A method for promoting the synthesis of cytosine triphosphate

Abstract

The invention discloses a method for promoting the synthesis of cytidine triphosphate, belonging to the field of genetic engineering and microbial engineering. The present invention knocks out the dCTP deaminase gene dcd, the phosphate nucleoside kinase gene ndk, the ribonucleoside triphosphate reductase gene nrdD, the phosphate nucleoside pyrophosphohydrolase gene mazG, and the 5'-CMP diphosphohydrolase gene nudG of Escherichia coli by gene knockout technology, and obtains an Escherichia coli mutant that can accumulate cytidine triphosphate. Further by overexpressing the orotate phosphoribosyltransferase gene pyrE, the yield of CTP is increased, and the CTP level can reach more than 21.9mg / L. This method for promoting the synthesis of cytidine triphosphate and the high-efficiency Escherichia coli strain obtained can be used to realize the industrial production of CTP and its derivatives (such as citicoline, etc.), which is beneficial to reduce its production cost and environmental pollution, and realize green biomanufacturing.

Description

Technical Field

[0001] The invention relates to a method for promoting the synthesis of cytosine triphosphate, and belongs to the fields of genetic engineering and microbial engineering. Background Art

[0002] Cytosine triphosphate (CTP), as a nucleotide derivative, is an important biochemical reagent with a strong membrane permeability. It can promote the anabolism of phospholipids, nucleic acids and proteins in damaged nerve cells, regulate the synthesis and reconstruction of damaged nerve biological membranes, effectively provide energy for nerve cells, and mainly participate in the biosynthesis of RNA and phospholipids in cell metabolism. Clinically, as a cell metabolism activator, it has the functions of strengthening and regulating nerve tissue, improving fat metabolism, preventing and relieving vascular sclerosis, etc. It is suitable for the treatment of autonomic disorders, neurosis, sequelae of brain trauma, impaired consciousness caused by nerve damage, paralysis and secondary epilepsy, hepatitis, senile dementia, fatty liver, high blood cholesterol and other diseases.

[0003] The main methods for synthesizing CTP are chemical synthesis and biosynthesis. The chemical synthesis method mainly uses cytosine monophosphate (CMP) as the raw material and adds two high-energy phosphate bonds to the phosphate end of CMP. The chemical synthesis method has many disadvantages, such as the use of toxic organic chemical reagents and low conversion rate. Zhan Guyu et al. studied the synthesis of CTP from CMP through photosynthetic phosphorylation reaction in spinach chloroplasts. 280g of spinach leaves can catalyze 1g of CMP to synthesize 1.3g of CTP, with a conversion rate of about 85%. After the crude product is purified by ion exchange column, the purity of the product can reach 93.4%, and the yield of CMP is 50.2% (Chemical Reagents, 1996, 18 (5), 296-298). Zhan Guyu et al. used spinach chloroplasts from different sources (open-field frost spinach, 1-5°C open-field spinach, and 10°C greenhouse spinach) to synthesize CMP into CTP through photosynthetic phosphorylation reaction, with a conversion rate of 85%. The synthesized CTP product was obtained by ethanol precipitation, ion exchange chromatography, ethanol crystallization, etc., and the yield of CMP reached 50.2% (Northwest Pharmaceutical Journal, 1997, 4 (12), 81-82). Ruan Wenhui et al. used an enzymatic method to catalyze the conversion of CMP into CTP. The molar fractions of CMP, CDP and CTP in the enzyme conversion solution were 1.3%, 0.8% and 97.9%, respectively (Ion Exchange and Adsorption, 2009, 25 (5): 385-394). However, the above methods still have problems such as high production cost and low conversion rate.

