Application of aspartate decarboxylase in fermentative production of vitamin B5

Abstract

The present application relates to the field of microorganism, and in particular to a method for producing vitamin B5 by using high-activity aspartate decarboxylase.The present application screens L-aspartate alpha-decarboxylase from Bacillus licheniformis, which has significantly higher activity than other sources of PanD in catalyzing the production of beta-alanine. The present application uses PanD from B. licheniformis to construct an engineered bacterium for fermentative production of vitamin B5, thereby eliminating the metabolic bottleneck of beta-alanine in biosynthesis of vitamin B5. Compared with the chemical method for producing vitamin B5 with high pollution, the present application has the advantages of renewable raw materials, easy treatment and resource utilization of waste residue, waste water and waste gas, etc., thereby being applicable to industrial production of vitamin B5 in practice and having important application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microorganisms, in particular to the application of aspartate decarboxylase in the fermentation production of vitamin B5. BACKGROUND

[0002] Vitamin B5 (VB5) is also known as D-pantothenic acid, which is a water-soluble vitamin and a component of coenzyme A and acyl carrier protein. It is involved in the metabolism of sugar, fat, protein and energy as a cofactor for more than 70 enzymes, and plays an important role in physiological metabolism regulation. VB5 is mainly used in animal feed additives, food additives and pharmaceutical raw materials. With the discovery of new functions of VB5 and the expansion of its application fields, the market demand for VB5 will still show a steady growth trend.

[0003] Microbial fermentation method for producing VB5 not only uses renewable glucose as raw material, but also forms waste residue, waste water and waste gas in the production process, which is easy to handle and resource utilization, which can effectively solve the high pollution problem of VB5 industry. The metabolic pathway of VB5 synthesized by microorganisms using glucose is complex, and the fermentation yield is very low. β-alanine is synthesized by β-alanine and D-panthothenic acid. β-alanine is catalyzed by L-aspartate α-decarboxylase encoded by panD gene. The initial translation synthesis of PanD is a proenzyme without catalytic activity, and the proenzyme is spontaneously cleaved at the Gly-Ser bond to produce two subunits. The N-terminal subunit containing pyruvoyl has catalytic effect. The mature PanD pyruvoyl forms a transition intermediate with the substrate, which is prone to amino transfer, resulting in irreversible loss of enzyme activity. In addition, the accumulation of β-alanine is also regulated by the concentration of coenzyme A, a downstream metabolic product of VB5. The protein complex formed by coenzyme A and PanD / PanZ negatively regulates the expression of PanD. PanD not only has a slow maturation process after translation modification, but also has the problems of catalytic inactivation and feedback inhibition, which leads to very low synthesis efficiency of β-alanine, the C3 precursor of VB5, and limits the efficient synthesis of VB5. In order to improve the fermentation yield of VB5, a large amount of β-alanine needs to be supplemented in the fermentation medium (Sahm, H., et al., (1999) Appl Environ Microb, 65, 1973-1979; Dusch, N., et al., (1999) Appl Environ Microb, 65, 1530-1539; Zhang, B., et al., (2019) Food Chemistry, 294, 267-275.). Therefore, the biosynthesis of β-alanine is the metabolic bottleneck of the fermentation production of VB5. SUMMARY

[0004] Therefore, in order to break through the metabolic bottleneck of efficient synthesis of beta-alanine, the inventors screened 16 key enzymes of different bacterial genera and with large evolutionary differences, L-aspartate alpha-decarboxylase. L-aspartate alpha-decarboxylase is encoded by the panD gene and catalyzes the decarboxylation of L-aspartate to produce beta-alanine.

[0005] In order to achieve the above-mentioned purposes of the application, the present application provides the following technical solutions.

[0006] In a first aspect, the present application provides an application of enhancing the expression of L-aspartate alpha-decarboxylase gene panD in the production of vitamin B5.

[0007] The L-aspartate alpha-decarboxylase is derived from Bacillus licheniformis.

[0008] In some embodiments of the present application, the L-aspartate alpha-decarboxylase gene panD has:

[0009] (I) the nucleotide sequence shown in SEQ ID No. 3; or

[0010] (II) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (I), and a nucleotide sequence functionally identical or similar to the nucleotide sequence shown in (I); or

[0011] (III) a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (I) or (II).

[0012] In some embodiments of the present application, it further comprises:

[0013] (1) inserting a strong promoter and / or a strong RBS in the avtA gene, wherein the strong promoter is PPL and the strong RBS is BCD2; and / or

[0014] (2) expressing ilvGM genes derived from Escherichia coli BL21; and / or

[0015] (3) increasing the copy number of panB, panC and / or panE genes.

[0016] In a second aspect, the present application further provides an expression vector comprising L-aspartate alpha-decarboxylase gene panD.

[0017] The L-aspartate alpha-decarboxylase is derived from Bacillus licheniformis.

[0018] In some embodiments of the present application, the expression vector further comprises:

[0019] (i) a strong promoter and / or a strong RBS; and / or

[0020] (ii) ilvGM genes derived from E. coli BL21; and / or

[0021] (iii) panB, panC and / or panE genes with increased copy number.

[0022] In a third aspect, the present application further provides a host expressing L-aspartate alpha-decarboxylase gene panD derived from Bacillus licheniformis.

[0023] In some embodiments of the present application, the host further comprises:

[0024] (i) a strong promoter and / or a strong RBS; and / or

[0025] (ii) ilvGM genes derived from E. coli BL21; and / or

[0026] (iii) panB, panC and / or panE genes with increased copy number.

[0027] In some embodiments of the present application, the host is transfected or transformed with the expression vector as claimed in claim 4 or 5.

[0028] Preferably, the host is derived from E. coli, preferably E. coli K12, more preferably E. coli K12 MG1655 strain.

[0029] In a fourth aspect, the present application further provides use of the expression vector and the host in production of vitamin B5.

[0030] In a fifth aspect, the present application further provides a method for producing vitamin B5, wherein the host is used as a fermentation strain, without adding beta-alanine, fermentation, collecting the fermentation broth, centrifuging to obtain the supernatant, and obtaining vitamin B5.

[0031] The application discloses a high-activity aspartate decarboxylase and a method for producing vitamin B5 by using the aspartate decarboxylase. The application screens L-aspartate alpha-decarboxylase from Bacillus licheniformis, and the activity of the L-aspartate alpha-decarboxylase in catalyzing production of beta-alanine is obviously higher than that of PanD from other sources. The application constructs an engineering bacterium for fermentative production of vitamin B5 by using PanD from B. licheniformis, and resolves the metabolic bottleneck of beta-alanine in biosynthesis of vitamin B5. Compared with the chemical method for producing vitamin B5 with high pollution, the biological method for producing vitamin B5 has the advantages of renewable raw materials, easy treatment and resource utilization of waste residue, waste water and waste gas, and thus can be practically used for industrial production of vitamin B5, and has important application value. DETAILED DESCRIPTION

[0032] The application discloses application of aspartate decarboxylase in fermentative production of vitamin B5. Those skilled in the art can refer to the content of the application, and appropriately improve process parameters. It is particularly pointed out that all similar replacements and changes are obvious to those skilled in the art, and are regarded as included in the application. The method and application of the application have been described by using preferred embodiments, and those skilled in the art can obviously make changes or appropriate changes and combinations on the method and application described in the application, so as to realize and apply the technology of the application without departing from the content, spirit and scope of the application.

[0033] The panD genes of the present application are respectively derived from Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus licheniformis, Chlorobium phaeobacteroides, Corynebacterium efficiens, Corynebacterium glutamicum, Corynebacterium marinum, Escherichia coli, Haloquadratum walsbyi, Hydrothermal vent metagenome, Methanocaldococcus jannaschii, Magnetospirillum magneticum, Metarhizium robertsii, Mine drainage metagenome, Rhodopirellula baltica and Thermotoga maritima.

[0034] In screening high-efficiency L-aspartate α-decarboxylase, the same bi-cistronic design element BCD2 (Nature Methods, 2013, 10(4): 354-360) is used to regulate the translation initiation level of the above-mentioned 16 L-aspartate α-decarboxylases from different sources. The BCD element introduces a leader-cistron sequence in front of the exogenous structural gene, and the ribosome smoothly passes through the cistron and occupies the next cistron RBS sequence, which can avoid the formation of stem-loop structure with the coding sequence at the front of the gene, thereby avoiding the translation repression of part of the panD gene. The translation intensity of BCD is highly related to the affinity of the RBS core sequence and the ribosome subunit, and is less related to the gene coding sequence, thereby avoiding the interference of 16 different panD gene sequences on the same translation initiation element.

[0035] In order to screen the high-efficiency L-aspartate α-decarboxylase, the 16 BCD2-panD sequences are connected to plasmids to construct 16 recombinant plasmids pET28a-BCD2-panD, and the same promoter is used to regulate transcription. The plasmid vector used in the present application can be pET series vectors such as pET28a, pET32a, pET3, etc.; or pQE series vectors or other E. coli expression vectors. The promoter of the present application can be T7 promoter, etc.

[0036] The recombinant plasmid is transformed into the derivative strain of E. coli B, including BL21, BL21-Codonplus (RIL), BL21 (DE3), BL21 Star, C41 (DE3), BL21 (DE3) pLys S / E, BL21-CodonPlus (DE3) strain, Origami (DE3) strain, Rosetta-gammi (DE3) strain, etc., so as to obtain the whole-cell catalytic engineering bacteria. The obtained target gene and vector are usually connected by restriction enzyme digestion and T4 ligase to construct a recombinant vector. The recombinant vector can be transformed into host cells by the method of calcium chloride chemical transformation or electroporation transformation in the conventional molecular biology experiment, so as to obtain the engineering bacteria which can be used for whole-cell catalysis.

[0037] The method of whole-cell catalysis is used to screen the high-efficiency L-aspartate α-decarboxylase. In the whole-cell catalysis process of the present application, the bacterial cells are first cultured in a liquid medium, and the expression of L-aspartate α-decarboxylase is induced at the appropriate time. The medium for the growth of the engineering bacteria can be a rich medium or an inorganic salt medium. The medium contains carbon source, nitrogen source, inorganic ions, antibiotics and other nutritional factors. As the carbon source, sugars such as glucose, lactose and galactose can be used; or alcohols such as glycerol and mannitol can be used; or organic acids such as gluconic acid, citric acid and succinic acid can be used. As the carbon source, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium phosphate and ammonium chloride can be used; or organic nitrogen sources such as corn steep liquor, soybean hydrolysate, hair powder, yeast extract and peptone can be used. The inorganic ions include one or more of iron, calcium, magnesium, manganese, molybdenum, cobalt, copper and potassium ions. The other nutritional factors further include vitamins such as vitamin B1, pyridoxal and biotin.

