A Bacillus licheniformis cell for fixing carbon dioxide

Abstract

The present invention discloses a Bacillus licheniformis cell for fixing carbon dioxide, belonging to the field of fermentation engineering. In the present invention, two recombinant strains were constructed by overexpressing phosphoenolpyruvate carboxykinase and acetyl-CoA carboxylase in Bacillus licheniformis respectively. Under anaerobic fermentation conditions, compared with the control strain, the conversion rates of the products lactic acid, 2,3-butanediol, and acetic acid of the recombinant strain overexpressing phosphoenolpyruvate carboxykinase were increased by 19.6%, 34.7%, and 51.1% respectively; the conversion rates of the three products of the recombinant strain overexpressing acetyl-CoA carboxylase were increased by 22.9%, 14.8%, and 75% respectively. The recombinant strains constructed by the present invention have practical significance for reducing carbon dioxide emissions and increasing carbon utilization.

Description

Technical Field

[0001] The present invention relates to a Bacillus licheniformis cell for fixing carbon dioxide, belonging to the field of fermentation engineering. Background Art

[0002] Since the 21st century, with the improvement of people's awareness of environmental protection and sustainable development, mankind has faced two major problems: global warming and resource problems have become increasingly intractable, and these two problems are both closely related to the emission and utilization of carbon dioxide. In recent years, the content of carbon dioxide in the air has been rising sharply, while human activities mainly rely on traditional fossil resources. Therefore, in order to meet the goal of sustainable development, reducing emissions and utilizing carbon dioxide will provide new solutions for global warming and the exhaustion of fossil fuel resources, and also contribute to the goal of carbon peak and carbon neutrality.

[0003] There are a large number of carbon-fixing enzymes in the self-metabolism and carbon-fixing pathways of microorganisms. Most of them are carboxylases, which catalyze the binding of carbon dioxide molecules to organic substrates. In addition to the function of fixing carbon dioxide, carboxylases also play a role in biosynthesis. Of course, an enzyme may also have multiple functions, and these enzymes play an important role in the growth and metabolism of microorganisms.

[0004] Medina et al. expressed Phosphoribulokinase (PRK) and Ribulose 1,5-bisphosphate Carboxylase / Oxygenase (RuBisCo) in Saccharomyces cerevisiae and constructed a CO 2 fixation bypass pathway, which increased the ethanol yield by 10%; Gong et al. introduced two enzymes, PRK and RuBisCo, into Escherichia coli and introduced the CCM carbon concentration mechanism. The developed carbon metabolic flux index MFIh-CO 2 can be used to characterize the amount of carbon dioxide fixed, demonstrating the carbon-fixing function of the recombinant bacteria; Matthew et al. divided the natural carbon-fixing pathway 3-hydroxypropionate bicycle into four modules and introduced them into Escherichia coli. Each module can function, demonstrating the great potential of this carbon-fixing pathway in Escherichia coli. Bacillus licheniformis is an important industrial microorganism, with rich enzyme systems, strong stress resistance, and not easy to be contaminated by bacteria. However, under oxygen-limited conditions, nearly 50% of the carbon source will be released in the form of carbon dioxide during the fermentation of Bacillus licheniformis, which not only causes a large amount of carbon emissions but also seriously wastes raw materials. Therefore, screening carbon-fixing enzymes and establishing a carbon-fixing system in Bacillus licheniformis have high research value and broad application prospects. Summary of the Invention

[0005] The object of the present invention is to provide the construction and application of a recombinant plasmid capable of highly expressing a carbon fixation enzyme gene in Bacillus licheniformis and increasing the utilization of carbon dioxide.

[0006] The present invention provides a recombinant Bacillus licheniformis capable of fixing carbon dioxide, which expresses phosphoenolpyruvate carboxykinase derived from Bacillus subtilis or acetyl-CoA carboxylase derived from Corynebacterium glutamicum.

[0007] In one embodiment, the coding gene of the phosphoenolpyruvate carboxykinase is as shown in SEQ ID NO.2.