[0004] The market demand for CTP and its derivatives (such as citicoline, etc.) is gradually expanding, and there is a huge demand gap. The efficient, high-production intensity, and low-cost industrial production of CTP has become an urgent problem to be solved. A more efficient CTP synthesis method is of great significance for improving the production intensity of CTP and its derivatives (such as citicoline, etc.) and reducing production costs. Summary of the invention

[0005] The technical problem to be solved by the present invention is that the prior art lacks a method and a recombinant strain capable of synthesizing CTP at low cost and high efficiency.

[0006] The invention provides a recombinant Escherichia coli capable of producing cytosine triphosphate, wherein a dCTP deaminase gene dcd, a nucleoside phosphate kinase gene ndk, a ribonucleoside triphosphate reductase gene nrdD and a nucleoside triphosphate pyrophosphohydrolase gene mazG are knocked out.

[0007] In one embodiment, the recombinant Escherichia coli also has a 5'-CMP diphosphohydrolase gene nudG knocked out.

[0008] In one embodiment, the recombinant Escherichia coli also overexpresses the orotate phosphoribosyltransferase gene pyrE.

[0009] In one embodiment, the Escherichia coli includes but is not limited to MG1655, DH5α, BL21 (DE3), JM109, and HB101.

[0010] In one embodiment, the recombinant Escherichia coli uses MG1655 as a starting strain.

[0011] In one embodiment, the orotate phosphoribosyltransferase gene pyrE is integrated into the ldh gene site on the Escherichia coli genome for integrated expression, or is expressed episomally using plasmids such as pEtac, pET22b, pET28a or pRSFDuet-1.

[0012] In one embodiment, the nucleotide sequence of the dCTP deaminase gene dcd is shown as SEQ ID NO.1, the nucleotide sequence of the nucleoside phosphate kinase gene ndk is shown as SEQ ID NO.3, the nucleotide sequence of the ribonucleoside triphosphate reductase gene nrdD is shown as SEQ ID NO.5, the nucleotide sequence of the nucleoside triphosphate pyrophosphate hydrolase gene mazG is shown as SEQ ID NO.7, the nucleotide sequence of the 5'-CMP diphosphohydrolase gene nudG is shown as SEQ ID NO.9, and the nucleotide sequence of the orotate phosphoribosyltransferase gene pyrE is shown as SEQ ID NO.11.

[0013] The present invention also provides a method for synthesizing CTP using the recombinant bacteria, the method comprising inoculating the recombinant strain into an LB culture medium to obtain a seed solution; transferring the seed solution into a fermentation culture medium, performing fermentation culture at 20-45°C and 50-350rpm, and feeding with dissolved oxygen, performing feeding when the dissolved oxygen is higher than 16-55%, and controlling the pH value to be maintained at 6.5-7.5 using ammonia water.

[0014] In one embodiment, the method comprises inoculating the recombinant strain into LB medium to obtain seed liquid; transferring 10% of the seed liquid into a fermentation medium, and fermenting and culturing at 37°C and 300rpm; and supplementing dissolved oxygen when the dissolved oxygen is higher than 30%, and controlling the pH to be maintained at 7.2 using ammonia water.

[0015] In one embodiment, the culture medium used for fermentation contains glycerol or glucose as the carbon source.

[0016] In one embodiment, the fermentation medium contains: 50 g / L glycerol or 55 g / L glucose, 4.5 mg / L ferric chloride, 2.1 g / L MgSO4, 3.8 mg / L sodium citrate, 97 mg / L calcium chloride, 2.9 g / L disodium hydrogen phosphate, 2.1 g / L sodium dihydrogen phosphate, 19 mg / L zinc chloride, 6 g / L yeast powder, 5 g / L peptone, and 9 mL of trace element solution; wherein the trace element solution contains 21 g / L copper chloride, 28 g / L zinc sulfate, and 22 g / L sodium molybdate.

[0017] In one embodiment, the feed medium contains: 730 g / L glycerol or 826 g / L glucose, 9 g / L peptone, and 11 g / L yeast powder.

