable linker. In some embodiments, the enzyme is cathepsin B, and the linker is a cathepsin-cleavable linker. In some embodiments, the enzymatically cleavable linker (e.g., a cathepsin-cleavable linker) exhibits one or more of the aforementioned improved properties compared to alternative cleavage mechanisms.

[0197] In some embodiments, the cleavable peptide portion in the linker comprises an amino acid unit. In some embodiments, the amino acid unit comprises valine-citrulline (Val-Cit). In some embodiments, compared to ADCs comprising alternative amino acid units or alternative cleavable portions, ADCs comprising Val-Cit exhibit increased stability, reduced off-target cell killing, increased on-target cell killing, lower aggregation levels, and / or higher drug loading.

[0198] In some embodiments, the adapter includes at least one spacer subunit that binds the antibody portion to the cleavable portion. In some embodiments, the spacer subunit in the adapter may include at least one polyethylene glycol (PEG) portion. For example, the PEG portion may include -(PEG). m - where m is an integer from 1 to 10. In some embodiments, the spacer subunit in the connector comprises (PEG)2. In some embodiments, regardless of the shorter connector length, an ADC comprising a shorter spacer subunit (e.g., (PEG)2) exhibits lower aggregation levels and / or higher drug loading compared to an ADC comprising a longer spacer subunit (e.g., (PEG)8).

[0199] In some embodiments, the spacer subunit is linked to the antibody portion of the ADC via a maleimide (Mal) portion. In some embodiments, an ADC containing a linker connected to the antibody portion via Mal exhibits a higher drug loading than an ADC containing a linker connected to the antibody portion via an alternative portion. In some embodiments, the Mal in the linker is bound to the antibody portion via a cysteine ​​residue (e.g., LCcys80). In some embodiments, the Mal in the linker is bound to a cysteine ​​residue (e.g., LCcys80) in the light chain variable region of an antibody or antigen-binding fragment. In some embodiments, p is 2, and both -LD portions are linked to the antibody or antigen-binding fragment. In some embodiments, each -LD portion is linked to a cysteine ​​residue (e.g., LCcys80) in the light chain variable region of an antibody or antigen-binding fragment. In some embodiments, the cysteine ​​residue is LCcys80. In some embodiments, the Mal-spacer subunit contains a PEG portion. In some embodiments, the linker contains Mal-(PEG). m For example, Mal-(PEG)2. In some embodiments, the Mal-spacer subunit links the antibody portion to a cleavable portion in the adapter. In some embodiments, the cleavable portion in the adapter is a cleavable peptide portion, such as an amino acid unit. In some embodiments, the adapter comprises Mal-(PEG)2-Val-Cit.

[0200] In some embodiments, the cleavable portion of the connector directly binds to the eribulin drug portion of the ADC, and the cleavable portion is directly connected to the antibody portion or connected via a spacer unit. In some embodiments, the spacer unit also connects the cleavable portion of the connector to the eribulin drug portion. In some embodiments, the spacer unit that connects the cleavable portion of the connector to the eribulin drug portion is self-ablating. In some embodiments, the self-ablating spacer is capable of releasing unmodified eribulin from target cells. In some embodiments, the self-ablating spacer unit comprises p-aminobenzylmethyl alcohol, such as p-aminobenzyloxycarbonyl (pAB). In some embodiments, the pAB in the connector connects the cleavable portion to the eribulin drug portion. In some embodiments, the cleavable portion is a cleavable peptide portion, such as an amino acid unit. In some embodiments, the connector comprises Val-Cit-pAB. In some embodiments, the connector comprises Val-Cit-pAB and a PEG spacer unit that connects the connector to the antibody portion via Mal.

[0201] In some embodiments, p is an integer from 1 to 8, or from 2 to 6. In some embodiments, p is 2 or 6. In some embodiments, the connector comprises Mal-(PEG)2-Val-Cit-pAB. In some embodiments, the connector comprises Mal-(PEG)2-Val-Cit-pAB and p is 2. In some embodiments, the connector comprises Mal-(PEG)2-Val-Cit-pAB and p is 6.

[0202] In some embodiments, the antibody portion is conjugated to the eribulin drug portion via a linker comprising a Mal portion, a PEG portion, a Val-Cit portion, and pAB. In these embodiments, the maleimide portion covalently links the linker drug portion to the antibody portion, and the pAB acts as a self-ablating spacer subunit. Such a linker may be referred to as a "Mal-VC-pAB" linker, "Mal-VCP", "maleimide-VCP" or "VCP" linker, "Mal-(PEG)2-VCP" linker, or "Mal-(PEG)2-Val-Cit-pAB" linker. In some embodiments, the eribulin drug portion is eribulin covalently linked at the C-35 position. In some embodiments, the pAB of the Mal-(PEG)2-Val-Cit-pAB linker is attached to the C-35 amine on the eribulin drug portion.

[0203] 345A12-HC15-LC4 is an exemplary anti-mesothelin antibody that comprises or is encoded by the sequences shown in Tables 1-10 above, such as a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:13 and a light chain variable region comprising the amino acid sequence of SEQ ID NO:14. In some embodiments, the antibody portion of the ADC disclosed herein comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:13 and a light chain variable region comprising the amino acid sequence of SEQ ID NO:14. In some embodiments, the antibody portion of the ADC disclosed herein is 345A12-HC15-LC4.

[0204] In some embodiments, the ADC disclosed herein comprises 345A12-HC15-LC4-VCP-eribulin. In these embodiments, the antibody moiety comprising 345A12-HC15-LC4 is bound to the eribulin drug moiety via a linker comprising Mal-(PEG)2-Val-Cit-pAB. Such an ADC may be referred to as "MORAb-109". In some embodiments, the ADC disclosed herein is MORAb-109.

[0205] In some embodiments, the ADC disclosed herein is MORAb-109 and has a p of 2. In some embodiments, when p is 2, the ADC may be referred to as "MORAb-109(DAR2)". In other embodiments, the ADC disclosed herein is MORAb-109 and has a p of 6. In some embodiments, when p is 6, the ADC may be referred to as "MORAb-109(DAR6)".

[0206] In various embodiments, the adapter is designed to promote bystander killing (killing of neighboring cells, such as cells that do not express mesothelin) via lysis after the adapter drug portion and / or the drug portion diffuses independently to adjacent cells. In some embodiments, the adapter promotes cell internalization. In some embodiments, the adapter is designed to minimize lysis in the extracellular environment and thereby reduce off-target tissue (e.g., non-cancerous tissue) toxicity while maintaining bystander killing of ADCs bound to the target tissue and antigens that do not express the antibody portion targeting the ADC but surround the target cancer tissue expressing the antigen. In some embodiments, adapters comprising a maleimide (Mal) portion, a polyethylene glycol (PEG) portion, valine-citrulline (Val-Cit or “VC”), and pAB provide these functional features. In some embodiments, adapters comprising Mal-(PEG)2-Val-Cit-pAB are particularly effective in providing these functional features when conjugating both the antibody portion and the eribulin drug portion. In some embodiments, the linker comprising Mal-(PEG)2-Val-Cit-pAB is effective in providing some or all of these functional features when conjugating anti-mesothelin antibody portions (such as 345A12-HC15-LC4 and eribulin drug portions).

[0207] In some embodiments, the anti-mesothelin antibody or antigen-binding fragment comprises the sequence disclosed herein (e.g., comprising the six CDRs and / or heavy and light chain variable domains disclosed in Tables 1-3). In some embodiments, the antibody or antigen-binding fragment is a full-length antibody. In some embodiments, the antibody or antigen-binding fragment is a monospecific antibody or antigen-binding fragment, a bispecific antibody or antigen-binding fragment, or a multispecific antibody or antigen-binding fragment. In some embodiments, the antibody or antigen-binding fragment is a single-chain variable fragment (scFv) or a Fab fragment.

[0208] In some embodiments, compared to ADCs containing an anti-mesothelin antibody (Ab) moiety and a cleavable peptide moiety, ADCs exhibit lower aggregation levels, improved antibody:drug ratios, increased on-target killing of cancer cells, reduced off-target killing of non-cancer cells, higher drug loading (p), and improved cytotoxicity and / or efficacy. In some embodiments, the ADC is an ADC of formula (I):

[0209] Ab-(LD) p (I)

[0210] Wherein Ab is an antibody or antigen-binding fragment, wherein the antibody or antigen-binding fragment is capable of binding to mesothelin and comprises: three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:1 (HCDR1), SEQ ID NO:2 (HCDR2), and SEQ ID NO:3 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:4 (LCDR1), SEQ ID NO:5 (LCDR2), and SEQ ID NO:6 (LCDR3), as defined by the Kabat numbering system; or three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:7 (HCDR1), SEQ ID NO:8 (HCDR2), and SEQ ID NO:9 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:10 (LCDR1), SEQ ID NO:11 (LCDR2), and SEQ ID NO:12 (LCDR3), as defined by the IMGT numbering system;

[0211] D stands for chemotherapeutic agents (such as eribulin);

[0212] L is a pyrolytic linker that covalently connects Ab to D; and

[0213] p is an integer from 1 to 8.

[0214] In some embodiments, the antibody or antigen-binding fragment comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:13; and a light chain variable region comprising the amino acid sequence of SEQ ID NO:14. In some embodiments, the antibody or antigen-binding fragment comprises a human IgG1 heavy chain constant domain and a human Igκ light chain constant domain. In some embodiments, the antibody or antigen-binding fragment comprises: a heavy chain constant region comprising the amino acid sequence of SEQ ID NO:15; and a light chain constant region comprising the amino acid sequence of SEQ ID NO:16. In some embodiments, the antibody or antigen-binding fragment comprises: a heavy chain comprising the amino acid sequence of SEQ ID NO:17; and a light chain comprising the amino acid sequence of SEQ ID NO:18.

[0215] In some embodiments, the ADC has equation (I):

[0216] Ab-(LD) p (I)

[0217] in:

[0218] Ab is an antibody or antigen-binding fragment capable of binding to mesothelin and / or cells expressing mesothelin and comprising: three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:1 (HCDR1), SEQ ID NO:2 (HCDR2), and SEQ ID NO:3 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:4 (LCDR1), SEQ ID NO:5 (LCDR2), and SEQ ID NO:6 (LCDR3), as defined by the Kabat numbering system; or three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:7 (HCDR1), SEQ ID NO:8 (HCDR2), and SEQ ID NO:9 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:10 (LCDR1), SEQ ID NO:11 (LCDR2), and SEQ ID NO:6 (HCDR3). The amino acid sequence of NO:12 (LCDR3), as defined by the IMGT numbering system;

[0219] D stands for Eriblin;

[0220] L is a pyrolytic linker that covalently connects Ab to D; and

[0221] p is an integer from 1 to 8.

[0222] In some embodiments, the antibody or antigen-binding fragment targeting mesothelin and / or cells expressing mesothelin comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:13; and a light chain variable region comprising the amino acid sequence of SEQ ID NO:14. In some embodiments, the antibody or antigen-binding fragment comprises a human IgG1 heavy chain constant domain and a human Igκ light chain constant domain. In some embodiments, the antibody or antigen-binding fragment comprises: a heavy chain constant region comprising the amino acid sequence of SEQ ID NO:15; and a light chain constant region comprising the amino acid sequence of SEQ ID NO:16. In some embodiments, the antibody or antigen-binding fragment comprises: a heavy chain comprising the amino acid sequence of SEQ ID NO:17; and a light chain comprising the amino acid sequence of SEQ ID NO:18.

[0223] In some embodiments, the ADC has equation (I):

[0224] Ab-(LD) p (I)

[0225] in:

[0226] Ab is an antibody or antigen-binding fragment thereof targeting mesothelin and / or cells expressing mesothelin, the fragment comprising: three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:1 (HCDR1), SEQ ID NO:2 (HCDR2), and SEQ ID NO:3 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:4 (LCDR1), SEQ ID NO:5 (LCDR2), and SEQ ID NO:6 (LCDR3), as defined by the Kabat numbering system; or three heavy chain complementarity-determining regions (HCDRs) containing the amino acid sequences of SEQ ID NO:7 (HCDR1), SEQ ID NO:8 (HCDR2), and SEQ ID NO:9 (HCDR3); and three light chain complementarity-determining regions (LCDRs) containing the amino acid sequences of SEQ ID NO:10 (LCDR1), SEQ ID NO:11 (LCDR2), and SEQ ID NO:12 (LCDR3), as defined by the IMGT numbering system;

[0227] D stands for Eriblin;

[0228] L is a pyrolytic linker containing Mal-(PEG)2-Val-Cit-pAB; and

[0229] p is an integer from 1 to 8.

[0230] In some embodiments, the antibody or antigen-binding fragment targeting mesothelin and / or cells expressing mesothelin comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:13; and a light chain variable region comprising the amino acid sequence of SEQ ID NO:14. In some embodiments, the antibody or antigen-binding fragment comprises a human IgG1 heavy chain constant domain and a human Igκ light chain constant domain. In some embodiments, the antibody or antigen-binding fragment comprises: an IgG1 heavy chain constant region comprising the amino acid sequence of SEQ ID NO:15; and an Igκ light chain constant region comprising the amino acid sequence of SEQ ID NO:16. In some embodiments, the antibody or antigen-binding fragment comprises: a heavy chain comprising the amino acid sequence of SEQ ID NO:17; and a light chain comprising the amino acid sequence of SEQ ID NO:18.

[0231] In some embodiments, the ADC has equation (I):

[0232] Ab-(LD) p (I)

[0233] in:

[0234] Ab is an antibody or antigen-binding fragment, wherein the antibody or antigen-binding fragment is capable of binding to mesothelin and includes a heavy chain variable region containing the amino acid sequence of SEQ ID NO:13; and a light chain variable region containing the amino acid sequence of SEQ ID NO:14;

[0235] D stands for Eriblin;

[0236] L is a pyrolytic linker containing Mal-(PEG)2-Val-Cit-pAB; and

[0237] p is an integer from 1 to 8.

[0238] In some embodiments, the antibody or antigen-binding fragment comprises a human IgG1 heavy chain constant region and a human Igκ light chain constant region. In some embodiments, the antibody or antigen-binding fragment comprises: a heavy chain constant region comprising the amino acid sequence of SEQ ID NO:15; and a light chain constant region comprising the amino acid sequence of SEQ ID NO:16. In some embodiments, the antibody or antigen-binding fragment comprises: a heavy chain comprising the amino acid sequence of SEQ ID NO:17; and a light chain comprising the amino acid sequence of SEQ ID NO:18.

[0239] In some embodiments, the antibody or antigen-binding fragment of the ADC is 345A12-HC15-LC4. In some embodiments, p is 1 to 8. In some embodiments, p is 2 or 6. In some embodiments, p is 2.

[0240] In some embodiments, the ADCs disclosed herein (e.g., ADCs containing the anti-mesothelin antibody and adapter disclosed herein) with a lower eribulin drug load (e.g., p = 2) can deliver the same or similar amounts of eribulin to cancer cells or tumor tissue as ADCs with a higher drug load (e.g., p = 6). In some embodiments, ADCs with a lower drug load (e.g., p = 2) can provide tumor growth inhibition and / or in vivo anticancer therapeutic efficacy comparable to or superior to ADCs with a higher drug load (e.g., p = 6).

[0241] In some embodiments, each eribulin moiety binds to an antibody or antigen-binding fragment targeting mesothelin via a cleavable linker through a cysteine ​​residue (e.g., LCcys80) on the antibody or fragment. In some embodiments, a total of two linkers—the eribulin moiety—are linked to the antibody or antigen-binding fragment targeting mesothelin, for example via two cysteine ​​residues on the antibody or antigen-binding fragment (i.e., such that the ADC has DAR2). In some embodiments, one or more cysteine ​​residues are LCcys80.

[0242] The development and production of ADCs (antibody-adjuvant drugs) for human therapeutic use (e.g., for oncology) may require more than just identifying antibodies capable of binding to one or more desired targets and being linked to drugs used alone to treat cancer. Linking an antibody to a drug can have significant and unpredictable effects on the activity of one or both the antibody and the drug, depending on the type of antibody and / or adapter and / or the drug chosen. Therefore, in some embodiments, the components of the ADC are selected to (i) retain one or more therapeutic properties exhibited by the separated antibody and drug moieties; (ii) maintain the specific binding properties of the antibody moieties; (iii) optimize the drug loading and drug-to-antibody ratio; (iv) allow delivery of the drug moieties via stable linkage to the antibody moieties (e.g., intracellular delivery); (v) maintain the stability of the ADC as a complete conjugate until transport or delivery to the target site; (vi) minimize aggregation of the ADC before or after administration; (vii) allow the therapeutic effects of the drug moieties, such as cytotoxic effects, to be achieved after lysis in the cellular environment; (viii) exhibit in vivo anticancer therapeutic efficacy similar to or superior to that of the separated antibody and drug moieties; (ix) minimize off-target killing caused by the drug moieties; and / or (x) exhibit desired pharmacokinetic and pharmacodynamic properties, reproducibility, and toxicological / immunological characteristics. Screening for each of these properties may be necessary to identify improved ADCs for therapeutic use (Ab et al. (2015) Mol. Cancer Ther. [Molecular Cancer Therapeutics] 14:1605-13).

[0243] In some embodiments, the ADCs disclosed herein that comprise an anti-mesothelin antibody or antigen-binding fragment conjugated to a chemotherapeutic agent (e.g., eribulin) exhibit a specific combination of desired properties. These properties include, but are not limited to, effective drug load, low aggregation levels, stability under storage conditions and / or when circulating in vivo (e.g., serum and matrix stability), retaining affinity for target-expressing cells comparable to unconjugated antibodies, potent cytotoxicity against target-expressing cells, high levels of bystander killing, and / or potent in vivo anticancer activity, all in comparison to ADCs using other antibody portions. In some embodiments, the high anticancer activity of these conjugates is observed even when tested in cell lines with moderate antigen expression, indicating effective sensitivity to the toxin payload delivered by the ADC. In some embodiments, ADCs comprising the anti-mesothelin antibody or antigen-binding fragment disclosed herein exhibit particularly advantageous antitumor cytotoxicity and / or potency, as well as improved off-target toxicity and drug metabolism and pharmacokinetic (DMPK) profiles, compared to ADCs comprising alternative antibody portions. In some embodiments, ADCs comprising the humanized anti-mesothelin antibody and eribulin disclosed herein offer unexpectedly favorable pharmacological and toxicological properties compared to ADCs comprising alternative antibody moieties and / or conjugates.

