A molecular marker combination and method for predicting the content of linalool, a floral fragrance component in peach fruits

By using the combination of molecular markers of Lin_KASP4, Lin_KASP6 and PTS1-SSR labels in peach germplasm resource screening, the problems of low screening efficiency and long breeding cycle were solved, and efficient prediction of linalool content in peach fruits and targeted improvement of traits were achieved.

CN115786561BActive Publication Date: 2025-06-13SHANGHAI ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210976140.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-15
Publication Date
2025-06-13
Estimated Expiration
2042-08-15

AI Technical Summary

Technical Problem

The prior art problems of low early screening efficiency, poor targeted trait improvement, and long breeding cycle during the peach germplasm resource screening process.

Method used

Using a combination of molecular markers including Lin_KASP4, Lin_KASP6 and PTS1-SSR tags, the early prediction of linalool content in peach fruit was achieved through KASP technology and PCR amplification.

Benefits of technology

It improves the early prediction efficiency of linalool content in peach fruit, shortens the breeding cycle, and improves the targetedness of breeding efficiency and trait improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115786561B_ABST
    Figure CN115786561B_ABST
Patent Text Reader

Abstract

The present invention provides a molecular marker combination and method for predicting the content of linalool, a floral fragrance component in peach fruits, including two KASP markers, Lin_KASP4 and Lin_KASP6, which are significantly correlated with the linalool content in peach fruits, and one functional specific SSR marker located between them, which are located at positions 1,409,919, 1,414,767 on chromosome 4 of the peach genome, and at positions 1,414,653 - 1,414,673 on chromosome 4, respectively. The present invention uses this combination for the rapid identification of the linalool content in peach germplasm resources, and finally determines that when the genotype combination is GG-187 / 187-AA, the linalool content in peach fruits is high, showing a strong rose fragrance. This identification method has low cost, high efficiency, accurate and reliable results, and a short operation cycle, which is of great significance for predicting the linalool content in new variety fruits, and can effectively improve the accuracy and precision of floral fragrance peach breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular genetic breeding, and more particularly to a molecular marker combination and method for predicting the content of linalool, a floral fragrance component in peach fruits. Background Art

[0002] Peach (Prunus persica L. Batsch) is an important stone fruit tree in the genus Prunus of the Rosaceae family. Its fruits have a good taste, rich flavor, and abundant nutrition, and are deeply loved by consumers. China is the origin country of peaches. After more than 4,000 years of cultivation and evolution history, rich variety resources and cultivation types have been formed.

[0003] Aroma is the most direct flavor index to measure the quality of peach fruits. It is composed of multiple compounds and controlled by multiple genes. The research on the genetic regulation of its main compounds has always been a research hotspot and one of the most concerned traits in the breeding process. The research on peach fruit aroma substances mainly focuses on aspects such as the extraction of aroma substances, comparison between varieties, and post-harvest quality regulation. More than 110 volatile substances have been detected in peach fruits. Among them, linalool is the most important floral fragrance component in peach fruits, mainly showing a rose fragrance type, and also plays a decisive role in the sweetness of peaches. It is the main aroma component of white-fleshed nectarines and white-fleshed peaches, and is synthesized from geranylgeranyl diphosphate (GDP) by monoterpene synthase (TPS) in the terpenoid isoprene pathway. As a perennial woody plant, peaches mainly have factors that are not conducive to the development of urban modern agriculture in the breeding and cultivation processes, such as a long breeding cycle, a large land area, and a large amount of labor. Moreover, the genetic transformation system has not been successfully constructed, and trait improvement cannot be carried out through gene editing technology. It takes at least 10 - 15 years to breed a new variety, which greatly limits the breeding process. It is necessary to use modern biotechnology to deeply evaluate peach germplasm resources, specifically mine and locate key genes, develop molecular markers with high accuracy, improve the early screening efficiency and the pertinence of trait improvement, and shorten the breeding cycle.

[0004] With the advent of the post-genomic era, genomic data is becoming increasingly rich. The third-generation molecular marker single nucleotide polymorphism (SNP) has been widely used in the development and application of molecular markers due to its high density, high throughput, and easy automated analysis. Based on SNP genotyping, the Kompetitive allele specific PCR (KASP) technology has advantages such as high throughput, low cost, strong operability, and high visualization degree of molecular detection in the fine mapping of trait genes, molecular assisted breeding, and seed resource identification in the agricultural field, which plays an important role in accelerating the breeding process and improving the efficiency of molecular breeding. Summary of the Invention

[0005] The object of the present invention is to provide a molecular marker combination and method for predicting the content of linalool, a floral fragrance component in peach fruits, so as to solve the problems of low early screening efficiency, poor targeting of trait improvement, and long breeding cycle in the screening process of peach germplasm resources in the prior art.