[0038] The culture process is preferably carried out under aerobic conditions for about 5-48 hours, and the culture temperature is usually controlled at 25-45°C, and the pH is usually controlled at 5-8. The at least one inducer selected from IPTG, lactose and allolactose is added after 3-40 hours of culture, and the inducer can be added in one time, intermittently or continuously, and the addition amount of the inducer is 0.01-1 mmol.

[0039] The substrate L-aspartic acid, which is usually preferably L-aspartic acid, L-aspartic acid sodium salt, L-aspartic acid potassium salt, L-aspartic acid ammonium salt, etc., is added all at once after 0.5-30 hours of induction agent addition.

[0040] In the process of producing beta-alanine by L-aspartic acid decarboxylation reaction, the pH value of the catalytic liquid continuously increases, and it is necessary to add acid to maintain the pH value in the range conducive to whole cell catalysis, which is usually above 4.0, preferably above 5.0, more preferably above 5.5, and usually below 8.0, preferably below 7.5, more preferably below 6.8. The acid used here is L-aspartic acid. The supplement can be in the form of solid powder, suspension or solution; it can be added intermittently or continuously to maintain the pH value in the above range, or it can be added by feedback of the pH electrode signal of the fermentation tank to maintain the pH value at a constant value.

[0041] The temperature of the catalytic reaction is usually between 25℃ and 60℃, preferably between 30℃ and 45℃. The temperature during the catalytic process can be set to a fixed value in the above range, or it can be changed from low to high.

[0042] The present application further applies the screened efficient L-aspartic acid alpha-decarboxylase to construct an engineered bacterium for fermentative production of vitamin B5, thereby solving the metabolic bottleneck of beta-alanine in biosynthesis of vitamin B5.

[0043] The E. coli for fermentative production of VB5 described in the present application expresses panB, panC and panE genes in the terminal synthesis pathway of VB5. The panB gene of E. coli encodes ketopantoate hydroxymethyltransferase, which catalyzes the substrate a-ketoisovalerate to form ketopantoate by adding a methyl group. Ketopantoate is reduced to pantoate by ketopantoate reductase encoded by the panE gene. Pantoic acid synthase encoded by the panC gene further catalyzes the condensation of pantoate and beta-alanine to form VB5.

[0044] The genome of E. coli K12 MG1655 is used as a template for PCR amplification of panBC genes. A strong promoter Ptrc is introduced on the amplification primer, and BamHI and SphI restriction endonuclease sites are designed at both ends of the primer. The Ptrc-panBC product obtained by PCR amplification is recovered after gel electrophoresis identification, and is double-digested with BamHI and SphI, and the pACYC184 plasmid is also double-digested at the same time. The double-digested Ptrc-panBC and pACYC184 plasmid are recovered by gel electrophoresis, and are ligated using T4 ligase, and the ligation product is chemically transformed into E. coli DH5α competent cells, which are incubated for 1 hour and then plated on chloramphenicol plates. The plated plates are incubated in a 37℃ incubator for 12 hours, and single colonies are picked and subcultured, and the recombinant plasmid is extracted and sequenced to obtain the correct recombinant plasmid pACYC184-Ptrc-panBC.

[0045] The panE gene was amplified by PCR using the genome of E. coli K12 MG1655 as a template. A strong promoter PJ23119 was introduced into the amplification primer, and SphI and BsaBI restriction endonuclease sites were designed at both ends of the primer. The PJ23119-panE product obtained by PCR amplification was recovered after gel electrophoresis identification, and was double-digested with BamHI and SphI, while the pACYC184-Ptrc-panBC plasmid was also double-digested. The double-digested PJ23119-panE and pACYC184-Ptrc-panBC plasmids were recovered by gel electrophoresis, and were ligated using T4 ligase. The ligation product was chemically transformed into E. coli DH5α competent cells, and was plated on a chloramphenicol plate after 1 hour of recovery. The plated plate was placed in a 37°C incubator for 12 hours, and a single colony was picked and subcultured. The recombinant plasmid was extracted and sequenced, and the correct recombinant plasmid pACYC184-Ptrc-panBC-PJ23119-panE was obtained, thereby obtaining a recombinant plasmid overexpressing the vitamin B5 terminal synthesis pathway gene.

[0046] The ilvG gene of E. coli K12 MG1655 is mutated and inactivated, and the ilvG gene with activity of E. coli BL21 is introduced, thereby improving the supply of VB5 precursors. + The ilvG + M gene is inserted into the chromosome of E. coli K12 MG1655, and the transcription initiation of ilvG + M is regulated by the terminator Ter. + The insertion site of the ilvG + M gene in the chromosome is the coding sequence of the avtA gene, which causes AvtA to be inactivated, weakens the synthesis of valine, and thus weakens the competitive pathway of VB5, which is conducive to the biosynthesis of VB5. The engineered bacterium E. coli MG1655 avtA:ilvG + M is constructed, which improves the synthesis pathway of the VB5 precursor acetylsuccinic acid and weakens the valine competitive pathway.

[0047] The three panD genes with higher activity screened above are integrated into the avtA gene of E. coli K12 MG1655, and are derived from Bacillus subtilis, Bacillus licheniformis, and Corynebacterium glutamicum, respectively. The three genes use the same strong promoter PPL and the same BCD2 to regulate the transcription and translation initiation, respectively.

[0048] The recombinant plasmid pACYC184-Ptrc-panBC-PJ23119-panE constructed above was transformed into the engineering bacteria E. coli MG1655 avtA:panDBs-ilvG + M, the engineering bacteria E. coli MG1655 avtA:panDBs-ilvG + M, and the engineering bacteria E. coli MG1655 avtA:panDCg-ilvG + M, the engineering bacteria for producing VB5 by fermentation was obtained. The VB5 production of the engineering bacteria was compared by shake flask fermentation, and the optimal PanD was verified.

[0049] The method for producing VB5 by fermentation, the culture medium comprises a carbon source, a nitrogen source, inorganic ions, antibiotics and other nutritional factors. As the carbon source, sugars such as glucose, lactose, galactose, etc. can be used. As the inorganic nitrogen source, inorganic nitrogen sources such as ammonia water, ammonium sulfate, ammonium phosphate, ammonium chloride, etc. can be used; as the organic nitrogen source, organic nitrogen sources such as corn steep liquor, soybean meal hydrolysate, hair powder, yeast extract, peptone, etc. can be used. The inorganic ions include one or more of iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, potassium, etc.

[0050] Through the two-step verification of catalytic production of beta-alanine and fermentation production of VB5, the highest activity L-aspartate alpha-decarboxylase was screened from 16 different sequences of different sources of candidate enzymes, which can efficiently produce VB5 without adding beta-alanine, and the biosynthetic bottleneck is eliminated, and the production cost is reduced.

[0051] The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified. In the quantitative tests in the following examples, three repeated experiments were set, and the average value was taken. In the following examples, unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art and commonly used instruments and reagents available on the market. Please refer to "Molecular Cloning Experiment Guide (3rd Edition)" (Science Press), "Microbiology Experiment (4th Edition)" (Higher Education Press) and the manufacturer's instructions of the corresponding instruments and reagents, etc.

[0052] If the sequence described in the specification is inconsistent with the sequence table, the sequence described in the specification shall prevail.

[0053] The application will be further described below in conjunction with the examples:

[0054] Example 1 detection method

[0055] The accumulation of β-alanine in the fermentation broth was quantitatively determined by HPLC. The specific method is as follows: The supernatant of the fermentation broth was taken, diluted with purified water to an appropriate concentration, and filtered through a 0.22 μm filter membrane. The concentration of β-alanine was determined by online pre-column derivatization with o-phthalaldehyde (OPA). The chromatographic column used was an Agilent AdvanceBio AAA C18 (4.6 x 100 mm, 2.7 μm), the column temperature was 40℃, the detection wavelength was 338 nm, and the mobile phase flow rate was 1 mL / min. Mobile phase A consisted of 10 mM Na₂HPO₄ and 10 mM Na₂B₄O₇, adjusted to pH 8.2. Mobile phase B consisted of acetonitrile:methanol:water = 45:45:10. A standard curve of alanine concentration versus absorbance under these chromatographic conditions was determined using β-alanine purchased from Sigma-Aldrich as a standard.

[0056] The yield of VB5 in the fermentation broth was quantitatively determined by HPLC. The specific method is as follows: The supernatant of the fermentation broth was taken, diluted with purified water to an appropriate concentration, and filtered through a 0.22 μm filter membrane. An Agilent ZORBAX SB-Aq column (4.6 x 250 mm) was used, with a column temperature of 30℃, a detection wavelength of 210 nm, and a mobile phase flow rate of 1 mL / min. The mobile phase was 3.12 g / L NaH2PO4·2H2O, and the pH was adjusted to 2.2 with phosphoric acid. A standard curve was determined using calcium pantothenate (purchased from Sigma) as a standard, comparing the concentration of 0.1–0.5 g / L calcium pantothenate with the absorbance.

[0057] Example 2: Construction of a vector overexpressing L-aspartate α-decarboxylase and a whole-cell engineered bacterium for β-alanine production.

[0058] Sixteen L-aspartate a-decarboxylase genes, panD, were synthesized from Bacillus amyloliquefaciens (as shown in SEQ ID No. 1), Bacillus subtilis (as shown in SEQ ID No. 2), Bacillus licheniformis (as shown in SEQ ID No. 3), Chlorobium phaeobacteroides (as shown in SEQ ID No. 4), Corynebacterium efficiens (as shown in SEQ ID No. 5), Corynebacterium glutamicum (as shown in SEQ ID No. 6), Corynebacterium marinum (as shown in SEQ ID No. 7), Escherichia coli (as shown in SEQ ID No. 8), Haloquadratum walsbyi (as shown in SEQ ID No. 9), Hydrothermal vent metagenome (as shown in SEQ ID No. 10), Methanocaldococcus jannaschii (as shown in SEQ ID No. 11), Magnetospirillum magneticum (as shown in SEQ ID No. 12), Metarhizium robertsii (as shown in SEQ ID No. 13), Mine drainage metagenome (as shown in SEQ ID No. 14), Rhodopirellula baltica (as shown in SEQ ID No. 15), and Thermotoga maritima (as shown in SEQ ID No. 16) by Gene Synthesis, Inc. Xbal and Hindlll restriction enzyme sequences were removed by synonymous codon replacement when custom synthesizing the above panD gene sequences.

