Application of Plant APT2 Protein and Encoding Nucleic Acid in Tobacco Crop Breeding

Abstract

The present invention discloses the application of a plant APT2 protein and the encoding nucleic acid in the breeding of tobacco crops. The present invention provides the application of any one of the following substances 1-3 in regulating the resistance of tobacco plants to pathogens and regulating the height of tobacco plants: 1. the protein APT2; 2. the nucleic acid molecule encoding the protein APT2; 3. a recombinant vector, expression cassette, transgenic crop, transgenic cell line or recombinant bacterium containing the nucleic acid molecule encoding the protein APT2. The experiments of the present invention prove that APT2 can be used to regulate the height of tobacco plants and to control tobacco mosaic virus or other pathogens by affecting the efficiency of viral cell-to-cell movement.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, and specifically relates to the application of an APT2 protein and a nucleic acid encoding the APT2 protein in regulating the height of tobacco plants and the resistance to pathogens. Background Art

[0002] In crop breeding, genes that can regulate crop growth traits can be used to cultivate ideal crop varieties. For example, by regulating the expression level of genes and reducing the plant height, the lodging of plants can be reduced. On this basis, it is of great significance for crop breeding to simultaneously improve the resistance of crops to pathogens.

[0003] Plant virus diseases caused by the infection of Tobacco mosaic virus (TMV) are a kind of virus diseases that occur widely worldwide and can infect many major common economic crops such as Solanaceae, Compositae, and Cruciferae. TMV has a fast transmission speed, a wide range of infected hosts, high genetic variability, and a common phenomenon of complex infection, seriously affecting the production of many economic crops. The annual yield loss of tobacco virus diseases caused by TMV infection can reach about 30%. In production, the prevention and control of tobacco mosaic virus diseases mainly include chemical pesticide control, RNA interference technology, planting resistant varieties, etc. Among them, the use of chemical pesticides is likely to have a negative impact on the natural environment, the RNA interference technology has the factor of unstable RNA molecules, and although the resistant varieties have good resistance effects, they are easily broken through by the virus. Resistance genes are relatively common in the prevention and control of tobacco mosaic virus, while there are few reports on reducing or knocking out susceptible genes for the prevention and control of tobacco mosaic virus.

[0004] Plasmodesmata are the main channels for signal communication and material transport between plant cells, and at the same time are the main paths for virus intercellular movement and plant cell-to-cell material exchange. The aperture size of plasmodesmata in plant cells controls the permeability of plasmodesmata, thereby affecting the rate of intercellular material transport in plant cells. The accumulation degree of callose at the aperture at both ends of plasmodesmata directly regulates the size and permeability of plasmodesmata. The movement of plant virus particles, genomes or protein nucleic acid complexes through plasmodesmata with the assistance of virus-encoded movement proteins is an extremely important link in the infection cycle of plant viruses. As the main channel for plant virus intercellular movement, the movement rate of plant viruses between plant cells is regulated by the size and permeability of plasmodesmata. Regulating the permeability of plasmodesmata in plant cells to control the intercellular movement of plant viruses and the diffusion of other pathogens between cells has great potential for developing into a broad-spectrum antiviral and anti-pathogen technology. Summary of the Invention

[0005] The object of the present invention is to solve the problems existing in the prior art and provide an application of a plant APT2 gene in regulating the height of tobacco plants and the resistance of tobacco plants to pathogens.

[0006] To achieve the above object, the specific technical solutions adopted by the present invention are as follows:

[0007] In the first aspect, the present invention provides an application of any one of the following substances a1) to a3) in regulating the height of tobacco plants or regulating the resistance of tobacco plants to pathogens:

[0008] a1) Protein APT2;

[0009] a2) A nucleic acid molecule encoding protein APT2;

[0010] a3) A recombinant vector, expression cassette, transgenic line, transgenic cell line or recombinant bacterium containing a nucleic acid molecule encoding protein APT2;

[0011] The protein APT2 is as follows b1) or b2):

[0012] b1) A protein consisting of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing;

[0013] b2) A protein derived from b1) with the same function, in which one or several amino acid residues in the amino acid sequence shown in SEQ ID No. 2 in the sequence listing are substituted and / or deleted and / or added.

