A genetic element related to adipocyte differentiation and its application in detecting bovine adipocyte differentiation

Abstract

The present invention discloses a genetic element associated with adipocyte differentiation, namely lncRNA420, with a nucleotide sequence as SEQ ID NO. 1. The present invention first discovered that lncRNA420 sequence expression is associated with bovine preadipocyte differentiation. As the degree of preadipocyte differentiation increases, the expression level of lncRNA420 decreases, and lncRNA420 expression is higher in bovine abdominal fat than in subcutaneous fat. By detecting the expression of lncRNA420, the degree of adipocyte differentiation can be identified. Promoting lncRNA420 expression can inhibit adipocyte differentiation, providing a new method for targeting bovine fat development and lipid metabolism.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular genetics, and in particular relates to a method for detecting fat cell differentiation in beef cattle by utilizing the lncRNA420 genetic modification element. Background Art

[0002] Adipocyte differentiation and lipid metabolism are complex biological processes involving the coordinated regulation of multiple genes and transcription factors. Beef quality is influenced by numerous factors, and many meat quality traits are associated with fat deposition. Fat is a crucial substance for the body to store and supply energy, so research on the mechanisms of adipocyte differentiation is crucial for understanding the growth and fat deposition metabolism of beef cattle.

[0003] Long noncoding RNAs (lncRNAs) constitute a class of functional noncoding RNAs. These are transcripts longer than 200 nucleotides and lack protein-coding potential. LncRNAs can be regulated not only at the transcriptional level but also at the post-transcriptional level. Experimental studies have shown that lncRNAs participate in adipocyte growth and development, proliferation, and differentiation, as well as in energy metabolism, thereby influencing pathways related to lipid metabolism and playing a vital role in many other biological processes. However, further research is needed to understand the role of additional lncRNAs and their roles in adipocyte differentiation, fat deposition, and metabolism.

[0004] Intramuscular fat differentiation and deposition are important traits that influence beef quality and are crucial for beef cattle breeding. The biological mechanisms underlying these traits are complex, involving multiple genetic interactions and epigenetic regulation, such as genetic modifiers. Therefore, uncovering the molecular regulatory role of lncRNAs in the metabolic processes of adipocyte differentiation and intramuscular fat deposition in beef cattle is crucial for beef cattle breeding and can provide a technical basis for the discovery of new candidate genes and regulatory elements for meat quality traits. Summary of the Invention

[0005] The present invention first discovered that the expression of lncRNA420 is associated with bovine adipocyte differentiation. The expression levels of lncRNA420 vary in different parts of bovine adipose tissue, and as the degree of differentiation of bovine preadipocytes increases, the expression level of lncRNA420 decreases. By detecting lncRNA420, the degree of adipocyte differentiation in different parts of adipose tissue can be identified. Increasing the expression level of lncRNA420 can inhibit adipocyte differentiation, providing a new method for studying bovine fat deposition and lipid metabolism. This completes the present invention.

[0006] The present invention provides a genetic element related to adipocyte differentiation, characterized in that the genetic element is lncRNA420, and the nucleotide sequence is shown in SEQ ID NO.1.

[0007] Furthermore, a recombinant vector containing the genetic element is provided.

[0008] Also provided are recombinant cells containing the genetic elements.

[0009] The present invention also provides the use of the genetic element in regulating the growth, development, or differentiation of bovine adipocytes. Specifically, the genetic element is incrementally expressed in bovine preadipocytes. More specifically, the copy number of the genetic element is increased in primary bovine preadipocytes by constructing an incremental expression vector to inhibit bovine preadipocyte differentiation and / or lipid metabolism.

[0010] The present invention also provides a reagent for detecting whether bovine adipocytes are differentiated, characterized by detecting the expression level of the genetic element using nucleic acid amplification technology. Specifically, the nucleic acid amplification technology uses the upstream primer sequence of SEQ ID NO. 2 and the downstream primer sequence of SEQ ID NO. 3. This reagent is particularly useful for detecting adipocyte differentiation in beef cattle.

[0011] The present invention also provides a method for detecting whether bovine adipocytes have differentiated, characterized in that the expression level of the genetic element in the bovine adipocytes is detected. If the expression level increases, it indicates that the bovine adipocytes have differentiated into mature adipocytes. Preferably, the detection using the reagent is particularly useful for detecting the differentiation of beef cattle adipocytes. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 is the expression level of lncRNA420 in adipose tissues of different parts.

[0013] Figure 2 The expression of lncRNA420 in bovine preadipocytes and mature adipocytes.

[0014] Figure 3 The Oil Red O method was used to detect the effect of lncRNA420 on bovine preadipocyte differentiation.