[0006] To solve the above technical problems, the present invention adopts the following technical solutions:

[0007] According to the first aspect of the present invention, there is provided a molecular marker combination for predicting the content of linalool, a floral fragrance component in peach fruits, including 2 KASP markers significantly related to the linalool content in peach fruits: Lin_KASP4, Lin_KASP6, and 1 SSR marker located between the two KASP markers: PTS1-SSR; wherein, the Lin_KASP4 locus is at the 1,409,919th position on chromosome 4 of the peach genome; the PTS1-SSR marker is an AT repeat sequence and is located at the 1,414,653-1,414,673rd positions on chromosome 4 of the peach genome; the Lin_KASP6 locus is at the 1,414,767th position on chromosome 4 of the peach genome.

[0008] According to the second aspect of the present invention, there is provided a molecular marker primer combination for predicting the content of linalool, a floral fragrance component in peach fruits, including:

[0009] The primer pair for the Lin_KASP4 locus:

[0010] Upstream primer P1: TTTGCTTAGAAGGCCGGGATG,

[0011] Upstream primer P2: TTTGCTTAGAAGGCCGGGATA,

[0012] Downstream primer P3: TCTATCTTAAAGAATTTGGGTTGGGA;

[0013] The primer pair for the Lin_KASP6 locus:

[0014] Upstream primer P4: TGCCATGGGCCACGTATACCATTTG,

[0015] Upstream primer P5: TGCCATGGGCCACGTATACCATTTA,

[0016] Downstream primer P6: GTGGAAAGAACTAGGCTTGACAAAGG;

[0017] Among them, the 5' ends of P1 and P4 are connected with the fluorescent label FAM, and the 5' ends of P2 and P5 are connected with the fluorescent label HEX.

[0018] According to a third aspect of the present invention, a method for predicting the linalool content of floral fragrance components in peach fruits is provided, including the following steps: S1: Extract genomic DNA from peach tissues; S2: Using the genomic DNA as a template, perform PCR amplification on the Lin_KASP4 locus and the Lin_KASP6 locus respectively to obtain PCR amplification products; S3: Perform genotyping on the PCR amplification products to obtain the genotypes of the Lin_KASP4 locus and the Lin_KASP6 locus, and the genotypes of both together with the genotype of the PTS1-SSR marker form the genotype combination of this molecular marker combination, thereby realizing the identification or auxiliary identification of the linalool content in the fruits of the peach variety to be tested.

[0019] The method includes: detecting whether the genotype of the Lin_KASP4 locus in the genome of the peach variety to be tested is AA, AG or GG, and detecting whether the genotype of the Lin_KASP6 locus in the genome of the peach variety to be tested is AA or AG.

[0020] According to a preferred embodiment of the present invention, when the "AA" genotype of Lin_KASP6, the "GG" genotype of Lin_KASP4 and the "187 / 187" genotype of PTS1-SSR jointly form the genotype combination GG-187 / 187-AA, the linalool content of the peach variety to be tested is high.

[0021] According to another preferred embodiment of the present invention, when the "AA" genotype of Lin_KASP6, the "AA" genotype of Lin_KASP4 and the "177 / 177" genotype of PTS1-SSR jointly form the genotype combination AA-177 / 177-AA, the linalool content of the peach variety to be tested is low.

[0022] In the step S2, PCR amplification is performed using the molecular marker primers as described above.

[0023] PCR reaction procedure: Pre-denaturation at 94°C for 15 min; Denaturation at 94°C for 20 s; Annealing and extension at 61 - 55°C for 60 s, 10 cycles (each cycle decreases by 0.6°C); Denaturation at 94°C for 20 s; Annealing and extension at 55°C for 60 s, 26 cycles; Reading at 38°C for 30 s. After the reaction ends, the sample typing situation is judged according to the detected two fluorescence signals, and different fluorescence signals obtain different genotypes.

[0024] The method provided by the present invention can be used for the early prediction of the linalool content in peach fruits, thereby improving the breeding efficiency. Preferably, the method can be used for the breeding of excellent germplasms and new varieties of strong fragrance / floral fragrance peaches.