[0018] Beneficial effects:

[0019] The invention uses a gene knockout technology to knock out a dCTP deaminase gene dcd on the Escherichia coli genome, cuts off the path of UTP production catalyzed by CTP, and allows CTP to accumulate; uses a gene knockout technology to knock out a nucleoside phosphate kinase gene ndk on the Escherichia coli genome, cuts off the path of CDP production catalyzed by CTP, and allows CTP to accumulate; uses a gene knockout technology to knock out a ribonucleoside triphosphate reductase gene nrdD on the Escherichia coli genome, cuts off the path of dCTP production catalyzed by CTP, and allows CTP to accumulate; uses a gene knockout technology to knock out a nucleoside triphosphate pyrophosphohydrolase gene mazG on the Escherichia coli genome, cuts off the path of CMP production catalyzed by CTP, and allows CTP to accumulate; uses a gene knockout technology to knock out a 5'-CMP diphosphohydrolase gene nudG on the Escherichia coli genome, cuts off the path of CMP production catalyzed by CTP, and allows CTP to accumulate; and over-expresses an orotate phosphoribosyltransferase gene pyrE to promote CTP synthesis.

[0020] The recombinant Escherichia coli provided by the present invention can use glycerol as a substrate to efficiently synthesize CTP, and the CTP content after fermentation for 120 hours can reach 21.9 mg / L, which is convenient for separation and purification and has a simple process. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Ideas for constructing recombinant E. coli;

[0022] Figure 2 This is the PCR verification picture of dcd gene knockout colonies;

[0023] Figure 3 This is the PCR verification picture of ndk gene knockout colonies;

[0024] Figure 4 This is the PCR verification image of the nrdD gene knockout colony;

[0025] Figure 5 This is the PCR verification image of mazG gene knockout colonies;

[0026] Figure 6 Figure 2 is a graph of CTP content in recombinant strains (wherein, CK, control strain; A, E. coli MG1655ΔdcdΔndkΔnrdDΔmazG; B, E. coli MG1655ΔdcdΔndkΔnrdDΔmazGΔnudG; C, E. coli MG1655ΔdcdΔndkΔnrdDΔmazGΔnudG::pyrE);

[0027] Figure 7 This is the PCR verification picture of nudG gene knockout colonies. DETAILED DESCRIPTION

[0028] HPLC detection method for CTP: liquid chromatograph Shimadzu 10A, chromatographic column: INERTSIL ODS-SP 5μm 4.6*250mm, mobile phase: triethylamine phosphate buffer (pH 6.5): methanol (97:3), wavelength: 261nm, flow rate: 1.0mL / min.

[0029] Fermentation medium: glycerol 30 g / L, ferric chloride 8 mg / L, MgSO4 1 g / L, sodium citrate 8 mg / L, calcium chloride 150 mg / L, disodium hydrogen phosphate 3 g / L, sodium dihydrogen phosphate 3.0 g / L, zinc chloride 20 mg / L, yeast powder 6 g / L, peptone 5 g / L, trace element solution 10 mL.

[0030] Trace element solution: copper chloride 21g / L, zinc sulfate 18g / L, sodium molybdate 25g / L.

[0031] Culture medium: glycerol 600g / L, peptone 6g / L, yeast powder 6g / L.

[0032] Example 1: Construction of recombinant Escherichia coli for producing CTP

[0033] (1) Knockout of dCTP deaminase gene dcd

[0034] The dCTP deaminase gene dcd (nucleotide sequence as shown in SEQ ID NO: 1, amino acid sequence of the encoded enzyme as shown in SEQ ID NO: 2) on the genome of Escherichia coli MG1655 was knocked out by gene knockout, and a recombinant strain ( Figure 1 ).