[0244] The disclosed ADC compounds can selectively deliver an effective dose of a cytotoxic agent or cell growth inhibitor to cancer cells or tumor tissue. In some embodiments, the cytotoxic and / or cell growth inhibitory activity of the ADC depends on the expression level of the target antigen in the cells. In some embodiments, the disclosed ADC is particularly effective in killing cancer cells expressing high levels of the target antigen compared to cancer cells expressing low levels of the same antigen. In some embodiments, the disclosed ADC is particularly effective in killing cancer cells expressing intermediate levels of the target antigen compared to cancer cells expressing low levels of the same antigen.

[0245] Exemplary cancers that highly express mesothelin include, but are not limited to, ovarian cancer (e.g., serous ovarian cancer, clear cell ovarian cancer), pancreatic cancer, mesothelioma, endometrial cancer, non-small cell lung cancer (e.g., adenocarcinoma), and colorectal cancer. Exemplary cancers that moderately express mesothelin include, but are not limited to, gastric cancer, thymic carcinoma, and cholangiocarcinoma. Exemplary cancers that low express mesothelin include, but are not limited to, melanoma and lymphoma. In some embodiments, cancers expressing mesothelin may include cancers with mutations and / or drug resistance, such as KRAS / STK11 mutant lung cancer (non-small cell lung adenocarcinoma), for example, those mutant lung cancers exhibiting resistance to treatment with PD-1 checkpoint blockade.

[0246] Drug section

[0247] The pharmaceutical portion (D) of the ADC described herein can be any chemotherapeutic agent. Useful types of chemotherapeutic agents include, for example, anti-tubulin agents. In some embodiments, the pharmaceutical portion is an anti-tubulin agent. One exemplary pharmaceutical portion used in the ADC and composition described herein is eribulin. Another exemplary pharmaceutical portion used in the ADC and composition described herein is eribulin dimer.

[0248] In various embodiments, the structure of the iribulin used in its natural form in the disclosed ADC is shown in formula (II):

[0249]

[0250] In various other embodiments, the eribulin structure used in the disclosed ADC is shown in publication number US20180193478, which is incorporated herein by reference for all eribulin structures and methods for synthesizing those structures.

[0251] Drug load

[0252] The drug load may be represented by p, and is also referred to herein as the drug-to-antibody ratio (DAR). The drug load may range, for example, from 1 to 10 drug portions per antibody portion. In some embodiments, p is an integer from 1 to 10. In some embodiments, p is an integer from 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2. In some embodiments, p is an integer from 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, or 2 to 3. In some embodiments, p is an integer from 1 to 8. In some embodiments, p is an integer from 1 to 6. In some embodiments, p is an integer from 2 to 6. In some embodiments, p is 2. In some embodiments, p is 6.

[0253] In some embodiments, the drug loading may be limited by the number of linker sites on the antibody moiety. In some embodiments, the linker moiety (L) of the ADC is linked to the antibody moiety via a chemically active group on one or more amino acid residues. For example, the linker may be linked to the antibody moiety via a free amino, imino, hydroxyl, thiol, or carboxyl group (e.g., to the N-terminus or C-terminus, to an ε-amino group linked to one or more lysine residues, to a free carboxylic acid group linked to one or more glutamic acid or aspartic acid residues, or to a thioglycolic acid group linked to one or more cysteine ​​residues). The linker site may be a native residue in the amino acid sequence of the antibody moiety, or may be introduced into the antibody moiety, for example, through DNA recombination technology (e.g., by introducing cysteine ​​residues into the amino acid sequence) or through protein biochemistry (e.g., by reduction, pH adjustment, or hydrolysis).

[0254] In some embodiments, the number of drug portions that can be conjugated to the antibody portion is limited by the number of free cysteine ​​residues. For example, in the case of cysteine ​​thiols, the antibody may have only one or more cysteine ​​thiols, or may have only one or more sufficiently reactive thiols that can be linked via a linker. Typically, antibodies do not contain a large number of free reactive cysteine ​​thiols that can be linked to the drug portion. In fact, most of the cysteine ​​thiols in an antibody are contained in inter- or intra-chain disulfide bonds. Therefore, in some embodiments, conjugation to cysteine ​​may require at least partial reduction of the antibody. Excessive linking of linker-toxin to the antibody can destabilize the antibody by reducing the cysteine ​​residues available for forming disulfide bonds. Therefore, in some embodiments, the optimal drug:antibody ratio should increase the efficacy of the ADC (by increasing the number of drug portions linked to each antibody) without destabilizing the antibody portion. In some embodiments, the optimal ratio may be 2 or 6. In some embodiments, the optimal ratio is 2.

[0255] In some embodiments, one or more site-specific conjugation techniques are used to produce a homogeneous ADC product having a defined drug load (i.e., a defined drug-to-antibody ratio (DAR)). In some embodiments, free cysteine ​​residues may be generated in the light or heavy chain of the antibody for site-specific conjugation via residue-specific conjugation technique (RESPECT). Albone et al. (2017) Cancer Biol. Ther. 18(5):347-57 and international publications WO / 2016205618 and WO / 2017106643 describe exemplary schemes for generating antibodies in the form of RESPECT, the respective methods of site-specific conjugation of these documents being incorporated herein by reference. In some embodiments, site-specific conjugation is used to generate an ADC to covalently link the antibody portion to the drug portion via a linker (e.g., a Mal-(PEG)2-Val-Cit-pAB linker). In some embodiments, site-specific conjugation is used to target about 2 DARs of an ADC or composition containing an eribulin drug portion.

[0256] Rabbit monoclonal antibodies chimeric or humanized to human constant regions can generate unpaired cysteine ​​residues within the light chain, making those residues available for conjugation (Albone et al. (2017) Cancer Biol. Ther. [Cancer Biology and Therapeutics] 18(5):347-57; International Publication No. WO / 2016205618). In some embodiments, the antibody portion used for site-specific conjugation is an antibody in the form of RESPECT-L-. An exemplary RESPECT-L-form antibody is described herein, which has an unpaired cysteine ​​residue (LCcys80) at position 80 of the light chain. As used herein, according to the Kabat numbering system, “LCcys80” or “Cys80” refers to a cysteine ​​residue at amino acid position 80 of the variable region of the light chain on an antibody or antigen-binding fragment. For example, in some embodiments, LCcys80 appears at amino acid position 80 in the variable region of the light chain disclosed herein. Antibodies derived from RESPECT-L- can produce an ADC with a DAR of about 2. In some embodiments, site-specific conjugation may be used to achieve a drug load of approximately 2 and / or an average drug load.

[0257] Pharmaceutical Composition

[0258] In some embodiments, this disclosure further provides pharmaceutical compositions comprising one or more antibodies, antigen-binding fragments, conjugates, and / or ADCs disclosed herein, and pharmaceutically acceptable carriers. In some embodiments, the pharmaceutical compositions described herein comprise at least one additional pharmaceutical agent.

[0259] In some embodiments, this disclosure further provides pharmaceutical compositions comprising multiple copies of the antibodies, antigen-binding fragments, conjugates, and / or ADCs disclosed herein. In some embodiments, this disclosure further provides pharmaceutical compositions comprising multiple copies of the ADCs disclosed herein. In some embodiments, the average p-value of the ADC in the composition is from about 1 to about 8. In some embodiments, the average p-value of the ADC in the composition is from about 2 or about 6. In some embodiments, the average p-value of the ADC in the composition is from about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, or about 2.3. In some embodiments, the average p-value of the ADC in the composition is from about 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, or 6.5.

[0260] In some embodiments, the pharmaceutical composition may further comprise one or more additional therapeutic agents, such as one or more agents capable of treating cancers expressing mesothelin, steroids, and analogues.

[0261] Therapeutic uses and treatment methods

[0262] This document discloses methods for treating subjects with conditions such as oncological conditions using the disclosed antibodies, antigen-binding fragments, conjugates, ADCs, and / or pharmaceutical compositions. Antibodies, antigen-binding fragments, conjugates, and / or ADCs may be administered alone or in combination with a second therapeutic agent, and may be administered in any pharmaceutically acceptable formulation, dosage, and dosing regimen. The therapeutic efficacy of antibodies, antigen-binding fragments, and / or ADCs may be assessed and adjusted accordingly based on indicators of toxicity and efficacy. Efficacy measures include, but are not limited to, cell growth inhibition and / or cytotoxicity observed in vitro or in vivo, tumor volume reduction, tumor growth inhibition, and / or prolonged survival.

[0263] Methods for determining whether antibodies, antigen-binding fragments, and / or ADCs exert cell growth inhibitory and / or cytotoxic effects on cells are known. For example, the cytotoxic or cell growth inhibitory activity of antibodies, antigen-binding fragments, and / or ADCs can be measured by exposing mammalian cells expressing the target proteins of the antibodies, antigen-binding fragments, and / or ADCs to cell culture medium; culturing cells for a period of approximately 6 hours to approximately 5 days; and measuring cell viability. Cell-based in vitro analyses can also be used to measure ADC activity (proliferation), cytotoxicity, and induction of apoptosis (activation of apoptotic proteases).

[0264] To determine whether antibodies, antigen-binding fragments, and / or ADCs exert cell growth inhibitory effects, thymidine binding assays can be used. For example, cancer cells expressing the target antigen at a density of 5,000 cells per well of a coated 96-well plate can be cultured for 72 hours and exposed to 0.5 μCi of 3H-thymidine during the last 8 hours of the 72-hour period. The binding of 3H-thymidine to the cells in the culture can be measured in the presence and absence of antibodies, antigen-binding fragments, and / or ADCs.

[0265] To determine cytotoxicity, necrosis or apoptosis (programmed cell death) can be measured. Necrosis is typically accompanied by increased plasma membrane permeability, cell swelling, and plasma membrane rupture. Apoptosis is characterized by membrane bubbling, cytoplasmic condensation, and activation of endogenous endonucleases. Assays indicating any of these effects on cancer cells can be used to treat cancer.

[0266] Cell viability can be measured, for example, by measuring the color of the cells with dyes such as Neutral Red, Trypan Blue, Crystal Violet, or Alamar. TMThe absorption of blue dye is used to measure cytotoxicity (see, for example, Page et al. (1993) Intl. J. Oncology 3:473-6). In such assays, cells are incubated in a dye-containing medium, washed, and the remaining dye reflecting the cell’s absorption of the dye is measured spectrophotometrically. In some embodiments, a crystal violet assay is used to assess the in vitro efficacy and / or cytotoxicity of the prepared ADC. Crystal violet is a triarylmethane dye that accumulates in the nuclei of living cells. In this assay, cells are exposed to an ADC or control for a period of time, then stained with crystal violet, washed thoroughly with water, dissolved in 1% SDS, and read spectrophotometrically. Cytotoxicity can also be measured using the protein-binding dye sulforhodamine B (SRB) (Skehan et al. (1990) J. Natl. Cancer Inst. 82:1107-12).

[0267] Apoptosis can be quantified, for example, by measuring DNA fragmentation. Commercial photometric methods for the quantitative in vitro determination of DNA fragmentation are available. Examples of such assays (including TUNEL, which detects labeled nucleotides incorporated into fragmented DNA, and ELISA-based assays) are described in Biochemica (1999), Vol. 2, pp. 34-37 (Roche Molecular Biochemicals).

[0268] Apoptosis can also be determined by measuring morphological changes in cells. For example, as with necrosis, loss of plasma membrane integrity can be determined by measuring the uptake of certain dyes (e.g., fluorescent dyes such as acridine orange or ethidium bromide). Methods for measuring the number of apoptotic cells have been described in Duke and Cohen, Current Protocols in Immunology (Coligan et al., eds. (1992), pp. 3.17.1–3.17.16). Cells can also be labeled with DNA dyes (e.g., acridine orange, ethidium bromide, or propidium iodide) and chromosome aggregation and margination along the inner nuclear membrane can be observed. Other morphological changes that can be measured to determine apoptosis include, for example, cytoplasmic aggregation, increased membrane vesicle formation, and cell contraction.

[0269] The bystander killing activity of the disclosed ADC can also be evaluated. Bystander killing activity can be determined, for example, using a assay with two cell lines, one positive and one negative for the target antigen. The cell lines can be labeled for differentiation. For example, using Nuclight... TMGreen (NLG) labeled target-positive cells and Nuclight TM Target-negative cells marked in red (NLR) can be co-cultured, treated with ADC, and then monitored for cytotoxicity. Killing of target-negative cells mixed with target-positive cells indicates bystander killing, while killing of target-negative cells in the absence of target-positive cells indicates off-target killing.

[0270] In some embodiments, this disclosure is characterized by methods for killing cancer cells or tissues, inhibiting or regulating the growth of cancer cells or tissues, or interfering with the metabolism of cancer cells or tissues by disrupting tubulin. This method can be used by any subject to provide therapeutic benefit by disrupting tubulin. Subjects who may benefit from the disruption of tubulin include, but are not limited to, subjects who have or are at risk of having: gastric cancer, ovarian cancer (e.g., epithelial ovarian cancer), lung cancer (e.g., non-small cell lung cancer), breast cancer, endometrial cancer (e.g., serous endometrial cancer), osteosarcoma, Kaposi's sarcoma, testicular germ cell cancer, head and neck cancer, liver cancer, kidney cancer, urothelial carcinoma, uterine cancer, bile duct cancer, leukemia (e.g., acute myeloid leukemia), lymphoma (e.g., Hodgkin's disease, non-Hodgkin's lymphoma), myeloma, head and neck cancer, esophageal cancer, pancreatic cancer, prostate cancer, brain cancer (e.g., glioblastoma), thyroid cancer, colorectal cancer and / or skin cancer (e.g., melanoma) or any of their metastases (Dumontet and Jordan (2010) Nat. Rev. Drug Discov. [Nature Review Drug Discovery] 9:790-803).

[0271] In various embodiments, the disclosed antibodies, antigen-binding fragments, and / or ADCs may be administered to any cells or tissues expressing mesothelin, such as cancer cells or tissues expressing mesothelin. Exemplary embodiments include methods for inhibiting mesothelin-mediated cell signaling or for killing cells. This method may be used for any cells or tissues expressing mesothelin, such as cancer cells or metastatic lesions. Non-limiting examples of cancers expressing mesothelin include mesothelioma, pancreatic cancer (e.g., pancreatic cancer), ovarian cancer (e.g., serous ovarian cancer, clear cell ovarian cancer, epithelial ovarian cancer), and lung cancer (e.g., non-small cell lung cancer, lung adenocarcinoma) (Wang et al. (2012) PLoS ONE [PLOS ONE] 7:e33214). Other exemplary mesothelin-containing cancers include endometrial cancer, colorectal cancer, gastric cancer, leukemia, breast cancer, cervical cancer, head and neck cancer, liver cancer, prostate cancer, kidney cancer, thyroid cancer, urethral cancer, uterine cancer, and bile duct cancer. Non-limiting examples of cells expressing mesothelin include OVCAR3 human ovarian cancer cells, HEC-251 human endometrioid cells, H226 human lung squamous cell mesothelioma cells, and cells containing recombinant nucleic acids encoding mesothelin or a portion thereof.

[0272] Exemplary methods include the step of contacting cells with an effective amount, i.e., an amount sufficient to kill the cells, as described herein. This method can be used on cells, for example, in vitro, in vivo, ex vivo, or in situ cultures. For example, cells expressing mesothelin can be cultured in vitro in a culture medium (e.g., cells collected via biopsy of tumors or metastatic lesions; cells from established cancer cell lines; or recombinant cells), and the contact step can be influenced by adding the antibody, antigen-binding fragment, and / or ADC to the culture medium. This method will result in the killing of mesothelin-expressing cells, particularly tumor cells expressing mesothelin. Alternatively, the antibody, antigen-binding fragment, and / or ADC can be administered to a subject via any suitable route of administration (e.g., intravenous, subcutaneous, or direct contact with tumor tissue) to produce an effect in vivo. This method can also be used with antibodies and ADCs targeting other cell surface antigens.

[0273] The in vivo effects of disclosed antibody, antigen-binding fragment, and / or ADC therapeutic compositions can be evaluated in suitable animal models. For example, xenogeneic cancer models can be used, in which cancer explants or passaged xenograft tissues are introduced into immunocompromised animals (such as nude mice or SCID mice) (Klein et al. (1997) Nature Med. 3:402-8). Efficacy can be predicted using assays that measure inhibition of tumor formation, tumor regression, or metastasis.

[0274] In vivo assays can also be used to assess tumor death promotion through mechanisms such as apoptosis. In some embodiments, the presence of apoptotic foci in xenografts from tumor-bearing mice treated with the therapeutic composition can be examined and compared with untreated control xenograft-bearing mice. The extent of apoptotic foci found in the tumors of treated mice provides an indication of the therapeutic efficacy of the composition.

[0275] This article further provides methods for treating cancer. The antibodies, antigen-binding fragments, and / or ADCs disclosed herein can be administered to non-human mammals or human subjects for therapeutic purposes. The treatment method requires the administration to mammals with tumors a biologically effective amount of an antibody, antigen-binding fragment, and / or ADC comprising an antibody linked to an expressed antigen that binds to or is localized on the surface of cancer cells.

[0276] An exemplary embodiment is a method of delivering eribulin to cells expressing mesothelin, the method comprising binding eribulin to an antibody that is immune-specifically bound to a mesothelin epitope and exposing the cells to the antibody, an antigen-binding fragment, and / or an ADC. Exemplary tumor cells expressing mesothelin that indicate the antibodies, antigen-binding fragments, and / or ADCs disclosed herein include ovarian cancer cells, endometrioid cells, and lung squamous cell mesothelioma cells.

[0277] Another exemplary embodiment is a method for reducing or inhibiting the growth of tumors expressing target antigens (e.g., tumors expressing mesothelin), the method comprising administering a therapeutically effective amount of an antibody, an antigen-binding fragment, and / or an ADC. In some embodiments, the treatment is sufficient to reduce or inhibit the growth of a patient's tumor, reduce the number or size of metastatic lesions, reduce tumor burden, reduce primary tumor burden, reduce invasiveness, prolong survival time, and / or maintain or improve quality of life. In some embodiments, the tumor is resistant or refractory to treatment with the antibody or antigen-binding portion of the ADC when administered alone, and / or the tumor is resistant or refractory to treatment with eribulin when administered alone.

[0278] Furthermore, the antibodies disclosed herein may be administered to non-human mammals expressing mesothelin for veterinary purposes or as animal models of human disease. In the latter case, such animal models can be used to evaluate the therapeutic efficacy of the disclosed antibodies, antigen-binding fragments, and / or ADCs (e.g., test doses and administration schedules).

[0279] This document further provides therapeutic uses of the disclosed antibodies, antigen-binding fragments, and / or ADCs. Exemplary embodiments are also disclosed for the use of antibodies, antigen-binding fragments, and / or ADCs in treating cancers expressing target antigens (e.g., cancers expressing mesothelin). Methods for identifying subjects with cancers expressing target antigens (e.g., mesothelin) are known in the art and can be used to identify patients suitable for treatment with the disclosed antibodies, antigen-binding fragments, and / or ADCs.

