Kit and method for rapid detection of passiflora edulis virus of east asia
By using the MIRA method with specific primers and fluorescent probes to detect Passiflora edulis virus in East Asia, the problem of rapid and accurate detection in the field has been solved, achieving high sensitivity and high specificity for virus detection, which is suitable for large-scale field testing.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HAINAN UNIV
- Filing Date
- 2022-03-30
- Publication Date
- 2026-07-07
AI Technical Summary
Existing technologies make it difficult to detect East Asian passion fruit virus quickly and accurately in the field, leading to the rapid spread of the virus in passion fruit cultivation. This results in high infection rates and low cure rates, seriously affecting the industry's development.
A rapid detection kit and method for East Asian passion fruit virus were developed, including specific primers and fluorescent probes. Nucleic acid amplification was performed at room temperature using the MIRA method, combined with fluorescence detection to achieve rapid and accurate virus detection.
It enables short-time and accurate batch testing in the field, with high sensitivity and specificity, suitable for room temperature operation and storage, and applicable to large-scale rapid testing.
Smart Images

Figure CN114934133B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant virus detection technology, specifically to a kit and method for rapid detection of Passionflower Virus (Passiflora edulis). Background Technology
[0002] East Asian passiflora virus (EAPV) is a virus belonging to the Potato Virus Y genus and is a particularly serious disease affecting passion fruit (Passiflora edulis). After EAPV infection, passion fruit will exhibit mosaic, mottling, and shriveling. It spreads rapidly among seedlings through both vector-borne and non-vector-borne transmission, with an infection rate of 30%–40%, exceeding 90% in severe cases. Once infected, the cure rate is almost zero. The best preventative measure is high-temperature destruction to stop transmission.
[0003] Viral diseases have become a major technical obstacle threatening the development of the passion fruit industry. At the same time, large-scale rapid detection of viral diseases in the field of passion fruit, blocking transmission at the source and reducing the infection rate in the field have become the top priorities for the prevention and control of viral diseases in passion fruit. Summary of the Invention
[0004] To address the aforementioned problems, this invention provides a rapid detection kit and method for East Asian passion fruit virus (EAPV), enabling short-term, accurate, and batch detection of EAPV virus in the field.
[0005] To achieve the technical objective of this invention, the technical solution adopted is as follows:
[0006] This invention provides a rapid detection kit for East Asian passion fruit virus, comprising: EAPV primers, the sequence of which is:
[0007] EAPV-F: 5′-gattcaaatcttggaagatgacccatatatcc-3′,
[0008] EAPV-R: 5′-gtatgagtgtgattgtgatgggcaatccac-3′.
[0009] Preferably, the device further includes an EAPV probe, which comprises four modification sites: a dSpacer (tetrahydrofuran, THF) is labeled at the midpoint ≥35nt from the 5′ end as a recognition site for the exonuclease; a fluorescent group is labeled upstream of the THF site and a quencher group is labeled downstream of the THF site, with a spacing of 2-4nt between the two groups; the THF site is ≥15nt from the 3′ end, and a modification group is labeled at the 3′ end.
[0010] More preferably, the modifying group is selected from amino groups, phosphate groups, or C3-spacers.
[0011] More preferably, the sequence of the EAPV probe is:
[0012] tgctaatccatatgtaccgtatgcgtca[FAM-dT]t[THF][BHQ1-dT]gagaagggtataca[C3-spacer].
[0013] This invention also provides a method for rapid detection of East Asian passion fruit virus, comprising:
[0014] 1) Add upstream primer, downstream primer, probe, RNase-free water, nucleic acid template and buffer to the reaction tube;
[0015] The sequence of the upstream primer is: 5′-gattcaaatcttggaagatgacccatatatcc-3′,
[0016] The downstream primer sequence is: 5′-gtatgagtgtgattgtgatgggcaatccac-3′,
[0017] The probe sequence is as follows:
[0018] tgctaatccatatgtaccgtatgcgtca[FAM-dT]t[THF][BHQ1-dT]gagaagggtataca[C3-spacer];
[0019] 2) After mixing, shake the reaction solution to the bottom of the tube, and then immediately place the reaction tube into a constant temperature device at 42°C for 30 minutes.