[0059] The 16 BCD2-panD sequences are connected to plasmids to construct 16 recombinant plasmids pET28a-BCD2-panD. When the above-mentioned panD gene sequences are custom synthesized, the same BCD2 sequence (as shown in SEQ ID No. 17) is synthesized in front of each panD sequence, and XbaI and HindIII restriction enzyme sites are added at both ends of the BCD2-panD sequence. The synthesized sequence is connected to the vector. The above-mentioned synthesized BCD2-panD vector and pET28a(+) plasmid are double-digested with restriction enzymes XbaI and HindIII, and the digested BCD2-panD gene fragment and linearized vector segment are recovered by gel electrophoresis. The two fragments are further connected using T4 ligase, and the ligation product is transformed into E. coli DH5α competent cells, screened on LB plates containing 50 mg / L kanamycin, and the transformants containing the recombinant plasmid are obtained. After the transformants are expanded, the plasmid is extracted and sent for sequencing to verify that 16 correct plasmids pET28a-BCD2-panDBa, pET28a-BCD2-panDBs, pET28a-BCD2-panDBl, pET28a-BCD2-panDCp, pET28a-BCD2-panDCe, pET28a-BCD2-panDCg, pET28a-BCD2-panDCm, pET28a-BCD2-panDEc, pET28a-BCD2-panDHw, pET28a-BCD2-panDHv, pET28a-BCD2-panDMj, pET28a-BCD2-panDMm, pET28a-BCD2-panDMr, pET28a-BCD2-panDMd, pET28a-BCD2-panDRb, and pET28a-BCD2-panDTm are obtained. In the 16 recombinant vectors, the 16 panD genes from different sources are regulated by the same promoter (T7) to initiate transcription, and the same BCD2 sequence is used to regulate the initiation of translation.

[0060] The 16 pET28a-BCD2-panD plasmids expressing panD genes from different sources were transformed into competent cells of E. coli BL21 (DE3), screened on LB plates containing 50 mg / L kanamycin, and 16 strains of engineered bacteria E. coli BL21 / pET28a-BCD2-panDBa, E. coli BL21 / pET28a-BCD2-panDBs, E. coli BL21 / pET28a-BCD2-panDBI, E. coli BL21 / pET28a-BCD2-panDCp, E. coli BL21 / pET28a-BCD2-panDCe, E. coli BL21 / pET28a-BCD2-panDCg, E. coli BL21 / pET28a-BCD2-panDCm, E. coli BL21 / pET28a-BCD2-panDEc, E. coli BL21 / pET28a-BCD2-panDHw, E. coli BL21 / pET28a-BCD2-panDHv, E. coli BL21 / pET28a-BCD2-panDMj, E. coli BL21 / pET28a-BCD2-panDMm, E. coli BL21 / pET28a-BCD2-panDMr, E. coli BL21 / pET28a-BCD2-panDMd, E. coli BL21 / pET28a-BCD2-panDRb, and E. coli BL21 / pET28a-BCD2-panDTm were obtained for β-alanine whole-cell catalysis.

[0061] Example 3 Whole-cell catalysis screening of optimal panD gene

[0062] The bacterial lawns of the 16 engineered bacteria E. coli BL21 / pET28a-BCD2-panD were scraped and inoculated into 50 mL sterile gas-permeable cap test tubes containing 3 mL LB medium (containing 50 mg / L kanamycin), and incubated in a 37°C shaker at 220 rpm for 12 h to obtain seed liquid, OD600= 0.8-1.0. The seed liquid was inoculated into 50 mL LB medium (containing 50 mg / L kanamycin) in a 250 mL flask, and incubated in a 37°C shaker at 220 rpm for 12 h to obtain the whole-cell catalysts of the 16 strains of engineered bacteria E. coli BL21 / pET28a-BCD2-panD. 600The obtained seed liquid was inoculated into a 500 mL baffle flask containing 30 mL LB medium containing 50 mg / L kanamycin at an inoculation amount of 2%, and was cultured in a 37°C shaking bed at 220 rpm for 2 h, 0.3 mM inducer IPTG was added, and the induction was continued for 4 h under the same conditions. After induction, 30 mL aspartic acid solution (pH was adjusted to 6.0 using sodium hydroxide) was added to the flask, and the flask was placed in a 37°C shaking bed at 220 rpm for 30 minutes. After centrifugation, the supernatant was detected for the yield of β-alanine, and three parallel experiments were set for each engineering bacteria, and the average value was taken. The β-alanine yield of the engineering bacteria overexpressing panD genes from different sources is shown in Table 1. The β-alanine yield of the engineering bacteria overexpressing panD genes from B. subtilis (SEQ ID No. 2), B. licheniformis (SEQ ID No. 3), C. glutamicum and M. magneticum is about ten times higher than that of other engineering bacteria, and the catalytic efficiency of L-aspartate α-decarboxylase from B. licheniformis is the highest.

[0063] Table 1

[0064]

[0065]

[0066] The catalytic performance of the engineering bacteria E. coli BL21 / pET28a-BCD2-panDBl was further verified using a 5L fermenter. The engineering bacteria E. coli BL21 / pET28a-BCD2-panDBl was scraped from the bacterial lawn and inoculated into a 500 mL flask containing 50 mL LB medium containing 50 mg / L kanamycin (5-200 mg / L can be used) at 37°C, 220 rpm in a shaking bed for 4 h to obtain a seed liquid, OD 600 The obtained seed liquid was inoculated into a 500 mL baffle flask containing 30 mL LB medium containing 50 mg / L kanamycin at an inoculation amount of 2%, and was cultured in a 37°C shaking bed at 220 rpm for 2 h, 0.3 mM inducer IPTG was added, and the induction was continued for 4 h under the same conditions. After induction, 30 mL aspartic acid solution (pH was adjusted to 6.0 using sodium hydroxide) was added to the flask, and the flask was placed in a 37°C shaking bed at 220 rpm for 30 minutes. After centrifugation, the supernatant was detected for the yield of β-alanine, and three parallel experiments were set for each engineering bacteria, and the average value was taken. The β-alanine yield of the engineering bacteria overexpressing panD genes from different sources is shown in Table 1. The β-alanine yield of the engineering bacteria overexpressing panD genes from B. subtilis (SEQ ID No. 2), B. licheniformis (SEQ ID No. 3), C. glutamicum and M. magneticum is about ten times higher than that of other engineering bacteria, and the catalytic efficiency of L-aspartate α-decarboxylase from B. licheniformis is the highest. 600 The obtained seed liquid was inoculated into a 500 mL baffle flask containing 30 mL LB medium containing 50 mg / L kanamycin at an inoculation amount of 2%, and was cultured in a 37°C shaking bed at 220 rpm for 2 h, 0.3 mM inducer IPTG was added, and the induction was continued for 4 h under the same conditions. After induction, 30 mL aspartic acid solution (pH was adjusted to 6.0 using sodium hydroxide) was added to the flask, and the flask was placed in a 37°C shaking bed at 220 rpm for 30 minutes. After centrifugation, the supernatant was detected for the yield of β-alanine, and three parallel experiments were set for each engineering bacteria, and the average value was taken. The β-alanine yield of the engineering bacteria overexpressing panD genes from different sources is shown in Table 1. The β-alanine yield of the engineering bacteria overexpressing panD genes from B. subtilis (SEQ ID No. 2), B. licheniformis (SEQ ID No. 3), C. glutamicum and M. magneticum is about ten times higher than that of other engineering bacteria, and the catalytic efficiency of L-aspartate α-decarboxylase from B. licheniformis is the highest. 600The concentration reached approximately 80. 10 g / L of L-aspartic acid was added as a substrate. The pH was not adjusted during the catalytic process; when the pH stopped rising, another 10 g / L of L-aspartic acid was added. Solid aspartic acid was added intermittently 25 times, and the catalytic process lasted 36 hours, resulting in a β-alanine yield of 140.5 g / L.

[0067] The components of the inorganic salt culture medium and the feed solution are as follows: Inorganic salt culture medium: 2 g / L (NH4)2HPO4 4, 4g / LKH2PO4, 0.85g / L Citric acid, 0.7g / L MgSO4·7H2O, 10mg / L FeSO4·7H2O, 2.25mg / L ZnSO4·7H2O, 0.2mg / L CuSO4·5H2O, 0.5mg / LMnSO4·5H2O, 0.23mg / L NaB4O7·10H2O, 2.0mg / L CaCl2·2H2O, 0.1mg / LNH4Mo7O 24 The feed solution contained 0.15 mg / L CoCl2·6H2O, with the remainder being water. The feed solution also contained 700 g / L glucose and 20 g / L MgSO4·7H2O, with the remainder being water.

[0068] Example 4: Construction of engineered bacteria for fermentation production of VB5.

[0069] Using P1 and P2 as primers and wild-type Escherichia coli K12 MG1655 strain genomic DNA as a template, the high-fidelity polymerase KAPA HiFi was used. TM HotStar, the nucleotide sequence amplified by PCR is shown in SEQ ID No. 18, where 10nt-45nt is the promoter trc, 74nt-868nt is the coding sequence of the panB gene, and 880nt-1731nt is the coding sequence of the panC gene. A strong promoter trc was designed to be introduced into primer P1, and BamHI and SphI restriction endonuclease sites were designed at the 5' ends of primers P1 and P2, respectively. The PCR program was: 98℃ denaturation for 30 seconds, 65℃ annealing for 15 seconds, 72℃ extension for 90 seconds, 26 cycles, yielding approximately 1800bp of the P gene. trc -panBC gene fragment.

[0070]

[0071] (As shown in SEQ ID No. 24; the underlined sequence is the BamHI restriction site, and the italicized sequence is the trc sequence of the promoter.)

[0072] P2: 5'-ACAT GCA TGC CCTGTGTTAT GACAGATGAC-3'

[0073] (as shown in SEQ ID No. 25; the sequence indicated by underlining is a Sph I enzyme digestion recognition site)

[0074] The PCR-amplified P trc The panBC product was recovered after gel electrophoresis identification, and was double-digested with BamHI and SphI, while the pACYC184 plasmid was also double-digested. The double-digested Ptrc-panBC and pACYC184 plasmid were recovered by gel electrophoresis, and were ligated using T4 ligase. The ligation product was chemically transformed into E. coli DH5a competent cells, and was plated on a chloramphenicol plate after 1 hour of recovery. The plated plate was incubated in a 37°C incubator for 12 hours, and a single colony was picked for subculture. The recombinant plasmid was extracted, and was sequenced to obtain the correct recombinant plasmid pACYC184-panBC. trc The DNA fragment of the panBC gene and the pACYC184 plasmid were recovered by gel electrophoresis, and were ligated using T4 ligase. The ligation product was chemically transformed into E. coli DH5a competent cells, and was plated on a chloramphenicol plate after 1 hour of recovery. The plated plate was incubated in a 37°C incubator for 12 hours, and a single colony was picked for subculture. The recombinant plasmid was extracted, and was sequenced to obtain the correct recombinant plasmid pACYC184-panBC.