[0280] Another exemplary embodiment is the use of antibodies, antigen-binding fragments, and / or ADCs in a method of manufacturing a medicament for treating cancers expressing target antigens (e.g., cancers expressing mesothelin).

[0281] Therapeutic compositions for practicing the foregoing methods can be formulated into pharmaceutical compositions comprising a pharmaceutically acceptable carrier suitable for the desired delivery method. Exemplary embodiments include pharmaceutical compositions comprising antibodies, antigen-binding fragments, and / or ADCs disclosed herein, and a pharmaceutically acceptable carrier. Suitable carriers include any material that retains the antitumor function of the therapeutic composition when combined with it and generally does not react with the patient's immune system.

[0282] Pharmaceutically acceptable carriers include any and all physiologically compatible solvents, dispersion media, coating agents, antibacterial and antifungal agents, isotonics, and absorption delay agents. Examples of pharmaceutically acceptable carriers include one or more of water, physiological saline, phosphate-buffered saline, dextran, glycerol, ethanol, mesylates and their analogues, and combinations thereof. In many cases, the composition includes isotonics such as sugars, polyols (e.g., mannitol, sorbitol), or sodium chloride. Pharmaceutically acceptable carriers may further contain trace amounts of excipients, such as wetting agents or emulsifiers, preservatives, or buffers, which enhance the shelf life or effectiveness of the ADC.

[0283] Therapeutic formulations are soluble and can be administered via any route capable of delivering the therapeutic composition to the tumor site. Potentially effective routes of administration include, but are not limited to, intravenous, non-enteral, intraperitoneal, intramuscular, intratumoral, intradermal, intraorganic, orthotopic, and similar routes. Therapeutic protein formulations may be lyophilized and stored as sterile powders, for example, under vacuum, and subsequently reconstituted in antibacterial water (containing, for example, a benzyl alcohol preservative) or sterile water prior to injection. Therapeutic formulations may comprise antibodies, antigen-binding fragments, and / or ADCs, or pharmaceutically acceptable salts thereof (e.g., mesylates).

[0284] The antibodies, antigen-binding fragments, and / or ADCs disclosed herein can be administered to patients in need at doses ranging from about 0.2 mg / kg to about 10 mg / kg. In some embodiments, the antibodies, antigen-binding fragments, and / or ADCs are administered to patients daily, every two months, or at any time between. The dosage and administration regimen for treating cancer using the foregoing methods will vary depending on the method and the target cancer, and will generally be determined based on a number of other factors known in this art.

[0285] Various delivery systems are known and can be used to administer one or more of the antibodies, antigen-binding fragments, and / or ADCs disclosed herein. Methods of administering antibodies, antigen-binding fragments, and / or ADCs include, but are not limited to, parenteral administration (e.g., intradermal, intramuscular, intraperitoneal, intravenous, and subcutaneous), epidural administration, intratumoral administration, and mucosal administration (e.g., intranasal and oral routes). Additionally, pulmonary administration may be employed, for example, through the use of inhalers or nebulizers and formulations having aerosol formulations. See, for example, compositions and methods for pulmonary administration described in U.S. Patent Nos. 6,019,968, 5,985,320, 5,985,309, 5,934,272, 5,874,064, 5,855,913, 5,290,540, and 4,880,078; and International Publications WO 1992 / 019244, WO 1997 / 032572, WO 1997 / 044013, WO 1998 / 031346, and WO 1999 / 066903. ADCs can be administered via any convenient route, such as by infusion or bolus injection, or by absorption through the epithelial or mucosal lining of the skin (e.g., oral mucosa, rectal and intestinal mucosa). Administration can be systemic or local.

[0286] The therapeutic compositions disclosed herein are sterile and stable under manufacturing and storage conditions. In some embodiments, one or more antibodies, antigen-binding fragments, and / or ADCs or pharmaceutical compositions are provided in a hermetically sealed container as a dry, sterile lyophilized powder or anhydrous concentrate and are reconstituteable (e.g., with water or saline) to an appropriate concentration for administration to a subject. In some embodiments, one or more of the prophylactic or therapeutic agents or pharmaceutical compositions are supplied in a hermetically sealed container as a dry, sterile lyophilized powder in unit doses of at least 5 mg, at least 10 mg, at least 15 mg, at least 25 mg, at least 35 mg, at least 45 mg, at least 50 mg, at least 75 mg, or at least 100 mg, or any amount between thereof. In some embodiments, the lyophilized antibodies, antigen-binding fragments, and / or ADCs or pharmaceutical compositions are stored in the original container between 2°C and 8°C. In some embodiments, one or more of the antibodies, antigen-binding fragments, and / or ADCs or pharmaceutical compositions described herein are supplied in liquid form in a hermetically sealed container, such as a container indicating the amount and concentration of the agent. In some embodiments, the liquid form of the administered composition is supplied in a hermetically sealed container having an ADC of at least 0.25 mg / mL, at least 0.5 mg / mL, at least 1 mg / mL, at least 2.5 mg / mL, at least 5 mg / mL, at least 8 mg / mL, at least 10 mg / mL, at least 15 mg / mL, at least 25 mg / mL, at least 50 mg / mL, at least 75 mg / mL, or at least 100 mg / mL. The liquid form can be stored in the original container between 2°C and 8°C.

[0287] In some embodiments, the disclosed antibodies, antigen-binding fragments, and / or ADCs may be incorporated into pharmaceutical compositions suitable for parenteral administration. Injectable solutions may consist of liquid or lyophilized dosage forms in flint or amber vials, ampoules, pre-filled syringes, or other known delivery or storage devices.

[0288] The compositions described herein may be in a variety of forms. These forms include, for example, liquid, semi-solid, and solid dosage forms, such as liquid solutions (e.g., injectable and infusionable solutions), dispersions or suspensions, tablets, pills, powders, liposomes, and suppositories. The form depends on the intended administration method and therapeutic application.

[0289] In various embodiments, treatment involves single or repeated administration of an antibody, antigen-binding fragment, and / or ADC formulation via an acceptable route of administration.

[0290] Patients can be assessed based on the amount of target antigen in a given sample (e.g., the amount of cells expressing the target antigen) to help determine the most effective dosing regimen. An exemplary embodiment is a method for determining whether a patient responds to treatment with antibodies, antigen-binding fragments, and / or ADCs disclosed herein, the method comprising providing a biological sample from the patient and contacting the biological sample with the antibody, antigen-binding fragment, and / or ADC. Exemplary biological samples include tissues or body fluids, such as inflammatory exudates, blood, serum, intestinal fluid, stool samples, or tumor biopsies (e.g., tumor biopsies derived from patients with or at risk of having cancer expressing a target antigen, such as mesothelin). In some embodiments, the sample (e.g., tissue and / or body fluid) may be obtained from the subject, and suitable immunological methods may be used to detect and / or measure the protein expression of the target antigen (e.g., mesothelin). Such assessments are also used for monitoring purposes throughout therapy and may be combined with other parameter assessments to monitor treatment success.

[0291] In some embodiments, the efficacy of the antibody, antigen-binding fragment, and / or ADC can be assessed by contacting a tumor sample from a subject with the antibody, antigen-binding fragment, and / or ADC and evaluating the tumor growth rate or volume. In some embodiments, when the antibody, antigen-binding fragment, and / or ADC has been determined to be effective, it can be administered to the subject.

[0292] The above treatments can be combined with any of a variety of additional surgical, chemotherapy, or radiation therapy regimens. In some embodiments, the antibodies, antigen-binding fragments, and / or ADCs or compositions disclosed herein are co-formulated and / or co-administered with one or more other therapeutic agents, such as one or more chemotherapeutic agents. Non-limiting examples of chemotherapeutic agents include alkylating agents, such as nitrogen mustard, ethylene imine compounds, and alkyl sulfonates; antimetabolites, such as folic acid, purine, or pyrimidine antagonists; and antimitotic agents, such as antitubule agents, such as eribulin or eribulin mesylate. TM ), vinca alkaloids and auristatin; cytotoxic antibiotics; compounds that impair or interfere with DNA expression or replication, such as DNA minor groove binders; and growth factor receptor antagonists. In some embodiments, the chemotherapeutic agent may be a cytotoxic agent or a cell growth inhibitor. Examples of cytotoxic agents include, but are not limited to, antimitotic agents such as eribulin or eribulin mesylate (Halaven). TM), olentatine (e.g., monomethylolentatine E (MMAE), monomethylolentatine F (MMAF)), maytansine alkaloids (e.g., maytansine), sulphurin, dosstatin, novolucrin, vinblastine alkaloids (e.g., vincristine), taxane, paclitaxel, and colchicine; anthracyclines (e.g., doxorubicin, doxorubicin, dihydroxyanthracindione); cytotoxic antibiotics (e.g., mitomycin, actinomycin, pyromycin (e.g., CC-1065), auromycin / duomycin, calicheamicin, endomycin, phenolmycin); alkylating agents (e.g., cisplatin); intercalating agents (e.g., ethidium bromide); topoisomerase inhibitors (e.g. Etoposide and tenoposide; radioactive isotopes such as At211, I131, I125, Y90, Re186, Re188, Sm153, Bi212 or 213, P32 and radioactive isotopes of lutetium (e.g., Lu177); and toxins of bacterial, fungal, plant or animal origin (e.g., ricin (e.g., ricin A chain), diphtheria toxin, Pseudomonas exotoxin A (e.g., PE40), endotoxins, mitogens, comprestatin, localized aspergillin, gelonin, α-broomrodactylin, abrin toxin (e.g., abrin A chain), modicin (e.g., modicin A chain), curicin, crotonin, Sapaonaria officinalis inhibitor, glucocorticoids).

[0293] This document also discloses the use of one or more of the disclosed antibodies, antigen-binding fragments, and / or ADCs in the manufacture of medicaments for treating cancer, for example, according to the methods described above. In some embodiments, the ADCs disclosed herein are used, for example, to treat cancer according to the methods described above.

[0294] In various embodiments, kits for laboratory and therapeutic applications described herein are within the scope of this disclosure. Such kits may comprise a carrier, package, or container partitioned to accommodate one or more containers such as vials, cannulas, and the like, each of which contains one of the independent elements to be used in the methods disclosed herein, and a label or insert containing instructions for use as described herein. Kits may comprise containers containing a pharmaceutical portion. This disclosure also provides one or more of antibodies, antigen-binding fragments, and / or ADCs, or pharmaceutical compositions thereof, encapsulated in hermetically sealed containers (such as ampoules or capsules) indicating the amount of the pharmaceutical agent.

[0295] The kit may contain the container described above and one or more other containers associated therewith, which contain materials that are commercially and user-appropriate, including buffers, diluents, filters, needles, syringes; carriers, packages, containers, vials and / or canister labels listing the contents and / or instructions for use; and a drug information leaflet with instructions for use.

[0296] Labels may be present on or inside the container to indicate that the composition is intended for a specific therapeutic or non-therapeutic application, such as prognostic, preventative, diagnostic, or laboratory use. Labels may also indicate instructions regarding in vivo or in vitro use (as described herein). Instructions and / or other information may also be included in inserts or labels included in or on the kit. Labels may be on or associated with the container. Labels may be on the container when the letters, numbers, or other characters forming the label are molded or etched into the container itself. Labels may be associated with the container, for example, as a packaging insert, when the label is present within a receiver or carrier that also holds the container. Labels may indicate that the composition is intended for the diagnosis or treatment of conditions such as cancers described herein.

[0297] It will be apparent to those skilled in the art that the methods of the invention described herein are obvious without departing from the scope of the invention or embodiments disclosed herein, and that other suitable modifications and adaptations may be made thereto using appropriate equivalents. The invention has now been described in detail, and will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting.

[0298] Example

[0299] Example 1: Production of chimeric antibodies against human mesothelin

[0300] Chimeric antibodies containing rabbit and human immunoglobulin sequences were generated according to the procedure described below. The binding of the antibodies to human mesothelin and epitope binding were analyzed. The initial ADC cytotoxicity of the recombinant chimeric anti-mesothelin antibody was evaluated in human cell lines expressing different levels of mesothelin. Key antibodies used for humanization and ADC development are described in Examples 2-3.

[0301] 1.1 Reagents and Materials

[0302] 1.1.1 Antibodies

[0303] The antibody used in the following studies was a rabbit-human chimeric (-xi) anti-human mesothelin antibody with an unpaired cysteine ​​residue at position 80 of the light chain (LCcys80). The antibody was purified and decysteinated as described in Section 1.5 below. The final protein content was assessed by BCA analysis and SDS-PAGE.

[0304] 1.1.2 Can conjugate cytotoxins and LCcys80 ADC

[0305] The adapter-cytotoxic compound used in the following studies included Mal-PEG2-Oprestatin F. The antibody was conjugated to Mal-PEG2-Oprestatin F at a molar ratio of 1:5 (mAb: payload). The conjugated LCcys80 antibody was purified by desalting chromatography on AKTA FPLC using 2 x 5 mL HiTrap desalting columns (GE Healthcare), with 1X DPBS as the operating buffer. The final protein content was determined by BCA analysis.

[0306] 1.1.3 Tumor cell lines

[0307] Human tumor cell lines used for analysis of rabbit-human chimeric ADCs included A431-K5 (human melanoma cells A431, MSLN stably transfected with human mesothelin). hi A431 (MSLN) lo ) and OVCAR3 (human ovarian cancer, MSLN) hi The A431-K5 cells were obtained from the National Cancer Institute. The cell line used was obtained directly from the American Type Culture Collection (ATCC).

[0308] 1.1.4 Other reagents

[0309] Unless otherwise specified, all reagents used were purchased from commercial suppliers at research grade or higher.

[0310] 1.2 Inducing antibodies against human mesothelin in rabbits

[0311] Human mesothelin cDNA from vector p0301 was cloned into the Aldevron expression vector (pB8-mesothelin-hum). Two rabbits were then immunized with the pB8-mesothelin-human immunomodulator. Immune serum was obtained on day 52 of the immunization protocol after four genetic applications. Rabbit immune serum was diluted 1:1000 or 1:5000 in PBS containing 1% BSA and tested by flow cytometry for the following: mammalian cells pre-transfected with human mesothelin cDNA cloned into the Aldevron expression vector (pB1-mesothelin-hum) and mammalian cells transfected with unrelated cDNA cloned into the same vector. Antibodies from the immune serum were then detected using 10 μg / mL goat anti-rabbit IgG R-phycoerythrin (SBA (SouthernBiotech), #4030-09). Immunization, flow cytometry, and cell cryopreservation were performed using Aldevron (Dreiburg, Germany).

[0312] 1.3 High-throughput screening of cultures producing anti-mesothelin antibodies

[0313] 1.3.1 Cell Culture

[0314] Cryopreserved rabbit lymph node cells (2.0 × 10⁻⁶) 7 Cells were thawed, activated with 2.5 μg / mL lectin from *Phytolacca americana*, and recovered with DNase I at 37°C for one hour at 5% CO2. Cells were seeded at 5 cells per well in 384-well plates with feeder cells (CHO expressing rabbit CD154) and cultured in complete IMDM (IMDM supplemented with 10% FBS, 2 mM L-glutamine, 1X MEM NEAA, 1 mM sodium pyruvate, 50 U / mL penicillin, 50 μg / mL streptomycin, and 55 μM 2-Me) containing 10.5 ng / mL human IL2 and 10.5 ng / mL human IL21 intercytokinin (PeproTech).

[0315] 1.3.2 Isolation of rabbit IgG and polyclonal antibodies against human mesothelin

[0316] In week 2, wells producing rabbit IgG antibodies were identified using IgG FRET with europium cavitate. The presence of rabbit IgG Fcγ antibodies in wells producing IgG was screened by ELISA against plates coated with 1 μg / mL CHO-MT40 mesothelin. Cultures producing mesothelin-specific rabbit IgG were confirmed by ELISA screening against 1 μg / mL mesothelin and reverse screening against 1 μg / mL CD73-his. FRET and ELISA were performed at... Performed on the FX machine system (Beckman).

[0317] 1.3.3 mRNA gene rescue of rabbit antibodies targeting human mesothelin

[0318] Using RNAqueous TM Total RNA was isolated from the wells containing rabbit IgG anti-mesothelin antibody using the -96 Total RNA Isolation Kit (Ambion). cDNA was synthesized and amplified by PCR using the Platinum Taq One-Step RT-PCR Kit (Invitrogen) with internal primers for the light and heavy chain variable regions (Table 11). The light and heavy chain variable regions were amplified using the Platinum Taq Amplification Kit and a thermal cycler (40 cycles, 1 min 94°C, 1 min 54°C, 1.5 min 68°C) with nested primers (Table 12). The amplified DNA template was observed by gel electrophoresis, purified using the QIAquick 96 PCR Purification Kit (Qiagen), and sequenced using GeneWiz (South Plainfield, NJ) with internal primers (Table 13). DNA sequences were analyzed against the rabbit family (IMGT / V-QUEST) for the V and J genes and against the internal In-Fusion Primer Database (Blastn). In-Fusion primers (Table 14) were identified or designed to contain a human Fc linker added to the 5' end of primers used for the V and J genes. The primers were synthesized via IDT (Coralville, IA).

[0319] Table 11. Primer sequences for one-step RT-PCR

[0320]

[0321] Table 12. Primer sequences used for PCR

[0322]

[0323] Table 13. Primer sequences used for DNA template sequencing

[0324] Gene 3' primer Heavy TTGGTGTTGGTGGCTGGGTG(SEQ ID NO:45) light GTTBTACTGKTMTYGATGCC(SEQ ID NO:46)

[0325] Table 14. Primer sequences for In-Fusion PCR of sample 345A12

[0326]

[0327] 1.3.4 PCR fragments

[0328] The PCR-amplified variable domain comprises 15 base pairs at the 5' and 3' ends, homologous to the cloning site in the subcloning vector. Following the manufacturer's protocol, the PCR fragment was subcloned into an expression plasmid containing either the human γ (p1974pC+75IZ-ldr-InFusion-huγ) or κ constant region (p1975pC+75IB-ldr-InFusion-huκ) using the In-Fusion HD Cloning Kit (Clontech). Following the manufacturer's protocol, 1 μL of In-Fusion reactants was converted into Stellar competent cells (Clontech). The transformants were grown overnight at 37°C in 1 mL of TB medium (Teknova) on a microtiter plate shaker. The following day, the culture was purified on a small scale using the QIAprep 96Turbo Small-Scale Purification Kit (Qiagen) using epMotion 5075 according to the manufacturer's protocol.

