A king cyclic nucleotide-gated cation channel gene, its encoded protein and application

Abstract

The present invention relates to the field of molecular biology, and in particular to a cyclic nucleotide-gated cation channel gene in the desert plant Zygophyllum grandiflorum, its encoded protein and application. The present invention provides the nucleotide sequence and encoded amino acid sequence of the cyclic nucleotide-gated cation channel gene ZxCNGC1;2. In yeast heterologous expression systems and mammalian HEK293T cell heterologous expression systems, the protein can mediate cation transport, which not only provides a theoretical basis for the selection and breeding of new stress-resistant plant varieties, but also provides new gene resources for the cultivation of stress-resistant crops, and has broad application prospects.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a king cyclic nucleotide-gated cation channel gene, its encoded protein and application. Background Art

[0002] Cyclic nucleotide-gated ion channels (CNGCs) are important tetrameric cation channels in plants, playing crucial regulatory roles in plant growth and development, as well as responses to biotic and abiotic stresses. Plant CNGCs are primarily composed of six transmembrane domains (TMs), a P-loop (Pore helix) located between the fifth and sixth transmembrane domains, a calmodulin-binding domain (CaMBD), and a cyclic nucleotide-binding domain (CNBD). CNGCs can be divided into four main groups based on amino acid sequence similarity and function, with the fourth group being divided into two subgroups.

[0003] The succulent xerophyte Zygophyllum xanthoxylum is a dominant species in the desert areas of northwest my country. It has strong drought and salt tolerance. Studies have found that Zygophyllum xanthoxylum can absorb a large amount of Na from the barren desert soil. + and localize it to the vacuole, thereby transferring Na + As an osmotic regulator, it reduces the osmotic potential of cells and maintains their turgor pressure to resist adverse stress. In the early stage, our research group used the king cDNA as a template to clone three CNGCs sequences, namely ZxCNGC1;1, ZxCNGC2;1 and ZxCNGC4. The results showed that ZxCNGC1;1 can not only mediate the divalent cation Ca 2+ Mg 2+ absorption of monovalent cations Na + However, ZxCNGC2;1 and ZxCNGC4 cannot mediate Na + , K + absorption.

[0004] Based on previous studies, the inventors cloned a cyclic nucleotide-gated cation channel gene ZxCNGC1;2 from the king of kings. The protein encoded by this gene is located in the first subfamily of CNGC and has a high homology with the gene ZxCNGC1;1 and the gene AtCNGC1. The gene ZxCNGC1;2 is mainly expressed in the root epidermis and cortical cells, and the encoded protein is localized to the cytoplasmic membrane. Expression pattern analysis showed that under 150mM NaCl treatment, the gene ZxCNGC1;2 in the king of kings roots was upregulated, and the expression level was the highest after 6 hours of treatment, which was about 2.8 times that of the control. Yeast heterologous expression analysis showed that the gene ZxCNGC1;2 can mediate Na +Transport; Rice OsCNGC1 has no Na in yeast heterologous expression system + Transport activity. In the HEK293T cell heterologous expression system, when Na was added to the electroporation buffer, + When the cells transformed with genes ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 were all transformed with genes ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1, the electrical signals were recorded, indicating that the proteins encoded by the three genes all have Na + Transport capacity; Among them, genes ZxCNGC1;2 and ZxCNGC1;1 are + The transport capacity of OsCNGC1 is strong, while that of Na + The transport capacity of the gene OsCNGC1 channel is weak; the channel is only open at an extreme voltage of -180mV, and at a clamping voltage of -180mV, the gene ZxCNGC1; 2 is weak to Na + The permeability of ZxCNGC1;1 to Na + The permeability of ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 is about 4.6 times that of OsCNGC1. 2+ and Mg 2+ Transport activity. Summary of the Invention

[0005] The protection technical solution of the present invention is as follows:

[0006] The primary purpose of the present invention is to provide a Zygotic cyclic nucleotide-gated cation channel gene ZxCNGC1;2, whose nucleotide sequence is shown in SEQ ID NO.1.

[0007] The second object of the present invention is to provide a protein encoded by the cyclic nucleotide-gated cation channel gene ZxCNGC1;2, whose amino acid sequence is shown in SEQ ID NO.2.