[0075] The sequence amplified by PCR using the genome of E. coli K12 MG1655 as a template and P3 and P4 as primers is shown in SEQ ID No. 19, wherein 11nt-45nt is a PJ23119 promoter, 66nt-977nt is a coding sequence of the panE gene, and 988nt-1731nt is a terminator sequence. The promoter PJ23119 is designed on the primer P3, and the terminator L3S2P56 sequence is designed on the primer P4. SphI and BsaBI restriction endonuclease sites are designed at the 5' ends of the primers P3 and P4, respectively. The PJ23119-panE product amplified using the above-described PCR reaction conditions was recovered after gel electrophoresis identification, and was double-digested with SphI and BsaBI, while the pACYC184-Ptrc-panBC plasmid was also double-digested. The double-digested PJ23119-panE and pACYC184-panBC plasmid were recovered by gel electrophoresis, and were ligated using T4 ligase. The ligation product was chemically transformed into E. coli DH5a competent cells, and was plated on a chloramphenicol plate after 1 hour of recovery. The plated plate was incubated in a 37°C incubator for 12 hours, and a single colony was picked for subculture. The recombinant plasmid was extracted, and was sequenced to obtain the correct recombinant plasmid pACYC184-panBCE, thereby obtaining the recombinant plasmid overexpressing the vitamin B5 terminal synthesis pathway gene.

[0076] P3: 5'-ACAT GCA TGC

[0077]

[0078] (as shown in SEQ ID No. 26; the sequence shown underlined is the Sphl enzyme digestion recognition site, and italicized is the sequence of the promoter J23119)

[0079]

[0080] (as shown in SEQ ID No. 27; the sequence shown underlined is the BsaBI enzyme digestion recognition site, and italicized is the sequence of the L3S2P56 terminator)

[0081] The CRISPR-Cas9 gene editing system containing pCas9 and pTargetF vectors was applied as reported (Jiang, Y., Chen, B., Duan, C. L., Sun, B. B., Yang, J. J., and Yang, S. (2015) Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System, Appl Environ Microb 81, 2506-2514.).

[0082] The NEB's Gene Mutagenesis Kit (NEB's Site-Directed Mutagenesis Kit, Cat. No. E0552S) was used to mutate the pTargetF vector according to the kit's instructions, designing primers P5 and P6. The mutated N20 sequence is CTTTCCAAGC TGGGTCTACC, targeting the avtA gene. The mutated pTargetF is named pTargetFavtA. P5: TGGGTCTACCG TTTTAGAGCT AGAAATAGC (as shown in SEQ ID No. 28);

[0083] P6: GCTTGGAAAG GACTAGTATT ATACCTAGG (as shown in SEQ ID No. 29);

[0084] P7: CG GACTGGAAGA AGATCTG (as shown in SEQ ID No. 30);

[0085] P8: TTTCTTAGAC GTCGGAATTG AGACTCATGC ACAGCACGA (as shown in SEQ ID No. 31);

[0086] P9: TCGTGCTGT GCATGAGT

[0087] C T ​CAATTCCGACGTCTAAGAAAC (as set forth in SEQ ID No. 32);

[0088] P10: GATCTCCTTT TTAAGTGAAC TTGGGGTCAG TGCGTCCTGCT GAT (as set forth in SEQ ID No. 33);

[0089] P11 : ATCAGCAGGACGCACTGACCCCAAGTTCACTTAAAAAGGAGATC (as set forth in SEQ ID No. 34);

[0090] P12: TGCCGTTCAT ATTGGTGATG CAAAAAACCC CTCAAGACC (as set forth in SEQ ID No. 35);

[0091] P13: GGTCTTGAGGGGTTTTTTGCATC ACCAATATGAACGGCA (as set forth in SEQ ID No. 36);

[0092] P14: GCTGATAGAG CTGCTTGGT (as set forth in SEQ ID No. 37);

[0093] P15: GGAGCTACTC ACACTGCTTG (as set forth in SEQ ID No. 38);

[0094] P16: CGCATACATT GATGCGTATG (as set forth in SEQ ID No. 39);

[0095] The primer P7 and P8 were used to amplify the sequence upstream of the avtA gene, the primer P9 and P10 were used to amplify the PL promoter, the primer P11 and P12 were used to amplify the BCD2-panDBs-Ter, BCD2-panDB1-Ter and BCD2-panDCg-Ter gene fragments, respectively, using pET28a-BCD2-panDBs, pET28a-BCD2-panDB1 and E. coli BL21 / pET28a-BCD2-panDCg as the templates, and the primer P13 and P14 were used to amplify the sequence downstream of the avtA gene. The four fragments were connected by overlapping PCR to obtain the combination of the four DNA fragments, DonorBs (as shown in SEQ ID No. 20), DonorBl (as shown in SEQ ID No. 21) and DonorCg (as shown in SEQ ID No. 22), which were used as the templates for gene editing. Among them, 1nt-312nt of SEQ ID No. 20, 21 and 22 is the sequence upstream of the target gene avtA gene, 313nt-474nt is the PL promoter, and 475nt-560nt is the BCD2 sequence. 560nt-943nt of SEQ ID No. 20 is the panDBs sequence, 944nt-995nt is the terminator sequence, and 996-1261nt is the sequence downstream of the avtA gene. 560nt-943nt of SEQ ID No. 21 is the panDB1 sequence, 944nt-995nt is the terminator sequence, and 996-1261nt is the sequence downstream of the avtA gene. 560nt-970nt of SEQ ID No. 22 is the panDCg sequence, 971nt-1022nt is the terminator sequence, and 1023-1288nt is the sequence downstream of the avtA gene.

[0096] The pCas9 plasmid was transformed into MG1655 and coated on a plate containing 50 mg / L kanamycin resistance, and cultured at 30°C to obtain the strain MG655 / pCas9. The MG655 / pCas9 bacterial lawn was picked into a 500 mL shake flask containing 50 mL of LB containing kanamycin, and cultured at 30°C, 220 rpm. When the OD600 of the culture medium was 0.2, 10 mM arabinose was added for induction, and the OD600 was 0.45 to prepare competent cells. Two microliters of pTargetFavtA plasmid and 10 microliters of DonorBs template DNA were electroporated into MG655 / pCas9 competent cells, and coated on a double-antibiotic plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C. The single colony of PPL-BCD2-panD-Ter integrated on the avtA gene was identified using primers P15 and P16, and the correct size PCR product was verified by sequencing. The single colony with correct sequencing was selected, and 0.2 mM IPTG was added for culture to eliminate the pTargetFavtA plasmid, and the engineering bacteria E. coli MG1655 avtA:panDBs / pCas, E. coli MG1655 avtA:panDB1 / pCas, and E. coli MG1655 avtA:panDCg / pCas were obtained, respectively. The competent cells were prepared according to the above method.

[0097] The engineering bacteria E. coli MG1655 avtA:panDBs / pCas, E. coli MG1655 avtA:panDB1 / pCas, and E. coli MG1655 avtA:panDCg were inoculated into LB liquid culture medium without antibiotics, and cultured at 37°C for 12 hours, and then diluted and coated on LB plates to obtain the engineering bacteria E. coli MG1655 avtA:panDBs, E. coli MG1655 avtA:panDB1, and E. coli MG1655 avtA:panDCg with the pCas plasmid eliminated, respectively. The gene panD is inserted into the coding sequence of the avtA gene in the chromosome, which causes the inactivation of AvtA and weakens the valine competitive metabolic pathway.

[0098] The ilvG gene of the wild-type E. coli K12 MG1655 is mutated, and the encoded acetolactate synthase has no activity. The present application introduces the active ilvG gene of E. coli BL21 into the chromosome of E. coli MG1655, which improves the synthesis of the precursor of VB5, acetolactate. The present application inserts the ilvG + M gene from E. coli BL21 into the chromosome of E. coli K12 MG1655, and regulates the ilvG +Transcription initiation of M, regulation of ilvG with terminator Ter + Transcription termination of M. ilvG + Integration of M gene into another N20 target sequence of avtA gene. Mutation of pTargetF vector using the above mutation kit and primers P17 and P18, after mutation pTargetF is named as pTargetFavtA1. Mutation kit and primers P17 and P18 mutate pTargetF vector, after mutation pTargetF is named as pTargetFavtA1.

[0099] P17: ACGGTCCACAG TTTTAGAGCT AGAAATAGC (as shown in SEQ ID No. 40);

[0100] P18: CGTAGTTACA GACTAGTATT ATACCTAGG (as shown in SEQ ID No. 41);

[0101] P19: GGCAGAAAAT CAGCCAGTTC (as shown in SEQ ID No. 42);

[0102] P20: TCCACACATT ATACGAGCCG GATGATTAAT TGTCAAGAACTCTGTAGCAA GGAAGG (as shown in SEQ ID No. 43);

[0103] P21: TTGACAATTAATCATCCGGCTCGTATAATGTGTGGACAAGATT CAGGACGGGG AAC (as shown in SEQ ID No. 44);

[0104] P22: CGAAAAAAGA CGCTCTAAAA GCGTCTCTTT TCTGGTATATTCCTTTTGCG CTCAG (as shown in SEQ ID No. 45);

[0105] P23: CAGAAAAGAGACGCT TTT AG AGCGTCTTTTTTCGTTTTGGAGCTACTC ACACTGCTTG (as shown in SEQ ID No. 46);

[0106] P24: GCCAATATGC AGATGCTCATGAGCATCTGCATATTGG C (as shown in SEQ ID No. 47);

[0107] P25: CAC GTT CGG A TAT GAA CTG (as shown in SEQ ID No. 48);

[0108] P26:CGTCAAGCTT CAGCAACTC (as shown in SEQ ID No. 49).

[0109] The upstream sequence of the avtA gene was amplified using primers P19 and P20, and the ilvG gene of E. coli BL21 was amplified using primers P21 and P22. + The M sequence was used to amplify the downstream sequence of the avtA gene using primers P23 and P24. The trc promoter TTGACAATTAATCATCCGGCTCGTATAATGTGTGGA was introduced using primers P20 and P21, and the terminator sequence CCAGAAAAGAGACGCT was introduced using primers P22 and P23. TTT AG AGCGTCTTTTTTCGTTTT. Overlap PCR was used to ligate the above three fragments to obtain the combinatorial DonorilvGM (as shown in SEQ ID No. 23), which served as a template for gene editing. Sequences 1-305nt in SEQ ID No. 23 are the upstream sequence of the target gene avtA, 306nt-341nt are the trc promoter, and 367nt-2013nt are ilvG derived from E. coli BL21. + The coding sequence of the gene is as follows: 2010nt-2273nt is the coding sequence of the ilvM gene, 2274-2328 is the terminator sequence, and 2329-2629 is the downstream sequence of the avtA gene.

[0110] Two μL of pTargetFavtA1 plasmid and 10 μL of DonorilvGM template DNA were electroporated into E. coli MG1655 avtA:panDBs / pCas, E. coli MG1655 avtA:panDBl / pCas, and E. coli MG1655 avtA:panDCg / pCas competent cells, respectively. The cells were then plated on double antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin and incubated at 30°C. Primers P25 and P26 were used to identify the integration of Ptrc-ilvG into the avtA gene. + Single colonies of M-Ter were sequenced to verify the correct PCR product size. Correctly sequenced single colonies were selected and cultured with 0.2 mM IPTG to eliminate the pTargetFavtA1 plasmid. They were then further inoculated into antibiotic-free LB broth and incubated at 37°C for 12 hours. The inoculated colonies were then diluted and plated on LB agar plates to obtain the engineered E. coli MG1655 avtA:panDBs-ilvG strain with the pCas plasmid eliminated. + M, E.coli MG1655 avtA:panDBl-ilvG +M and E. coli MG1655 avtA:panDCg-ilvG + M. By integrating active ilvG onto the chromosome + M enhances the synthesis of acetolactate, a precursor of VB5.