[0015] Figure 4 The results are from RT-qPCR detection of expression changes of differentiation-related genes. DETAILED DESCRIPTION

[0016] The present invention is further described by way of examples below, which do not limit the present invention in any way. Without departing from the technical solution of the present invention, any modification or alteration of the present invention that can be easily implemented by a person skilled in the art will fall within the scope of the claims of the present invention.

[0017] Example 1. Acquisition of lncRNA420

[0018] The lncRNA420 involved in the present invention is a candidate lncRNA related to adipocyte differentiation that was screened in the early stage of beef cattle fat whole transcriptome sequencing.

[0019] Samples: Fat tissues from one-month-old beef bulls were collected, wrapped in tin foil, and immediately placed in liquid nitrogen and stored at -80°C.

[0020] Reagents: Trizol total RNA extraction solution was purchased from Tiangen Biochemical Technology Co., Ltd. (Beijing); cDNA first-strand synthesis kit was purchased from Takara (Japan); 2× Taq Master Mix was purchased from Takara (Japan).

[0021] 1) Total RNA extraction

[0022] Remove tissue blocks from a -80°C freezer and grind in liquid nitrogen. Weigh 1 g of the ground powder and add 1 mL of TRIzol. Add 200 μL of pre-chilled chloroform to each EP tube, shake vigorously for 20-30 seconds, incubate at room temperature for 10 minutes, and centrifuge at 4°C (12,000 g for 15 minutes). The liquid after centrifugation will separate into three layers: the upper layer is a colorless, transparent liquid (RNA); the middle layer is a white, flocculent layer (DNA); and the lower layer is a pink, oily liquid (protein). Carefully pipette 450 μL of the supernatant into a new 1.5 mL EP tube. Add an equal volume of pre-chilled isopropanol and gently shake up and down to mix. Let settle at room temperature for 15 minutes, then centrifuge at 4°C (12,000 g for 15 minutes). Discard the supernatant and add 1 mL of pre-chilled 75% ethanol DEPC solution. Mix thoroughly by pipetting, and then centrifuge at 4°C (7,500 g for 5 minutes). In a clean hood, carefully aspirate any remaining liquid, open the lid, and let stand for 2-3 minutes to fully remove any residual solution. The white precipitate is RNA. When the precipitate becomes translucent, add 20-50 μL of DEPC water to the precipitate. Pipet until the precipitate is completely dissolved, then test the RNA quality and concentration. Check the RNA sample's purity by agarose gel electrophoresis, and use a NanoDrop 2000 spectrophotometer to check the RNA sample's concentration, integrity, and presence of genomic DNA or protein contamination. Store the remaining RNA at -80°C.

[0023] 2) Reverse transcription

[0024] The first step was to remove genomic DNA from total RNA. The total volume of 1 μg RNA and genomic DNA removal reagent was 10 μL, and the reaction was carried out at room temperature for 5 minutes. The second step was to reverse transcribe the total RNA into cDNA. The total volume of the above mixture, buffer, and reverse transcriptase was 20 μL. The reaction was carried out at 37°C for 15 minutes, 85°C for 5 seconds, and stored at -20°C.

[0025] 3) PCR amplification

[0026] According to the DNA sequence of lncRNA420 (SEQ ID NO. 1), lncRNA420 amplification primers were designed using Primer 6 software as follows:

[0027] The upstream primer for lncRNA420 is GTGCTTTTGACTTAGGGATTGC; the downstream primer is AACCAGGGCGTTGATAACAG. The reaction system is as follows: 10 μL of cDNA, 0.5 μL of lncRNA420-specific upstream and downstream primers, 4 μL of cDNA, and ddH2O to 20 μL. PCR amplification conditions were: initial denaturation at 95°C for 5 minutes, followed by 40 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 20 seconds. After PCR amplification, the resulting 3862 bp gene fragment was analyzed by agarose gel electrophoresis.

[0028] Example 2: Spatial expression characteristics of lncRNA420

[0029] Samples: Adipose tissue from different parts of one-month-old Holstein bulls was collected, wrapped in tin foil, and immediately placed in liquid nitrogen and stored at -80°C.

[0030] Reagents: Trizol total RNA extraction solution was purchased from Tiangen Biochemical Technology Co., Ltd. (Beijing); cDNA first-strand synthesis kit was purchased from Takara (Japan); and real-time fluorescence quantification kit was purchased from Roche (Germany).