[0008] The third object of the present invention is to provide a specific primer pair for amplifying the cyclic nucleotide-gated cation channel gene ZxCNGC1;2, wherein the specific primers include a forward primer F and a reverse primer R; specifically:

[0009] F:ATGAGTTACCATCAAGACAAGGC

[0010] R: CTATTGATCTTCAGCAGTGAAG.

[0011] The fourth object of the present invention is to provide the ZxCNGC1;2 promoter of the Zygophylline cyclic nucleotide-gated cation channel gene, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0012] The fifth object of the present invention is to provide an expression vector containing the ZxCNGC1;2 cyclic nucleotide-gated cation channel gene.

[0013] The sixth object of the present invention is to provide a cell line containing the ZxCNGC1;2 cyclic nucleotide-gated cation channel gene.

[0014] The seventh object of the present invention is to provide a host bacteria containing the ZxCNGC1;2 cyclic nucleotide-gated cation channel gene.

[0015] The eighth object of the present invention is to provide a novel cation channel, which is obtained by expressing the ZxCNGC1;2 cyclic nucleotide-gated cation channel gene. The gene sequence of the ZxCNGC1;2 cyclic nucleotide-gated cation channel gene is shown in SEQ ID No. 1.

[0016] Preferably, the cation channel is capable of transporting Na + , K + 、Li + , Rb + 、Cs + , Ca 2+ Mg 2+ 、Ba 2+ 、Sr 2+ , Pb 2 + 、Cd 2+ One or more of the .

[0017] Preferably, the cation channel is capable of transporting Na + , Ca 2+ and Mg 2+ One or more of the .

[0018] The ninth object of the present invention is to provide the ZxCNGC1;2 overlord cyclic nucleotide gated cation channel gene in different Na + Concentration of Na in transgenic plants + Application of utilization.

[0019] The tenth object of the present invention is to provide the ZxCNGC1;2 overlord cyclic nucleotide gated cation channel gene in different Ca 2+ The transgenic plants Ca 2+ Application of utilization.

[0020] The eleventh object of the present invention is to provide the ZxCNGC1;2 overlord cyclic nucleotide gated cation channel gene in different Mg2+ and Mg2+ medium. 2+Concentration of transgenic plants Mg 2+ Application of utilization.

[0021] The twelfth objective of the present invention is to provide the application of the Zygophylline cyclic nucleotide-gated cation channel gene ZxCNGC1;2 in improving the stress resistance of transgenic plants.

[0022] The thirteenth object of the present invention is to provide a novel cation channel, wherein the cation channel is obtained by expressing the rice cyclic nucleotide-gated cation channel gene OsCNGC1, the nucleotide sequence of the rice cyclic nucleotide-gated cation channel gene OsCNGC1 is shown in SEQ ID No. 6, and the cation channel can transport Na + , Ca 2+ and Mg 2+ One or more of the .

[0023] The fourteenth object of the present invention is to provide an application of the expression of the rice cyclic nucleotide-gated cation channel gene OsCNGC1 in regulating the cation content of transgenic plants. The nucleotide sequence of the rice cyclic nucleotide-gated cation channel gene OsCNGC1 is shown in SEQ ID No.6.

[0024] The beneficial effects of the present invention are:

[0025] (1) The present invention provides the Zygophylline cyclic nucleotide-gated cation channel gene ZxCNGC1;2, and provides the amino acid sequence, specific primers and promoter of the ZxCNGC1;2;

[0026] (2) The ZxCNGC1;2 is mainly expressed in the root epidermis and cortical cells, and the encoded protein is located in the cytoplasmic membrane, which is a new type of cation channel; the new type of cation channel can transport Na + , Ca 2+ Mg 2+ One or more of the following;

[0027] (3) The present invention also provides a novel cation channel, which is obtained by expressing the rice cyclic nucleotide-gated cation channel gene OsCNGC1. The cation channel can transport Na + , Ca 2+ and Mg 2+ One or more of the .