[0329] 1.3.5 Gene Synthesis Fragments

[0330] Humanized heavy and light variable domains were codon-optimized for expression in Chinese hamster ovary (CHO) cells and synthesized using gene technology. The synthesized variable domains contained a Kozak translation initiation sequence and an Ig secretion leader sequence, and included 15 base pairs at the 5' and 3' ends homologous to the cloning site in the subcloning vector. The gene-synthesized PCR fragments were subcloned into expression plasmids containing either the human γ (p1974 pC+75IZ-ldr-InFusion-huγ) or κ constant region (p1975pC+75IB-ldr-InFusion-huκ) using the In-Fusion HD cloning kit (Clontech). All clones were sequenced to confirm the presence and fidelity of the inserted sequences.

[0331] 1.4 Instantaneous mAb Generation

[0332] 1.4.1 HEK cells

[0333] For each milliliter 3×10 6Cells to be transfected with ExpiFectamine (ThermoFisher) were incubated with 333.3 ng of HC plasmid and 333.3 ng of LC plasmid in 50 μL Opti-MEM (ThermoFisher) for 5–10 min. Similarly, 2.67 μL of ExpiFectamine was incubated in 50 μL Opti-MEM. The ExpiFectamine solution was added to the DNA mixture and incubated at room temperature for 20–30 min. Simultaneously, the DNA:ExpiFectamine mixture was added to the cells and incubated at 37°C, 8% CO2, and 125 rpm with shaking. On the second day, 5 μL of enhancer 1 and 50 μL of enhancer 2 / mL of cells were added to the transfection solution, and the cells were incubated for another 7–10 days. After 48–72 hours, the cells were fed a final concentration of 10 g / L yeast extract (BD Biosciences), 5 mM valerate (Sigma-Aldrich), and 1:100 CD lipid concentrate (ThermoFisher).

[0334] 1.4.2 CHO cells

[0335] For each milliliter 6×10 6 For cells to be transfected with ExpiFectamine CHO (ThermoFisher), 500 ng of HC plasmid and 500 ng of LC plasmid were mixed in 40 μL of Opti-PRO (ThermoFisher). Similarly, 3.2 μL of ExpiFectamine CHO was mixed in 36.8 μL of Opti-PRO. The ExpiFectamine CHO solution was added to the DNA mixture and incubated at room temperature for 1–5 min. While vortexing, the DNA:ExpiFectamine CHO mixture was added to the cells and incubated at 37°C, 8% CO2, and 125 rpm. On day 2, 6 μL of enhancer and 160 μL of feed / mL cells were added to the transfection solution, and the cells were transferred to 32°C, 5% CO2. On day 5, an additional 160 μL of feed / mL cells was added. The supernatant was collected on days 12–14.

[0336] 1.5 mAb purification and decysteine ​​conversion

[0337] 1.5.1 Antibody Purification

[0338] Equilibrate the Prosep-vA high-capacity protein A resin (Millipore) with DPBS, and add 50 μL to 2 mL of sample. After incubation at room temperature for 1 hour, add the medium and resin to a filter plate and wash twice with 1 mL of DPBS. Elute the sample from the resin by adding 400 μL of 0.1 M glycine, pH 2.9, followed by centrifugation at 15,000 × g for 30 seconds. Neutralize the sample with 20 μL of 1 M Tris, pH 8.0. Concentrate the sample to approximately 100 μL by centrifugation at 15,000 × g for 5 min using a 0.5 mL Amicon Ultra, 10 kWh cutoff filter (Millipore), and exchange the sample into DPBS using a 0.5 mL Zeba desalting column with 7 kWh MWCO buffer according to the manufacturer's instructions. mAb concentration was determined by measuring AU280 and converted to mg / mL using the extinction coefficient of mAb.

[0339] 1.5.2 Cysteine ​​decapping

[0340] Purification was performed using the AKTA Xpress purification platform (GE Healthcare). Up to 1 L of modified medium was loaded onto a 5 mL MabSelect column (GE Healthcare) equilibrated at 20 mM sodium phosphate, 150 mM NaCl, pH 7.0. After loading, the column was thoroughly washed with equilibration buffer until a stable baseline was observed. The bound material was eluted with 100 mM glycine at pH 2.9. The eluted material was immediately injected onto a 26 / 10 HiPrep desalting column (GE Healthcare) equilibrated in 1X phosphate-buffered saline (PBS) and eluted in the same buffer. Peak fractions were collected. Protein content was analyzed by BCA analysis (ThermoFisher) and by reducing and non-reducing SDS-PAGE electrophoresis.

[0341] 1.6 Initial screening and characterization of recombinant chimeric anti-mesothelin antibodies for ADC development

[0342] Anti-mesothelin antibody was transiently expressed in Expi-293 medium and cultured in 96-well deep-well plates. The antibody from the supernatant was purified and decysteylated as described above. The antibody was conjugated with Mal-PEG2-Oristatin F as the load at a 1:5 (mAb:load) molar ratio. The conjugated antibody was desalted using a Thermo Zeba spin desalting plate to remove the hyperfree load.

[0343] 1.7 Combined Characterization

[0344] 1.7.1 Anti-mesothelin epitope clustering using Octet

[0345] First, antibodies binding to mesothelin epitopes were characterized using Octet with streptavidin tips in a custom binding assay. Epitopes binding to anti-mesothelin antibodies were normalized relative to epitopes bound by the known anti-mesothelin antibody MORAb-009 (amatuximab). Antibodies were grouped based on their binding to the same, adjacent, or different epitopes as MORAb-009. This process was repeated until all antibodies were clustered and aligned with different epitopes. Based on the Octet results, binding affinities were ranked as high, intermediate, and low. All binding steps were performed in PBST buffer containing 0.2% BSA.

[0346] 1.7.2 Surface Plasmon Resonance (BIAcore) Combined Analysis

[0347] The binding affinity of anti-mesothelin antibodies to mesothelin was measured using a series of S CM5 chips via BIAcore (BIAcore T-100, GE Healthcare, #1426075). Antibody concentrations were adjusted to 1 μg / mL in 1X HBS-P+ buffer (GE Healthcare), and mesothelin (50 μg) was adjusted to 100 nM. Anti-human antibody capture chips were prepared using CM5 chips with a fixed guide according to the manufacturer's protocol. The final captured antibody level in HBS-P+ was 8000–9000 RU. Chips were prepared for analysis with five cycles of 300-second buffer injection followed by 30-second regeneration, all cycles spanning all four flow cells at 30 μL / min. Antibodies were captured in flow cells 2–4 by sequentially injecting single ligand solutions at 10 μL / min for 90 seconds. Analyte injections were performed in a single-cycle kinetic configuration as follows: sequentially injecting analyte solutions of increasing concentrations at 30 μL / min for 240 seconds each. The detection sequences were 2-1, 3-1, and 4-1. The injected sequences were double-referenced using the same ligand capture, followed by five buffer-only injections for 240 seconds each, followed by dissociation for 1800 seconds and regeneration as described above. All ligand binding to mesothelin was analyzed in duplicate. Kinetic analysis was performed using a 1:1 Langmuir fitting model with BIAEvaluations software. Association rate, dissociation rate, and affinity constant were averaged using a self-repeating operation.

[0348] 1.8 In vitro cytotoxicity analysis

[0349] A431, A431-K5, and OVCAR3 cells were subcultured and seeded at 5,000 cells / well in complete growth medium in 96-well tissue culture plates and incubated overnight (16 hours) at 37°C and 5% CO2. Test reagents were serially diluted 1:3 (total of 10 dilutions) in 2 mL deep-well dilution plates starting at 200 nM. 100 μL of the diluted sample was added to the cell culture plates (starting concentration of 100 nM test sample). The plates were incubated for another 5 days at 37°C and 5% CO2. The culture medium was then discarded, and the plates were washed once with 200 μL of DPBS, stained with 50 μL of 0.2% crystal violet solution for 15 min at room temperature, and then thoroughly washed with tap water. The culture plates were air-dried, and the crystal violet was dissolved in 200 μL of 1% SDS solution. The culture plates were read at 570 nm. Data were analyzed using a GraphPad Prism6.

[0350] 1.9 Results

[0351] 1.9.1 Rabbit Immunization

[0352] Two rabbits were immunized with plasmid pB8-mesothelin-human for DNA immunization for four genetic applications. Immune serum was obtained on day 52 of the immunization protocol, diluted 1:1000 or 1:5000 in PBS containing 1% BSA, and analyzed by flow cytometry using mesothelin-expressing cells. Serum from the two immunized rabbits was combined with mesothelin-expressing cells transfected with pB1-mesothelin-hu. Figure 1 (Lower curve). Conversely, serum from immunized rabbits does not bind to cells transfected with unrelated cDNA ( Figure 1 (Upper curve).

[0353] 1.9.2 High-throughput screening of rabbit polyclonal antibodies against human mesothelin

[0354] Rabbit lymph node cells were collected and cryopreserved. Cells from thawed lymph nodes (2 × 10⁻⁶) were then transferred to the cryopreserved lymph nodes. 7 Rabbit IgG antibody-producing cultures were seeded at 5 cells / well in 384-well plates using feeder cells and cultured in intact IMDM containing 10.5 ng / mL human IL-2 and 10.5 ng / mL human IL-21 cytokines. Two weeks after seeding with europium cavitary compound via IgG FRET, wells producing rabbit IgG antibodies were identified, and 18,715 IgG-producing cultures were screened for reactivity to human mesothelin by ELISA. The reactivity to mesothelin was reconfirmed for the eighty-fifth mesothelin-specific culture, and reactivity to human CD73 was reverse-selected. Fifty-four cultures produced rabbit Fcγ antibodies with binding exceeding 0.2 OD. 450Mesothelin has no cross-reactivity with CD73. Figure 2 The results of the primary ELISA are shown as the rightmost bar chart, and the results of the secondary ELISA are shown as the leftmost bar chart, with human CD73 binding shown through the middle bar chart.

[0355] 1.9.3 RT-PCR, Sequencing, and Cloning of Variable Regions

[0356] Total RNA was isolated from 54 confirmed cultures that produced rabbit IgG anti-mesothelin antibodies. cDNA was synthesized by RT-PCR, and the variable regions of the light and heavy chains were amplified by PCR. Fifty-two DNA sequences were analyzed using the rabbit family of V and J genes (IMGT / V-QUEST), and PCR amplification was performed on 51 sequences using primer pairs specific to In-Fusion cloned into the constant region expression vector. Figure 3 A total of 48 antibodies were cloned into human constant region expression vectors and subsequently transfected into expi293F cells. Antibodies were detected in 45 of the 51 transfectants. Figure 4 The rabbit variable region was cloned into the human constant region expression vector via In-Fusion.

[0357] 1.9.4 Initial screening of ADCs for cells expressing mesothelin

[0358] Purify the chimeric rabbit anti-human mesothelin (rb-hu-xi anti-MSLN) antibody according to the method described in Section 1.5. Determine the protein concentration of the purified antibody. Figure 5 To screen for anti-mesothelin antibodies targeting ADC development, microconjugation of anti-mesothelin antibodies with Mal-PEG2 olistatin F was performed. The ADCs were characterized by in vitro cell-based efficacy analysis using OVCAR3, A431-K5, and A431 cell lines. OVCAR3 and A431-K5 expressed high levels of mesothelin, and A431 (MSLN) cells were used. - ) was used as a control cell line for evaluating the off-target killing and specificity of ADCs. Figure 6 ).

[0359] 1.9.5 Epitope binding of anti-mesothelin antibody

[0360] The mesothelin-binding epitopes of 48 anti-mesothelin antibodies were characterized using Octet, as indicated in Section 1.7.1. Six different epitopes were identified for each antibody, and binding was not observed in the current formulation of 102A6 by Octet. Figure 7 As indicated in Section 1.7.2, antibody binding affinity to mesothelin was measured using the BIAcore. The binding affinity results are summarized in Table 15.

[0361] Table 15. Binding affinity of anti-mesothelin antibodies to mesothelin

[0362]

[0363]

[0364] Based on the above results, fifteen antibodies covering all epitope groups were selected for expanded conjugation and characterization, as indicated in Table 16. When conjugated with olistatin F, 102A6A was also selected based on its favorable in vitro efficacy.

[0365] Table 16. Fifteen selected anti-mesothelin antibodies and their epitopes

[0366]

[0367]

[0368] Example 2: Humanization of anti-mesothelin ADCs

[0369] Humanized anti-mesothelin antibodies were generated according to the procedure described below. The binding activity of the antibodies and ADCs to retained human mesothelin and their cytotoxic efficacy against mesothelin-expressing cells were analyzed. The antibodies were also biophysically characterized for drug loading, aggregation, thermal stability, and serum and matrix stability. The major humanized antibodies and ADCs were evaluated in vivo as described in Example 3.

[0370] 2.1 Reagents and Materials

[0371] 2.1.1 Antibodies

[0372] The antibodies used in the following studies contained an unpaired cysteine ​​residue at position 80 of the light chain (LCcys80) and included rabbit-human chimeric (-xi) and humanized (-zu) forms of anti-human mesothelin antibodies 33O11, 201C15, 111B10, 324O5, 178F16, 264E24, 237N18, 383I18, 393L14, 346C6, 62B10, 55B4, MORAb009, 120N18, 345A12, and 102A6A2. The antibodies were purified batch-wise using Prosep-vA high-capacity protein A resin and a Zeba desalting column. Purification and decysteine ​​removal were performed in modified medium (Example 1) as described in Section 1.5. The final protein content was assessed by BCA analysis and SDS-PAGE.

[0373] 2.1.2 Can conjugate cytotoxins and LCcys80 ADC

[0374] The linker-cytotoxic compounds used in the following studies included maleimide-VCP-eribulin, maleimide-VCP-noscotin, and maleimide-VCP-eribulin dimer. Conjugated antibodies were purified by desalting chromatography using a HiTrap desalting column (GE Healthcare) equilibrated in 1X DPBS. Final protein content was determined by BCA analysis.

[0375] 2.1.3 Tumor cell lines

[0376] Human tumor cell lines used for analysis of rabbit-human chimeric ADCs include A431 (human melanoma cells, MSLN). neg A3 (A431 and MSLN stably transfected with human mesothelin) hi OVCAR3 (human ovarian cancer cells, MSLN) hi HEC-251 (human endometrioid, MSLN) med ) and H226 (human pulmonary squamous cell mesothelioma, MSLN) lo All cell lines used were obtained directly from the American Type Culture Collection (ATCC). Except for A3, which was produced at Morphotek from the parental A431 cell line and HEC-251, and obtained from JCRB.

[0377] 2.1.4 Other reagents

[0378] Unless otherwise specified, all reagents used were purchased from commercial suppliers at research grade or higher.

[0379] 2.2 Biophysical characterization of ADC

[0380] 2.2.1 SEC-HPLC Aggregation Analysis

[0381] SEC-HPLC analysis was performed using an Agilent 1200 HPLC system. An AdvanceBio SEC 300A (2.7 μm, 7.8 × 50 mm, serial number 0006344424-13, batch number 0006344424) guard column was connected to an AdvanceBio SEC300A analytical column (2.7 μm, 7.8 × 300 mm, serial number 0006336837-4, batch number 0006336837) and equilibrated at a flow rate of 0.5 mL / min in 0.1 M sodium phosphate, 0.15 M sodium chloride, 5% IPA, pH 7.4.

[0382] Aggregation of LCcys80 ADCs was analyzed using size exclusion chromatography and high-performance liquid chromatography (SEC-HPLC) with an Agilent 1200 HPLC system. Antibody and ADC were prepared in 1X DPBS at 2 mg / mL, and 8 μL (16 μg) of each sample was injected and incubated for 36 min. All data were analyzed using Agilent ChemStation software. Aggregation percentage, monomer percentage, and fragmentation percentage are reported.

[0383] 2.2.2 Hydrophobic Interaction Chromatography (HIC-HPLC) DAR Analysis

[0384] DAR was analyzed using hydrophobic interaction chromatography (HIC-HPLC) on an Agilent HPLC 1260 system. Samples were injected onto a TSKgel ethyl-5PW column (TOSOH Bioscience, 7.5 mm ID × 7.5 cm, 10 μm, pore-free) and eluted at 0.7 mL / min through a 3-min equilibration with 100% mobile phase A, a 15-min gradient (0-100% B), a 5-min hold in 100% B, a 1-min change to 100% A, and a 5-min reequilibration in 100% mobile phase A. Mobile phase A consisted of 25 mM sodium phosphate and 1.5 M ammonium sulfate, pH 7.0. Mobile phase B consisted of 25 mM sodium phosphate and 25% isopropanol, pH 7.0. Detection was performed at 280 nm (reference 320 nm). DAR was determined using the following formula:

[0385] [AUC+1+2(AUC+2)+3(AUC+3)+…n(AUC+n)] / ΣAUCtot]

[0386] Where AUC+1 is the area under the curve (AUC) of the antibody peak corresponding to an ADC conjugated with one cytotoxin, and AUC+2 is the AUC of the antibody peak corresponding to an ADC conjugated with two cytotoxins. ΣAUCtot is the AUC of the combination of conjugated and unconjugated peaks (DAR = 0, 1, and 2).

[0387] 2.2.3 Liquid Chromatography / Mass Spectrometry (LC-MS) DAR Analysis

[0388] DAR was also analyzed using LC-MS with Waters Alliance HPLC featuring SQD / PDA detection. Samples were injected into a Proteomix RP-1000 column (5 μm) at 65°C. Elution was performed on a 4.6 mm × 15 cm Sepax lens, using a 3-minute equilibration with 25% B, a 27-minute linear gradient from 25% to 55% B, a 5-minute hold in 55% B, a 1-minute change to 90% B, a 5-minute hold in 90% B, a 1-minute change back to 25% B, and a 5-minute reequilibration with 25% B. Mobile phase A was water containing 0.1% TFA, and mobile phase B was acetonitrile containing 0.1% TFA. The eluent was then aliquoted 10:1 into the PDA and SQD detector. The SQD detector was set to positive ES, a capillary voltage of 3.5 kV, a cone voltage of 50 V, an extractor voltage of 5 V, and an RF lens of 0.3 V, a source temperature of 150 °C, and a desolvation temperature of 350 °C. Mass data were acquired continuously for 40 minutes at 200–2000 m / z with a scan time of 1 second. Data was analyzed using MassLynx and MaxEnt1, and deconvolution was performed offline. DAR was calculated using the following formula:

[0389] 2[[AUCLC+1+2(AUCLC+2)+3(AUCLC+3)+…n(AUCLC+n)] / ΣILCtot]+2[[AUCHC+1+2(AUCHC+2)+3(AUCHC+3)+…n(AUCHC+n)] / ΣAUCHCtot]

[0390] Where AUCLC+1 is the area under the curve (AUCLC+1) of the light chain peak conjugated with one cytotoxin, AUCLC+2 is the AUCLC+2 of the light chain peak conjugated with two cytotoxins, and so on. AUCHC is the AUCLC+1 of the corresponding heavy chain, and ΣAUCLCtot and ΣAUCHCtot are the combined AUCLC+1 and combined AUCLC+1 of all unconjugated and conjugated light and heavy chains, respectively.