[0035] The specific primers used were: Δdcd-up-FW: AACTCAAATGAACCACGATG; Δdcd-up-RS: GCGCGAAAGGAGAAAATGCCTTCAGGCCCATTGAGGATAC; Δdcd-down-FW: TGTATCCTAATGGGCCTGAAGGCATTTTCTCCTTTCGCGC; Δdcd-down-RS: AGTCTCATCAGTGCGTCATT. The knockout cassette Δdcd( Figure 2). Primers Sg-dcd-FW: GTCCTAGGTATAATACTAGTATTGAAGCCTGGCTTGATGAGTTTTAGAGCTAGAAATAGC; pTarget-dcd-RS: TTTGTGATGCTCGTCAGGGG were used to construct the recombinant plasmid pTarget-Δdcd containing the guide RNA. PCR amplification conditions: pre-denaturation at 98°C for 5 min; denaturation at 95°C for 30 s; annealing at 55°C for 30 s; extension at 72°C (the enzyme extension rate is 1 kb / min, and the specific time is set according to the length of the amplified fragment); set the cycle to 30 times; re-extension at 72°C for 10 min; and finally keep warm at 16°C. PCR amplification system: 5×PS buffer 20μL, dNTP 10μL, upstream / downstream primers (10μmol·L -1 )2μL, template 1μL, enzyme 1μL, water 66μL. The plasmid pCas was transformed into Escherichia coli MG1655, and the recombinant E. coli strain was screened on a resistance plate. pTarget-Δdcd and the knockout box Δdcd were electroporated into the recombinant E. coli strain containing the plasmid pCas, and screened on a resistance plate containing bleomycin and kanamycin. The obtained single colony was verified by colony PCR using primers Δdcd-PCR-FW: GGCGTTTATGTGACTCCTGC and Δdcd-PCR-RS: AGTCTCATCAGTGCGTCATT, and the obtained E. coli MG1655Δdcd was screened. Figure 2 As shown, the bands obtained by PCR were smaller than those of the control strain, indicating that the dCTP deaminase gene dcd had been knocked out. At the same time, the sequence was sent to a sequencing company for sequencing verification.

[0036] (2) Based on the knockout of the dCTP deaminase gene dcd, further knockout of ndk

[0037] Based on the dCTP deaminase gene dcd knockout strain E. coli MG1655Δdcd constructed in step (1), the diphosphate nucleoside kinase gene ndk (nucleotide sequence as shown in SEQ ID NO: 3, amino acid sequence of the encoded enzyme as shown in SEQ ID NO: 4) on the E. coli genome was further knocked out by gene knockout to construct a recombinant strain.

[0038] The specific primers used were: Δndk-up-FW: CCCATGCCCATCATCACTAC; Δndk-up-RS: AACAATTTACAGAGGTAAAATAATTTCGTAAATGCCGCGT; Δndk-down-FW: ACGCGGCATTTACGAAATTATTTTACCTCTGTAAATTGTT; Δndk-down-RS: GCCGCCAACTCTATTACTGC. The knockout cassette Δndk( Figure 3 ). Primers Sg-ndk-FW: GTCCTAGGTATAATACTAGTGAAATAAGCGATTTCGCGAGGTTTTAGAGCTAGAAATAGC; pTarget-RS: TTTGTGATGCTCGTCAGGGG were used to construct the recombinant plasmid pTarget-Δndk containing the guide RNA. PCR amplification conditions: pre-denaturation at 98°C for 5 min; denaturation at 95°C for 30 s; annealing at 55°C for 30 s; extension at 72°C (the enzyme extension rate is 1 kb / min, and the specific time is set according to the length of the amplified fragment); set the cycle to 30 times; re-extension at 72°C for 10 min; and finally keep warm at 16°C. PCR amplification system: 5×PS buffer 20μL, dNTP 10μL, upstream / downstream primers (10μmol·L -1 )2μL, template 1μL, enzyme 1μL, water 66μL. The plasmid pCas was transformed into E.coli MG1655Δdcd, and the recombinant E. coli strain was screened on a resistance plate. pTarget-Δndk and the knockout box Δndk were electroporated into the recombinant E. coli strain containing the plasmid pCas, and screened on a resistance plate containing bleomycin and kanamycin. The obtained single colony was verified by colony PCR using primers Δndk-PCR-FW:CCCTGATTGGCGTTGGATTT and Δndk-PCR-RS:ACGCCCGTTGTTGGTCAGTT, and the obtained E. coli E.coliMG1655ΔdcdΔndk was screened. Figure 3 As shown, the bands obtained by PCR were smaller than those of the control strain, indicating that the nucleoside diphosphate kinase gene ndk had been knocked out. At the same time, the sequence was sent to a sequencing company for sequencing verification.