[0028] (4) At -180 mV clamping voltage, ZxCNGC1;2 reacts with Na + The permeability of OsCNGC1 is about 2.4 times that of OsCNGC1. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1Linking and transformation steps of cyclic nucleotide-gated cation channel gene ZxCNGC1;2

[0030] Figure 2 Prediction of the three-dimensional protein structure model of the cyclic nucleotide-gated cation channel gene ZxCNGC1;2

[0031] Figure 3 Cluster analysis of cyclic nucleotide-gated cation channel genes ZxCNGC1;2 and other plant CNGC members

[0032] Figure 4 Relative expression levels of cyclic nucleotide-gated cation channel genes ZxCNGC1;2 in roots, stems, and leaves of Zygophyllum xanthoxylum

[0033] Figure 5 Analysis of the expression pattern of cyclic nucleotide-gated cation channel genes ZxCNGC1;2 in Zygophyllum xanthoxylum

[0034] Figure 6 Subcellular localization of cyclic nucleotide-gated cation channel gene ZxCNGC1;2 in tobacco epidermal cells

[0035] Figure 7 Subcellular Localization of Cyclic Nucleotide-Gated Cation Channel Genes ZxCNGC1;2 in Arabidopsis Protoplasts

[0036] Figure 8 Chemical staining analysis of the expression of the GUS reporter gene driven by the promoter of the cyclic nucleotide-gated cation channel gene ZxCNGC1;2 in Arabidopsis

[0037] Figure 9 Growth of yeast strain G19 transformed with cyclic nucleotide-gated cation channel genes ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 on AP medium

[0038] Figure 10 Growth of yeast strain CY162 transformed with cyclic nucleotide-gated cation channel genes ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 on AP medium

[0039] Figure 11 Yeast strain G19 transformed with cyclic nucleotide-gated cation channel genes ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 was cultured in 50 mM Na + -Growth curve in Ura liquid medium

[0040] Figure 12 The Na accumulated in the yeast strain G19 transformed with the cyclic nucleotide-gated cation channel genes ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 +content

[0041] Figure 13 K accumulation in yeast strain CY162 transformed with cyclic nucleotide-gated cation channel genes ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 + content

[0042] Figure 14 Na expression of cyclic nucleotide-gated cation channel genes ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 in HEK293T cells + Selectivity analysis

[0043] Figure 15 K expression of cyclic nucleotide-gated cation channel genes ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 in HEK293T cells + Selectivity analysis

[0044] Figure 16 Ca2+ expression of cyclic nucleotide-gated cation channel genes ZxCNGC1;2, ZxCNGC1;1, and OsCNGC1 in HEK293T cells 2+ Selectivity analysis

[0045] Figure 17 Mg expression of cyclic nucleotide-gated cation channel genes ZxCNGC1;2, ZxCNGC1;1, and OsCNGC1 in HEK293T cells 2+ Selectivity analysis DETAILED DESCRIPTION

[0046] The present invention is further described below with reference to specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of protection claimed in the present invention.

[0047] Example 1 Cloning of cyclic nucleotide-gated cation channel gene ZxCNGC1;2

[0048] The primer sequences used for PCR amplification of the coding region of the cyclic nucleotide-gated cation channel gene ZxCNGC1;2 are as follows:

[0049] F:ATGAGTTACCATCAAGACAAGGC

[0050] R:CTATTGATCTTCAGCAGTGAAG

[0051] The reaction system of the PCR amplification is as follows:

[0052]

[0053] The reaction conditions of the PCR amplification are as follows:

[0054]

[0055] The ligation transformation steps are as follows Figure 1 shown.

[0056] The ZxCNGC1;2 was cloned through the above steps, and the three-dimensional structure prediction of its encoded protein showed that ZxCNGC1;2 has 6 transmembrane domains and 1 P-ring structure ( Figure 2 Cluster analysis of ZxCNGC1;2 and other plant CNGC members showed that ZxCNGC1;2 was located in the first subfamily and had the highest homology with ZxCNGC1;1 and AtCNGC1 ( Figure 3 The ZxCNGC1;2 nucleotide sequence is shown in SEQ ID No. 1, and the encoded ZxCNGC1;2 amino acid sequence is shown in SEQ ID No. 2.