[0111] The constructed vector pACYC184-panBCE was transformed into the engineered strain E. coli MG1655avtA:panDBs-ilvG. + M, E.coli MG1655 avtA:panDBl-ilvG + M and E. coli MG1655avtA:panDCg-ilvG + In M, engineered E. coli MG1655avtA:panDBs-ilvG were obtained respectively. + M / pACYC184-panBCE, E.coliMG1655avtA:panDBl-ilvG + M / pACYC184-panBCE and E. coli MG1655avtA:panDCg-ilvG + M / pACYC184-panBCE is used for the fermentation production of VB5.

[0112] in:

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131] Example 5 Fermentation test of VB5 engineered bacteria

[0132] Test strain: E. coli MG1655 avtA:panDBs-ilvG + M / pACYC184-panBCE, E. coli MG1655 avtA:panDBs-ilvG + M / pACYC184-panBCE, E. coli MG1655 avtA:panDBs-ilvG + M / pACYC184-panBCE, E. coli MG1655 avtA:panDBs-ilvG

[0133] Fermentation medium: MOPS 80 g / L, glucose 20.0 g / L, ammonium sulfate 10.0 g / L, potassium dihydrogen phosphate 2.0 g / L, magnesium sulfate heptahydrate 2.0 g / L, yeast powder 5.0 g / L, trace element mixture 5 mL / L, and the rest is water. Trace element mixture: FeSO4·7H2O 10 g / L, CaCl2 1.35 g / L, ZnSO4·7H2O 2.25 g / L, MnSO4·4H2O 0.5 g / L, CuSO4·5H2O 1 g / L, (NH4)6Mo7O 24 ·4H2O 0.106 g / L, Na2B4O7·10H2O 0.23 g / L, CoCl2·6H2O 0.48 g / L, 35% HCl 10 mL / L, and the rest is water.

[0134] During the cultivation, the pH value of the reaction system was adjusted by using ammonia water to maintain at 6.8-7.0. During the cultivation, the glucose content was detected by using a biosensor analyzer SBA-40D every 4h, and when the glucose content in the system was less than 5g / L, glucose was supplemented to make the glucose concentration in the system reach 20g / L. After 24h of cultivation, sampling was performed, centrifugation was performed at 12000g for 2min, the supernatant was taken, and the VB5 content was detected (Table 2).

[0135] Table 2

[0136] Engineered bacteria Vitamin B5 (g / L) [EColi MG1655 avtA:panDBs-ilvG + M / pACYC184-panBCE]]> 2.12±0.13 [EColi MG1655 avtA:panDBl-ilvG + M / pACYC184-panBCE]]> 3.36±0.25 [Ec. coli MG1655 avtA:panDCg-ilvG + M / pACYC184-panBCE]]> 1.77±0.15

[0137] The present application verifies that the PanD derived from Bacillus licheniformis and screened by the present application has the highest activity, and can significantly improve the fermentation yield of VB5 through the two aspects of whole cell catalysis and VB5 fermentation.