[0008] In one embodiment, the coding gene of the acetyl-CoA carboxylase is as shown in SEQ ID NO.3.

[0009] In one embodiment, the expression of the phosphoenolpyruvate carboxykinase or the acetyl-CoA carboxylase is regulated by the P2 promoter.

[0010] In one embodiment, the nucleotide sequence of the P2 promoter is as shown in SEQ ID NO.1.

[0011] In one embodiment, the recombinant bacterium uses the Escherichia coli - Bacillus subtilis shuttle plasmid pHY-PLK300 as an expression vector.

[0012] In one embodiment, the Bacillus licheniformis uses Bacillus licheniformis CICIM B1391 as a host.

[0013] The present invention also provides the application of the recombinant Bacillus licheniformis in carbon dioxide fixation.

[0014] In one embodiment, the carbon dioxide fixation includes but is not limited to converting carbon dioxide into lactic acid, 2,3-butanediol or acetic acid.

[0015] In one embodiment, the application is to culture the recombinant Bacillus licheniformis in an anaerobic environment, so that the recombinant Bacillus licheniformis utilizes carbon dioxide in the environment to convert and generate lactic acid, 2,3-butanediol or acetic acid.

[0016] In one embodiment, the application is to culture the recombinant Bacillus licheniformis in a medium containing glucose and potassium nitrate at 35 - 40 °C in an anaerobic environment for at least 48 h.

[0017] In one embodiment, the medium is a fully synthetic medium, containing: ammonium chloride, potassium dihydrogen phosphate, disodium hydrogen phosphate, magnesium sulfate heptahydrate and trace elements; the trace elements include: calcium chloride, ferrous sulfate heptahydrate, manganese sulfate.

[0018] Beneficial effects: By overexpressing two carboxylases in Bacillus licheniformis respectively in this experiment, the endogenous carboxylation pathway in Bacillus licheniformis was strengthened, and the product conversion rate of the obtained recombinant bacterium was improved. This recombinant bacterium has practical significance for reducing carbon dioxide emissions and increasing carbon utilization. The recombinant bacterium BL 2 -pHY-P2-PCK under anaerobic fermentation conditions in a synthetic medium with 10 g / L glucose increased the conversion rates of three products, namely lactic acid, 2,3-butanediol, and acetic acid, by 19.6%, 34.7%, and 51.1% respectively; the recombinant bacterium BL 2 -pHY-P2-ACC under anaerobic fermentation conditions in a synthetic medium with 10 g / L glucose increased the conversion rates of three products, namely lactic acid, 2,3-butanediol, and acetic acid, by 22.9%, 14.8%, and 75% respectively. Description of the drawings

[0019] Figure 1 : Construction of pHY-P2-PCK and pHY-P2-ACC recombinant plasmids.

[0020] Figure 2 : Verification of pHY-P2-PCK and pHY-P2-ACC recombinant plasmids; M: DL30000, 1: PCK, 2: ACC;

[0021] Figure 3 : Anaerobic fermentation products of Bacillus licheniformis: a-lactic acid, b-2,3-butanediol, c-acetic acid.

[0022] Figure 4 : Sugar consumption and biomass in anaerobic fermentation of Bacillus licheniformis: a-consumption of glucose, b-biomass OD 600 .

[0023] Figure 5 : Product conversion rate and unit cell conversion rate: a-conversion rates of three products, b-unit cell conversion rates of three products. Detailed implementation manners

[0024] Determination of cell biomass: Take cells at different time points, dilute them with 2 mol / L hydrochloric acid, and detect the absorbance value at OD 600 .

[0025] Detection of glucose, lactic acid, 2,3 - butanediol, and acetic acid concentrations: Take 1 ml of cells sampled at different times, centrifuge at 12000 r / min for 10 min, take 500 μl of the supernatant, add 10% trichloroacetic acid to precipitate for 3 h, centrifuge at 12000 r / min for 20 min, and take the supernatant for HPLC determination. Use Dikma CarboPac H+ (300 mm × 8.0 mm, 6 μm) as the chromatographic column, 0.5‰ dilute sulfuric acid solution as the mobile phase, the flow rate is 0.8 mL / min, the column temperature is 50 °C, and a differential refractive index detector is used.