[0391] 2.3 Combined Characterization

[0392] 2.3.1 Anti-mesothelin epitope clustering using Octet

[0393] First, antibodies binding to mesothelin epitopes were characterized using Octet with streptavidin tips using a custom binding assay. Epitopes binding to anti-mesothelin antibodies were normalized relative to epitopes bound by the known anti-mesothelin antibody MORAb-009. Antibodies were grouped based on their binding to the same, adjacent, or different epitopes as MORAb-009. This process was repeated until all antibodies were clustered and aligned with different epitopes. Based on the Octet results, binding affinities were ranked as high, intermediate, and low. All binding steps were performed in PBST buffer containing 0.2% BSA.

[0394] 2.3.2 Surface Plasmon Resonance (BIAcore) Combined Analysis

[0395] The binding affinity of anti-mesothelin antibodies to mesothelin was measured using a series of S CM5 chips via BIAcore (BIAcore T-100, GE Healthcare, #1426075). Antibody concentrations were adjusted to 1 μg / mL in 1X HBS-P+ buffer (GE Healthcare), and mesothelin (50 μg) was adjusted to 100 nM. Anti-human antibody capture chips were prepared using CM5 chips with a fixed guide according to the manufacturer's protocol. The final captured antibody level in HBS-P+ was 8000–9000 RU. Chips were prepared for analysis with five cycles of 300-second buffer injection followed by 30-second regeneration, all cycles spanning all four flow cells at 30 μL / min. Antibodies were captured in flow cells 2–4 by sequentially injecting single ligand solutions at 10 μL / min for 90 seconds. Analyte injections were performed in a single-cycle kinetic configuration as follows: sequentially injecting analyte solutions of increasing concentrations at 30 μL / min for 240 seconds each. The detection sequences were 2-1, 3-1, and 4-1. The injected sequences were double-referenced using the same ligand capture, followed by five buffer-only injections for 240 seconds each, followed by dissociation for 1800 seconds and regeneration as described above. All ligand binding to mesothelin was analyzed in duplicate. Kinetic analysis was performed using a 1:1 Langmuir fitting model with BIAEvaluations software. Association rate, dissociation rate, and affinity constant were averaged using a self-repeating operation.

[0396] 2.4 Differential Scanning Calorimetry (DSC) Thermal Stability Analysis

[0397] A VP capillary differential scanning calorimeter (VP-CapDSC; Microcal, VP-CapDSC, #12-07-149 with Origin-7 plotting and MicroCal VP capillary DSC software version 2.0) was used to decipher and compare the higher-order structures and thermal stability of different F(ab')2 fragments and controls. Samples were prepared on 96-well analytical plates (Microliter Analytical Supply) using 20% ​​Contrad solution and analyzed at 10°C in an autosampler.

[0398] 2.5 Capillary Isoelectric Focusing (cIEF) Analysis

[0399] Fill the autosampler reagents according to the CFR installation and startup procedure. Use heme as the system stability standard. Use the default settings for batch data analysis. Perform focusing time #1 at 1,500V for 1 min for system suitability standards and samples. Perform focusing time #2 at 3,000V for 5 min for system suitability standards and 3,000V for 11 min for TIGC samples and buffer controls. Duplicate the TIGC samples using focusing time #2 for 4.5 min and classify all samples according to system suitability standards. Autointegrate the samples using a peak width parameter of 0.1, a threshold of 5, and an integral between pI values ​​of 7.5 and 9.4.

[0400] 2.6 Preparation of DAR2 and DAR6 MORAb-109 ADCs

[0401] The 345A12-HC15-LC4 CHOZN cell line was cultured in a 20L filter bag until viability was <30% and concentrated to 2L using TFF. Antibodies were captured on Amosphere A3 resin pre-equilibrated with 20mM sodium phosphate, 10mM EDTA, pH 7.2, washed in the same buffer until a stable baseline was achieved (to remove unbound material), and then reduced on the column at low flow rate with 20mM sodium phosphate, 10mM EDTA, 10mM cysteine, pH 7.2 for 8 hours, followed by re-oxidation on the column with 20mM Tris, pH 7.5 for 60 hours. The bound material was eluted in 0.1M glycine, pH 3.0, followed by percolation in 1X PBS, 2mM EDTA, pH 7.4 and concentration to >10 mg / mL. The final recovery was 100%.

[0402] For DAR2 MORAb-109, maleimide-VCP-eribulin was added (in DMSO) at a molar ratio of 1:2.5 (mAb:load) for 1 hour at room temperature. After conjugation, the material was diluted to 2 mg / mL, percolated in 1X PBS and 2 mMEDTA to remove unconjugated linker load, and concentrated to 5 mg / mL. The DAR2 material was purified by preparative ether-5PW HIC chromatography. The final material was characterized by SEC-HPLC, RP-HPLC, and HIC-HPLC.

[0403] For DAR6 MORAb-109, the purified / decysteine-depleted antibody was diluted to 7.5 mg / mL in 1X PBS and 2 mM EDTA, and further reduced by adding an equal volume of 250 μM TCEP to the same buffer for 50 min, followed by adding an equal total volume of 50% propylene glycol to 1X DPBS / 1 mM EDTA. The final maleimide-VCP-eribulin was then incubated at a 1:8 (mAb:load) molar ratio for 1 h at room temperature. The ADC was purified by G-25 chromatography to remove unconjugated load and formulated to 1X PBS and 2 mM EDTA. The final material was characterized by SEC-HPLC, RP-HPLC, and HIC-HPLC.

[0404] 2.7 In vitro serum stability

[0405] Anti-mesothelin ADCs (maleimide-VCP-eribulin as the active load) were prepared in PBS or human serum at a concentration of 0.5 mg / mL. Samples were incubated at 37°C for 0, 24, 48, 72, 96, or 240 hours, followed by transfer to -80°C for storage. All samples were thawed to ambient temperature and single-diluted 1:2,000 for testing. Total mAb, total ADC, and cell-based efficacy were measured in the samples. Total mAb analysis was developed as a stepwise sandwich assay on Gyrolab XP, using biotinylated mesothelin for capture and detection with Alexa Fluor 647 anti-IgG1 Fc. The quantifiable ranges for total mAb and complete ADC analysis were 6.25–800 ng / mL and 6.25–800 ng / mL, respectively. Standard curves and QC were prepared using MORAb-109 (345A12-HC15-LC4-VCP-eribulin).

[0406] 2.8 In vitro DAR-sensitive matrix stability of MORAb-109 ADC

[0407] MORAb-109 (345A12-HC15-LC4-VCP-Eribulin) DAR 2 was prepared in triplicate at 0.1 mg / mL in PBS or human, monkey, rat, or mouse serum. Samples were incubated at 37°C for 0, 24, 48, 72, 96, or 240 hours. Samples removed from each time point were transferred to -80°C for storage. Analysis was performed using a label-free biolayer interference assay. Matrix samples were diluted 1:20 in 1X PBS (analytical buffer) containing 0.05% Tween-20 and 1% BSA. Control samples of MORAb-109 DAR 0, DAR 1, DAR 2, and DAR 6 were diluted to 0.1 mg / mL in matched matrices. A negative control sample was prepared as a 5% matrix. Biotin-labeled mesothelin was captured at 5 μg / mL onto the tip of the SA streptavidin biosensor in analytical buffer (300 s; Pall-ForteBio), followed by the capture of diluted stability samples and controls (300 s). The effective load was then quantified at 100 mg / mL by binding to rabbit-human chimeric anti-eribulin antibody 5E4. Association was monitored for 300 s, at which point binding equilibrium was reached. The degree of binding (R0.05) at the end of the dissociation phase for each sample was determined at 295 s of association. eq By plotting R relative to t0 eq Stability is determined by percentage, where:

[0408] R eq =R eq t x / R eq t0

[100] and t x Percentage = 0-240 hours.

[0409] 2.9 In vitro cytotoxicity analysis

[0410] A431, A3, OVCAR3, HEC-251, and H226 cells were subcultured and seeded at 5,000 cells / well in complete growth medium in 96-well tissue culture plates and incubated overnight (16 hours) at 37°C and 5% CO2. Test reagents were serially diluted 1:3 (total of 10 dilutions) in 2 mL deep-well dilution plates starting at 200 nM. 100 μL of the diluted sample was added to the cell culture plates (at an initial concentration of 100 nM test sample). The plates were incubated for another 5 days at 37°C and 5% CO2. The culture medium was then discarded, and the plates were washed once with 200 μL of DPBS, stained with 50 μL of 0.2% crystal violet solution for 15 min at room temperature, and then thoroughly washed with tap water. The culture plates were air-dried, and the crystal violet was dissolved in 200 μL of 1% SDS solution. The culture plates were read at 570 nm. Analyze data using GraphPad Prism 6.

[0411] 2.10 Results

[0412] 2.10.1 Initial screening of humanized anti-mesothelin eribulin ADCs

[0413] Fifteen anti-mesothelin antibodies were subcloned, proportionally amplified for expression, and purified, with maleimide-VCP-eribulin used as the effective loading conjugate at the Cys80 position. All ADCs were purified and characterized by SEC-HPLC for aggregation analysis, and HIC-HPLC was used for DAR analysis, employing A431-A3 (MSLN)... hi A431 (MSLN) lo ) and OVCAR3 (MSLN hi Cell-based analysis of cell lines. Cells were treated with ADC for 6 hours and then washed away, or treated for 48 hours (A431-A3 and A431 cells) or 72 hours (OVCAR3 cells) for efficacy comparison. Characterization data are summarized in...

[0414] In Table 17, based on the characterization data below, six antibodies (in bold) were selected for humanization.

[0415] Table 17. Characterization of fifteen anti-mesothelin eribulin ADCs

[0416]

[0417]

[0418] 2.10.2 Humanization of ADC with HC1-LC1 and in vitro cytotoxicity

[0419] Sequences of rabbit Fv regions 102A6A2, 11B10, 201C15, 345A12, and 346C6 were obtained using IGBLAST (National Center for Biotechnology Information (NCBI)) and IMGT / DomainGapAlign (International Immunogenetic Information System). BLASTing was performed using tools to select the closest homologous human germline variable domain protein sequence. Rabbit frame sequences were replaced with the closest homologous human germline sequence to generate humanized variants of the CDR transplant (HC1 and LC1). The last two residues of the Kabat-defined FWRH2 were retained as rabbit residues. The final Kabat-defined FWRH3 residues were retained for 111B10. The RESPECT-L motifs Cys80 and Ala83 in the Vκ region of all clones were retained. After generating humanized antibodies, both chimeric and humanized antibodies were conjugated to three different hydrophobically modified payloads (maleimide-VCP-eribulin, maleimide-VCP-noscotin, and maleimide-VCP-eribulin dimer). Binding affinity to mesothelin was measured using BIAcore for all antibodies, and the ADCs were characterized for aggregation percentage (%), DAR, and in vitro efficacy, as summarized in Table 18. The potency of the humanized anti-mesothelin ADC was also measured and summarized in Table 19. In all five cell lines tested, the ADC exhibited low nanomolar EC50 cell-killing values.

[0420]

[0421]

[0422]

[0423] Table 19. In vitro cell-based efficacy of payload

[0424]

[0425] 2.10.3 Humanization Improvement

[0426] Because of the loss of mesothelin binding to clones 201C15, 345A12, and 346C6, subsequent mutations are needed to preserve mesothelin binding. Rabbit and CDR-transplanted Fv sequences were used to generate a computer simulation model of the variable domain. The theoretical structures of the rabbit and humanized models were superimposed, and the potential structural effects of residues very close to the CDR on the overall structure of the CDR ring were analyzed. Distinguishing residues between the rabbit and humanized sequences were identified. Most distinguishing residues were not located at the dimer interface or far from the CDR. Several residues in the VH and Vκ regions were found to be very close to the CDR (in...). (Inside), and further analysis.

[0427] Two humanized regions in the VH region were identified as potentially interfering with antigen binding in clones 201C15, 345A12, and 346C6. The N-terminus of all clones was one amino acid longer than that of HC1 in the rabbit sequence. Furthermore, each clone had a 2-amino acid deletion in FWRH3 (residues 72-73). For each of these clones, the first five and six amino acids (residues 71-76) surrounding the FWRH3 deletion in HC1 were restored to the rabbit sequence. Residue 93 of 345A12 was also restored to the rabbit sequence in HC5. Regarding LC1, the N-terminus of 201C15, 345A12, and 346C6 were restored to the rabbit sequence. A residue in FWRL3 of 201C5 (residue 67) and 345A12 (residue 70) was identified as potentially interacting with CDR, and a residue in FWRL2 of 346C6 (residue 36) was also identified.

[0428] 2.10.4 Hyperhumanization 345A12

[0429] In order to identify other rabbit residues in Vκ that are crucial for antigen binding, additional mutants of 345A12 were generated to introduce an increased number of human residues throughout the VH and Vκ regions. Analysis of computer simulation models identified residues 35, 48, 49, 57, 58, 61, 62, 63, and 64 in VH and residues 1, 3, 24, 55, and 70 in Vκ.

[0430] 2.10.5 Biophysical characterization of hyperhumanized 345A12 antibody

[0431] Hyperhumanized 345A12 antibody was purified from 350 mL scale-up cell cultures and reconstituted in 1X DPBS. The antibody was concentrated for physicochemical property assessment. As shown in Table 20, the combination of HC10-LC7 and HC15-LC7 precipitated during the concentration step, potentially due to relatively low pI or poor solubility. The purified antibody was analyzed for mesothelin binding affinity using BIAcore, and the data are summarized in Table 21 below.

[0432] Table 20. Summary of purification of humanized 345A12 antibody

[0433]

[0434]

[0435] 2.10.6 DSC and cIEF Analysis

[0436] The thermal melting curves of the F(ab')2 fraction were analyzed by DSC. The curves for HC15-LC4F(ab')2 and HC10-LC4 F(ab')2 are shown below. Figure 8 middle.

[0437] The pI of the 345A12-HC10-LC4 and 345A12-HC15-LC4 mAbs was analyzed by cIEF. The pI varied within 0.06 pH units between the mAbs, and was 8.19 for 345A12-HC10-LC4 and 8.25 for 345A12-HC15-LC4 (Table 22).

[0438] Table 22. cIEF Analysis

[0439] Sample Name pI acid peak % neutral peak % alkaline peak % 345A12-HC10-LC4 8.19 24.412 57.171 18.417 345A12-HC15-LC4 8.25 34.787 50.790 14.424

[0440] 2.10.7 Serum stability

[0441] As described in Section 2.7, the stability of the 345A12-HC10-LC4 and 345A12-HC15-LC4 ADCs in PBS / human serum was assessed for up to 10 days. The data are summarized in Table 23 below.

[0442]

[0443]

[0444] 2.10.8 Matrix stability of 345A12-HC15-LC4-VCP-Eribulin in various matrices analyzed using DAR-sensitive Octet.

[0445] The in vitro stability of 345A12-HC15-LC4-VCP-eribulin (DAR2) in mouse, rat, cynomolgus monkey, and human plasma and serum was analyzed. The ADC was incubated in the matrix at 0.1 mg / mL for 1 week and removed at time points 1, 2, 3, 4, and 10 days. Analysis was performed using DAR-sensitive Octet (biolayer interferometry) based analysis as described in Section 2.3.1. Results are shown in... Figure 9In the study, 345A12-HC15-LC4-VCP-Eribulin (DAR2) showed time-dependent release of the effective load, with an average release of 20% after 10 days of incubation at 37°C.

[0446] 2.10.9 Cultures producing rabbit IgG and polyclonal antibodies against human mesothelin

[0447] In week 2, wells producing rabbit IgG antibodies were identified using IgG FRET with europium cavitate. The presence of rabbit IgG Fcγ antibodies in wells producing IgG was screened by ELISA against plates coated with 1 μg / mL CHO-MT40 mesothelin. Cultures producing mesothelin-specific rabbit IgG were confirmed by ELISA screening against 1 μg / mL mesothelin and reverse screening against 1 μg / mL CD73-his. FRET and ELISA were performed at... Performed on the FX machine system (Beckman).

[0448] Example 3: In vivo studies

[0449] Following the protocol described below, ADCs comprising a major humanized anti-mesothelin antibody and an eribulin conjugate were evaluated in mice using human lung cancer and gastric cancer xenograft models and a human mesothelioma patient-derived xenograft (PDX) model. The anticancer activity and off-target toxicity of different DAR species of the ADC were assessed.

[0450] 3.1 Reagents and Materials

[0451] 3.1.1 Antibodies

[0452] The antibodies used in the following studies have an unpaired cysteine ​​residue at position 80 of the light chain (LCcys80) and include rabbit-human chimeric (-xi) and humanized (-zu) forms of anti-human mesothelin antibodies xi345A12-HC1-LC2, xi102A6A2-HC1-LC2, zu345A12-HC1-LC2, zu345A12-HC10-LC4, and zu345A12-HC15-LC4.

[0453] 3.1.2 Can conjugate cytotoxins and LCcys80 ADC

[0454] The linker-cytotoxic compounds used in the following studies include maleimide-VCP-eribulin and maleimide-VCP-diOH eribulin dimer.

[0455] 3.1.3 Tumor cell lines

[0456] The human NSCLC cell line NCI-H2110, the human gastric cancer cell line NCI-N87, and the human mesothelioma cancer cell line HAY were used in the following studies. All cell lines used were obtained directly from the American Type Culture Collection (ATCC), except for HAY cells, which were obtained from NCI.

[0457] 3.1.4 Other reagents

[0458] Unless otherwise specified, all reagents used were purchased from commercial suppliers at research grade or higher.

[0459] 3.2 In vivo screening and efficacy studies in human cancer xenotransplantation models

[0460] 3.2.1 Studying Animals

[0461] Female CD-1IGS mice (Charles River, 7-9 weeks old) were used for the maximum tolerated dose (MTD) study, female NOD.CB17-SCID mice (Jackson laboratory) were used for NCI-H2110 and HAY xenograft studies, and female NCr nude mice (Taconic, 5 weeks old) were used for NCI-N87 xenograft studies. Upon arrival, the animals were allowed 5-7 days of acclimatization before inoculation. Animals were housed in 3-5 ventilated cages with sterile food blocks and water bottles readily available. Animals were tagged and weighed before the start of the study.