[0014] As a preference of the above first aspect, the nucleic acid molecule is any one of the following nucleic acid molecules c1) to c4):

[0015] c1) A nucleic acid molecule whose coding region is the nucleic acid molecule shown in SEQ ID No. 1 in the sequence listing;

[0016] c2) A nucleic acid molecule whose coding region is the nucleic acid molecule shown in SEQ ID No. 3 in the sequence listing;

[0017] c3) A DNA molecule that hybridizes with the DNA sequence defined by c1) or c2) under stringent conditions and encodes a protein with the same function;

[0018] c4) A nucleic acid molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology with the DNA sequence defined by c1) or c2) and encodes a protein with the same function.

[0019] As a preference of the above first aspect, the regulation of the height of tobacco plants is to reduce the height of tobacco plants;

[0020] The regulation of the resistance of tobacco plants to pathogens is to increase or decrease the virus infection efficiency of tobacco plants;

[0021] Preferably, the plant virus is tobacco mosaic virus.

[0022] In a second aspect, the present invention provides the use of any one of the following substances a1) to a3) in controlling pathogens of tobacco plants;

[0023] Or, the use of any one of the following substances a1) to a3) in cultivating virus-resistant tobacco plants;

[0024] Or, the use of any one of the following substances a1) to a3) in changing the sensitivity of tobacco plants to pathogens;

[0025] a1) Protein APT2;

[0026] a2) A nucleic acid molecule encoding protein APT2;

[0027] a3) A recombinant vector, expression cassette, transgenic line, transgenic cell line or recombinant bacterium containing a nucleic acid molecule encoding protein APT2;

[0028] The protein APT2 is as follows b1) or b2):

[0029] b1) A protein consisting of the amino acid sequence shown in SEQ ID No.2 in the sequence listing;

[0030] b2) A protein derived from b1) with the same function, which is obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID No.2 in the sequence listing.

[0031] Preferably, the plant pathogen is tobacco mosaic virus.

[0032] In a third aspect, the present invention provides a method for reducing the height of tobacco plants, which is to obtain a transgenic plant with a plant height lower than that of the target tobacco plant by reducing the expression level and / or activity of a nucleic acid molecule encoding protein APT2 in the target tobacco plant;

[0033] The protein APT2 is as follows b1) or b2):

[0034] b1) A protein consisting of the amino acid sequence shown in SEQ ID No.2 in the sequence listing;

[0035] b2) A protein derived from b1) with the same function, which is obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID No.2 in the sequence listing.

[0036] Fourth aspect, the present invention provides a method for cultivating an antiviral tobacco plant, which is to obtain a transgenic plant with higher antiviral properties than the target tobacco plant by reducing the expression level and / or activity of a nucleic acid molecule encoding protein APT2 in the target tobacco plant; or, reducing the activity of protein APT2 in the target tobacco plant to obtain a transgenic plant with higher antiviral properties than the target tobacco plant;

[0037] The protein APT2 is as follows b1) or b2):

[0038] b1) A protein consisting of the amino acid sequence shown in SEQ ID No.2 in the sequence listing;

[0039] b2) A protein derived from b1) with the same function, which is obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID No.2 in the sequence listing.

[0040] As a preference of the above third aspect and fourth aspect, reducing the expression level and / or activity of the nucleic acid molecule encoding protein APT2 in the target tobacco plant is to knockout the DNA molecule encoding protein APT2 or reduce the expression of the RNA molecule.

[0041] As a preference of the above third aspect and fourth aspect, the virus is tobacco mosaic virus or a virus of a related genus.

[0042] Fifth aspect, the present invention provides a method for changing the sensitivity of a tobacco plant to a virus, including the following steps:

[0043] Reducing the expression level and / or activity of the nucleic acid molecule encoding protein APT2 in the target tobacco plant to obtain a first transgenic plant; or, reducing the activity of protein APT2 in the target tobacco plant to obtain a first transgenic plant; the virus sensitivity of the first transgenic plant is lower than that of the target tobacco plant;

[0044] Increasing the expression level and / or activity of the nucleic acid molecule encoding protein APT2 in the target tobacco plant to obtain a second transgenic plant; or, increasing the activity of protein APT2 in the target tobacco plant to obtain a second transgenic plant; the virus sensitivity of the second transgenic plant is higher than that of the target tobacco plant;

[0045] The protein APT2 is as follows b1) or b2):

[0046] b1) A protein consisting of the amino acid sequence shown in SEQ ID No.2 in the sequence listing;

[0047] b2) A protein derived from b1), which has the amino acid sequence shown in SEQ ID No. 2 in the sequence listing with substitution and / or deletion and / or addition of one or several amino acid residues and has the same function.