[0025] According to the fourth aspect of the present invention, there is also provided a kit for predicting the linalool content of floral fragrance components in peach fruits, and the kit includes the molecular marker primers for predicting the linalool content of floral fragrance components in peach fruits as described above.

[0026] In order to make the prediction results more accurate, the inventors initially screened 7 SNP molecular markers from the internationally common peach "RosBREED_Peach_10K 11494376" chip in the peach genome database to design primers. By genotyping 113 peach varieties, finally two SNP molecular markers, Lin-KASP4 and Lin-KASP6, were selected, and the genotyping results were correlated with the linalool content of the peach varieties to be tested. Finally, it was concluded that when the genotype combination of the molecular marker locus was GG-187 / 187-AA, the linalool content of the fruits of this peach variety was relatively high, and when the genotype combination of the molecular marker locus was AA-177 / 177-AA, the linalool content was relatively low.

[0027] It should be understood that the 7 SNP molecular markers screened in the present invention are mainly based on the linalool synthesis genes mined by the applicant and predecessors, and markers are developed from the upstream and downstream of this key gene. The internationally common peach "RosBREED_Peach_10K 11494376" chip selected is developed based on 1500 germplasm resources at home and abroad, with high accuracy and strong universality, and has been used for genome-wide association analysis of multiple traits in peaches and pedigree relationship correction, but it has not been applied in the prediction of aroma substances in different peach varieties, and KASP markers have not been developed yet. At the same time, the present invention mainly uses the LGC high-throughput genotyping detection platform, whose main characteristics are simple operation, high degree of automation in the preparation of the PCR system, full instrument operation, high detection throughput, extremely low cost, with the cost per sample per marker being only 1 yuan, high result accuracy, simple and convenient analysis, high visualization degree. After the experiment is completed, the data analysis software Kraken or KlusterCaller of LGC can be used to obtain clear and intuitive experimental results.

[0028] Peaches belong to perennial woody plants with a long juvenile period and a large land occupation area. It takes at least 10 - 15 years to breed an excellent variety by traditional cross-breeding methods. In recent years, with climate warming, the labor costs for orchard management, picking, etc. have been increasing day by day. By adopting the technical scheme of the present invention, not only can germplasm resources with relatively high linalool content be accurately screened as parents to increase the linalool content of the fruits of hybrid offspring, but also the linalool content of the fruits can be predicted during the juvenile period of seedling raising, and the offspring with relatively low linalool content can be screened out earlier, removed or managed separately, so as to advance the planting plan of hybrid offspring or reduce the land occupation area, and finally improve the breeding efficiency.

[0029] In summary, according to a DNA molecular marker combination for predicting the linalool content of rose fragrance substances in peach fruits provided by the present invention, the combination includes 2 KASPs and 1 SSR. One haplotype is significantly correlated with a high linalool content, and one haplotype is significantly correlated with a low linalool content, belonging to the field of plant molecular breeding. The two KASP markers significantly correlated with the linalool content in peach fruits are Lin_KASP4 and Lin_KASP6, which are located at the 1,409,919th and 1,414,767th bases on chromosome 4 of the peach genome, respectively. One SSR marker is PTS1-SSR, which is located in the middle of the two KASP markers, that is, at the 1,414,653-1,414,673rd bases on chromosome 4 of the peach genome. The present invention uses three molecular markers and their genotype combination information, and applies them to the rapid identification of the linalool content of peach germplasm resources. Finally, when the genotype combination is GG-187 / 187-AA, the linalool content in peach fruits is high, showing a strong rose fragrance. The identification method provided by the present invention has low cost, high efficiency, accurate and reliable results, and a short operation cycle, which has important significance for predicting the linalool of new variety fruits and can effectively improve the accuracy and precision of flower-scented peach breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is a schematic diagram of the linalool content of different genotype combinations. DETAILED DESCRIPTION OF THE INVENTION

[0031] The following further describes the present invention in conjunction with specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and not to limit the scope of the present invention.

[0032] Example 1 Design of candidate molecular markers and primers related to linalool content

[0033] 1.1 Design of candidate molecular markers

[0034] The synthesis of linalool in peach fruits is significantly correlated with the terpene synthase gene PRUPE.030300 located on chromosome 4. The inventor has previously developed a highly polymorphic SSR molecular marker from its intron region, named PTS1-SSR. The PTS1-SSR marker is an AT repeat sequence and is located at positions 1,414,653-1,414,673 on chromosome 4 of the peach genome.