[0039] (3) Based on the knockout of dCTP deaminase gene dcd and diphosphate nucleoside kinase gene ndk, nrdD was further knocked out.

[0040] Based on the dCTP deaminase gene dcd and diphosphate nucleoside kinase gene ndk knockout strain E.coliMG1655ΔdcdΔndk constructed in step (2), the ribonucleoside triphosphate reductase nrdD (nucleotide sequence as shown in SEQ ID NO:5, amino acid sequence of the encoded enzyme as shown in SEQ ID NO:6) on the E. coli genome was further knocked out by gene knockout to construct a recombinant strain.

[0041] The specific primers used were: ΔnrdD-up-FW: AAGATTTCCGCCACGGTTTC; ΔnrdD-up-RS: CTTAAAAATATGGAGCGATCTCTTCACTCTGAGCTAAGCA; ΔnrdD-down-FW: TGCTTAGCTCAGAGTGAAGAGATCGCTCCATATTTTTAAG; ΔnrdD-down-RS: AACTACGAAGAAGCCTCACC. The knockout cassette ΔnrdD ( Figure 4 ). Primers Sg-nrdD-FW: GTCCTAGGTATAATACTAGTCATTCCCCAAATGTTTAACGGTTTTAGAGCTAGAAATAGC; pTarget-RS: TTTTGATGCTCGTCAGGGG were used to construct the recombinant plasmid pTarget-ΔnrdD containing the guide RNA. PCR amplification conditions: pre-denaturation at 98°C for 5 min; denaturation at 95°C for 30 s; annealing at 55°C for 30 s; extension at 72°C (the enzyme extension rate is 1 kb / min, and the specific time is set according to the length of the amplified fragment); set the cycle to 30 times; re-extend at 72°C for 10 min; and finally keep warm at 16°C. PCR amplification system: 5×PS buffer 20μL, dNTP 10μL, upstream / downstream primers (10μmol·L -1 )2μL, template 1μL, enzyme 1μL, water 66μL. The plasmid pCas was transformed into E.coli MG1655ΔdcdΔndk, and the recombinant E. coli strain was screened on a resistance plate. pTarget-ΔnrdD and the knockout box ΔnrdD were electroporated into the recombinant E. coli strain containing the plasmid pCas, and screened on a resistance plate containing bleomycin and kanamycin. The obtained single colony was verified by colony PCR using primers ΔnrdD-PCR-FW:TCCTCGTTGGTATTCAGTTC and ΔnrdD-PCR-RS:CGATGATTCCTCGGTGTTTT, and the obtained E. coli MG1655ΔdcdΔndkΔnrdD was screened. Figure 4 As shown, the bands obtained by PCR were smaller than those of the control strain, indicating that the nucleoside diphosphate kinase gene nrdD had been knocked out. At the same time, the sequence was sent to a sequencing company for sequencing verification.

[0042] (4) Based on the knockout of dCTP deaminase gene dcd, diphosphate nucleoside kinase gene ndk and ribonucleoside triphosphate reductase nrdD, mazG was further knocked out.