[0048] As a preference of the above fifth aspect, reducing the expression level and / or activity of the nucleic acid molecule encoding protein APT2 in the target plant means knocking out the DNA molecule encoding protein APT2 or reducing the expression of the RNA molecule;

[0049] Increasing the expression level and / or activity of the nucleic acid molecule encoding protein APT2 in the target plant means introducing the DNA molecule encoding protein APT2 into the target tobacco plant;

[0050] As a preference of the above fifth aspect, the virus is tobacco mosaic virus or a virus of a related genus.

[0051] It should be noted that in the above second aspect, third aspect, fourth aspect, and fifth aspect, the nucleic acid molecule encoding protein APT2 can also adopt any one of the nucleic acid molecules described in c1) - c4) in the first aspect.

[0052] The present invention provides the application of plant APT2 protein and the nucleic acid encoding APT2 protein in regulating plant height and plant resistance to pathogens. Through the analysis of the height of plant APT2 transgenic lines, the accumulation of callose, the permeability of plasmodesmata, and the sensitivity analysis to tobacco mosaic virus, the present invention finds that knocking down the expression level of APT2 in plants can reduce the plant height, and there is a negative correlation between the expression level of APT2 in plants and the accumulation of callose at the plasmodesmata aperture, a positive correlation with the permeability of plasmodesmata, and a positive correlation with the rate of intercellular movement of tobacco mosaic virus. Compared with wild-type plants, the plants with APT2 knocked out have an increase in the accumulation of callose at the plasmodesmata aperture between cells, a decrease in the permeability of plasmodesmata, and a slowdown in the intercellular movement of the virus. Compared with wild-type plants, the transgenic plants overexpressing APT2 have a decrease in the accumulation of callose at the plasmodesmata aperture between cells, an increase in the permeability of plasmodesmata, and an increase in the intercellular movement of the virus. It can be found that by regulating the expression level of APT2 in plants to regulate plant height and the rate of intercellular movement of tobacco mosaic virus, the APT2 gene can be used for dwarfing cultivation in crop breeding and the prevention and control of plant viruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 Identification of APT2 overexpression and knockout transgenic lines.

[0054] Figure 2 Comparison of the plant heights of APT2 overexpression and knockout transgenic plants.

[0055] Figure 3 Analysis of callose accumulation in plasmodesmata of leaves of APT2 overexpressing and knockout transgenic plants

[0056] Figure 4 Analysis of plasmodesmata permeability in leaves of APT2 overexpressing and knockout transgenic plants

[0057] Figure 5 Analysis of the intercellular movement rate of tobacco mosaic virus in leaves of APT2 overexpressing and knockout transgenic plants Specific implementation manners

[0058] The preferred implementation manners of the present invention will be described in detail below in conjunction with embodiments. It should be understood that the following embodiments are given only for the purpose of illustration and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0059] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following embodiments can all be obtained from commercial channels.

[0060] Example 1 Overexpression and knockout of tobacco APT2 gene

[0061] (1) Extraction of total RNA from plant tissues

[0062] Extract the total RNA of plant tissues by the Trizol method. The specific method is as follows: Take the tissues of tobacco plants, weigh 0.1 g with a balance, add liquid nitrogen to quickly grind the plant tissues into a powder, transfer them to a 2 mL EP tube, add 1 mL of Trizol, and mix them thoroughly with a shaker. Add 200 μL of chloroform to the above solution, shake for 20 - 30 s, and let it stand at room temperature for 10 min. Centrifuge at 4 °C and 12000 rpm for 15 min, transfer about 600 μL of the supernatant to a new centrifuge tube, add 600 μL of chloroform, shake well, and let it stand at room temperature for 10 min. Centrifuge at 4 °C and 12000 rpm for 15 min, and transfer about 500 μL of the supernatant to a new centrifuge tube again, add 500 μL of isopropanol, mix well, and let it stand at room temperature for 30 min. Centrifuge at 4 °C and 12000 rpm for 20 min, discard the supernatant, wash the obtained precipitate with 70% cold ethanol and absolute ethanol successively (4 °C, 12000 rpm, 5 min), dry the precipitate, and add 50 μL of DEPC-H 2 O for dissolution.