[0138] The above only describes the preferred embodiments of the present application, and it should be pointed out that, for ordinary skilled persons in the technical field, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be regarded as the protection scope of the present application. SEQUENCE LISTING <110> Institute of Microbiology, Chinese Academy of Sciences <120> Application of aspartate decarboxylase in fermentation production of vitamin B5 <130> IM2022023I <141> 2022-03-07 <160> 49 <170> SIPOSequenceListing 1.0 <210> 1 <211> 372 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 atgatggccg gaaaactgca ccgcgctacc gtgacggaag ccaatttaaa ctatgtcggc 60 agcataacga ttgatgaaga tcttttagat gccgtcggaa tgctcgctaa tgaaaaagtt 120 cagattgtga ataataataa cggagcgaga cttgaaacgt atattattcc cggtaagcgg 180 gggagcggcg tcatctgttt aaatggagct gccgcccgtc tcgtccaaga aggagataaa 240 gtcattatta tttcttatca aatgatgtct gatcaggaag caaaaagcca tcagccgaag 300 gtggccgttc tggatgatca gaataaaatc gagcagatgc tgggccagga gccggcacac 360 acgattttgt aa 372 <210> 2 <211> 384 <212> DNA <213> Artificial Sequence <400> 2 atgtatcgaa caatgatgag cggcaaactt cacagggcaa ctgttacgga agcaaacctg 60 aactatgtgg gaagcattac aattgatgaa gatctcattg atgctgtggg aatgcttcct 120 aatgaaaaag tacaaattgt gaataataat aatggagcac gtcttgaaac gtatattatt 180 cctggtaaac ggggaagcgg cgtcatatgc ttaaacggtg cagccgcacg ccttgtgcag 240 gaaggagata aggtcattat tatttcctac aaaatgatgt ctgatcaaga agcggcaagc 300 catgagccga aagtggctgt tctgaatgat caaaacaaaa ttgaacaaat gctggggaac 360 gaaccagccc gtacaatttt gtaa 384 <210> 3 <211> 384 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 3 atgtaccgta cgttaatgag cgcaaaactt cacagagcga gagtgacgga agccaatttg 60 aactacgtcg gcagcgtgac aattgatgaa gatttgctgg atgctgtcgg aatgatggca 120 aatgaaaaag tgcaaattgt gaataataat aacggggccc ggctggaaac gtacattatt 180 cccggtgaaa ggggcagcgg cgtcgtttgt ttaaacggag ctgccgcccg ccttgtccag 240 gttggagatg tcgtcatcat cgtgtcttat gcgatgatgt ctgaagagga agcaaagacc 300 cataagccga aggttgccgt tttgaacgag agaaacgaaa tcgaggaaat gctgggtcag 360 gagccagccc gtaccattct gtaa 384 <210> 4 <211> 396 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 4 atgaagctgc acctgctgaa gagcaaaatt cacaacgcgc gtgttaccag cggtgacctg 60 gagtacgaag gcagcattac catcgatcag gagctgctgc tgctggcgga gatgatcccg 120 aatgaaaaag tgcaaattgt gaataataat aacggggccc ggctggaaac gtacattatt 180aacgaaaaag ttctggtggt gaacaacaac aacggcgagc gtttcgaaac ctatatcatt 180 aacggtgaac cgggcagccg tgttattcag ctgaacggtg cggcggcgcg ttgcgcgctg 240 ccgggcgacg agatcattat catgaccttc gcggtgatgg atgaaaagaa agcgcgtacc 300 tttcaaccga tggtgctgat cgttgaccac ctgaacaacc cgaagcgtcg tcaccgtatt 360 ggccaggaag acgaacaact gagcagcagc atctaa 396 <210> 5 <211> 411 <212> DNA <213> Artificial Sequence <400> 5 atgctgcgca ccatcctcgg tagcaagatt caccgcgcca ccgtcaccca ggccgacctt 60 gactatgtcg gctccatcac catcgacgcc gacctggtca atgccgccgg cctcatcgag 120 ggcgagaagg tcgccgtcgt ggacatcacc aacggcgccc gcattgagac ctatgtgatc 180 accggcgatg ccggaaccgg cagcatctgc atcaatggtg ccgccgccca tctgatcaac 240 ccgggtgatc tggtcatcat catgagctat ctgcaggcca ccgatgccga ggcccgcgcc 300 taccagccca atatcgtcca cgtggatgcc gacaaccgga tcgtcgccct gggcaacgac 360 gccggcgagc ccatcccggg ttccagcttg ctgtcctcgc gctccctcta a 411 <210> 6 <211> 411 <212> DNA <213> Artificial Sequence <400> 6 atgctgcgca ccatcctcgg aagtaagatt caccgagcca ctgtcactca agctgatcta 60 gattatgttg gctctgtaac catcgacgcc gacctggttc acgccgccgg attgatcgaa 120 ggcgaaaaag ttgccatcgt agacatcacc aacggcgctc gtctggaaac ttatgtcatt 180 gtgggcgacg ccggaacggg caatatttgc atcaatggtg ccgctgcaca ccttattaat 240 cctggcgatc ttgtgatcat catgagctac cttcaggcaa ctgatgcgga agccaaggcg 300 tatgagccaa agattgtgca cgtggacgcc gacaaccgca tcgttgcgct cggcaacgat 360 cttgcggaag cactacctgg atccgggctt ttgacgtcga gaagcattta a 411 <210> 7 <211> 411 <212> DNA <213> Artificial Sequence <400> 7 atgctcagaa ccatcctcgg cagcaaaatc caccgcgcca cggtcaccca ggcagacctc 60 aactacgtgg ggtccgtcac ggtcgacgcc gacctgctcg cggccgccgg cctcatcgag 120 ggcgaaaagg tggccatcgt cgacgtcacc aacggtgcca ggctggagac ctacgtcatc 180 accggtcgcc cgggcaccgg cgagatctgc atcaacggtg cggcggcgca cctgatccac 240 ccgggcgaca tcgtcatcct catctcctac ctgcaggcca ccctggacga ggccctcgaa 300 tacgagccgc gcatcgtcca cgtcgacgag aacaaccgca tcgtcgccct gggcaatgac 360 atcgccgagg ccgtcccggg ctccgacacc gtctccgccc ggaacatcta a 411 <210> 8 <211> 381 <212> DNA <213> Artificial Sequence <400> 8 atgattcgca cgatgctgca gggcaaactc caccgcgtga aagtgactca tgcggacctg 60 cactatgaag gttcttgcgc cattgaccag gattttcttg acgcagccgg tattctcgaa 120 aacgaagcca ttgatatctg gaatgtcacc aacggcaagc gtttctccac ttatgccatc 180 gcggcagaac gcggttcgag aattatttct gttaacggtg cggcggccca ctgcgccagt 240 GTCGGCGATA TTGTcatcat CGCCAGCTTC GTTACCAtGC CCAGATGAAG AAGCTCGCAC C 300 TGGCGACCCA ACgtcgccta ttttgaaggc gacaatgaaa tgaaacgtac cgcgaaagcg 360 ATTCCGgtac aggttgctta a 381 <210> 9 <211> 345 <212> DNA <213> Artificial Sequence <400> 9 ATGCGTCGTT GGCTGCTGAA GAGCAAACCG TGCACCCTGT GACCCTGAGA AG 60 GACTACGAAG GCAGCATCAG CATTGATGCG GCGCTGCTGA GCGAGGCGGA CATTGCGGTG 120 GGTGAACAGG TTCAAGTGTT AACGTTACCA ACGGCGAGCG TTTCCAAACC TATACCATT 180 GAGGGTGAAA GCCGTCAGAT GGAGCTGAAC GGTGCGGCGG CGCCTCTGGC GAAACCAGT 240 GATGTGATCA TTGTTATCAG CTACGGCCTG TATGTGAAAG ATGAGCAACC GGAACCgACC 300 GTTCtGCTGC TGGACGAGGA AAACCCTATT AGCGAGCGTG AATAA 345 <210> 10 <211> 228 <212> DNA <213> Artificial Sequence <400> 10 atgcagcgta ccttcctgaa gagcaaactg caccgtctga ccaccaccat ccgtggcaag 60 gagaacagcg gcgtgattct ggttaacggt gtggcgccgc acaaagttgc gggcgacctg 120 ctgatcattg cggcgtacag cagctatagc gaggatgaac tgcgtaacta ccaaccggcg 180 ctgtgctatg ttgacgaaaa gaacgtgctg acccgtatca gccgttaa 228 <210> 11 <211> 1191 <212> DNA <213> Artificial Sequence <400> 11 atgcgtaaca tgcaggagaa aggcgtgagc gagaaggaaa ttctggagga actgaagaaa 60 taccgtagcc tggatctgaa atatgaagac ggcaacattt tcggtagcat gtgcagcaac 120 gtgctgccga tcacccgtaa gatcgttgat attttcctgg agaccaacct gggtgacccg 180 ggcctgttta aaggtaccaa gctgctggag gaaaaagcgg tggcgctgct gggcagcctg 240 ctgaacaaca aggatgcgta cggtcacatc gttagcggtg gcaccgaagc gaacctgatg 300 gcgctgcgtt gcatcaaaaa catttggcgt gagaaacgtc gtaagggcct gagcaaaaac 360 GAACACCCGA AGATCATTGT GCCGATTCGC GCGCCTTCAG CTTTGAGAA AGGTCGTGAA 420 ATGATGGATC TGGAGTACAT CTATGCGCCG ATTAAGAGGA CTACACCATC GACGAAAAA 480 TTTTGTGAAGGACGCGGTTGA GGACTATGAT GTTGACGGTA TCATTGGCAT TGCGGGTACC 540 ACC GAAC TGG GTACCATCGA TAACATTGAG GAAC TGA GCAAAATCGCGAAGGAAAACAAC 600 ATCTACATTCACGTGGACGCGGC GTTCGGTGGCCTGGTTATCCC GTTTCTGGACGATAAA 660 TACAAGAAAAAGGGCGTGA ACTATAAGTTC GATTTTAGCC TGGGTGTTGAT AGCATCACCT 720 ATTGACCCGC AAAATGGGTC ACTGCCCGAT CCCGAGCGGT GGCATTCCT GTTCAAAGAC 780 ATCGGTTACA AGCGTTATCT GGATGTGGAC GCGCCGTATC TGACC GAGACCCGTCAGGCG 840 ACCATTCTGG GCACCCGTGT GG GTTTTGGT GGC GC GTGCACCTACGC GGTTC TGC GTTAT 900 CTGGGCCGTG AAGGTCAACG TAAAATCGTA ACGAGTGCA TGGAAAACAC CCTGTACCTG 960 TATAAAAAGC TGAAAGAGAA CAAC T TCAAGCCGGTGATCGAACC GATTC TGAACATCGTT 1020 GCGATTGAGG ATGAAGACTA CAAAGAGGTG TGCAAAAAGC TGC GTGACCGTGGTATTTAT 1080 gtgagcgttt gcaactgcgt taaagcgctg cgtatcgtgg ttatgccgca cattaagcgt 1140 gagcacatcg ataactttat cgaaattctg aacagcatca aacgtgacta a 1191 <210> 12 <211> 543 <212> DNA <213> Artificial Sequence <400> 12 atgatgaaga tcattcgtgc gaaactgcac ggcatccgtg tgaccaacgc ggatctgaac 60 taccacggca gcattaccct ggacccggag cagtgcgaaa tggcgggtat ctatccgatg 120 gagttcgttg atatttggaa caagaacagc gcggcgcgta tcagcaccta cgtgattttt 180 ggtgaaccgg gcagccgttg ctgcgttctg aacggtgcgg cggcgcgtac ctgccaaaaa 240 ggcgacgagc tgatcattgc ggcgagcgcg gatatcagcg gtccggaaaa gctgtacgac 300 atcaaaccgc gtattctgac cttcctgccg gacaaccacg tggatcaggt tctgtactat 360 gatgtgttcc aaagcgagaa gcgtccgtat gactttcgta tcgttgacgc ggataaacac 420 accattgaaa gctgccacac ctggccgaac gtggacatca ccaagctgcg tagcgatctg 480 gatgtgttcc aaagcgagaa gcgtccgtat gactttcgta tcgttgacgc ggataaacac 420 accattgaaa gctgccacac ctggccgaac gtggacatca ccaagctgcg tagcgatctg 480 gcggcgaaag gttggagcga ggcggaaatc gacagcttca ttgcgagcca ctttagcctg 540 taa 543 <210> 13 <211> 1506 <212> DNA <213> Artificial Sequence <400> 13 atgcgtgaca ccaagaaaat gctgaaccgt gcggatgagc tggacgatct gtacgaagcg 60 gttcgtgcgc tgatcattcc gcatgtgcgt gcggcggatg aagcgtgcag cctgaagagc 120 gcgggtcagc tgcacaccga cgatacccag cgtctgcaaa acgttctggt ggaaccgtac 180 ccgccgaagg cgctgcagga gcgtttccaa tttaccctgc cggacaacga gggtaacggc 240 aaagatggcc tgatgcacct gatccgtgat gttctgcgtt atagcgtgaa cacctgggac 300 caaggtttta tggataagct gaccagcagc accaacccgg ttggcgtgat cagcgaaatt 360 gttctgggca tcctgaacac caacgttcat gtgtaccatg tggcgccggc gctgagcgtt 420 attgagaaag tgaccggccg taccctggcg gcgtatttcg gttttaacag cccgagcgcg 480 ggtggcatta gctgccaggg tggcagcgcg agcaacctga ccagcctggt