[0043] Based on the dCTP deaminase gene dcd, diphosphate nucleoside kinase gene ndk and ribonucleoside triphosphate reductase nrdD knockout strain E. coli MG1655ΔdcdΔndkΔnrdD constructed in step (3), the nucleoside triphosphate pyrophosphohydrolase gene mazG (nucleotide sequence as shown in SEQ ID NO: 7, amino acid sequence of the encoded enzyme as shown in SEQ ID NO: 8) on the E. coli genome was further knocked out by gene knockout to construct a recombinant strain.

[0044] The specific primers used were: ΔmazG-up-FW: CGACCCGTGGTGAAGTTGTT; ΔmazG-up-RS: GCAATTTTCAGGACAATTCAGGGAATTACGCGGTCAAGCG; ΔmazG-down-FW: CGCTTGACCGCGTAATTCCCTGAATTGTCCTGAAAATTGC; ΔmazG-down-RS: GCGGTTTGAGGAAAGGGTTA. The Escherichia coli genome was used as a template to obtain the knockout frame ΔmazG ( Figure 5 ). Primers Sg-mazG-FW: GTCCTAGGTATAATACTAGTCGATATTCCTCGTAGTTTACGTTTTAGAGCTAGAAATAGC; pTarget-RS: TTTGTGATGCTCGTCAGGGG were used to construct the recombinant plasmid pTarget-ΔmazG containing the guide RNA. PCR amplification conditions: pre-denaturation at 98°C for 5 min; denaturation at 95°C for 30 s; annealing at 55°C for 30 s; extension at 72°C (the enzyme extension rate is 1 kb / min, and the specific time is set according to the length of the amplified fragment); set the cycle to 30 times; re-extend at 72°C for 10 min; and finally keep warm at 16°C. PCR amplification system: 5×PS buffer 20μL, dNTP 10μL, upstream / downstream primers (10μmol·L -1)2μL, template 1μL, enzyme 1μL, water 66μL. The plasmid pCas was transformed into E.coli MG1655ΔdcdΔndkΔnrdD, and the recombinant E. coli strain was screened on a resistance plate. pTarget-ΔmazG and the knockout box ΔmazG were electroporated into the recombinant E. coli strain containing the plasmid pCas, and screened on a resistance plate containing bleomycin and kanamycin. The obtained single colony was verified by colony PCR using primers ΔmazG-PCR-FW:TGATTGCGTTAGTGATGTGC and ΔmazG-PCR-RS:TAGCGACACCAAACAGCAAC, and the obtained E. coli MG1655ΔdcdΔndkΔnrdDΔmazG was screened. Figure 5 As shown, the bands obtained by PCR were smaller than those of the control strain, indicating that the nucleoside triphosphate pyrophosphohydrolase gene mazG had been knocked out. At the same time, the sequence was sent to a sequencing company for sequencing verification.

[0045] The constructed strain E.coli MG1655ΔdcdΔndkΔnrdDΔmazG was inoculated into LB medium containing kanamycin, cultured at 37°C and 200rpm for 8h to obtain seed liquid; the seed liquid was inoculated into the fermentation medium according to 10% inoculation amount, transferred to the fermentation medium containing kanamycin (30L fermenter, initial liquid volume is 13L), fermented and cultured at 37°C and 200rpm, and fed with dissolved oxygen. Feeding was performed when the dissolved oxygen was higher than 30%. Ammonia water was used to control the pH to 7.0. After fermentation for 120h, the bacteria were centrifuged, the supernatant was taken, and the CTP content therein was determined by HPLC. Taking the strain E. coli MG1655 without knockout of dcd, ndk, nrdD, and mazG genes as the control, the CTP content in the fermentation broth of the control strain was almost undetectable; the knockout strain E. coli MG1655ΔdcdΔndkΔnrdDΔmazG could detect 12.1 mg / L of CTP ( Figure 6 ).

[0046] Example 2: Construction of recombinant E. coli for producing CTP

[0047] Based on the knockout of dCTP deaminase gene dcd, diphosphate nucleoside kinase gene ndk, ribonucleoside triphosphate reductase nrdD and triphosphate nucleoside pyrophosphohydrolase gene mazG in Example 1, nudG was further knocked out.