[0063] The total RNA of the extracted plant samples was reverse transcribed to obtain cDNA. Using species-specific primers for APT2, such as the specific primer pair for Nicotiana benthamiana APT2: F: 5’-ATGAGCTTCAGTGGCTCTACAGC-3’ and R: 5’TCATGTCCCCCCAAGACTCAAATT-3’, the DNA coding sequence of the NbAPT protein was obtained by PCR amplification, which is the nucleic acid molecule shown in SEQ ID No.1. The specific SEQ ID No.1 sequence is as follows:

[0064] ATGAGCTTCAGTGGCTCTACAGCAGGTTCTGGTAGCAGAACAAGTCAAACATCGTTTGAATTTGGAAGGACTCATGTTGTTTGGCCCAAAGGAAAGCATGAAGCAACTATTGTTTGGCTACATGGTTTAGGTGATAAAGGTTCAAGCTGGTCCCAGCTTTTTGAAAGCCTTCCACTTCCTAATGTCAAATGGATTTGCCCAACTGCTCCTACTCGTCCTGTTGCTGCCTTTGGTGGATTTCCCTGCACTGCTTGGTTTGACGTAGGAGATATTTCAGAAGATGCTCCTGATGATTTGGAAGGCTTAGATTTTTCTGCGGCACATGTTGCAAATCTCTTATCAACAGAGCCAGCTGATGTTAAATTATGTGTTGGAGGATTCAGTATGGGAGCTGCAGCTGCTCTTTATTCGGCCACATGCCATGCATTCAAGCAATATGGTAATGGAAGTCCTTATCCACTGAACCTGAGTGCAGTTGTTGGCCTTAGTGGCTGGCTTCCTTGTTCAAGGACATTAAGGAACCGAATGCAAGGAATGAATGATGCTGGAAGACGTGCAGCATCCTTGCCAATTTTGCTGTGTCATGGCACTGGTGATGATGTTGTGGCATATCAACATGGAGAAAAATCTGCAAGAATTTTAAGCTCATCCGGCTTTCAGAATCTGACCTTTAGGAATTATCAGGGGCTTGGTCACTACACAATTCCTGAAGAGACTGATGAAGTTTGTTGCTGGCTAGCTGCAAATTTGAGTCTTGGGGGGACATGA

[0065] Then, the APT2 coding sequence was recombined into a plant binary expression vector and electrotransformed into Agrobacterium tumefaciens. Subsequently, the wild-type tobacco plants (WT) were genetically transformed through the Agrobacterium-mediated transformation method. After subculture and identification, overexpression lines were obtained. After extracting the overexpression lines, quantitative PCR was performed using the forward primer CAAAGGAAAGCATGAAGCAACTA and the reverse primer AAAGGCAGCAACAGGACGAG to analyze the overexpression level of the APT2 transcript in the APT2 overexpression transgenic lines ( Figure 1 , A). The amino acid sequence of the protein APT2 is shown in SEQ ID No.2 in the sequence listing. The specific SEQ ID No.2 sequence is as follows:

[0066] MSFSGSTAGSGSRTSQTSFEFGRTHVVWPKGKHEATIVWLHGLGDKGSSWSQLFESLPLPNVKWICPTAPTRPVAAFGGFPCTAWFDVGDISEDAPDDLEGLDFSAAHVANLLSTEPADVKLCVGGFSMGAAAALYSATCHAFKQYGNGSPYPLNLSAVVGLSGWLPCSRTLRNRMQGMNDAGRRAASLPILLCHGTGDDVVAYQHGEKSARILSSSGFQNLTFRNYQGLGHYTIPEETDEVCCWLAANLSLGGT

[0067] Finally, two APT2-high expression tobacco lines OE-NbAPT2 (OE-NbAPT2-flag-2 and OE-NbAPT2-flag-9) were selected for seed preservation for downstream biological analysis.

[0068] (2) Editing and knocking out the APT2 gene using the CRISPR-Cas9 technology

[0069] The gene encoding the protein APT2 was edited and knocked out using the CRISPR-Cas9 technology. The gene knockout in this example was performed on the DNA sequence shown in SEQ ID No.3 in the sequence listing. The specific SEQ ID No.3 sequence is as follows:

[0070]

[0071] Search for the target of NbAPT2, TGGAAGGACTCATGTTGTT, on the website http: / / crispr.hzau.edu.cn / CRISPR2 / Figure 1 . B), and edit and knockout the APT2 gene according to this target sequence. Through DNA extraction screening and sequencing verification Figure 1 . B) Screen 2 homozygous mutant tobacco independent lines with APT2 gene knockout (Nbapt2-1, Nbapt2-3).