[0035] To make the prediction results more accurate, a total of 7 SNP molecular markers were screened from the international common peach "RosBREED_Peach_10K 11494376" chip (www.rosaceae.org / search / snp / genotype) in the peach genome database. The genomic positions and sequences of the 7 SNP molecular markers are shown in Table 1 below, and the sequences are shown as SEQ ID No. 1-14 respectively.

[0036] Table 1 Genomic positions and sequence information of 7 SNP markers

[0037]

[0038]

[0039] 1.2 Design of candidate molecular primers

[0040] To detect the above 7 SNP molecular markers, the inventors also designed corresponding primer pairs respectively. The primer pairs designed for each SNP molecular marker include: 2 specific forward primers and 1 reverse primer.

[0041] Taking Lin-KASP4 and Lin-KASP6 as examples, Lin-KASP4 consists of 2 forward primers (P1, P2) and 1 reverse universal primer (P3), and Lin-KASP6 consists of 2 specific forward primers (P4, P5) and 1 reverse universal primer (P6). The 5' ends of primers P1 and P4 are linked with the fluorescent label FAM, the 5' ends of primers P2 and P5 are linked with the fluorescent label HEX, and primers P3 and P6 are not linked with fluorescent labels. The primer design and synthesis were carried out by Hangzhou Fuji Biotechnology Co., Ltd. and Sangon Biotech (Shanghai) Co., Ltd. respectively.

[0042] The labeling of other primer pairs is the same as the foregoing, and will not be elaborated here. The primer combination sequence information of the 7 SNP markers is shown in Table 2 below, and the primer combination sequences are shown as SEQ ID No. 15-35 respectively.

[0043] Table 2 Primer sequence information of 7 SNP markers

[0044] Marker Name Forward Primer 1 (Primer_Allele_FAM) Forward Primer 2 (Primer_Allele_HEX) Common Primer (Primer_Common) Lin-KASP2 CTTCAAGTCGATGTCAATGGT CTTCAAGTCGATGTCAATGGC ATCAGAGCACCATTTATTAATTACCTTG Lin-KASP3 CAGTGTCCTGTTTCTCATGCTTAAC CAGTGTCCTGTTTCTCATGCTTAAT ACAATCTCAAGACTTTAGACTCTCTG Lin-KASP4 P1: TTTGCTTAGAAGGCCGGGATG P2: TTTGCTTAGAAGGCCGGGATA P3: TCTATCTTAAAGAATTTGGGTTGGGA Lin-KASP6 P4: TGCCATGGGCCACGTATACCATTTG P5: TGCCATGGGCCACGTATACCATTTA P6: GTGGAAAGAACTAGGCTTGACAAAGG Lin-KASP7 ATTGTTGACAACATCAACACA ATTGTTGACAACATCAACACG TCCCAGAGCCGTAGAATGGTCG Lin-KASP8 CACCAAGCTAGAGTTGTTGGAA CACCAAGCTAGAGTTGTTGGAC AGTGGCCAAACTTTTGTGATGG Lin-KASP9 GACCTTGCTGCTGATTTCATTCGTC GACCTTGCTGCTGATTTCATTCGTA CTACCAGACTACATGAAAATATGC

[0045] Example 2 Selection of representative peach germplasm resources for genomic DNA extraction

[0046] In this example, 113 representative peach varieties were selected. The plant materials included the world-class high-quality cultivated peach ancestor 'Shanghai Honey' peach, which is sweet and juicy, and its excellent backbone descendants, such as traditional local famous peaches 'White Flower Honey', 'Sahuan Hong Flat Peach', 'Ox Hoof-shaped Flat Peach', etc. After measurement, these ancient local resources have a relatively high linalool content.

[0047] Collect young and tender leaves without pests and diseases, extract genomic gDNA using the CTAB method, detect DNA purity using 1.0% agarose gel electrophoresis technology, and detect DNA concentration using Nanodrop for later use.

[0048] Example 3 uses the designed KASP primers to amplify the DNA of different peach varieties.