[0048] Based on the strain E. coli MG1655ΔdcdΔndkΔnrdDΔmazG constructed in Example 1, the 5'-CMP diphosphohydrolase gene nudG (nucleotide sequence as shown in SEQ ID NO: 9, amino acid sequence of the encoded enzyme as shown in SEQ ID NO: 10) on the E. coli genome was further knocked out by gene knockout to construct a recombinant strain.

[0049] Specifically, the primers: ΔnudG-up-FW: GCCGGTGGTAAAGTCGA; ΔnudG-up-RS: AGTCGGGTACGTGCCAGGCATGACAGTTCTTCGCGTAACT; ΔnudG-down-FW: AGTTACGCGAAGAACTGTCATGCCTGGCACGTACCCGACT; ΔnudG-down-RS: GATATTGCAG CGCCTCTTCA were used as templates to obtain the knockout cassette ΔnudG for knocking out the 5'-CMP diphosphohydrolase gene nudG by fusion PCR technology. The primers Sg-nudG-FW: GTCCTAGGTATAATACTAGTCGCCCAGAGCGATCAGGCGGGTTTTAGAGCTAGAAATAGC; pTarget-RS: TTTGTGATGCTCGTCAGGGG were used to construct the recombinant plasmid pTarget-ΔnudG containing the guide RNA. PCR amplification conditions: pre-denaturation at 98°C for 5 min; denaturation at 95°C for 30 s; annealing at 55°C for 30 s; extension at 72°C (enzyme extension rate is 1 kb / min, the specific time is set according to the length of the amplified fragment); set the cycle to 30 times; re-extension at 72°C for 10 min; and finally insulation at 16°C. PCR amplification system: 5×PS buffer 20 μL, dNTP 10 μL, upstream / downstream primers (10 μmol·L -1 )2μL, template 1μL, enzyme 1μL, water 66μL. The plasmid pCas was transformed into E.coli MG1655ΔdcdΔndkΔnrdDΔmazG, and the recombinant E. coli strain was screened on a resistance plate. pTarget-ΔnudG and the knockout box ΔnudG were electroporated into the recombinant E. coli strain containing the plasmid pCas, and screened on a resistance plate containing bleomycin and kanamycin. The obtained single colony was verified by colony PCR using primers ΔnudG-PCR-FW: ATGAAAATGATTGAAGTTGT and ΔnudG-PCR-RS: CTAATCCGCTGGTCTGGCGG, and the obtained E. coli E.coli MG1655ΔdcdΔndkΔnrdDΔmazGΔnudG was screened.

[0050] like Figure 7 As shown, the bands obtained by PCR are smaller than those of the control strain, indicating that the 5'-CMP diphosphohydrolase gene nudG has been knocked out. At the same time, the sequence was sent to a sequencing company for sequencing verification. The recombinant E. coli strain E. coli MG1655ΔdcdΔndkΔnrdDΔmazGΔnudG obtained by construction was fermented according to the fermentation method of Example 1. After the fermentation was completed, the bacteria were centrifuged, the supernatant was taken, and the CTP content therein was determined. The results showed that the CTP content in the fermentation broth after fermentation for 120 hours was 15.6 mg / L ( Figure 6 ).

[0051] Example 3: Construction of recombinant E. coli strain E. coli MG1655ΔdcdΔndkΔnrdDΔmazGΔnudG::pyrE