[0026] Culture medium:

[0027] LB medium (g / L): Tryptone 10, Yeast extract 5, NaCl 10.

[0028] Synthetic medium (g / L): Ammonium chloride 5.349, Potassium dihydrogen phosphate 4.0827, Disodium hydrogen phosphate 5.34, Magnesium sulfate heptahydrate 0.197, supplemented with 1 ml of trace elements. Trace elements (mg / L): Calcium chloride 0.727, Ferrous sulfate heptahydrate 1.112, Manganese sulfate 0.169.

[0029] Example 1 Construction of a recombinant expression vector carrying the P2 promoter

[0030] Synthesize the nucleotide sequence of the strong promoter P2 shown in SEQ ID NO.1, with a size of 191 bp.

[0031] Connect the promoter P2 fragment shown in the nucleotide sequence SEQ ID NO.1 to 16 bp after the replication origin Ori of pHY - PLK300 to obtain the pHY - P2 vector containing the strong promoter P2.

[0032] Example 2 Construction of a recombinant expression vector containing carbon fixation enzymes

[0033] Synthesize the coding gene of phosphoenolpyruvate carboxykinase (PCK) from Bacillus subtilis shown in the nucleotide sequence SEQ ID NO.2, with a size of 1584 bp.

[0034] Synthesize the coding gene of acetyl - CoA carboxylase (ACC) from Corynebacterium glutamicum shown in the nucleotide sequence SEQ ID NO.3, with a size of 1776 bp.

[0035] The PCK gene shown in SEQ ID NO.2 was amplified using PCK-F and PCK-R, the ACC gene shown in SEQ ID NO.3 was amplified using ACC-F and ACC-R, and the vector pHY-P2 was amplified by inverse PCR using pHY-F and pHY-R. The fragments shown in SEQ ID NO.2 or SEQ ID NO.3 were respectively ligated to the position 60 bp before the resistance gene Tet after the P2 promoter of the vector pHY-P2, and two expression plasmids pHY-P2-PCK and pHY-P2-ACC were obtained respectively. Subsequently, they were transformed into Escherichia coli JM109, and the recombinant plasmids were extracted.

[0036] Using Phanta DNA polymerase and primers:

[0037] PCK-F: aaaattaattaagaggtgaaggaaaATGAACTCAGTTGATTTGACCGCTG;

[0038] PCK-R: aaaattgatcctttttttataacagTTATACGAGAGGGCCGCCTGC;

[0039] ACC-F: aaaattaattaagaggtgaaggaaaATGAGCGTCGAAACGAGAAAAATCAC;

[0040] ACC-R: aaaattgatcctttttttataacagTTATTTGATTTCCAGAAGGACGACTCCTTTG;

[0041] pHY-F: CTGTTATAAAAAAAGGATCAATTTTGAACTCTCTCCC

[0042] pHY-R: TTTCCTTCACCTCTTAATTAATTTTGGGAGCTC

[0043] (The primer sequences are all in the 5′→3′ direction, and the lowercase letters represent the homologous arm sequences).

[0044] The reaction conditions were: pre-denaturation at 95°C for 5 min, then entering the next cycle: denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C, and the extension time was calculated as 1 min per 1000 bp. 30 cycles; extension at 72°C for 10 min, and incubation at 16°C.

[0045] The PCR products were ligated by homologous recombination. The vector carried the P2 promoter, the resistance genes Tet and Amp, and the carbon fixation enzyme gene PCK or ACC, as Figure 1。The recombinant plasmid was introduced into competent Escherichia coli JM109 and positive transformants were screened under Amp resistance conditions. The successfully constructed recombinant plasmid was verified by colony PCR, as Figure 2 。