[0049] Dispense the plant DNA samples extracted in Example 2 onto a 96-well PCR plate, adjust them to a uniform appropriate concentration (10 - 20 ng / μL), and add 2 negative controls (NTC) to each PCR plate. The KASP genotyping reaction solution system is a 1.6 μL system: 0.8 μL of DNA and 0.8 μL of 2x KASP Master mix. Prepare the required mixed solutions separately. Add the KASP genotyping mixed solution to the Array tape membrane containing the DNA template. Use the SNP gene detection platform of IntelliQube to program, and sequentially place the 384 Array tape, DNA sample plate, and KASP genotyping mixed solution into the IntelliQube genotyping detection platform. Operate the machine to execute the program, and automatically perform the process of dispensing the DNA sample diluent and KASP genotyping mixed solution into the 384-well Arraytape and sealing the membrane. The PCR reaction can be carried out in the IntelliQube machine in the SNP genotyping inline (when using a single membrane) mode. This platform has a short operation time and a large throughput, and is very suitable for genotyping of hybrid offspring materials.

[0050] PCR reaction program: Pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s; annealing and extension at 61 - 55°C for 60 s, 10 cycles (each cycle decreases by 0.6°C); denaturation at 94°C for 20 s; annealing and extension at 55°C for 60 s, 26 cycles; reading at 38°C for 30 s. After the reaction, judge the sample genotyping situation according to the two detected fluorescence signals, and different fluorescence signals obtain different genotypes.

[0051] Example 4 performs genotyping on the PCR amplification products to obtain genotyping results.

[0052] Genotyping was performed on the PCR amplification products obtained in Example 3 to obtain the genotyping results, as shown in Table 3 below. Among them, three markers, Lin-KASP2, Lin-KASP3, and Lin-KASP4, formed 3 genotype combinations (CC-CC-AA, TC-CT-GA, and TT-TT-GG). The genotypes of Lin-KASP6, Lin-KASP7, Lin-KASP8, and Lin-KASP9 formed 2 genotype combinations (AA-GG-AA-AA, AG-AG-AC-AC). Originally, 7 pairs of primers were selected around PTS1-SSR. Later, it was found that the three pairs of primers, Lin-KASP2, Lin-KASP3, and Lin-KASP4, were in a significant linkage state, and the information of one pair of primers could represent the information of the three pairs of primers. Finally, the closest genetically linked Lin-KASP4 was selected. The situation of Lin-KASP6, Lin-KASP7, Lin-KASP8, and Lin-KASP9 was the same as that of the above three pairs of primers. Finally, a pair of primers, Lin-KASP6, closest to PTS1-SSR, was selected to represent. The purpose of doing this is to be efficient and convenient and save costs.

[0053] Both of the two markers, Lin_KASP4 and Lin_KASP6, are located on chromosome 4 and are in the same region as the SSR molecular markers developed by the applicant earlier. Specifically, the Lin_KASP4 locus is at position 1409919 on chromosome 4 of the peach genome; the Lin_KASP6 locus is at position 1414767 on chromosome 4 of the peach genome.

[0054] Among them, the linalool contents of different genotype combinations are as Figure 1 shown.

[0055] In summary, according to the obtained genotyping results, the inventors finally selected 1 marker, Lin-KASP4 and Lin-KASP6, and 1 functional SSR from both sides of PTS1-SSR, and performed correlation analysis with the linalool content of the peach varieties to be tested. Genotyping was performed on 113 peach germplasm resources, and finally a total of 16 genotype combinations, G1-G16, were determined. Among them, the linalool content range of the peach variety corresponding to the G16 genotype combination was 84.65-344.95, which was significantly higher than the linalool content corresponding to other genotype combinations in the differential significance analysis; the linalool contents corresponding to genotype combinations G1 and G2 were significantly lower than those of other genotype combinations. The results proved that when the genotype combination of the molecular marker locus was GG-187 / 187-AA, the linalool content of the peach variety fruit was higher, and when the molecular marker genotype combination was AA-177 / 177-AA, the linalool content was lower.

[0056] Genotyping Results of 7 SNP Markers for 113 Peach Cultivars

[0057]

[0058]

[0059]

[0060]

[0061] The above are only the preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various changes can be made to the above embodiments of the present invention. All simple, equivalent changes and modifications made according to the claims and the content of the specification of the present invention application fall within the scope of protection of the claims of the present invention patent. Those not described in detail in the present invention are all conventional technical contents.