[0072] As Figure 1 . shown, the above APT2 overexpressing tobacco lines in this example are shown Figure 1 . A) and the identification results of the knockout transgenic tobacco lines Figure 1 . B). Figure 1 . As can be seen in A, in both OE-NbAPT2 lines, compared with the wild-type line, overexpression of APT2 occurred. Figure 1 . As can be seen in B, in the sequencing results after APT2 knockout, the coding sequences of two homologous genes of APT2 in two independent lines both showed mutations with an increase of 1 base, which would lead to a frameshift of the reading frame of the APT2 gene and unable to encode the correct APT2 protein. Next, the APT2 knockout tobacco line (Nbapt2), overexpressing tobacco line (OE-NbAPT2) and wild-type (WT) in this example will be applied to subsequent examples for analysis of related characteristics.

[0073] Example 2 Knockout of the tobacco APT2 gene leads to plant dwarfism

[0074] Compare the APT2 knockout tobacco line (Nbapt2), overexpressing tobacco line (OE-NbAPT2) and wild-type (WT) in Example 1, plant them together in the greenhouse and observe the growth phenotypes. The results are as Figure 2 . shown. The results show that the tobacco transgenic line with APT2 knockout presents a phenotype of significant plant dwarfism. There is no obvious difference in growth height between the overexpressing tobacco transgenic line of APT2 and the control.

[0075] Example 3 Analysis of callose accumulation in plasmodesmata of overexpressing and knockout transgenic lines of the tobacco APT2 gene

[0076] Select tobacco leaves of different transgenic strains at the 5-6 leaf stage with the same size and similar position for callus accumulation analysis experiment. For callus accumulation analysis, 0.05 mg / mL aniline blue fluorescein (Biosupplies) was used to stain the tobacco leaves. Cut leaves with a length and width of 2 cm, soak them in 0.05 mg / mL aniline blue fluorescein solution, vacuum until the leaves sink into the solution and observe that the leaves have been fully infiltrated with aniline blue fluorescein solution. Then prepare the slices for observation and use a laser confocal microscope (fluorescence parameters are excitation: 405 nm, detection: 485 nm) for observation. Use the laser confocal microscope's built-in software LSM880software Zen to analyze the average staining amount of the callus as an indicator of callus accumulation. Figure 3 The results of the analysis of callus accumulation in the leaves of APT2 overexpression, knockout transgenic tobacco strains and wild-type strains in this example show that knockout of APT2 can significantly increase the accumulation of callus at the plasmodesmata in cells, while overexpression reduces the accumulation of callus at the plasmodesmata.

[0077] Example 4 Analysis of Plasmodesmata Permeability in Tobacco APT2 Gene Overexpression and Knockout Transgenic Strains (CFDA Diffusion Efficiency Analysis)

[0078] Select the 5-6 leaf stage transgenic tobacco leaves of different strains with the same size and similar position. Use a microsyringe to draw 1 μl of 1mM CFDA (Sigma-Aldrich) and gently drop it on the front of the leaves of Nicotiana benthamiana. After standing for 10 minutes, rinse the CFDA with clean water. Cut the leaves and make slices to observe the back of the leaves. Use the same parameters as GFP fluorescence (excitation: 488nm, detection: 510nm) to observe and take pictures to record the diffusion area of ​​CFDA dye on the back of the leaves. Finally, use ImageJ software to statistically analyze the diffusion efficiency of CFDA. Figure 4 The results of the analysis of the permeability of the intercellular filaments in the leaves of APT2 overexpression, knockout transgenic tobacco strains and wild-type strains in this example show that knocking out APT2 can significantly inhibit the permeability of cell intercellular filaments, which is manifested by inhibiting the diffusion of CFDA between cells; while overexpression can significantly increase the permeability of cell intercellular filaments, which is manifested by promoting the diffusion of CFDA between cells.