[0020] 3) Place the reaction product in a fluorescence detector. If the negative control shows no fluorescence and the positive control shows fluorescence, the sample shows fluorescence, indicating that the sample is infected with EAPV virus; if the sample does not show fluorescence, it indicates that the sample is not infected with EAPV virus.
[0021] Preferably, in step 1), the nucleic acid template is obtained by the following method: Take 5-10g of fresh passion fruit leaves and place them in a 1.5mL centrifuge tube (for RNA), add 15-25μL of RNase-free water, grind them into a homogenate with a grinder, and transfer 2μL to a new centrifuge tube and dilute to 50μL for use as a nucleic acid template.
[0022] Preferably, in step 1), each 10 μL reaction system contains 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.24 μL of probe, 2.08 μL of RNase-free water, 0.5 μL of nucleic acid template, and 6.38 μL of buffer.
[0023] Preferably, in step 1), the concentrations of primer and probe are 10 μM and 5 μM, respectively.
[0024] Preferably, in step 3), the template for the negative control is RNase-free water, and the template for the positive control is EAPV plasmid.
[0025] The beneficial effects of this invention are as follows:
[0026] The rapid detection method for East Asian passion fruit virus based on the MIRA method is simple and easy to implement. It features high sensitivity, strong specificity, and short reaction time (only 30 minutes). It can be operated, reacted, and stored at room temperature, making it very suitable for large-scale rapid detection in the field. Attached Figure Description
[0027] Figure 1 This invention provides electrophoresis images of EAPV at different dilutions obtained using the RT-PCR method.
[0028] Figure 2 This invention detects EAPV-specific fluorescence patterns. Detailed Implementation
[0029] To more clearly illustrate the present invention, the invention will be further described in detail below with reference to embodiments and accompanying drawings. Those skilled in the art should understand that the specific description below is illustrative rather than restrictive and should not be construed as limiting the scope of protection of the present invention.
[0030] To help farmers solve the problem of rapid identification of passion fruit viral diseases in the field, the applicant conducted a survey throughout the province and learned that EAPV virus disease is widely distributed and causes serious damage in passion fruit cultivation in Hainan Province. This application designs specific primers for EAPV virus and demonstrates that the RNA isothermal rapid amplification (MIRA) kit can achieve short-term, accurate, and batch detection of EAPV virus in the field. The following detection reagents (such as buffer A and buffer B) are from the RNA isothermal rapid amplification kit (fluorescent type) (Weifang Anpu Future Biotechnology Co., Ltd.).
[0031] Example
[0032] I. Specific steps for detecting EAPV using the MIRA method:
[0033] 1. Primer design: Primers were designed based on the conserved EAPV sequence.
[0034] Table 1 EAPV Primer Sequences
[0035]
[0036] 2. Probe design: The probe sequence does not overlap with the specific primer recognition site, has a length of 46-52 nt, and avoids palindromic sequences, internal secondary structures, and continuous repeating bases.
[0037] The probe has four modification sites: a dSpacer (tetrahydrofuran, THF) is labeled at the midpoint ≥35nt from the 5' end as a recognition site for exonuclease; a fluorescent group is labeled upstream of the THF site and a quenching group is labeled downstream of the THF site, with a spacing of 2-4nt between the two groups; the THF site is ≥15nt from the 3' end, and a modification group, such as an amino group, a phosphate group, or a C3-Spacer, is labeled at the 3' end.
[0038] Table 2 EAPV probe sequences
[0039]
[0040] 3. Sampling: Take a small piece (about 5g) of fresh passion fruit tender leaves and place it in a 1.5mL centrifuge tube (for RNA only). Add 15-25μL of RNase-free, grind it into a homogenate with a grinder, and transfer 2μL to a new centrifuge tube and dilute it to 50μL for use as a nucleic acid template.