[0057] Example 2 Analysis of the expression pattern of ZxCNGC1;2

[0058] RT-qPCR specific primers were designed based on the nucleotide sequence of ZxCNGC1;2:

[0059] F:GGTGACCCTGTTGATGAGATGC

[0060] R:ATCCAGAGCCCATGTCAGAAGTT

[0061] ZxActin was used as the internal reference gene. Premix Ex Taq TM RT-qPCR reaction was performed on a StepOnePlus fluorescent quantitative PCR instrument according to the instructions of the II fluorescent dye kit (Takara, Dalian). Each sample was repeated 3 times. -ΔΔCt The relative expression abundance of each gene was calculated.

[0062] RT-qPCR reaction conditions are:

[0063]

[0064] The results showed that ZxCNGC1;2 was highly expressed in roots and relatively low in stems and leaves, regardless of the control or 50 mM NaCl treatment ( Figure 4 ).

[0065] The expression pattern of ZxCNGC1;2 in Zygophyllum rhizome was further analyzed by using 50 and 150 mM NaCl treatment. The results showed that the expression level of ZxCNGC1;2 was significantly different in the two NaCl treatments. +The expression of ZxCNGC1;2 in 150mM NaCl treatment was higher than that in 50mM NaCl treatment. The expression of ZxCNGC1;2 reached the highest level after 6 hours of 150mM NaCl treatment, which was about 2.8 times that of the control ( Figure 5 ).

[0066] Example 3 Subcellular localization of ZxCNGC1;2

[0067] a) Construction of subcellular localization vector

[0068] The plant expression vector PBI121-eGFP plasmid was digested with the restriction endonuclease Xba I. ZxCNGC1;2 was PCR amplified using specific primers containing the Xba I sequence, and the target band was recovered using a gel extraction kit. Subsequently, the PCR amplification product of ZxCNGC1;2 was ligated with the PBI121-eGFP digestion product using In-Fusion ligase to obtain the ZxCNGC1;2 subcellular localization vector PBI121-eGFP-ZxCNGC1;2.

[0069] b) Transformation and transient expression in tobacco

[0070] The subcellular localization vector PBI121-eGFP-ZxCNGC1;2 was transformed into Agrobacterium GV3101, and the cells were collected by centrifugation at 5500 rpm / min for 15 min and then resuspended in a resuspension solution (1 / 2MS solution with 10 mM MgCl2, 10 mM MES, 100 μM AS, pH adjusted to 5.7) to obtain an OD of 0. 600 The concentration of the culture medium was 0.4, and after standing at room temperature for 3 hours, the tobacco epidermal cells were transiently transformed by injection.

[0071] c) Protoplast extraction and transformation

[0072] Arabidopsis protoplasts were extracted according to the instructions of the Biyuntian Plant Protoplast Isolation Kit (C0362S) and transformed using the PEG-mediated method.

[0073] The green eGFP fluorescence signal was observed using a laser confocal microscope (Leica, Germany). Figure 6 and Figure 7 As shown in the figure, in tobacco epidermal cells and Arabidopsis protoplasts, cells transformed with ZxCNGC1;2 can see clear green eGFP fluorescence signals, and this fluorescence signal completely overlaps with the red plasma membrane marker protein (mCherry) fluorescence signal, indicating that ZxCNGC1;2 is localized in the plasma membrane ( Figure 6 and 7 ).

[0074] Example 4 Tissue Localization of ZxCNGC1;2

[0075] The plant expression vector pBIB-Basta-GWR-GUS was digested with restriction endonucleases Sma I and Hind III. The ZxCNGC1;2 promoter was PCR amplified using specific primers containing Sma I and Hind III sequences, and the target band was recovered using a gel extraction kit. Subsequently, the PCR amplification product of the ZxCNGC1;2 promoter was ligated with the digested product of pBIB-Basta-GWR-GUS using In-Fusion ligase to generate the plant expression vector PBIB-proZxCNGC1;2-GUS, which contains the ZxCNGC1;2 promoter driving the GUS reporter gene. Agrobacterium GV3101 was transformed into wild-type Arabidopsis thaliana using the Arabidopsis inflorescence dip method. Homozygous proZxCNGC1;2::GUS-resistant plants were obtained using BASTA selection until the T3 generation and subjected to GUS histochemical staining. The nucleotide sequence of the ZxCNGC1;2 promoter is shown in SEQ ID No. 3.