[0046] The successfully constructed recombinant plasmid was electrotransformed into Bacillus licheniformis CICIM B1391 according to the method of XIAO F X, LI Y R, ZHANG Y P, WANG H R, ZHANG L, DING Z Y, GU Z H, XU S, SHI G Y. Construction of a novel sugar alcohol-inducible expression system in Bacillus licheniformis[J]. Applied Microbiology and biotechnology, 2020, 104(12):5409-5425., and positive transformants were screened. According to the same electrotransformation method, the pHY-P2 vector constructed in Example 1 was transformed into Bacillus licheniformis CICIM B1391 as a control. Anaerobic fermentation of the recombinant bacteria containing carbon fixation enzymes in Example 3

[0047] The recombinant bacteria successfully constructed in Example 2 were streaked and activated on an LB plate (containing 20 ng / μL tetracycline). After culturing at 37 °C for 16 h, single colonies were picked and inoculated into 15 mL of LB liquid medium (containing 20 ng / μL tetracycline) and cultured at 37 °C and 250 rpm for 16 h. 2 mL was transferred to a synthetic medium (supplemented with glucose at a final concentration of 10 g / L and KNO 3 ) in an anaerobic serum bottle with a liquid loading of 100 mL, so that the OD ,600 after inoculation reached 0.1, and it was statically cultured in an incubator at 37 °C for 48 h. Fermentation culture was carried out according to the fermentation method of the recombinant bacteria, and the carbon fixation ability of the recombinant bacteria was verified using the products lactic acid, 2,3-butanediol, and acetic acid as indicators.

[0048] As Figures 3 to 5 shown. Under anaerobic fermentation conditions, the control strain had a faster glucose consumption rate than the recombinant bacteria. Taking the cells at the stationary phase of 48 h as an example, the recombinant bacteria BL2-pHY-P2-PCK overexpressing phosphoenolpyruvate carboxykinase increased the conversion rates of the three products lactic acid, 2,3-butanediol, and acetic acid by 19.6%, 34.7%, and 51.1% respectively; the recombinant bacteria overexpressing acetyl-CoA carboxylase increased the conversion rates of the three products by 22.9%, 14.8%, and 75% respectively. When considering the cell growth situation, the product conversion rates per unit cell of the two recombinant bacteria also increased to varying degrees compared with the control strain.

[0049] Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Anyone skilled in this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A recombinant Bacillus licheniformis capable of fixing carbon dioxide, characterized in that, using Bacillus licheniformis CICIMB1391 as the host, the expression of phosphoenolpyruvate carboxykinase derived from Bacillus subtilis or acetyl-CoA carboxylase derived from Corynebacterium glutamicum is regulated by the P2 promoter; the nucleotide sequence of the P2 promoter is as shown in SEQ ID NO.1; the coding gene of the phosphoenolpyruvate carboxykinase is as shown in SEQ ID NO.2; the coding gene of the acetyl-CoA carboxylase is as shown in SEQ ID NO.

3.

2. The recombinant Bacillus licheniformis according to claim 1, characterized in that, the recombinant Bacillus licheniformis uses the Escherichia coli-Bacillus subtilis shuttle plasmid pHY300-PLK as the expression vector.

3. Use of the recombinant Bacillus licheniformis according to claim 1 or 2 in fixing carbon dioxide.

4. The use according to claim 3, characterized in that, the fixing of carbon dioxide includes but is not limited to converting carbon dioxide into lactic acid, 2,3-butanediol or acetic acid.

5. The use according to claim 4, characterized in that, the use is to culture the recombinant Bacillus licheniformis in an anaerobic environment, so that the recombinant Bacillus licheniformis utilizes carbon dioxide in the environment to convert and generate lactic acid, 2,3-butanediol or acetic acid.

6. The use according to claim 4 or 5, characterized in that, the recombinant Bacillus licheniformis is cultured in a medium containing glucose and potassium nitrate in an anaerobic environment at 35-40 °C for at least 48 h.

7. The use according to claim 6, characterized in that, the medium is a fully synthetic medium, containing: ammonium chloride, potassium dihydrogen phosphate, disodium hydrogen phosphate, magnesium sulfate heptahydrate and trace elements; the trace elements include: calcium chloride, ferrous sulfate heptahydrate, manganese sulfate.

Images