ggttgcgcgt 540 aacagcctgt acccggactg caagctgaac ggtggcagca gctatcaatt tgcgatcttc 600 accagctgcc acggtcactt cagcatggaa aaagcggcga ttacctgcgg tatgggcctg 660 agcagcgtgg ttcacgttcc ggtgaacgac gatggccgta tgaacgttag cgcgctgcgt 720 gagctggtga tccaggcgaa ggcgcaaggt aaaaccccgc tgtatgttaa cgcgaccgcg 780 ggtaccaccg ttctgggtgt gtttgacccg ctgcacgaaa tcaagaccat ttgcgaggaa 840 tttggcatgt ggttccacgt ggatgcgagc tggggtggca gcatcatttt cagcgcgaag 900 caccgtcaca aactgaccgg ttgcgagctg gcggacagcc tgaccattag cccgcacaaa 960 atgctgaacg ttccgatgac ctgcagcttt ctgctgacca acaacctgag cagcttctac 1020 accgcgaaca gcctggacgc gggttacctg ttccacgata ccgaggacga tgaagtgtgg 1080 gacctggcga acctgaccct gcagtgcggt cgtcgtgcgg atagcctgaa aatggcgctg 1140 gcgtggacct actatggtgc ggcgggcttt gaacgtcgta tcaaccacgc gttcaagatg 1200 gcggcgcacc tgagcagcat cattcagaaa agcccggact ttgaactggt tagcccgaac 1260 GCGGCCGCGTGCCTGCAAGTGTGCTTCTACTATACCCCGGGTGGCAAGATGGCGAAAAGC 1320 GAGATGGAAA CCAGCCGTCG TACCCGTGCG ATGGTTGAAA AGATGGTGGA CC GTGGCTTC 1380 ATGTTTGATT TCgcCcgGgTCCGAAAGGC GATTTCTTTC GTGTGGTTGT GAACtGCgAG 1440 ACCCTGCTGG GTACCCTTGA AGGCCTGTTc AAGGGTCTGG AGGCgGTGGG TAAACAAGTT 1500 GTGTAa 1506 <210> 14 <211> 222 <212> DNA <213> Artificial Sequence <400> 14 ATGCTGAACA TCACCACCGG TGCgcGTTC ACCACCTACG CGATCgAAGC GCgcGTGGC 60 AGCAAAGTGA TTGgtGTGAA CGGTGCggCG GCgcGTCTGG TGCAGAAGGG TGACAAAGTT 120 ATCgTGGTTC CTACGGCAT GCTGCCGGAG GAAGAGGCc GTCaACTATACCCGACC GTG 180 GTTCTGCTGG ACGATGGTA ACCTGATTAA ACGTGCggCG TAA 222 <210> 15 <211> 471 <212> DNA <213> Artificial Sequence <400> 15 ATGGTGGAC ACCCCGTACC GTAAGATGCT GGCggCGAA ATCCACCgTG CGACCcTGAC 60 ggtgcggatg ttaactatga aggcagcctg accgtgccgc cggaactgct ggttgcggcg 120 aagatccacc cgtacgagag cctgcacgtg tggaacgtta cccgtggtac ccgtctggag 180 acctatgcga ttgaaggcct gccgaacagc aacgacgtgt gcgcgaacgg tgcggcggcg 240 cacctgattc gtccgggtga ccatgtgatt ctggcggcgt atgcgatggt tccggaggcg 300 gatgcggcga cccacaaacc gcgtctgatc ttcgtggacg ataacaacca gctgagccac 360 gttggtccgg aaattgcggg tccgaacctg cgtagcgaca gcgacgatac ccacctggtt 420 cgtagcaccg agatgacccc ggatggtcaa ccgctggcgg aaggctgcta a 471 <210> 16 <211> 345 <212> DNA <213> Artificial Sequence <400> 16 atgctgaaca tctacctgaa gagcaaaatc cacatggcga ccattacccg taaagaggtg 60 tactatgaag gtagcatcga gattgacgag gaactgatgg gtaaagcggg cattagcgag 120 ggcgaactgg ttctggtggt gaacgttaac aacgcggaac gtttcgtgac ctacgttatc 180 aagggtaaac gtggcagccg tgagattaac ctgtatggtg cggcggcgcg tctgggcgag 240 gaaggcgacc gtgtgatcat tatggcgttc acctttagcg ataagccggt gaaggcgaaa 300 accatcgttc tgaacgagaa gaacgaaatt gttcaggaaa aataa 345 <210> 17 <211> 84 <212> DNA <213> Artificial Sequence <400> 17 ccaagttcac ttaaaaagga gatcaacaat gaaagcaatt ttcgtactga aacatcttaa 60 tcatgctaag gaggttttct aatg 84 <210> 18 <211> 1800 <212> DNA <213> Artificial Sequence <400> 18 cgcggatcct tgacaattaa tcatccggct cgtataatgt gtggagcaca acatcaattt 60 atcaggatac gttatgaaac cgaccaccat ctccttactg cagaagtaca aacaggaaaa 120 aaaacgtttc gcgaccatca ccgcttatga ctatagcttc gccaaactct ttgctgatga 180 agggcttaac gtcatgctgg tgggcgattc gctgggcatg acggttcagg ggcacgactc 240 GAGAAGAAAGGCGTGCTGACCCTGGTGGAGTGGATGGGCTGCTGAGTGAGCACAGCCGGCTGC ACCCTGCCCgttgccgatatcgctaccacactgccgccgtacgtcgcggcgc 300 ACCAACCTGCCTGCTGCTGGCTGACCTGCCgtttatggcgtatgccacgCCGGAACAAGC 360 CTTCGAAAACGCCGCAACGGTTATGCgtgccggtgctaacatggtcaaaattgaaggcgg 420 TGAGTGGCTGGTAGAAACCGTACAAATGCTGACCgaacgtgccgttcctgtatgtggtca 480 CTTAGGTTTAACACCACAGTcagtgaatatTTTCGgtggctacaaagttcaggggcgcgg 540 CGATGAAGCGGGCGATCAACTGCTCAGCGATGCATtagccttagaagctgctggggcaca 600 GCTGCTGGTGCTGGAATGCGTGCCGgttgaactggcaaaacgtattaccgaagcactggc 660 GATCCCGGTTATTGGCATTGGCGCAGGCAACGTCactgacggcagatcctcgtgatgca 720 CGACGCCTTTGgtattaccggcggtcacattcctaaattcGCTAAAAATTTcctcgccga 780 AACGGGCgacatccgcgcggctgtgcggcagtatatggctgaagtggagtccggcgttta 840 TCCGGGCgAAGAacacagtttccattaaggagtcacgttgtgttaattatcgaaaccctg 900 CCGCTGCTGCTCAGCAAATTCGCCGCCTGcgtatggaagGCAAGCGCgtggcgctggtg 960 CCTACC ATGGTAACCTGCA CGATGGCCAT ATGAAGCTGG TCGACGAAGC CAAAGCCC GC 1020 GCCGATGTGGTCGTCTGCT ATTTTCCTTT AACCCGATGC AGTTCGACCG CCCGGAAGAT 1080 CTGGCTCGTT ATCCACGGAC CTTGCAGGAG GACTGCGAGA AGCTAAACAA AC GTA AAGTG 1140 GATTTAGTTTTCGCCCCTTC GGTA AAAGAG ATCTACCCGA AC GGTACTGAA ACCCACACT 1200 TACGTTGACG TTCCTGGCCT TTCGACCATG CTGGAAGGTG CCAGCCGTCC GGGACATTTT 1260 Cgcggcgtttcgactattgtcagcaagctgttcaacctggtccagccggacatcgcctgc 1320 TTCGTTGAAAAGATTTCAGCAACTGGCGCTGATCCGCAAATGGTTGCCGATATGGGC 1380 TTCGATATTGAGATTGTCGGTGTGCCAATTATGCgcgcCAAA GACGGTCTGGCGCTAAGT 1440 TCCCgTAACGGTTATCTGACGGCGGAACAACGCAAATTGCgcCTGgtCTGTACAAAGTT 1500 TTAAGTTCGATTGCTGACAAATTGCAGGCTGGGGAACGGGATCTCGATGAAATTATACC 1560 ATTGCGGGGC AAGA ACTGAA TGA AAAAGC TTCGC GC CG ATG ATATT CAG ATTCGC GAT 1620 GCCGACACATTGCTGGAAGTTTCTGAAACCAGCAAACGGCAGTAATTC TGGTAGCCGCC 1680 tggcttggcg atgctcgcct gatcgacaac aaaatggtcg agctggcgta atacttaact 1740 ggcgctacgg ctgatggcgc cagttattaa tttaccccac gtcatctgtc ataacacagg 1800 <210> 19 <211> 1044 <212> DNA <213> Artificial Sequence <400> 19 acatgcatgc ttgacagcta gctcagtcct aggtataatg ctagcgttgc gggtgaggag 60 gaacaatgaa aattaccgta ttgggatgcg gtgccttagg gcaattatgg cttacagcac 120 tttgcaaaca gggtcatgaa gttcagggct ggctgcgcgt accgcaacct tattgtagcg 180 tgaatctggt tgagacagat ggttcgatat ttaacgaatc gctgaccgcc aacgatcccg 240 attttctcgc caccagcgat ctgctcctgg tgacgctgaa agcatggcag gtttccgatg 300 ccgtcaaaag cctcgcgtcc acactgcctg taactacgcc aatactgtta attcacaacg 360 gcatgggcac catcgaagag ttgcaaaaca ttcagcagcc attactgatg ggcaccacca 420 cccatgcagc ccgccgcgac ggcaatgtca ttattcatgt ggcaaacggt atcacgcata 480 ttggcccggc acggcaacag gacggggatt acagttatct ggcggatatt ttgcaaaccg 540 tgttgcctga cgttgcctgg cataacaata ttcgcgccga gctgtggcgc aagctggcag 600 tcaactgcgt gattaatcca ctgactgcca tctggaattg cccgaacggt gaattacgtc 660 atcatccgca agaaattatg cagatatgcg aagaagtcgc ggcggtgatc gaacgcgaag 720 ggcatcatac ttcagcagaa gatttgcgtg attacgtgat gcaggtgatt gatgccacag 780 cggaaaatat ctcgtcgatg ttgcaggata tccgcgcgct gcgccacact gaaatcgact 840 atatcaatgg ttttctctta cgccgcgccc gcgcgcatgg gattgccgta ccggaaaaca 900 cccgcctgtt tgaaatggta aaaagaaagg agagtgaata tgagcgcatc ggcactggtt 960 tgcctcgccc ctggtagtga agagactaat tttcgaaaaa agacgctgaa aagcgtcttt 1020 tttcgttttg ggatctaaat cgag 1044 <210> 20 <211> 1261 <212> DNA <213> Artificial Sequence <400> 20 cggactggaa gaagatctgt ttgtctctgc gcgtccgaat attgaactgc tgccggaagg 60 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 agccgcacgc cttgtgcagg aaggagataa ggtcattatt atttcctaca aaatgatgtc 840 tgatcaagaa gcggcaagcc atgagccgaa agtggctgtt ctgaatgatc aaaacaaaat 900 tgaacaaatg ctggggaacg aaccagcccg tacaattttg taaaagccta gcataacccc 960 ttggggcctc taaacgggtc ttgaggggtt ttttgcatca ccaatatgaa cggcattatc 1020 agcctggcac ctggcggtat tggtccggcg atgatgtgtg aaatgattaa gcgtaacgat 1080 ctgctgcgcc tgtctgaaac agtcatcaaa ccgttttact accagcgtgt tcaggaaact 1140 atcgccatca ttcgccgcta tttaccggaa aatcgctgcc tgattcataa accggaagga 1200 gccattttcc tctggctatg gtttaaggat ttgcccatta cgaccaagca gctctatcag 1260 c 1261 <210> 21 <211> 1261 <212> DNA <213> Artificial Sequence <400> 21 cggactggaa gaagatctgt ttgtctctgc gcgtccgaat attgaactgc tgccggaagg 60 ccagtttaaa taccacgtcg attttgagca tctgcatatt ggcgaagaaa ccgggatgat 120 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 gcttgacgcg ctggcgaatc aacacggcat tccgctggtg attgataacg cttatggcgt 240 cccgttcccg ggtatcatct tcagtgaagc gcgcccgcta tggaatccga atatcgtgct 300 gtgcatgagt ctcaattccg acgtctaaga aaccattatt atcatgacat taacctataa 360 aaataggcgt atcacgaggc cctttcgtct tcacctcgag tccctatcag tgatagagat 420 tgacatccct atcagtgata gagatactga gcacatcagc aggacgcact gaccgggccc 480 aagttcactt aaaaaggaga tcaacaatga aagcaatttt cgtactgaaa catcttaatc 540 atgctaagga ggttttctaa tgtaccgtac gttaatgagc gcaaaacttc acagagcgag 600 agtgacggaa gccaatttga actacgtcgg cagcgtgaca attgatgaag atttgctgga 660 tgctgtcgga atgatggcaa atgaaaaagt gcaaattgtg aataataata acggggcccg 720 gctggaaacg tacattattc ccggtgaaag gggcagcggc gtcgtttgtt taaacggagc 780 tgccgcccgc cttgtccagg ttggagatgt cgtcatcatc gtgtcttatg cgatgatgtc 840 tgaagaggaa gcaaagaccc ataagccgaa ggttgccgtt ttgaacgaga gaaacgaaat 900 cgaggaaatg ctgggtcagg agccagcccg taccattctg taaaagccta gcataacccc 960 ttggggcctc taaacgggtc ttgaggggtt ttttgcatca ccaatatgaa cggcattatc 1020 agcctggcac ctggcggtat tggtccggcg atgatgtgtg aaatgattaa gcgtaacgat 1080 ctgctgcgcc tgtctgaaac agtcatcaaa ccgttttact accagcgtgt tcaggaaact 1140 atcgccatca ttcgccgcta tttaccggaa aatcgctgcc tgattcataa accggaagga 1200 gccattttcc tctggctatg gtttaaggat ttgcccatta cgaccaagca gctctatcag 1260 c 1261 <210> 22 <211> 1288 <212> DNA <213> Artificial Sequence <400> 22 cggactggaa gaagatctgt ttgtctctgc gcgtccgaat attgaactgc tgccggaagg 60 