[0076] Histochemical staining results showed that the ZxCNGC1;2 promoter could drive the expression of the GUS reporter gene in the root mature zone, plumule and hypocotyl ( Figure 8 A and B). Further cross-section observation of the roots revealed that ZxCNGC1;2 was expressed in the epidermal and cortical cells of the root mature zone ( Figure 8 C).

[0077] Example 5 Analysis of ion transport activity of ZxCNGC1; 2, OsCNGC1 in yeast heterologous expression system

[0078] The yeast heterologous expression vector p416 was digested with restriction endonucleases Xba I and Sma I. PCR amplification of ZxCNGC1;2 was performed using specific primers containing restriction site sequences. The target band was recovered using a gel extraction kit. Subsequently, the PCR amplification product of ZxCNGC1;2 was ligated with the p416 digestion product using In-Fusion ligase to obtain the yeast heterologous expression vector p416-ZxCNGC1;2.

[0079] The yeast heterologous expression vector p416-ZxCNGC1;2 was transformed into the sodium ion efflux defective yeast strain G19 and the potassium ion absorption defective yeast strain CY162 using the PEG / LiAc induction transformation method. Positive strains were obtained by screening with -Ura deficiency medium and cultured with shaking overnight in -Ura liquid screening medium. When the bacterial solution OD 600 When it reached 0.5, it was diluted 10, 100 and 1000 times respectively, and then applied to the solution containing different concentrations of Na + , K+ The cells were cultured upside down on AP solid medium and photographed after 2 days.

[0080] ZxCNGC1;1 was cloned from the B. repens by our research group in the early stage, and it has Na + The nucleotide sequence of rice OsCNGC1 is shown in SEQ ID No. 4, and the amino acid sequence is shown in SEQ ID No. 5. The nucleotide sequence of rice OsCNGC1 is shown in SEQ ID No. 6, and the amino acid sequence is shown in SEQ ID No. 7. The treatment method of ZxCNGC1;1 and OsCNGC1 is the same as that of ZxCNGC1;2.

[0081] In Na + The results of the analysis of the sensitive yeast strain G19 showed that the Na + As the concentration increased, the growth of each transformant was inhibited; but at the same Na + At the same concentration, the growth of ZxCNGC1;2 and ZxCNGC1;1 transformants was significantly weaker than that of the empty vector P416, and the growth of ZxCNGC1;1 transformant was even weaker than that of ZxCNGC1;2 ( Figure 9 ). Further analysis of the growth curves of each transformant under 50mM NaCl treatment and the Na + The results showed that the growth of ZxCNGC1;1 and ZxCNGC1;2 transformants was between AtHKT1;1 (AtHKT1;1 can mediate Na + absorption, used as a positive control in this study) and P416, and the growth of ZxCNGC1;2 was better than that of ZxCNGC1;1( Figure 10 ), and at the same time, in the presence of 50 mM Na + -Ura liquid medium, ZxCNGC1; 1 transformant Na + The content is higher than ZxCNGC1;2( Figure 11 ), indicating that the ZxCNGC1;1 transformant had a stronger Na + In addition, the growth of OsCNGC1 transformants and the Na + The contents of OsCNGC1 were similar to those of P416, indicating that OsCNGC1 did not have Na + Transport activity ( Figure 10 and 11 The above results indicate that both ZxCNGC1;2 and ZxCNGC1;1 can mediate Na + transport, and ZxCNGC1;1 to Na + The transport capacity is relatively stronger ( Figure 8 ).

[0082] In K+ Analysis of the yeast strain CY162 with loss of absorption function revealed that at 100 mM K + Under these conditions, all transformants were able to grow normally. + Under these conditions, AtAKT1 transformants (AtAKT1 can mediate K + absorption, used as a positive control in this study) could grow normally, but ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 transformants could not grow normally ( Figure 12 ), and at the same time, in the presence of 5 mM K + In the -Ura liquid medium, the K + There was no significant difference in the content ( Figure 13 ), indicating that ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 do not have K + Transport activity.

[0083] Example 6 Ion Selectivity Analysis of ZxCNGC1; 2, OsCNGC1 in HEK293T Cell Heterologous Expression System

[0084] The yeast heterologous expression vector pCI-neo was digested with restriction endonucleases EcoR I and Xba I. PCR amplification of ZxCNGC1;2 was performed using specific primers containing restriction site sequences, and the target band was recovered using a gel extraction kit. Subsequently, the PCR amplification product of ZxCNGC1;2 was ligated with the pCI-neo digestion product using In-Fusion ligase to obtain the HEK293T cell heterologous expression vector pCI-neo-ZxCNGC1;2.