[0079] Example 5 Analysis of the intercellular movement rate of tobacco mosaic virus in leaves of APT2 overexpression and knockout transgenic plants

[0080] Selected APT2 knockout and overexpression transgenic lines and wild-type Nicotiana benthamiana plants at the 5-6 leaf stage with similar sizes were chosen, and tobacco leaves with similar sizes and positions were selected. A virus inoculation experiment was conducted using the TMV-GFP Agrobacterium infectious clone. The TMV-GFP Agrobacterium infectious clone that had been activated by shaking overnight was centrifuged at 8000 rpm for 5 minutes to collect the bacteria. After adjusting the OD of the bacterial solution concentration of the TMV-GFP infectious clone to 1.0 using infiltration buffer, the TMV-GFP infectious clone bacterial solution was further diluted 300-fold with infiltration buffer and then infiltrated into the above-mentioned tobacco leaves. On the 4th day after infiltration inoculation, individual infection sites of TMV-GFP green fluorescence were observed under a hand-held ultraviolet lamp. The size of the intercellular movement area of TMV-GFP on the leaves of different transgenic lines was statistically analyzed using ImageJ software. Figure 5 This was a comparative analysis of the intercellular movement rate of tobacco mosaic virus in the leaves of APT2 overexpressing, knockout transgenic tobacco lines and wild-type tobacco lines in this example. The results showed that knocking out APT2 could significantly inhibit the size of TMV infection sites, indicating more disease resistance; while overexpression could significantly increase the size of TMV infection sites, indicating more susceptibility to disease.

[0081] Combined with the above Figures 2 to 5 It can be found that the level of protein APT2 expression in plants is negatively correlated with the accumulation of callose at the plasmodesmata aperture, positively correlated with plasmodesmata permeability, and positively correlated with the rate of intercellular movement of tobacco mosaic virus. Compared with wild-type plants (WT), plants with APT2 knocked out (Nbapt2) were dwarfed, with increased callose accumulation at the plasmodesmata aperture, reduced plasmodesmata permeability, and slower intercellular movement of the virus. Compared with wild-type plants (WT), transgenic plants overexpressing APT2 (OE-NbAPT2) had reduced callose accumulation at the plasmodesmata aperture, increased plasmodesmata permeability, and increased intercellular movement of the virus. Thus, by reducing the expression level of plant APT2 protein, the plant height can be reduced, which can be used to reduce plant height in breeding. Moreover, in disease-resistant breeding, by regulating the expression level of plant protein APT2 in plants, the susceptibility of plants to pathogens such as tobacco mosaic virus can be regulated.

[0082] Plasmodesmata are the main channels for the movement of viruses between plant cells. By regulating plasmodesmata through APT2, it can be applied to the prevention and control of plant viruses in tobacco. Specifically, the resistance of these target tobacco plants to pathogens can be regulated through the protein APT2 and the coding gene of this protein, and the infection efficiency of plant viruses can be increased or decreased. When it is necessary to improve the virus resistance of tobacco plants in breeding, the expression level or activity of the nucleic acid molecule encoding the protein APT2 in the target tobacco plants can be reduced, or the activity of the protein APT2 in the target tobacco plants can also be reduced. In addition, the nucleic acid molecule encoding the protein APT2 in the present invention can be further used to construct a recombinant vector, expression cassette, transgenic line, transgenic cell line or recombinant bacterium containing this nucleic acid molecule. The specific construction technology belongs to the prior art and will not be elaborated here.

[0083] Although the present invention has been described in detail with general descriptions and specific embodiments above, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

Claims

1. A method for reducing the height of tobacco plants, characterized in that, by reducing the expression level and / or activity of the nucleic acid molecule encoding protein APT2 in the target tobacco plant, a transgenic plant with a plant height lower than that of the target tobacco plant is obtained; the protein APT2 is a protein composed of the amino acid sequence shown in SEQ ID No.2 in the sequence listing.

2. The method according to claim 1, characterized in that: the reduction of the expression level and / or activity of the nucleic acid molecule encoding protein APT2 in the target tobacco plant is to knock out the DNA molecule encoding protein APT2 or reduce the expression of the RNA molecule.

3. A method for cultivating antiviral tobacco plants, characterized in that, by reducing the expression level and / or activity of the nucleic acid molecule encoding protein APT2 in the target tobacco plant, a transgenic plant with higher antiviral activity than that of the target tobacco plant is obtained; or, reducing the activity of protein APT2 in the target tobacco plant, a transgenic plant with higher antiviral activity than that of the target tobacco plant is obtained; the protein APT2 is a protein composed of the amino acid sequence shown in SEQ ID No.2 in the sequence listing; the virus is tobacco mosaic virus.

4. The method according to claim 3, characterized in that: the reduction of the expression level and / or activity of the nucleic acid molecule encoding protein APT2 in the target tobacco plant is to knock out the DNA molecule encoding protein APT2 or reduce the expression of the RNA molecule.

Images