ccagtttaaa taccacgtcg attttgagca tctgcatatt ggcgaagaaa ccgggatgat 120 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180gcttgacgcg ctggcgaatc aacacggcat tccgctggtg attgataacg cttatggcgt 240 cccgttcccg ggtatcatct tcagtgaagc gcgcccgcta tggaatccga atatcgtgct 300 gtgcatgagt ctcaattccg acgtctaaga aaccattatt atcatgacat taacctataa 360 aaataggcgt atcacgaggc cctttcgtct tcacctcgag tccctatcag tgatagagat 420 tgacatccct atcagtgata gagatactga gcacatcagc aggacgcact gaccgggccc 480 aagttcactt aaaaaggaga tcaacaatga aagcaatttt cgtactgaaa catcttaatc 540 atgctaagga ggttttctaa tgctgcgcac catcctcgga agtaagattc accgagccac 600 tgtcactcaa gctgatctag attatgttgg ctctgtaacc atcgacgccg acctggttca 660 cgccgccgga ttgatcgaag gcgaaaaagt tgccatcgta gacatcacca acggcgctcg 720 tctggaaact tatgtcattg tgggcgacgc cggaacgggc aatatttgca tcaatggtgc 780 cgctgcacac cttattaatc ctggcgatct tgtgatcatc atgagctacc ttcaggcaac 840 tgatgcggaa gccaaggcgt atgagccaaa gattgtgcac gtggacgccg acaaccgcat 900 cgttgcgctc ggcaacgatc ttgcggaagc actacctgga tccgggcttt tgacgtcgag 960 aagcatttaa aagcctagca taaccccttg gggcctctaa acgggtcttg aggggttttt 1020 tgcatcacca atatgaacgg cattatcagc ctggcacctg gcggtattgg tccggcgatg 1080 atgtgtgaaa tgattaagcg taacgatctg ctgcgcctgt ctgaaacagt catcaaaccg 1140 ttttactacc agcgtgttca ggaaactatc gccatcattc gccgctattt accggaaaat 1200 cgctgcctga ttcataaacc ggaaggagcc attttcctct ggctatggtt taaggatttg 1260 cccattacga ccaagcagct ctatcagc 1288 <210> 23 <211> 2629 <212> DNA <213> Artificial Sequence <400> 23 ggcagaaaat cagccagttc cgcgcccgcc atcccgcaat tggcgcgggc aaacaaacga 60 cacttttgct gaagcagggc tacggctttg ttcgtgagca tggcgacgat aaagtgctgg 120 tcgtctgggc agggcaacag taacttttcc ggcttcccgt tcgtcagtac ctcgggaagc 180 cgccaaccag gataaaatgt cagccctaat cagcgttgca ggataaagca ccgctcactc 240 ttcaacagac cgatttgcac cccagcaaat gtagcgttat tgttaccttc cttgctacag 300 agttcttgac aattaatcat ccggctcgta taatgtgtgg acaagattca ggacggggaa 360 ctaactatga atggcgcaca gtgggtggta catgcgttgc gggcacaggg tgtgaacacc 420 gttttcggtt atccgggtgg cgcaattatg ccggtttacg atgcattgta tgacggcggc 480 gtggagcact tgctatgccg acatgagcag ggtgcggcaa tggcggctat cggttatgct 540 cgtgctaccg gcaaaactgg cgtatgtatc gccacgtctg gtccgggcgc aaccaacctg 600 ataaccgggc ttgcggacgc actgttagat tccatccctg ttgttgccat caccggtcaa 660 gtgtccgcac cgtttatcgg cactgacgca tttcaggaag tggatgtcct gggattgtcg 720 ttagcctgta ccaagcacag ctttctggtg cagtcgctgg aagagttgcc gcgcatcatg 780 gctgaagcat tcgacgttgc ctgctcaggt cgtcctggtc cggttctggt cgatatccca 840 aaagatatcc agttagccag cggtgacctg gaaccgtggt tcaccaccgt tgaaaacgaa 900 gtgactttcc cacatgccga agttgagcaa gcgcgccaga tgctggcaaa agcgcaaaaa 960 ccgatgctgt acgttggcgg tggcgtgggt atggcgcagg cagttccggc tttgcgtgaa 1020 tttctcgctg ccacaaaaat gcctgccacc tgtacgctga aagggctggg cgcagtagaa 1080 gcagattatc cgtactatct gggcatgctg ggaatgcatg gcaccaaagc ggcgaacttc 1140 gcggtgcagg agtgcgactt gctgatcgcc gtgggtgcac gttttgatga ccgggtgacc 1200 ggcaaactga acaccttcgc accacacgcc agtgttatcc atatggatat cgacccggca 1260 gaaatgaaca agctgcgtca ggcacatgtg gcattacaag gtgatttaaa tgctctgtta 1320 ccagcattac agcagccgtt aaatatcaat gactggcagc tacactgcgc gcagctgcgt 1380 gatgaacatg cctggcgtta cgaccatccc ggtgacgcta tctacgcgcc gttgttgtta 1440 aaacaactgt cagatcgtaa acctgcggat tgcgtcgtga ccacagatgt ggggcagcac 1500 cagatgtggg ctgcgcagca catcgcccac actcgcccgg aaaatttcat cacctccagc 1560 ggcttaggca ccatgggttt tggtttaccg gcggcggttg gcgcgcaagt cgcgcgacca 1620 aacgataccg tcgtctgtat ctccggtgac ggctctttca tgatgaatgt gcaagagctg 1680 ggcaccgtaa aacgcaagca gttaccgttg aaaatcgtct tactcgataa ccaacggtta 1740 gggatggttc gacaatggca gcaactgttt ttccaggaac gatatagcga aaccaccctt 1800 accgataacc ccgatttcct catgttagcc agcgccttcg gcatccctgg ccaacacatc 1860 acccgtaaag accaggttga agcggcactc gacaccatgc tgaacagtga tgggccatac 1920 ctgcttcatg tctcaatcga cgaacttgag aacgtctggc cgctggtgcc gcctggtgcc 1980 agtaattcag aaatgttgga gaaattatca tgatgcaaca tcaggtcaat gtatcggctc 2040 gcttcaatcc agaaacctta gaacgtgttt tacgcgtggt gcgtcatcgt ggtttccacg 2100 tctgctcaat gaatatggcc gccgccagcg atgcacaaaa tataaatatc gaattgaccg 2160 ttgccagccc acggtcggtc gacttactgt ttagtcagtt aaataaactg gtggacgtcg 2220 cacacgttgc catctgccag agcacaacca catcacaaca aatccgcgcc tgagcgcaaa 2280 aggaatatac cagaaaagag acgcttttag agcgtctttt ttcgttttgg agctactcac 2340 actgcttgcc ggaatgctgc gcgagaagtt gggttgggat atcgaaccac agaatattgc 2400 actaacaaac ggcagccaga gcgcgttttt ctacttattt aacctgtttg ccggacgccg 2520. tgccgatggt cgggtcaaaa aagtgctgtt cccgcttgca ccggaataca ttggctatgc tgacgccgga ctggaagaag atctgtttgt ctctgcgcgt ccgaatattg aactgctgcc ggaaggccag tttaaatacc acgtcgattt tgagcatctg catattggc <210> 24 <211> 63 <212> DNA <213> Artificial Sequence <400> 24 cgcggatccc aattaatcat ccggctcgta taatgtgtgg together caatttatca 63 years <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <400> 25 acatgcatgc cctgtgttat bite <210> 26 <211> 65 <212> DNA <213> Artificial Sequence <400> 26 acatgcatgc ttgacagcta gctcagtcct aggtataatg ctagcgttgc gggtgaggag 65 years old <210> 27 <211> 90 <212> DNA <213> Artificial Sequence <400> 27 ctcgatttag atcccaaaac gaaaaaagac gcgcttttca gcgtcttttt tcgaaaatta 60 gtctcttcac taccagggat gactatcgag 90 <210> 28 <211> 30 <212> DNA <213> Artificial Sequence <400> 28 tgggtctacc gttttagagc tagaaatagc 30 <210> 29 <211> 29 <212> DNA <213> Artificial Sequence <400> 29 gcttggaaag gactagtatt atacctagg 29 <210> 30 <211> 19 <212> DNA <213> Artificial Sequence <400> 30 cggactggaa gaagatctg 19 <210> 31 <211> 39 <212> DNA <213> Artificial Sequence <400> 31 tttcttagac gtcggaattg agactcatgc acagcacga 39 <210> 32 <211> 40 <212> DNA <213> Artificial Sequence <400> 32 tcgtgctgtg catgagtctc aattccgacg tctaagaaac 40 <210> 33 <211> 44 <212> DNA <213> Artificial Sequence <400> 33 gatctccttt ttaagtgaac ttggggtcag tgcgtcctgc tgat 44 <210> 34 <211> 44 <212> DNA <213> Artificial Sequence <400> 34 atcagcagga cgcactgacc ccaagttcac ttaaaaagga gatc 44 <210> 35 <211> 39 <212> DNA <213> Artificial Sequence <400> 35 tgccgttcat attggtgatg caaaaaaccc ctcaagacc 39 <210> 36 <211> 39 <212> DNA <213> Artificial Sequence <400> 36 ggtcttgagg ggttttttgc atcaccaata tgaacggca 39 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <400> 37 gctgatagag ctgcttggt 19 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <400> 38 ggagctactc acactgcttg 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <400> 39 cgcatacatt gatgcgtatg 20 <210> 40 <211> 30 <212> DNA <213> Artificial Sequence <400> 40 acggtccaca gttttagagc tagaaatagc 30 <210> 41 <211> 29 <212> DNA <213> Artificial Sequence <400> 41 cgtagttaca gactagtatt atacctagg 29 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <400> 42 ggcagaaaat cagccagttc 20 <210> 43 <211> 56 <212> DNA <213> Artificial Sequence <400> 43 tccacacatt atacgagccg gatgattaat tgtcaagaac tctgtagcaa ggaagg 56 <210> 44 <211> 56 <212> DNA <213> Artificial Sequence <400> 44 ttgacaatta atcatccggc tcgtataatg tgtggacaag attcaggacg gggaac 56 <210> 45 <211> 55 <212> DNA <213> Artificial Sequence <400> 45 cgaaaaaaga cgctctaaaa gcgtctcttt tctggtatat tccttttgcg ctcag 55 <210> 46 <211> 58 <212> DNA <213> Artificial Sequence <400> 46 cagaaaagag acgcttttag agcgtctttt ttcgttttgg agctactcac actgcttg 58 <210> 47 <211> 38 <212> DNA <213> Artificial Sequence <400> 47 gccaatatgc agatgctcat gagcatctgc atattggc 38 <210> 48 <211> 19 <212> DNA <213> Artificial Sequence <400> 48 cacgttcgga tatgaactg 19 <210> 49 <211> 19 <212> DNA <213> Artificial Sequence <400> 49 cgtcaagctt cagcaactc 19

Claims

1.A host, characterized in that, an L-aspartate alpha-decarboxylase gene panD is inserted into the avtA gene of the host; the L-aspartate alpha-decarboxylase gene panD is derived from Bacillus licheniformis; the nucleotide sequence of the L-aspartate alpha-decarboxylase gene panD is shown in SEQ ID No. 3; further comprising: (i) inserting a strong promoter and a strong RBS into the avtA gene of the host; wherein the strong promoter is PPL and the strong RBS is BCD2; the nucleotide sequence of the BCD2 is shown in SEQ ID No. 17; the BCD2 regulates the translation initiation level of panD; (ii) inserting an ilvGM gene derived from Escherichia coli BL21 into the avtA gene of the host; (iii) increasing the copy number of panB, panC and panE genes; the host is derived from Escherichia coli, and the Escherichia coli is Escherichia coli K12. 2.The host of claim 1 is used in the production of vitamin B5. 3.A method for producing vitamin B5, characterized in that, using the host of claim 1 as a fermentation strain, without adding beta-alanine, fermenting, collecting the fermentation broth, centrifuging to obtain the supernatant, and obtaining vitamin B5.

Images