[0052] The Escherichia coli genome was used as a template for PCR amplification, and the pyrE gene (SEQ ID NO: 1) was constructed using primers pyrE-up-FW: AATCCAGGTATTTCCTCACG, pyrE-up-RS: GTGCAGTCGATAAGCTCCGGGCAGACGCGTACAAGCAC, pyrE-mid-FW: AAGTGCTTGTACGCGTCTGCCCGGAGCTTATCGACTGCAC, pyrE-mid-RS: TATCAACACAACAGGTGATTATCCGGATATAGTTCCTCCT, and pyrE-down-FW: AGGAGGAACTATATCCGGATAATCACCTGTTGT, pyrE-down-RS: TTACGGAACAGTGGTTATGC NO.11) integration frame; primers pyrE-up-FW, pyrE-up-RS and pyrE-down-FW, pyrE-down-RS were used to construct the pyrE gene homology arms; primers pyrE-mid-FW, pyrE-mid-RS were used to construct the pyrE gene integration expression cassette. PCR amplification conditions: pre-denaturation 98℃, 5min; denaturation 95℃, 30s; annealing 55℃, 30s; extension 72℃, 1min; set the cycle 29 times; re-extension 72℃, 10min; finally keep warm at 16℃. PCR amplification system: 5×PS buffer 20μL, dNTP 10μL, upstream / downstream primers (10μmol·L -1)2μL, template 1μL, enzyme 1μL, water 66μL. The constructed pyrE gene integration frame was transformed into the Escherichia coli E.coli MG1655ΔdcdΔndkΔnrdDΔmazGΔnudG constructed in Example 2, and the positive clones were screened on LB plates, and sequenced to verify the correctness. The recombinant Escherichia coli strain E.coli MG1655ΔdcdΔndkΔnrdDΔmazGΔnudG::pyrE was named and fermented to produce CTP according to the method of Example 1. After the fermentation was completed, the bacteria were centrifuged, the supernatant was taken, and the CTP content therein was determined. The results showed that the CTP content in the supernatant after fermentation for 120h was 21.9mg / L ( Figure 6 ).

[0053] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant Escherichia coli capable of producing cytosine triphosphate, characterized in that: Knockout of dCTP deaminase gene dcd, Nucleoside Phosphate Kinase Gene ndk, Ribonucleoside triphosphate reductase gene nD , nucleoside triphosphate pyrophosphohydrolase gene gG and 5'-CMP diphosphohydrolase gene nudG ; The recombinant Escherichia coli also overexpresses the orotate phosphoribosyltransferase gene pyrE ; The dCTP deaminase gene dcd The nucleotide sequence of the gene is shown in SEQ ID NO.

1. ndk The nucleotide sequence is shown in SEQ ID NO.3, and the ribonucleoside triphosphate reductase gene nD The nucleotide sequence is shown in SEQ ID NO.5, and the nucleoside triphosphate pyrophosphohydrolase gene gG The nucleotide sequence of the 5'-CMP diphosphohydrolase gene is shown in SEQ ID NO.

7. nudG The nucleotide sequence is shown in SEQ ID NO.9, and the orotate phosphoribosyltransferase gene pyrE The nucleotide sequence is shown in SEQ ID NO.11; the orotate phosphoribosyltransferase gene pyrE Integrated into the E. coli genome ldh Gene loci for integration and expression.

2. The recombinant Escherichia coli according to claim 1, characterized in that The Escherichia coli include but are not limited to MG1655, DH5α, BL21 (DE3), JM109, and HB101.

3. A method for producing cytosine triphosphate by fermentation, characterized in that: The recombinant Escherichia coli according to claim 1 or 2 is fermented in a culture medium with glucose or glycerol as a carbon source at 20-45°C and 50-350 rpm; dissolved oxygen feeding is also associated during the fermentation process; feeding is performed when the dissolved oxygen is higher than 16%, and ammonia water is used to control the pH to be maintained at 6.5-7.

5.

4. The method according to claim 3, characterized in that The method comprises culturing the recombinant Escherichia coli according to claim 1 or 2 in LB medium to obtain seed liquid; and transferring the seed liquid to a fermentation medium.

5. Use of the recombinant Escherichia coli according to claim 1 or 2, or the method according to claim 3 or 4 in the production of products containing cytosine triphosphate in the medical field.

Images