[0041] 4. Testing Procedures:
[0042] 1) Add 29.4 μL of buffer A (Note: buffer A must be completely dissolved and mixed, otherwise it will affect the experimental results), 2 μL of upstream primer, 2 μL of downstream primer and 1.2 μL of probe (primer and probe concentrations are 10 μM and 5 μM, respectively) to each dry powder reaction tube, mix well and then evenly dispense into 5 reaction tubes, each tube containing 6.92 μL of the above mixture;
[0043] 2) Add 2.08 μL of RNase-free water and 0.5 μL of nucleic acid template to each reaction tube sequentially;
[0044] 3) Finally, add 0.5 μL of B buffer to the reaction tube and mix thoroughly;
[0045] 4) After mixing, shake (or centrifuge quickly) the reaction solution to the bottom of the tube, and then immediately place the reaction tube into a constant temperature device. Maintain the temperature at 42℃ for 30 minutes.
[0046] 5) Place the reaction product in a fluorescence detector. If the negative control (RNAse-free water) shows no fluorescence and the positive control (EAPV plasmid, concentration 93 ng / μL) shows fluorescence, the sample exhibiting fluorescence indicates EAPV virus infection; if the sample showing no fluorescence indicates no EAPV virus infection.
[0047] II. Sensitivity Test
[0048] The EAPV plasmid (concentration 91 ng / μL) was first serially diluted 10-fold, then 106-fold, and finally serially diluted 2-fold to test its sensitivity (Table 3). RT-PCR was also used for auxiliary verification. Figure 1 The MIRA method was found to be up to 320 times more sensitive than the RT-PCR method for detecting EAPV.
[0049] Table 3. Fluorescence values of EAPV at different dilutions detected by MIRA method.
[0050]
[0051] Note: The negative control is RNase-free water (RNase-free water).
[0052] III. Specificity Testing
[0053] The specificity of EAPV primers was tested using three common passion fruit viral diseases: Telosma mosaic virus (TeMV), Passiflora mottle virus (PaMV), and Cucumber mosaic virus (CMV). Figure 2 It was found that the primers for EAPV are specific and suitable for rapid field detection of EAPV virus disease.
[0054] Obviously, the above embodiments of the present invention are merely examples to illustrate the present invention more clearly, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is impossible to exhaustively list all implementation methods here. Any obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.
Claims
1. Rapid detection methods for passion fruit East Asian passion fruit virus, including: 1) Add EAPV upstream primer, EAPV downstream primer, EAPV probe, RNase-free water, nucleic acid template, and buffer to the reaction tube. Nucleic acid templates can be obtained by the following method: Take 5-10g of fresh passion fruit leaves and place them in a 1.5mL centrifuge tube. Add 15-25μL of RNase-free water and grind them into a homogenate with a grinder. Transfer 2μL to a new centrifuge tube and dilute it to 50μL for use as a nucleic acid template. In each 10 μL reaction system, add 0.4 μL of EAPV upstream primer, 0.4 μL of EAPV downstream primer, 0.24 μL of probe, 2.08 μL of RNase-free water, 0.5 μL of nucleic acid template and 6.38 μL of buffer. The primer and probe concentrations are 10 μM and 5 μM, respectively. The sequence of the upstream primer for EAPV is: 5′-gattcaaatcttggaagatgacccatatatcc-3′, The sequence of the downstream primer for EAPV is: 5′-gtatgagtgtgattgtgatgggcaatccac-3′. The EAPV probe sequence is as follows: tgctaatccatatgtaccgtatgcgtca[FAM-dT]t[THF][BHQ1-dT]gagaagggtataca[C3-spacer]; 2) After mixing, shake the reaction solution to the bottom of the tube, and then immediately place the reaction tube into a constant temperature device at 42°C for 30 minutes. 3) Place the reaction product in a fluorescence detector. If the sample shows fluorescence when the negative control shows no fluorescence and the positive control shows fluorescence, it indicates that the sample is infected with EAPV virus. If the sample shows no fluorescence, it indicates that the sample is not infected with EAPV virus.
2. The method for rapid detection of passion fruit East Asian passion fruit virus according to claim 1, characterized in that, 3) The template for the negative control was RNase-free water, and the template for the positive control was EAPV plasmid.
3. A rapid detection kit for MIRA type passion fruit virus, comprising the EAPV upstream primer, EAPV downstream primer and EAPV probe as described in claim 1.
Citation Information
Patent Citations
Primer pair set for East Asian passiflora virus whole-genome determination and application of primer pair set
CN110846440A
Primer, probe and reagent for rapidly detecting vibrio parahaemolyticus at room and isothermal temperature, and method realized through reagent
CN111621579A