Claims

1. A molecular marker combination for predicting the linalool content of floral fragrance components in peach fruits, characterized in that, the molecular marker combination is 2 KASP markers significantly correlated with the linalool content in peach fruits: Lin_KASP4, Lin_KASP6, and 1 SSR marker located in the middle of the two KASP markers: PTS1-SSR; wherein, the Lin_KASP4 locus is at position 1,409,919 on chromosome 4 of the peach genome; the PTS1-SSR marker is an AT repeat sequence located at positions 1,414,653 - 1,414,673 on chromosome 4 of the peach genome; the Lin_KASP6 locus is at position 1,414,767 on chromosome 4 of the peach genome; the specific nucleotide sequence of the said Lin_KASP4 is: ATCTTTCTATCTTAAAGAA TTTGGGTTGGGATGAAGATGATAATGAAGTTGCAAACTCAT[T / C]ATCCCGGCCTTCTAAGCAAATTGATAATCTTTCCACCAAGGTTGGTGAATCCTCTGTAAC; the specific nucleotide sequence of the said Lin_KASP6 is: CAGGTGGTGGAAAGAACTAGGC TTGACAAAGGAGTTGAATTTTGTGAGAGACCAGCCAAT[T / C]AAATGGTATACGTGGCCCATGGCATGCCTCACAGATCCAAGCTTATCAGAGGAAAGGCTT.

2. The molecular marker combination for predicting the linalool content of floral fragrance components in peach fruits according to claim 1, characterized in that, the primer pair for the Lin_KASP4 locus: upstream primer P1: TTTGCTTAGAAGGCCGGGATG, upstream primer P2: TTTGCTTAGAAGGCCGGGATA, downstream primer P3: TCTATCTTAAAGAATTTGGGTTGGGA; the primer pair for the Lin_KASP6 locus: upstream primer P4: TGCCATGGGCCACGTATACCATTTG, upstream primer P5: TGCCATGGGCCACGTATACCATTTA, downstream primer P6: GTGGAAAGAACTAGGCTTGACAAAGG; wherein, the 5' ends of P1 and P4 are linked with the fluorescent label FAM, and the 5' ends of P2 and P5 are linked with the fluorescent label HEX.

3. A method for predicting the linalool content of floral fragrance components in peach fruits by using the molecular marker combination according to claim 1, characterized in that, it includes the following steps: S1: Extract the genomic DNA of peach tissues; S2: Using the said genomic DNA as a template, perform PCR amplification on the Lin_KASP4 locus and the Lin_KASP6 locus respectively to obtain PCR amplification products; S3: Genotype the PCR amplification products to obtain the genotypes of the Lin_KASP4 locus and the Lin_KASP6 locus. Together, these two genotypes and the genotype of the PTS1-SSR marker form the genotype combination of this molecular marker combination, thereby realizing the identification or auxiliary identification of the linalool content in the fruit of the peach variety to be tested.

4. The method according to claim 3, wherein, the method includes: detecting whether the genotype of the Lin_KASP4 locus in the genome of the peach variety to be tested is AA, AG or GG, and detecting whether the genotype of the Lin_KASP6 locus in the genome of the peach variety to be tested is AA or AG.

5. The method according to claim 4, wherein, When the genotype combination GG-187 / 187-AA is formed by the "AA" genotype of Lin_KASP6, the "GG" genotype of Lin_KASP4 and the "187 / 187" genotype of PTS1-SSR, the linalool content in the peach variety to be tested is high.

6. The method according to claim 4, wherein, When the genotype combination AA-177 / 177-AA is formed by the "AA" genotype of Lin_KASP6, the "AA" genotype of Lin_KASP4 and the "177 / 177" genotype of PTS1-SSR, the linalool content in the peach variety to be tested is relatively low.

7. The method according to claim 3, wherein, in the step S2, PCR amplification is carried out using the primer pair in the molecular marker primer combination according to claim 2.

8. The method according to claim 3, wherein, The PCR reaction program includes: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s; annealing and extension at 61 - 55°C for 60 s, for 10 cycles, with a decrease of 0.6°C in each cycle; denaturation at 94°C for 20 s; annealing and extension at 55°C for 60 s, for 26 cycles; reading at 38°C for 30 s.

9. The method according to claim 3, wherein, the method is used for the breeding of excellent germplasms and new varieties of floral-scented peaches.

10. A kit for predicting the linalool content of the floral-scented components in peach fruits, wherein, the kit includes reagents for detecting the molecular marker combination for predicting the linalool content of the floral-scented components in peach fruits according to claim 1.