[0031] Based on the DNA sequence of lncRNA420 (SEQ ID NO. 1), lncRNA420 quantitative primers were designed using Primer 6 software as follows:

[0032] Upstream primer of lncRNA420: 5'-GTGCTTTTGACTTAGGGATTGC-3' (SEQ ID NO. 2)

[0033] Downstream primer: 5'-AACCAGGGCGTTGATAACAG-3' (SEQ ID NO. 3)

[0034] β-actin upstream primer: 5'-GCAGGTCATCACCATCGG-3' (SEQ ID NO. 4)

[0035] Downstream primer: 5'-CCGTGTTGGCGTAGAGGT-3' (SEQ ID NO. 5)

[0036] Total RNA was extracted and reverse transcribed from each group of samples according to the method in Example 1, and then fluorescence quantitative PCR was performed.

[0037] The total volume of the fluorescence quantitative PCR reaction was 10 μL, including 5.0 μL of 2× FastStart Universal SYBR Green Master (ROX), 0.2 μL of upstream and downstream primers, 1.0 μL of cDNA, and 3.6 μL of water. The PCR amplification conditions were: 95°C for 5 min; 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 20 s. Each sample was repeated three times, and 2 -ΔΔCT Method analysis results.

[0038] The results are as follows Figure 1 As shown in the data, the expression level of lncRNA420 in bovine abdominal fat is higher than that in subcutaneous fat, indicating that lncRNA420 is related to the difference in fat deposition in different locations. This also proves that lncRNA has spatiotemporal expression specificity and its expression levels in different tissues vary.

[0039] Example 3. Temporal expression characteristics of lncRNA420

[0040] Samples: Primary preadipocytes were isolated from abdominal adipose tissue of one-month-old calves using enzymatic digestion. Preadipocytes were then induced to differentiate, and finally the bovine preadipocytes and differentiated mature adipocytes were collected separately.

[0041] Reagents: Trizol total RNA extraction solution was purchased from Tiangen Biochemical Technology Co., Ltd. (Beijing); cDNA first-strand synthesis kit was purchased from Takara (Japan); real-time fluorescence quantitative kit was purchased from Roche (Germany); DMEM / F12 medium, double antibodies (penicillin and streptomycin), and fetal bovine serum were purchased from Hyclone (USA).

[0042] Total RNA was extracted and reverse transcribed from each group of samples according to the method in Example 1, and fluorescent quantitative PCR was performed according to the method in Example 2.

[0043] The results are as follows Figure 2 As shown in the figure, the expression of lncRNA420 in preadipocytes is significantly higher than that in mature adipocytes, indicating that lncRNA420 is related to the regulation of preadipocyte differentiation. As the differentiation level of preadipocytes increases, the expression level of lncRNA decreases.

[0044] Example 4: Role of lncRNA420 in the Differentiation of Bovine Preadipocytes

[0045] Cells: Bovine preadipocytes

[0046] Reagents: Restriction enzymes MIuⅠ and NotⅠ were purchased from NEB, 4% paraformaldehyde, Oil Red O dye, and Lipofectamine 3000 transfection reagent.

[0047] 1) Verification of the efficiency of lncRNA420 incremental expression vector

[0048] The lncRNA420 fragment was inserted between the MIuI and NotI sites of the pBI-CMV3 plasmid to construct the pBI-CMV3-lncRNA420 incremental expression vector plasmid. Bovine preadipocytes were seeded into 6-well plates and transfected when the cell density reached approximately 70%. A complex was prepared with 150 μL of Opti, 3 μg of plasmid, and 80 μL of Lipofectamine 3000 per well. After standing at room temperature for 15 minutes, the complex was added to the cells. The medium was replaced after 6 hours, and the cells were harvested after 48 hours. Total RNA was extracted and reverse transcribed from each sample according to the method in Example 1. The expression of lncRNA420 was detected by fluorescent quantitative PCR according to the method in Example 2.

[0049] The expression level of lncRNA420 in the pBI-CMV3-lncRNA420 transfection group was significantly higher than that in the control group (P<0.05), and the expression level was about 70 times that of the control group, indicating that the incremental expression vector can significantly improve the expression of lncRNA420.

[0050] 2) Effects of lncRNA420 expression on lipid droplets in bovine preadipocytes

[0051] After seeding cells in a 12-well plate, transfection was performed when the cell density reached approximately 70%. After 48 hours of transfection, the culture medium was removed and the cells were gently rinsed twice with PBS. The cells were then fixed in paraformaldehyde at 37°C for 40 minutes. After fixation, the paraformaldehyde was washed away with PBS. The cells were stained with freshly prepared Oil Red O working solution at room temperature for 60 minutes. After staining, the floating color was washed away with PBS and the cells were stained with hematoxylin for 5 minutes in the dark. The cells were observed under a microscope within 1 hour. The dye in each group was extracted with 60% isopropanol, and the absorbance of each group was measured using a microplate reader.

[0052] The results are as follows Figure 3 As shown, Oil Red O staining results showed that the intracellular lipid droplets in the pBI-CMV3-lncRNA-420 transfection group were small and few in number, while the intracellular lipid droplets in the control group were larger and more numerous. The OD value of each group was measured using a microplate reader. The OD value of the pBI-CMV3-lncRNA-420 transfection group was lower than that of the control group.