[0462] 3.2.2 Cell Culture

[0463] Cryopreserved NCI-H2110, NCI-N87, or HAY cells from cryopreservation stock solutions were cultured in medium containing the necessary supplements. The cells were then cultured for two subcultures in complete medium before in vivo seeding.

[0464] 3.2.3 Tumor implantation, selection methods and treatment

[0465] Cells were suspended at a 1:1 (volume:volume) ratio in PBS mixed with ice-cold Matrigel to achieve a concentration of 1.0 × 10⁶ for NCI-H2110 and HAY cells. 8 1 cell / mL or 5.0 × 10 7 The final concentration was determined by cells / mL. Mice were subcutaneously injected with a 100 μL / mouse cell mixture, and body weight and tumor growth were monitored. Measurements were obtained three times weekly using an electronic digital caliper, starting on day 3 post-implantation.

[0466] 3.2.4 Tumor Measurement and Treatment

[0467] Tumor volume is calculated using the following formula: W(mm)×L(mm)×D(mm)×π / 6. Once the tumor reaches 100mm in size... 3 Based on the average volume, mice were randomly divided into groups of five. Each mouse was treated with 200 μL of medication intravenously. Final body weight was measured and recorded at the end of each study.

[0468] 3.2.5 Statistical Analysis

[0469] Tumor volumes in animals from each treatment group were compared with those in the control group using repeated measures two-way ANOVA, followed by the Bonferroni post-hoc test. Comparisons of tumor growth within each experimental group were also performed using the same statistical analysis.

[0470] 3.3 In vivo efficacy study in human mesothelioma PDX model

[0471] 3.3.1 Studying Animals

[0472] Before inoculation and upon arrival, allow NMRI nu / nu female mice (Janvier laboratory, 5-6 weeks) to acclimatize for at least 4 days. Confine 3-5 mice per ventilated cage with sterile food blocks and water bottles readily available. Mark and weigh the animals before the start of the study.

[0473] 3.3.2 Xenotransplantation

[0474] On day 0 of the study, Meso 7212 tumors were removed from five donor mice under aseptic conditions. Donor tumor tissue was cut into 2×2 mm fragments and placed in sterile Piper dishes lined with 0.9% saline. Simultaneously, recipient animals were given analgesia. (2 mg / kg) subcutaneous administration, followed by a single intravenous injection (0.15 mL / mouse) Anesthetize (12 mg / kg). Make a 5-8 mm vertical incision in the skin on the left flank. Insert the tip of surgical scissors directly into the incision on the flank to create a pit in the subcutaneous space. Use surgical forceps to implant one tumor fragment into the pit for each mouse. Close the incision with metal clips and return the animal to a clean cage.

[0475] 3.3.3 Experimental Procedure

[0476] During tumor proliferation, tumor diameter was measured using an electronic digital caliper (Mitutoyo). Tumor volume was determined based on the animal's tumor volume (inclusion criteria: 0.1–0.3 cm). 3 Animals were randomly assigned to experimental groups. Tumor volume and body weight were recorded twice a week.

[0477] 3.3.4 Processing

[0478] On the day of randomization, eribulin was administered intravenously at doses of 0.2, 0.3, and 3.2 mg / kg. MORAb-109 (DAR 0, 2, and 6) was administered intravenously at a dose of 10.0 mg / kg on the day of randomization or at a dose of 2.5 mg / kg over four consecutive days. For intravenous administration in all experimental groups, the volume was 10 mL / kg.

[0479] 3.3.5 Statistical Analysis

[0480] Descriptive statistics were collected on tumor volume and body weight. Tumor volumes from each treatment group were compared with those from the control group using repeated measures two-way ANOVA followed by the Bonferroni post-hoc test. Tumor growth within each group was also compared using the same statistical analysis.

[0481] 3.4 Results - In vivo screening and efficacy study

[0482] 3.4.1 Study M109-004-2016: In vivo screening of 345A12-HC1-LC2 and 102A6A2HC1-LC2 eribulin dimer ADCs in a human NSCLC xenograft model

[0483] In vivo comparative screening of two clones of anti-mesothelin antibodies (345A12-HC1-LC2 and 102A6A2-HC1-LC2) was conducted in a human non-small cell lung cancer (NSCLC) NCI-H2110 xenograft model. Mice were treated with either 2.5 mg / kg of 345A12-HC1-LC2-diOH eribulin dimer ADC or 2.5 mg / kg of 102A6A2-HC1-LC2-diOH eribulin dimer ADC. The antitumor activity and changes in body weight of the two ADCs are shown in the figures. Figure 10A and Figure 10B middle.

[0484] 3.4.2 Preliminary assessment of the maximum tolerated dose (MTD) of 345A12-HC1-LC2 and 345A12-HC15-LC4 eribulin dimer ADCs in study M109-006-2017: CD-1 mice

[0485] Changes in body weight were measured in female CD1 mice after administration of 5, 10, 15, or 20 mg / kg of 345A12-HC1-LC2-diOH eribulin dimer ADC or 5, 10, or 20 mg / kg of 345A12-HC15-LC4-diOH eribulin dimer ADC. Changes in body weight for each ADC are shown in the figure. Figure 11A and Figure 11B middle.

[0486] 3.4.3 Study M109-007-2017: In vivo screening of 345A12-HC10-LC4 and 345A12-HC15-LC4 eribulin dimer ADCs in a human NSCLC xenograft model

[0487] In vivo comparative screening of two other clones of anti-mesothelin antibodies (345A12-HC10-LC4 and 345A12-HC15-LC4) was conducted in a human NSCLC NCI-H2110 xenograft model. Mice were treated with either 2.5 mg / kg of 345A12-HC10-LC4-diOH eribulin dimer ADC or 2.5 mg / kg of 345A12-HC15-LC4-diOH eribulin dimer ADC. The antitumor activity and changes in body weight of the two ADCs are shown in the figures. Figure 12A and Figure 12B middle.

[0488] Based on the antitumor activity and toxicity characteristics of the 345A12-HC15-LC4 clone, it was selected as a candidate clone for the antibody used in the MORAb-109 ADC.

[0489] 3.4.4 Study M109-010-2018: Antitumor effects of DAR2 and DAR6 species of 345A12-HC15-LC4-VCP-eribulin ADC (MORAb-109) in a human gastric cancer xenograft model.

[0490] At a dose of 10 mg / kg, two DAR classes (DAR2 and DAR6) of 345A12-HC15-LC4-VCP-eribulin ADC (MORAb-109) were compared in a human gastric cancer NCI-N87 xenograft model. Both DAR2 and DAR6 ADC classes showed durable and similar antitumor responses. Figure 13A After administration of any type of DAR, less to no weight loss was observed. Figure 13B ).

[0491] 3.4.5 Study M109-010-2018: Antitumor effects of DAR2 and DAR6 species of 345A12-HC15-LC4-VCP-eribulin ADC (MORAb-109) in a human mesothelioma xenograft model.

[0492] Two DAR classes (DAR2 and DAR6) of 345A12-HC15-LC4-VCP-eribulin ADC (MORAb-109) were compared in a human mesothelioma HAY xenograft model. Both DAR2 and DAR6 ADC classes demonstrated a durable and tumor-like antitumor response in mice treated with a single dose (5 mg / kg) of MORAb-109, while eribulin alone (administered at MTD (3.2 mg / kg) or at an equivalent molar amount of eribulin, as found in MORAb-109 (0.1 mg / kg)) showed limited antitumor activity. Figure 14A Acute and transient weight loss was observed in mice treated with the MTD dose of eribulin, while no weight loss was observed in mice treated with either ADC. Figure 14B ).

[0493] 3.4.6 Antitumor effect of MORAb-109 (DAR6) in human mesothelioma PDX model

[0494] The antitumor activity of 345A12-HC15-LC4-VCP-eribulin ADC (MORAb-109) (DAR6) was investigated in the human mesothelioma PDX model Meso7212 (MV15369). Two different treatment regimens were tested: a single administration of 10 mg / kg MORAb-109 or four consecutive daily administrations of 2.5 mg / kg. Both treatment regimens of MORAb-109 demonstrated durable and similar antitumor responses, while the equivalent molar amount of eribulin alone (0.2 mg / kg) showed limited antitumor activity. Figure 15A Compared with the MTD dose of eribulin alone, MORAb-109 ADC treatment showed significantly increased antitumor activity in all treatments (P<0.05). Weight changes in all treatments are shown in... Figure 15B middle.

[0495] 3.4.7 Antitumor effects of MORAb-109 (DAR2 and DAR6) in a human mesothelioma PDX model

[0496] The antitumor activity of two DAR classes (DAR2 and DAR6) of 345A12-HC15-LC4-VCP-eribulin ADC (MORAb-109) was investigated in the human mesothelioma PDX model Meso7212 (MV16071) at a single administration of 10 mg / kg. Both DAR2 and DAR6 classes of MORAb-109 demonstrated durable and comparable antitumor responses, while eribulin alone (0.3 mg / kg) and eribulin-free conjugated with MORAb-109 class (DAR0) showed limited or no antitumor activity. Figure 16ANo weight loss was observed in any group. Figure 16B There was no statistically significant difference in antitumor activity between DAR2 and DAR6 species of MORAb-109.

[0497] Example 4: Mesothelin (MSLN) Expression and In Vitro Efficacy

[0498] 4.1 Methods

[0499] Cytotoxicity Cells were subcultured and seeded at 5,000 cells / well in complete growth medium in 96-well tissue culture plates and incubated overnight (16 hours) at 37°C and 5% CO2. Test reagents were serially diluted 1:3 (total of 10 dilutions) in 2 mL deep-well dilution plates starting at 200 nM. 100 μL of the diluted sample was added to the cell culture plates (at the initial concentration of 100 nM test sample). The plates were incubated for another 5 days at 37°C and 5% CO2. The culture medium was then discarded, and the plates were washed once with 200 μL of DPBS, stained with 50 μL of 0.2% crystal violet solution for 15 min at room temperature, and then thoroughly washed with tap water. The plates were air-dried and the crystal violet was dissolved in 200 μL of 1% SDS solution. The plate readings were taken at 570 nm. IC50 was analyzed using a GraphPad Prism 6. 50 The measured data were analyzed for correlation using nonparametric Spearman analysis in GraphPad Prism.

[0500] 4.2 Results

[0501] The correlation between MORAb-109 (DAR6) efficacy and mesothelin expression was observed in all cell lines. Figure 17 (Tables 24 and 25).

[0502] For MORAb-109 (DAR2), a significant correlation was observed between potency and mesothelin expression when cell lines with low mesothelin expression were excluded from the analysis (mean fluorescence intensity FACS staining (MFI) <80). Figure 17 (Tables 24 and 25). The efficacy of MORAb-109 (DAR2) is correlated with mesothelin expression at higher mesothelin expression levels.

[0503] Table 24. Correlation analysis of mesothelin expression and efficacy (DAR2 and DAR6)

[0504]

[0505] Table 25. Cell lines used in the correlation analysis of mesothelin expression and efficacy

[0506]

[0507]

[0508] Example 5: Dose-response of MORAb-109 in a human gastric cancer (NCI-N87) xenograft model

[0509] 5.1 Method

[0510] 5.1.1 Internal Efficacy

[0511] animal Female NCr nude mice (Taconic) arriving at 5 weeks of age were allowed 5-7 days to acclimatize before inoculation. Animals were housed in 3-5 ventilated cages with sterile food blocks and water bottles readily available. Animals were tagged and weighed before the start of the study.

[0512] Cell culture The cryopreserved NCI-N87 cells were thawed and grown in a medium containing the necessary supplements. The cells were then cultured for two subcultures in complete medium before being used for in vivo inoculation.

[0513] Tumor implantation, selection methods and treatment Mix the cell suspension in PBS with ice-cold Matrigel at a 1:1 (volume:volume) ratio to a final volume of 1.0 × 10⁻⁶. 8 The final concentration was [number of cells / mL]. 100 μL / mouse mixture was administered subcutaneously. Clinical health of mice was monitored starting on day 3 post-implantation, with body weight and tumor size measured three times weekly using an electronic digital caliper.

[0514] Tumor Measurement and Treatment Tumor volume (TV) (mm) 3 The following formula is used to calculate: W(mm) × L(mm) × D(mm) × π / 6. When the tumor reaches an average size of approximately 100mm... 3 Animals were randomly divided into groups of 5. Treatment was administered intravenously in 200 μL of test material. At the end of the study, final body weight was measured and recorded.

[0515] Statistical analysis Descriptive statistics were collected on tumor volume and body weight. Tumor volumes from each treatment group were compared to the control group using repeated measures two-way ANOVA followed by the Bonferroni post-hoc test. Tumor growth within each group was also compared using the same statistical analysis.

[0516] 5.1.2 Pharmacokinetics (PK)

[0517] PK analysis was performed using complete ADC analysis and total antibody analysis. Total antibody refers to the sum of all species, including conjugated and unconjugated species (i.e., DAR0 + DAR1 + DAR2 + ... + DARn), while complete ADC refers to all conjugated species (i.e., DAR1 + DAR2 + ... + DARn). The total antibody assay used biotin-labeled mesothelin for capture. The complete ADC assay used biotin-labeled anti-eribulin 5E4 Fab fragment for capture and AlexaFluor647-labeled anti-human Fc for detection. Sample analysis was performed using a Gyros analyzer. Data analysis was performed in WatsonLIMS 7.4.1 and plotted in Microsoft Excel.

[0518] 5.2 Results

[0519] Dose-dependent efficacy was observed in the dose range of MORAb-109 (DAR2) from 5 mg / kg to 25 mg / kg. Figure 18A and 18B No weight loss was observed in any dose group. Figure 18C Dose-dependent exposure to ADCs was observed in treated animals, as indicated by a dose-dependent increase in AUC. Figure 19 (and Table 26).

[0520] Table 26. PK of MORAb-109 (dose titration) in NCI-N87 tumor-carrying mice

[0521]

[0522] Example 6: In vivo antitumor efficacy of MORAb-109 in a human ovarian cancer (OVCAR-3-A1-T1) xenograft model

[0523] 6.1 Method

[0524] animal Female NOD.CB17-SCID mice (Jackson laboratory) aged 5 weeks upon arrival were acclimatized for 5-7 days prior to inoculation. Animals were housed in 3-5 ventilated cages with sterile food blocks and water bottles readily available. Animals were tagged and weighed before the start of the study.

[0525] Cell culture The cryopreserved OVCAR-3-A1-T1 cells were thawed and grown in a medium containing the necessary supplements. The cells were then cultured for two subcultures in complete medium before being used for in vivo seeding.

[0526] Tumor implantation, selection methods and treatmentMix the cell suspension in PBS with ice-cold Matrigel at a 1:1 (volume:volume) ratio to a final volume of 5.0 × 10⁻⁶. 7 The final concentration was [number of cells / mL]. 100 μL / mouse mixture was administered subcutaneously. Clinical health of mice was monitored starting on day 3 post-implantation, with body weight and tumor size measured three times weekly using an electronic digital caliper.

[0527] Tumor Measurement and Treatment Tumor volume (TV) (mm) 3 The following formula is used to calculate: W(mm) × L(mm) × D(mm) × π / 6. When the tumor reaches an average size of approximately 100mm... 3 Animals were randomly divided into groups of 5. Treatment was administered intravenously in 200 μL of test material. At the end of the study, final body weight was measured and recorded.

[0528] Statistical analysis Descriptive statistics were collected on tumor volume and body weight. Tumor volumes from each treatment group were compared to the control group using repeated measures two-way ANOVA followed by the Bonferroni post-hoc test. Tumor growth within each group was also compared using the same statistical analysis.

[0529] 6.2 Results

[0530] MORAb-109 (DAR2) demonstrated delayed tumor growth in a human ovarian cancer OVCAR-3-A1-T1 xenograft model. Figure 20A and Figure 20B ).

[0531] Example 7: In vivo antitumor efficacy of MORAb-109 in a human NSCLC PDX model (LC-F-25)

[0532] 7.1 Method

[0533] animal Distantly related, thymic athymic (nu / nu) female mice (HSD: naked athymic -Foxn1nu) arriving at 5 weeks of age were acclimatized for at least 4 days prior to inoculation. Animals were housed in 3-5 ventilated cages with sterile food blocks and water bottles readily available. Animals were tagged and weighed before the start of the study.

[0534] Xenotransplantation LC-F-25 was established as a growth tumor of primary non-small cell lung adenocarcinoma from human patients (P9.1.1 / 0). Based on immunohistochemical (IHC) analysis, LC-F-25 showed lower MSLN expression in terms of positive percentage and overall intensity compared to other tumor types (such as LXFA-737 (Example 8)).

[0535] Experimental Procedure When the mean tumor volume and median tumor volume reach 153.5 and 126 mm, respectively. 3 At that time, the distribution has 108 and 288 mm 3 Thirty-one (31) mice with existing LC-F-25 tumors (P9.1.1 / 0) were treated.

[0536] treat Efficacy was evaluated in 7 to 8 mice in each of the 4 groups.

[0537] • In Group 1, the mediator was administered intravenously (iv) in a single dose of 5 mL / kg on Day 1.

[0538] • In groups 2 and 3, eribulin was administered intravenously as a single dose on day 1 at doses of 0.1 mg / kg (5 mL / kg) and 3.2 mg / kg (6.4 mL / kg), respectively.

[0539] • In group 4, MORAb-109 was administered intravenously in a single dose of 10 mg / kg (5 mL / kg) on ​​day 1.

[0540] Tumors were measured and mice were weighed twice a week during the experimental period.

[0541] Statistical analysis Statistical analysis was performed on each measurement obtained through the Mann-Whitney non-parametric comparison test. Each treatment group was compared with the control group.

[0542] 7.2 Results

[0543] MORAb-109 (DAR2) administered intravenously in a single dose of 10 mg / kg was well tolerated, while weight loss was observed in mice without LC-F-25 tumors. Figure 21B MORAb-109 (DAR2) showed a delay in tumor growth at 10 mg / kg in the LC-F-25NSCLCPDX model. Figure 21A ).

[0544] Mice carrying LC-F-25 tumors tolerated eribulin well via a single intravenous dose of 0.1 mg / kg (equivalent molar amount of the effective load in MORAb-109 when administered at 10 mg / kg), but it did not induce statistically significant tumor growth inhibition. Figure 21A and Figure 21B ).

[0545] Mice carrying LC-F-25 tumors tolerated eribulin well via intravenous administration at a single dose of 3.2 mg / kg (the mouse MTD dose, or 32 times the molar amount of eribulin in MORAb-109 when administered at 10 mg / kg), but mild and transient weight loss was induced 3 to 10 days after administration. Figure 21B At this dose, eribulin induced statistically significant inhibition of tumor growth, with partial tumor regression in 6 out of 8 mice. Figure 21A ).