[0085] The treatment of genes ZxCNGC1;1 and OsCNGC1 was the same as that of ZxCNGC1;2.

[0086] Reference Lipofectamine TM HEK293T cells were transiently transfected in Nunc six-well plates using the 3000 Transfection Reagent Kit (Invitrogen) according to the kit's instructions. Forty-eight hours after transfection, whole-cell currents were recorded under an inverted microscope using a 200B + pClamp8 patch clamp apparatus. The recorded signals were converted to electrical signals, digitized using a 1440A digitizer, and data were acquired and analyzed using pClampex 10.0 software.

[0087] When Na is added to the electrofection buffer +When ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 were transformed, inward currents could be recorded in cells transformed with ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1, indicating that ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 can mediate Na + Among them, OsCNGC1 is only open at an extreme voltage of -180mV, while ZxCNGC1;2 and ZxCNGC1;1 can open at -120mV. This shows that ZxCNGC1;2 and ZxCNGC1;1 channels are easy to open, while the opening of OsCNGC1 channels requires cells to consume more energy to reach an extremely low intracellular voltage, indicating that ZxCNGC1;2 and ZxCNGC1;1 are sensitive to Na + The permeability of ZxCNGC1;2 is about 2.4 times that of OsCNGC1, and the permeability of ZxCNGC1;1 is about 4.6 times that of OsCNGC1 at a clamping voltage of -180mV. Figure 14 ).

[0088] When K is added to the electrofection buffer + When ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 were transformed, no inward current was generated in the cells, indicating that ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 do not have K + Transport activity ( Figure 15 ).

[0089] When Ca is added to the electrofection buffer 2+ or Mg 2+ When ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 were transformed, inward currents could be recorded from cells transformed with ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1, indicating that ZxCNGC1;2, ZxCNGC1;1 and OsCNGC1 all have Ca 2+ or Mg 2+ Transport activity ( Figure 16 and 17 ).

[0090] In summary, (1) the present invention provides the Zygophylline cyclic nucleotide-gated cation channel gene ZxCNGC1;2, and provides the amino acid sequence, specific primers and promoter of the ZxCNGC1;2;

[0091] (2) The ZxCNGC1;2 is mainly expressed in root epidermal and cortical cells, and the encoded protein is localized in the cytoplasmic membrane, which is a new type of cation channel;

[0092] (3) The novel ion channel can transport Na + , Ca 2+ Mg 2+One or more of the following;

[0093] (4) At a clamping voltage of -180 mV, the permeability of ZxCNGC1;2 is approximately 2.4 times that of OsCNGC1.

Claims

1. A king cyclic nucleotide-gated cation channel gene ZxCNGC1;2 , characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. For amplifying the cyclic nucleotide-gated cation channel gene according to claim 1 ZxCNGC1;2 The specific primer pair is characterized in that The specific primers include a forward primer F and a reverse primer R; specifically: F:ATGAGTTACCATCAAGACAAGGC R: CTATTGATCTTCAGCAGTGAAG.

3. The overlord cyclic nucleotide-gated cation channel gene according to claim 1 ZxCNGC1;2 A promoter, characterized in that The nucleotide sequence of the promoter is shown in SEQ ID NO.

3.

4. A method comprising the gene for the overlord cyclic nucleotide-gated cation channel according to claim 1 ZxCNGC1;2 expression vectors, cell lines, and host bacteria.

5. A novel cation channel, characterized in that The cation channel is composed of the cyclic nucleotide-gated cation channel gene of claim 1 ZxCNGC1;2 The expression was obtained, and the nucleotide sequence of the gene was shown as SEQ ID No.

1.

6. The cation channel according to claim 5, wherein The cation channel can transport Na + , Ca 2+ Mg 2+ One or more of the .

7. The overlord cyclic nucleotide-gated cation channel gene according to claim 1 ZxCNGC1;2 In the medium with different Na + , Ca 2+ Mg 2+ Concentration of Na in transgenic plants + , Ca 2+ Mg 2+ Utilization and its growth applications.

Images