[0053] 3) Effect of lncRNA420 upregulation on bovine preadipocyte differentiation

[0054] Bovine preadipocytes were inoculated into 6-well plates and transfected when the cell density reached about 70%. The cells were collected 48 hours later. Total RNA was extracted and reverse transcribed from each group of samples according to the method in Example 1. Fluorescence quantitative PCR was performed according to the method in Example 2 to detect changes in differentiation-related genes DLK1, ATGL, HSL, LPL, Fasn, and PPAR-γ.

[0055] Based on the mRNA sequences of differentiation-related genes DLK1 (NM_174037.2), ATGL (NM_001046005.2), HSL (NM_001080220.1), LPL (NM_001075120.1), Fasn (NM_001012669.1), and PPAR-γ (NM_181024.2) published in the NCBI database, quantitative primers were designed using Primer 6 software as follows:

[0056] Upstream primer of DLK1: 5'-TCTGTGCGGTCTGTTCTTATCTT-3' (SEQ ID NO.6)

[0057] Downstream primer: 5'-AACCAGGGCGTTGATAACAG-3' (SEQ ID NO.7)

[0058] Upstream primer of ATGL: 5'-ATGGTGCCCTACACTCTG-3' (SEQ ID NO.8)

[0059] Downstream primer: 5'-TGTCTGCTCCTTCATCCA-3' (SEQ ID NO.9)

[0060] Upstream primer of HSL: 5'-GGTAATTGCCGACTTCCTA-3' (SEQ ID NO.10)

[0061] Downstream primer: 5'- CGAGATGGTGACTGTGAG -3' (SEQ ID NO.11)

[0062] Upstream primer of LPL: 5'-CCGCAGACAGGATTACAG -3' (SEQ ID NO.12)

[0063] Downstream primer: 5'- ACAGTTAGCCACAGATTCG -3' (SEQ ID NO.13)

[0064] Upstream primer of Fasn: 5'-GTTTGACGCTTCCTTCTTCG -3' (SEQ ID NO.14)

[0065] Downstream primer: 5'- ACAATGGCCTCGTAGGTGAC -3' (SEQ ID NO.15)

[0066] Upstream primer of PPAR-γ: 5'-AAAGCGTCAGGGTTCCACTAT-3' (SEQ ID NO.16)

[0067] Downstream primer: 5'-ATCTCCGCTAACAGCTTCTCCC-3' (SEQ ID NO.17)

[0068] The results are as follows Figure 4 As shown in the figure, when the expression of lncRNA420 in cells increased, the expression level of the preadipocyte marker gene DLK1 increased, and genes related to lipid metabolism and decomposition such as ATGL 、 LPL 、 HSL The expression of genes related to fat synthesis was significantly upregulated. Fasn The expression of lipoprotein kinases related to lipid uptake was downregulated. PPAR-γ The expression level decreased significantly ( P <0.05). These results indicate that lncRNA inhibits cell differentiation by promoting lipid metabolism and decomposition.

Claims

1. A genetic element associated with adipocyte differentiation, characterized in that: The genetic element is lncRNA420, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. A recombinant vector containing the genetic element according to claim 1.

3. A recombinant cell containing the genetic element according to claim 1.

4. Use of the genetic element according to claim 1 in regulating the growth, development or differentiation of bovine adipocytes.

5. The use according to claim 4, characterized in that The adipocyte differentiation-related genetic element according to claim 1 is expressed in bovine preadipocytes.

6. The use according to claim 5, characterized in that The copy number of the adipocyte differentiation-related genetic element is enhanced in primary bovine preadipocytes by constructing an incremental expression vector, so as to inhibit the differentiation of bovine preadipocytes and / or lipid metabolism.

7. A reagent for detecting whether bovine adipocytes are differentiated, characterized in that: The expression level of the adipocyte differentiation-related genetic element as described in claim 1 is detected by nucleic acid amplification technology, and the primers used in the nucleic acid amplification technology are designed based on the adipocyte differentiation-related genetic element as described in claim 1; the upstream primer sequence used in the nucleic acid amplification technology is SEQ ID NO.2, and the downstream primer sequence is SEQ ID NO.

3.

8. A method for detecting whether bovine adipocytes are differentiated, characterized in that: Preadipocytes and mature adipocytes are distinguished by detecting the expression level of the adipocyte differentiation-related genetic element according to claim 1 in bovine adipocytes, wherein the expression in preadipocytes is significantly higher than that in mature adipocytes.

9. The method according to claim 8, wherein The detection is performed by the reagent as claimed in claim 7.

Images