[0546] Example 8: In vivo antitumor efficacy of MORAb-109 in a human NSCLC PDX model (LXFA-737)

[0547] 8.1 Method

[0548] animal Female NMRI nu / nu mice (Crl:NMRI-Foxn1nu) aged 4 to 6 weeks.

[0549] Xenotransplantation LXFA-737 was established as a growth tumor (P14N4) of primary non-small cell lung adenocarcinoma from a human patient. Based on IHC analysis, LXFA-737 showed moderate MSLN expression in terms of overall intensity and a high positive percentage compared to other tumor types (such as LC-F-25 (Example 7)).

[0550] Experimental Procedure Monitor animals until the tumor implant reaches 50-250 mm in a sufficient number of animals. 3 (e.g., 80-200mm) 3 The study volume standard was determined by randomizing mice into groups with comparable group midpoints and mean tumor volumes. The day of randomization was designated as day 0.

[0551] treat Efficacy was evaluated in 6 to 7 mice in each of the 4 groups.

[0552] • In Group 1, the mediator was administered intravenously (iv) in a single dose of 5 mL / kg on Day 1.

[0553] • In groups 2 and 3, eribulin was administered intravenously as a single dose of 0.2 mg / kg and 3.2 mg / kg, respectively, on day 1.

[0554] • In group 4, MORAb-109 was administered intravenously in a single dose of 10 mg / kg on day 1.

[0555] Tumors were measured and mice were weighed twice a week during the experimental period. Day 1 was the first day of drug administration, following the day of randomization (day 0).

[0556] Statistical analysis Tumor growth inhibition, test / control value inhibition in (Min.T / C)%: The test value relative to the control value (T / C%) is calculated by multiplying the ratio of the median residual tumor volume (RTV) of the test group to the control group on day X by 100. The time interval (in days) for tumor volume doubling and quadrupling (Td, Tq) in the test and control groups is defined as the time interval (in days) required to reach 200% or 400% of the median RTV.

[0557] 8.2 Results

[0558] In the LXFA-737NSCLC PDX model, MORAb-109 (DAR2) demonstrated stable antitumor efficacy at 10 mg / kg (minimum T / C, 2.3% on day 41). Figure 22A Furthermore, its Tq was not reached during the study. MORAb-109 was also well-tolerated at a single dose, without weight loss in mice carrying LXFA-737 tumors. Figure 22B ).

[0559] Mice carrying LXFA-737 tumors tolerated eribulin well via a single intravenous dose of 3.2 mg / kg (the mouse MTD dose, or 32 times the molar amount of eribulin in MORAb-109 when administered at 10 mg / kg), demonstrating antitumor efficacy (lowest T / C, 4.2% on day 27) and a Tq of 80.1%. However, eribulin induced mild and transient weight loss after administration. Figure 22A and Figure 22B A single dose of 0.2 mg / kg, twice the molar amount of eribulin administered at 10 mg / kg in MORAb-109, showed limited antitumor efficacy (minimum T / C, 51.1% on day 44).

[0560] Example 9: Dose-response of MORAb-109 in a human gastric cancer (NCI-N87) xenograft model

[0561] 9.1 Method

[0562] 9.1.1 Internal Efficacy

[0563] animalFemale NCr nude mice (Taconic) arriving at 5 weeks of age were allowed 5-7 days to acclimatize before inoculation. Animals were housed in 3-5 ventilated cages with sterile food blocks and water bottles readily available. Animals were tagged and weighed before the start of the study.

[0564] Cell culture The cryopreserved NCI-N87 cells were thawed and grown in a medium containing the necessary supplements. The cells were then cultured for two subcultures in complete medium before being used for in vivo inoculation.

[0565] Tumor implantation, selection methods and treatment Mix the cell suspension in PBS with ice-cold Matrigel at a 1:1 (volume:volume) ratio to a final volume of 1.0 × 10⁻⁶. 8 The final concentration was [number of cells / mL]. 100 μL / mouse mixture was administered subcutaneously. Clinical health of mice was monitored starting on day 3 post-implantation, with body weight and tumor size measured three times weekly using an electronic digital caliper.

[0566] Tumor Measurement and Treatment Tumor volume (TV) (mm) 3 The following formula is used to calculate: W(mm) × L(mm) × D(mm) × π / 6. When the tumor reaches an average size of approximately 100mm... 3 Animals were randomly divided into groups of 5. Treatment was administered intravenously in 200 μL of test material. At the end of the study, final body weight was measured and recorded.

[0567] Statistical analysis Descriptive statistics were collected on tumor volume and body weight. Tumor volumes from each treatment group were compared to the control group using repeated measures two-way ANOVA followed by the Bonferroni post-hoc test. Tumor growth within each group was also compared using the same statistical analysis.

[0568] 9.1.2 Pharmacokinetics (PK)

[0569] PK analysis was performed using complete ADC analysis and total antibody analysis. Total antibody refers to the sum of all species, including conjugated and unconjugated species (i.e., DAR0 + DAR1 + DAR2 + ... + DARn), while complete ADC refers to all conjugated species (i.e., DAR1 + DAR2 + ... + DARn). Total antibody analysis used biotin-labeled mesothelin for capture and AlexaFluor647-labeled anti-human Fc for detection. Complete ADC analysis used biotin-labeled anti-eribulin 5E4 for capture and AlexaFluor647-labeled anti-human Fc for detection. Sample analysis was performed using a Gyros analyzer. Data analysis was performed in WatsonLIMS 7.4.1 and plotted in Microsoft Excel. Eribulin was quantified using LC-MS from plasma, tumor, and bone marrow samples.

[0570] 9.1.3 LC-MS

[0571] 20–50 μL of MORAb-109 (DAR2) plasma from a single mouse or 50 μL of the same pooled plasma from mice treated with MORAb-109 (DAR6) were used for analysis. Dynabeads M-280 streptavidin (100 μL) was incubated with 3 μg of capture-selective human IgG-Fc PK biotin conjugate at room temperature for 1 hour, followed by washing with HBS-EP buffer. Plasma samples diluted in HBS-EP buffer were then mixed with the complex / washed beads to capture the MORAb-109 complex, incubated at room temperature for 1 hour, and then washed twice with HBS-EP buffer. The washed beads containing the complex were deglycosylated for 1 hour at 37°C with PNGase buffer containing Rapid PNGase F (1 μL), followed by a single wash with HBS-EP buffer. The captured / deglycosylated MORAb-109 was eluted with 10% acetonitrile w / 0.1% formic acid (30 μL). Synapt G2 / M type UPLC analysis was used to analyze the integrity or reduced quality of the sample.

[0572] 9.2 Results

[0573] Figure 23A and Figure 23B The study showed the antitumor effects and weight changes in a human gastric cancer NCI-N87 xenograft model treated with a single dose of 10 mg / kg MORAb-109 (DAR2 or DAR6).

[0574] PK analysis of MORAb-109(DAR2), MORAb-109(DAR6), and unconjugated antibodies is shown in Table 27. The total antibody levels of unconjugated and MORAb-109(DAR2) were similar, while MORAb-109(DAR6) was lower, indicating that MORAb-109(DAR2) is stable in cycling.

[0575] DAR analysis of ADCs from plasma samples indicated that, for DAR6 species, there was a higher effective load release rate and higher plasma concentrations of eribulin (Tables 28 and 29).

[0576] Table 27. PK characteristics of MORAb-109 (DAR2 and DAR6) in NCI-N87 tumor-carrying mice

[0577]

[0578]

[0579] Table 28. DAR2 of MORAb-109 (DAR2) in plasma

[0580]

[0581] Table 29. DAR of MORAb-109 (DAR6) in plasma

[0582]

[0583] Example 10: Comparison of binding affinity between 345A12 HC15 LC4 and Annextumab

[0584] 10.1 Method

[0585] Antibody : 345A12 HC15 LC4 (anti-mesothelin antibody in MORAb-109) and annetumab. The sequence of annetumab and the human anti-mesothelin antibody are described in Table 30.

[0586] Combining affinityBinding measurements were performed using HBS-P+ buffer on a BIAcore T-100 instrument. The antibody was diluted to 1 μg / mL in HBS-P+. The sample was centrifuged at 14,000 × g for 5 min at room temperature, and the supernatant was then transferred to a new 1.5 mL BIAcore tube and capped. Mesothelin (50 μg) was diluted to 100 nM in 1x HBS-P+ buffer, followed by five-fold serial dilutions of 100, 20, 4, 0.8, and 0.16 nM in BIAcore tubes and capped. An anti-human antibody capture chip was prepared using a CM5 chip with a fixed guide according to the manufacturer's protocol. The final capture antibody level in HBS-P+ was 8000–9000 RU. The chip was prepared for analysis with five cycles of 300-second buffer injection followed by 30-second regeneration, all cycles spanning all four flow cells at 30 μL / min.

[0587] Antibodies were captured in flow cells 2-4 by sequentially injecting single ligand solutions at 10 μL / min for 90 seconds. Assay injections were performed in a single-cycle kinetic configuration as follows: analyte solutions of increasing concentration were injected sequentially at 30 μL / min for 240 seconds each. Detection was performed at 2-1, 3-1, and 4-1. The injected sequences were used for double reference with the same ligand for capture, followed by five buffer-only injections for 240 seconds each, followed by dissociation for 1800 seconds and regeneration as described above. All ligand binding to mesothelin was analyzed in duplicate. Kinetic analysis was performed using a 1:1 Langmuir fitting model with BIAEvaluations software. Association rate, dissociation rate, and affinity constant were averaged using a self-repeating operation.

[0588] 10.2 Results

[0589] 345A12 HC15 LC4 showed a 40-fold higher affinity than annetumab (Table 31). 345A12 HC15 LC4 maintained its binding affinity to cynomolgus mesothelin, while annetumab did not bind to cynomolgus mesothelin. Neither antibody bound to rat mesothelin.

[0590] Table 30. Anatolimab Sequence

[0591]

[0592]

[0593] Table 31. Binding of 345A12 HC15 LC4 and anetumab to mesothelin in humans, cynomolgus monkeys and rats.

[0594]

[0595] Example 11: Comparison of in vitro efficacy between MORAb-109 and BAY 94-9343

[0596] 11.1 Method

[0597] ADC Evaluation of MORAb-109 (DAR2 and DAR6) and anetumab ravtansine (BAY 94-9343). Also known as BAY 94-9343, anetumab ravtansine is an ADC containing an anetumab conjugated to the maytansine-like microtubule inhibitor DM4 via a disulfide linker (reducible to the SPDB linker [4-(2-pyridyldithio)N-succinimide ester butyrate]). BAY 94-9343 is produced as described in Example 15.

[0598] Cytotoxicity Cells were subcultured and seeded at 5,000 cells / well in complete growth medium in 96-well tissue culture plates and incubated overnight (16 hours) at 37°C and 5% CO2. Test reagents were serially diluted 1:3 (total of 10 dilutions) in 2 mL deep-well dilution plates starting at 200 nM. 100 μL of the diluted sample was added to the cell culture plates (at the initial concentration of 100 nM test sample). The plates were incubated for another 5 days at 37°C and 5% CO2. The culture medium was then discarded, and the plates were washed once with 200 μL of DPBS, stained with 50 μL of 0.2% crystal violet solution for 15 min at room temperature, and then thoroughly washed with tap water. The plates were air-dried and the crystal violet was dissolved in 200 μL of 1% SDS solution. The plate readings were taken at 570 nm. IC50 was analyzed using a GraphPad Prism 6. 50 The measured data.

[0599] 11.2 Results

[0600] MORAb-109 (DAR2 and DAR6) exhibited specific cytotoxicity against MSLN-positive cell lines (Table 32). In contrast, BAY 94-9343 showed killing effects on both MSLN-positive and MSLN-negative cell lines.

[0601] Table 32. MSLN + and MSLN - Comparison of in vitro activity in cell lines

[0602]

[0603] Example 12: Comparison of specificity between MORAb-109 and BAY 94-9343

[0604] 12.1 Method

[0605] Cytotoxicity Cells were subcultured and seeded at 5,000 cells / well in complete growth medium in 96-well tissue culture plates and incubated overnight (16 hours) at 37°C and 5% CO2. Test reagents were serially diluted 1:3 (total of 10 dilutions) in 2 mL deep-well dilution plates starting at 200 nM. 100 μL of the diluted sample was added to the cell culture plates (at the initial concentration of 100 nM test sample). The plates were incubated for another 5 days at 37°C and 5% CO2. The culture medium was then discarded, and the plates were washed once with 200 μL of DPBS, stained with 50 μL of 0.2% crystal violet solution for 15 min at room temperature, and then thoroughly washed with tap water. The plates were air-dried and the crystal violet was dissolved in 200 μL of 1% SDS solution. The plate readings were taken at 570 nm. IC50 was analyzed using a GraphPad Prism 6. 50 The measured data.

[0606] 12.2 Results

[0607] Cytotoxicity analysis of the unconjugated antibody confirmed the efficacy of MORAb-109(DAR2) (…). Figure 25A ) rather than BAY 94-9343 ( Figure 25B The drug specifically kills mesothelin-expressing cells. Unbound by theory, the lack of competition observed with unconjugated antibodies against BAY 94-9343 suggests payload release, which could lead to killing even when antibody binding is blocked by unconjugated competitive agents. This payload release is consistent with the relatively high levels of cytotoxicity observed with BAY 94-9343 in mesothelin-negative cell lines (Table 32). Figure 27 Effective payload release was also directly observed (comparison of plasma stability).

[0608] Example 13: Comparison of ADCC activity between MORAb-109 and BAY 94-9343

[0609] 13.1 Method

[0610] MSLN-expressing CHO cells were thawed and seeded at 1,000 cells / well (25 μL) in complete RPMI-4% Ultra-low IgG FBS in 96-well tissue culture plates. Test reagents (345A12 antibody, MORAb-109 (DAR2), and BAY94-9343) were serially diluted 1:2.5 in complete RPMI-4% ultra-low IgG FBS starting at 20 μg / mL, and then transferred (25 μL) to cell culture plates and incubated at 37°C and 5% CO2 for 60 min. 6,000 Jurkat effector cells (Promega) were thawed and added (25 μL) to the cell culture plates, and the plates were incubated at 37°C and 5% CO2 for 18–22 h.

[0611] Thaw the luciferase assay reagent in the dark. Add 75 μL of the luciferase assay reagent to each well, and shake the plate on a plate shaker for 30 seconds. After incubation for 5 minutes, read the plate reading using a luminometer.

[0612] 13.2 Results

[0613] MORAb-109(DAR2) and 345A12 HC15 LC4 have similar ADCC activity. Figure 26A (and Table 33), while compared with annatuzumab, BAY 94-9343 has weaker ADCC activity ( Figure 26B (and Table 34).

[0614] Table 33. ADCC Activity - MORAb-109 and 345A12 HC15 LC4

[0615] 345A12 MORAb-109 100% 96.9%

[0616] Table 34. ADCC Activity - BAY 94-9343 and Analtuzumab

[0617] Anatozole BAY 94-9343 100% 65.06%

[0618] Example 14: Stability of MORAb-109 and BAY 94-9343 in the matrix

[0619] 14.1 Method

[0620] Anti-MSLN ADCs were prepared in human or mouse plasma at a concentration of 0.1 mg / mL. Samples were incubated at 37°C for 0, 24, 48, 72, 96, and 240 hours, and then transferred to -80°C for storage at the time points. All samples were thawed to ambient temperature and diluted 1:100 for testing. DAR sensitivity and stability assays were performed in a stepwise sandwich configuration on Gyrolab. After blocking and sample binding, the assay used biotin-labeled mesothelin for capture and Alexa Fluor 647 anti-eribulin 5E4 Fab or Alexa Fluor 647 anti-DM4 (Levena Biopharma) for detection. Standard curves and quality controls were prepared using MORAb-109 and BAY 94-9343.

[0621] 14.2 Results

[0622] In human and mouse plasma, MORAb-109 (DAR2) is more stable than BAY 94-9343. Figure 27 ).

[0623] Example 15: Antitumor efficacy of MORAb-109 and BAY 94-9343 in a human gastric cancer (NCI-N87) xenograft model

[0624] 15.1 Method

[0625] 15.1.1 Generate BAY 94-9343

[0626] BAY 94-9343 is an ADC containing anetolimab conjugated to the maytansin-like microtubule inhibitor DM4 via a disulfide linker (reducible to the SPDB linker [4-(2-pyridyldithio)N-succinimide ester butyrate]). The sequence from anetolimab was obtained from the Beacon database (Hanson-Wade). The antibody sequence (Table 30) was generated from overlapping oligonucleotides, amplified by PCR, cloned into an expression plasmid, and sequenced. A stable pool was created in 293F cells, and cells were grown until viability was <30%. Anetolimab was purified from modified medium using protein A affinity chromatography. BAY 94-9343 was generated by reactive conjugation with lysine of SPDB-DM4 (Levena BioPharma) to obtain a DAR of 3.7. Unconjugated payload was removed by desalting chromatography.

[0627] 15.1.2 Internal Efficacy

[0628] animalFemale NCr nude mice (Taconic) arriving at 5 weeks of age were allowed 5-7 days to acclimatize before inoculation. Animals were housed in 3-5 ventilated cages with sterile food blocks and water bottles readily available. Animals were tagged and weighed before the start of the study.

[0629] Cell culture The cryopreserved NCI-N87 cells were thawed and grown in a medium containing the necessary supplements. The cells were then cultured for two subcultures in complete medium before being used for in vivo inoculation.

[0630] Tumor implantation, selection methods and treatment Mix the cell suspension in PBS with ice-cold Matrigel at a 1:1 (volume:volume) ratio to a final volume of 1.0 × 10⁻⁶. 8 The final concentration was [number of cells / mL]. 100 μL / mouse mixture was administered subcutaneously. Clinical health of mice was monitored starting on day 3 post-implantation, with body weight and tumor size measured three times weekly using an electronic digital caliper.

[0631] Tumor Measurement and Treatment Tumor volume (TV) (mm) 3 The following formula is used to calculate: W(mm) × L(mm) × D(mm) × π / 6. When the tumor reaches an average size of approximately 100mm... 3 Animals were randomly divided into groups of 5. Treatment was administered intravenously in 200 μL of test material. At the end of the study, final body weight was measured and recorded.

[0632] Statistical analysis Descriptive statistics were collected on tumor volume and body weight. Tumor volumes from each treatment group were compared to the control group using repeated measures two-way ANOVA followed by the Bonferroni post-hoc test. Tumor growth within each group was also compared using the same statistical analysis.

[0633] 15.2 Results

[0634] Both MORAb-109 (DAR2) and BAY 94-9343 demonstrated similar efficacy in NCI-N87 tumor-carrying mice. Figure 28A No weight loss was observed in any group. Figure 28B ).

[0635] Example 16: Antitumor efficacy of MORAb-109 and BAY 94-9343 in a human mesothelioma (HAY) xenograft model

[0636] 16.1 Method

[0637] animalFemale NOD.CB17-SCID mice (Jackson laboratory) aged 5 weeks upon arrival were acclimatized for 5-7 days prior to inoculation. Animals were housed in 3-5 ventilated cages with sterile food blocks and water bottles readily available. Animals were tagged and weighed before the start of the study.

[0638] Cell culture HAY cells that had been cryopreserved were thawed and grown in a medium containing the necessary supplements. The cells were then cultured for two subcultures in complete medium before being used for in vivo inoculation.

[0639] Tumor implantation, selection methods and treatment Mix the cell suspension in PBS with ice-cold Matrigel at a 1:1 (volume:volume) ratio to a final volume of 5.0 × 10⁻⁶. 7 The final concentration was [number of cells / mL]. 100 μL / mouse mixture was administered subcutaneously. Clinical health of mice was monitored starting on day 3 post-implantation, with body weight and tumor size measured three times weekly using an electronic digital caliper.

[0640] Tumor Measurement and Treatment Tumor volume (TV) (mm) 3 The following formula is used to calculate: W(mm) × L(mm) × D(mm) × π / 6. When the tumor reaches an average size of approximately 100mm... 3 Animals were randomly divided into groups of 5. Treatment was administered intravenously in 200 μL of test material. At the end of the study, final body weight was measured and recorded.

[0641] Statistical analysis Descriptive statistics were collected on tumor volume and body weight. Tumor volumes from each treatment group were compared to the control group using repeated measures two-way ANOVA followed by the Bonferroni post-hoc test. Tumor growth within each group was also compared using the same statistical analysis.

[0642] 16.2 Results

[0643] Both MORAb-109 (DAR2) and BAY 94-9343 demonstrated similar efficacy in HAY tumor-carrying mice. Figure 29A No weight loss was observed in any group. Figure 29B ).

[0644] Example 17: Antitumor efficacy of MORAb-109 and BAY 94-9343 in a human mesothelioma PDX model (Meso7212)

[0645] 17.1 Method

[0646] animalNMRI nu / nu female mice (Janvier laboratory) aged 5 to 6 weeks upon arrival were acclimatized for at least 4 days prior to inoculation. Animals were housed in 3-5 ventilated cages with sterile food blocks and water bottles readily available. Animals were tagged and weighed before the start of the study.

[0647] Xenotransplantation On day 0, Meso 7212 tumors were removed from five donor mice under aseptic conditions. Tumor tissue was cut into 2×2 mm fragments and placed in sterile Piper dishes covered with 0.9% saline. Simultaneously, recipient animals were... (2 mg / kg) was administered subcutaneously for analgesia, followed by a single intravenous injection (0.15 mL / mouse) for... Anesthetize (12 mg / kg). Make a 5-8 mm vertical incision in the skin on the left flank. Insert the tip of surgical scissors directly into the incision on the flank to create a pit in the subcutaneous space. Use surgical forceps to implant one tumor fragment into the pit for each mouse. Finally, close the incision with metal clips and return the animal to a clean cage.

[0648] Experimental Procedure Following xenografting, tumor transplantation and spread in mice were controlled by palpation at least twice a week. When the tumor was palpable, its diameter was measured using an electronic digital caliper (Mitutoyo).

[0649] Before treatment begins, the tumor volume of the animal is assessed (inclusion criteria for tumor volume: 0.1-0.3 cm). 3 Animals were randomly assigned to the experimental group. Tumor volume and body weight were recorded twice a week, starting from the first treatment day. Animal welfare was monitored twice daily.

[0650] treat All reagents were administered intravenously in a single dose on the day of randomization. Animals in the control group were treated with DPBS in the same manner.

[0651] Statistical analysis Descriptive statistics were collected on tumor volume and body weight. Tumor volume in each treatment group was compared to the control group using repeated measures two-way ANOVA followed by the Bonferroni post-hoc test. Tumor growth within each group was also compared using the same statistical analysis.

[0652] 17.2 Results

[0653] Both MORAb-109 (DAR2) and BAY 94-9343 demonstrated tumor regression in Meso7212 tumor-carrying mice. Figure 30ANo weight loss was observed in any group. Figure 30B ).

[0654] Example 18: Antitumor efficacy of MORAb-109 and BAY 94-9343 in a human NSCLC PDX model (LXFA-586)

[0655] 18.1 Method

[0656] animal Female NMRI nu / nu mice aged 4 to 6 weeks.

[0657] Xenotransplantation LXFA-586 was established as a growing tumor (T2N1M0) from a human patient with primary non-small cell lung adenocarcinoma.

[0658] Experimental Procedure Monitor animals until the tumor implant reaches 50-250 mm in a sufficient number of animals. 3 (e.g., 80-200mm) 3 The study uses a specific tumor volume standard. Mice are assigned to groups based on comparable group midpoints and mean tumor volumes. The process of assigning mice to groups (enrollment, stratified randomization) is also known as randomization. The day of randomization is designated as day 0 of the experiment.

[0659] treat Efficacy was evaluated in 6 to 7 mice in each of the 4 groups.

[0660] • In Group 1, the mediator was administered intravenously (iv) in a single dose of 5 mL / kg on Day 1.

[0661] • In Group 2, BAY 94-9343 (DAR approx. 4) was administered intravenously in a single dose of 25 mg / kg on Day 1.

[0662] • In group 3, MORAb-109 (DAR2) was administered intravenously in a single dose of 25 mg / kg on day 1.

[0663] • In group 4, eribulin was administered intravenously in a single dose of 3.2 mg / kg on day 1.

[0664] Tumors were measured and mice were weighed twice a week during the experimental period. Day 1 was the first day of drug administration, following the day of randomization (day 0).

[0665] 18.2 Results

[0666] In the LXFA-586 NSCLC PDX model, MORAb-109 (DAR2) demonstrated stable antitumor efficacy at 25 mg / kg (minimum T / C, 1.8% on day 41). Figure 31A Furthermore, its Tq was not reached during the study. MORAb-109 was also well-tolerated at a single dose, without weight loss in mice carrying LXFA-586 tumors. Figure 31B ).

[0667] In the LXFA-586NSCLC PDX model, BAY 94-9343 (DAR approx. 4) demonstrated stable antitumor efficacy similar to MORAb-109 at 25 mg / kg. Figure 31A Furthermore, its Tq was not reached during the study period. However, the molar amount of DM4 effective load in BAY 94-9343 was approximately twice the amount of eribulin effective load in MORAb-109.

[0668] Mice carrying LXFA-586 tumors tolerated eribulin well via a single intravenous dose of 3.2 mg / kg (the mouse MTD dose, or 32 times the molar amount of eribulin in MORAb-109 when administered at 10 mg / kg), and showed antitumor efficacy (lowest T / C, 14.8% on day 21). However, eribulin induced mild and transient weight loss after administration. Figure 31A and Figure 31B ).

[0669] Example 19: Antitumor efficacy of MORAb-109 and BAY 94-9343 in a human NSCLC PDX model (LXFL-529)

[0670] 19.1 Method

[0671] animal Female NMRI nu / nu mice aged 4 to 6 weeks.

[0672] Xenotransplantation LXFL-529 was established as a growing tumor (T3N1M0) from a human patient with primary non-small cell lung adenocarcinoma.

[0673] Experimental Procedure Monitor animals until the tumor implant reaches 50-250 mm in a sufficient number of animals. 3 (e.g., 80-200mm) 3 The study uses a specific tumor volume standard. Mice are assigned to groups based on comparable group midpoints and mean tumor volumes. The process of assigning mice to groups (enrollment, stratified randomization) is also known as randomization. The day of randomization is designated as day 0 of the experiment.

[0674] treat Efficacy was evaluated in 6 to 7 mice in each of the 6 groups.

[0675] • In Group 1, the mediator was administered intravenously (iv) in a single dose of 5 mL / kg on Day 1.

[0676] • In Group 2, BAY 94-9343 (DAR approx. 4) was administered intravenously in a single dose of 12.5 mg / kg on Day 1.

[0677] • In group 3, eribulin was administered intravenously in a single dose of 3.2 mg / kg on day 1.

[0678] • In group 4, MORAb-109 (DAR2) was administered intravenously in a single dose of 25 mg / kg on day 1.

[0679] • In group 5, MORAb-109 (DAR2) was administered intravenously in a single dose of 12.5 mg / kg on day 1.

[0680] • In group 6, MORAb-109 (DAR2) was administered intravenously at a dose of 12.5 mg / kg on days 1, 8 and 16.

[0681] Tumors were measured and mice were weighed twice a week during the experimental period. Day 1 was the first day of drug administration, following the day of randomization (day 0).

[0682] 19.2 Results

[0683] MORAb-109 (DAR2) demonstrated stable antitumor efficacy at 12.5 and 25 mg / kg in the LXFL-529 NSCLC PDX model. Figure 32A MORAb-109 was also well tolerated at a single dose, without weight loss in mice carrying LXFL-529 tumors. Figure 32B ).

[0684] However, BAY 94-9343 (DAR approx. 4) at 12.5 mg / kg (the equivalent molar amount of DM4 effective load is the same as the amount of eribulin effective load in MORAb-109 at 25 mg / kg) showed no antitumor efficacy. Figure 32A ).

[0685] Mice carrying LXFL-529 tumors tolerated eribulin well and demonstrated antitumor efficacy with a single intravenous dose of 3.2 mg / kg (mice MTD). However, eribulin induced mild and transient weight loss after administration. Figure 32A and Figure 32B ).

Claims

1. An isolated antibody or antigen-binding fragment, wherein the antibody or antigen-binding fragment is capable of binding to mesothelin and comprises: (a) three heavy chain complementarity determining regions consisting of HCDR1, HCDR2, HCDR3 and three light chain complementarity determining regions consisting of LCDR1, LCDR2, and LCDR3, wherein the amino acid sequences of HCDR1, HCDR2, and HCDR3 are SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively, and the amino acid sequences of LCDR1, LCDR2, and LCDR3 are SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively, as defined by the Kabat numbering system; or, wherein the amino acid sequences of HCDR1, HCDR2, and HCDR3 are SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, respectively, and the amino acid sequences of LCDR1, LCDR2, and LCDR3 are SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, respectively, as defined by the IMGT numbering system.

2. The antibody or antigen-binding fragment of claim 1, wherein the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 13 and a light chain variable region comprising the amino acid sequence of SEQ ID NO:

14.

3. The antibody or antigen-binding fragment of claim 1, wherein the antibody or antigen-binding fragment comprises a human IgGl heavy chain constant region and a human Ig kappa light chain constant region.

4. The antibody or antigen-binding fragment of claim 1, wherein the antibody or antigen-binding fragment comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 17 and a light chain comprising the amino acid sequence of SEQ ID NO:

18.

5. The antibody or antigen-binding fragment of claim 1, wherein the antibody or antigen-binding fragment is conjugated to a therapeutic agent.

6. The antibody or antigen-binding fragment of claim 5, wherein the therapeutic agent is an anti-tubulin agent.

7. The antibody or antigen-binding fragment of claim 5, wherein the therapeutic agent is eribulin.

8. An antibody-drug conjugate of Formula (I): wherein Ab is the antibody or antigen-binding fragment of any one of claims 1-4; D is a therapeutic agent; L is a cleavable linker covalently linking Ab to D; and p is an integer from 1 to 8. Ab-(L-D) p (I) 9. The antibody-drug conjugate of claim 8, wherein p is 2 or 6.

10. The antibody-drug conjugate of claim 8, wherein the cleavable linker comprises a cleavable moiety that is positioned such that upon cleavage, the linker or any portion of the antibody or antigen-binding fragment does not remain bound to D.

11. The antibody-drug conjugate of claim 8, wherein the cleavable linker comprises a cleavable peptide moiety. ​ ​ ​ ​ ​ 12. The antibody-drug conjugate of claim 11, wherein the cleavable peptide moiety is cleavable by a cathepsin.

13. The antibody-drug conjugate of claim 11, wherein the cleavable peptide moiety comprises valine-citrulline (Val-Cit).

14. The antibody-drug conjugate of claim 8, wherein the cleavable linker comprises at least one spacer unit.

15. The antibody-drug conjugate of claim 14, wherein the spacer unit comprises a polyethylene glycol (PEG) moiety.

16. The antibody-drug conjugate of claim 15, wherein the PEG moiety comprises -(PEG) m -, and m is an integer from 1 to 10.

17. The antibody-drug conjugate of claim 16, wherein m is 2.

18. The antibody-drug conjugate of claim 14, wherein the spacer unit is linked to the antibody or antigen-binding fragment via a maleimide (Mal) moiety ("Mal-spacer unit").

19. The antibody-drug conjugate of claim 18, wherein the Mal-spacer unit is conjugated to the antibody or antigen-binding fragment via a cysteine residue on the antibody or antigen-binding fragment.

20. The antibody-drug conjugate of claim 19, wherein the cysteine residue is a cysteine residue at amino acid position 80 of the light chain variable region on the antibody or antigen-binding fragment ("LCcys80") according to the Kabat numbering system.

21. The antibody-drug conjugate of claim 20, wherein p is 2, and wherein each -L-D moiety is linked to LCcys80 on the antibody or antigen-binding fragment.

22. The antibody-drug conjugate of claim 8, wherein cleavage of the conjugate releases D from the antibody or antigen-binding fragment and linker.

23. The antibody-drug conjugate of claim 14, wherein the spacer unit linking the cleavable moiety in the linker to D is self-immolative.

24. The antibody-drug conjugate of claim 14, wherein the spacer unit linking the cleavable moiety in the linker to D comprises para-aminobenzyloxy carbonyl (pAB).

25. The antibody-drug conjugate of claim 24, wherein the pAB links the cleavable moiety in the linker to D.

26. The antibody-drug conjugate of claim 24, wherein the cleavable linker comprises Val-Cit-pAB.

27. The antibody-drug conjugate of claim 8, wherein D comprises an anti-tubulin agent.

28. The antibody-drug conjugate of claim 8, wherein D comprises eribulin.

29. The antibody-drug conjugate of claim 24, wherein D comprises eribulin, and the pAB is covalently linked to the eribulin via the C-35 amine.

30. The antibody-drug conjugate of claim 8, wherein the cleavable linker comprises Mal-(PEG)2-Val-Cit-pAB.

31. An antibody-drug conjugate of formula (I): wherein Ab-(L-D) p (I) ​ Ab is an antibody or antigen-binding fragment, wherein the antibody or antigen-binding fragment is capable of binding to mesothelin and comprises three heavy chain complementarity determining regions consisting of HCDR1, HCDR2, and HCDR3, and three light chain complementarity determining regions consisting of LCDR1, LCDR2, and LCDR3, wherein the amino acid sequences of HCDR1, HCDR2, and HCDR3 are SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively, and the amino acid sequences of LCDR1, LCDR2, and LCDR3 are SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively, as defined by the Kabat numbering system; or, wherein the amino acid sequences of HCDR1, HCDR2, and HCDR3 are SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, respectively, and the amino acid sequences of LCDR1, LCDR2, and LCDR3 are SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, respectively, as defined by the IMGT numbering system; D is eribulin; L is a cleavable linker comprising Mal-(PEG)2-Val-Cit-pAB; and p is an integer from 1 to 8.

32. The antibody-drug conjugate of claim 31, wherein the antibody or antigen-binding fragment comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 13; and a light chain variable region comprising the amino acid sequence of SEQ ID NO:

14.

33. The antibody-drug conjugate of claim 31, wherein the antibody or antigen-binding fragment comprises: a heavy chain comprising the amino acid sequence of SEQ ID NO: 17; and a light chain comprising the amino acid sequence of SEQ ID NO:

18.

34. A pharmaceutical composition comprising the antibody or antigen-binding fragment of any one of claims 1 to 7, or the antibody-drug conjugate of any one of claims 8 to 33, and a pharmaceutically acceptable carrier.

35. The pharmaceutical composition of claim 34, wherein the pharmaceutical composition comprises multiple copies of the antibody-drug conjugate, wherein the average p of the antibody-drug conjugate in the composition is about 1 to about 6.

36. The pharmaceutical composition of claim 35, wherein the average p of the antibody-drug conjugate in the composition is about 1.9, about 2.0, or about 6.

37. Use of an antibody or antigen-binding fragment of any one of claims 1 to 7 in the manufacture of a kit for use in a method of determining whether a subject having or suspected of having cancer will be responsive to treatment with an antibody or antigen-binding fragment of any one of claims 1 to 7, an antibody-drug conjugate of any one of claims 8 to 33, or a pharmaceutical composition of any one of claims 34 to 36, wherein the method comprises providing a biological sample from the subject; contacting the sample with the antibody or antigen-binding fragment; and detecting binding of the antibody or antigen-binding fragment to one or more cancer cells in the sample.

38. The use of claim 37, wherein the cancer is mesothelioma, lung cancer, ovarian cancer, or gastric cancer.

39. Use of an antibody or antigen-binding fragment of any one of claims 1 to 7, an antibody-drug conjugate of any one of claims 8 to 33, or a pharmaceutical composition of any one of claims 34 to 36 in a method of manufacturing a medicament for treating a subject having or suspected of having mesothelioma, lung cancer, ovarian cancer, or gastric cancer.

40. An isolated nucleic acid encoding an antibody or antigen-binding fragment of any one of claims 1 to 4.

41. An isolated vector comprising the nucleic acid of claim 40.

42. An isolated cell or population of cells comprising the nucleic acid of claim 38 or the vector of claim 41.

43. A method of producing an antibody or antigen-binding fragment of any one of claims 1 to 4, the method comprising culturing the isolated cell or population of cells of claim 42 under conditions suitable for production of the antibody or antigen-binding fragment.

44. A method of producing an antibody-drug conjugate of any one of claims 8 to 33, the method comprising reacting an antibody or antigen-binding fragment of any one of claims 1 to 4 with a cleavable linker linked to eribulin under conditions that allow conjugation.

45. The method of claim 44, wherein the cleavable linker linked to eribulin reacts with a cysteine residue on a light chain of the antibody or antigen-binding fragment.

Citation Information

Patent Citations

  • Eribulin-based antibody-drug conjugates and methods of use

    US20180193478A1

  • Protective cover for pressure cookers

    US2490250A

  • Recombinant immunoglobin preparations

    US4816567A

  • Exhaust muffler

    US4880078A

  • Method for treating infectious respiratory diseases

    US5290540A