Baeyer-villiger monooxygenases, mutants and use thereof for the preparation of chiral butyrolactones

By screening and modifying Baeyer-Villiger monooxygenase from Acinetobacter radiata, the problems of low substrate loading and low space-time yield in the existing technology have been solved. This has enabled the efficient catalytic asymmetric oxidation of prochiral 3-substituted cyclobutanone compounds, producing high-optical-purity 3-substituted chiral butyrolactone, which has good prospects for industrial application.

CN115960750BActive Publication Date: 2025-11-18EAST CHINA UNIV OF SCI & TECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211039656.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-29
Publication Date
2025-11-18
Estimated Expiration
2042-08-29

AI Technical Summary

Technical Problem

The existing Baeyer-Villiger monooxygenase-catalyzed 3-substituted cyclobutanone reaction suffers from low substrate loading, low space-time yield, insufficient product optical purity, and low stereoselectivity, making it difficult to meet industrial requirements.

Method used

Baeyer-Villiger monooxygenases were screened and optimized from Acinetobacter radioresistens, and highly efficient catalysts were obtained through site-directed mutagenesis. Combined with a formate dehydrogenase coenzyme regeneration system, they catalyze the asymmetric oxidation of prochiral 3-substituted cyclobutanone compounds under high substrate concentration conditions.

Benefits of technology

It achieves efficient conversion of high-concentration substrates, produces products with high optical purity, and significantly improves space-time yield, making it suitable for industrial production of optically pure 3-substituted chiral butyrolactone.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure QLYQS_1
    Figure QLYQS_1
  • Figure BDA0003819649980000071
    Figure BDA0003819649980000071
  • Figure BDA0003819649980000111
    Figure BDA0003819649980000111
Patent Text Reader

Abstract

The application discloses a kind of Baeyer-Villiger monooxygenase and its mutant in synthesis optical pure 3-substituted chiral butyrolactone Application, the application with the Baeyer-Villiger monooxygenase ArBVMO of Acinetobacter radioresistens (CGMCC No.25186) source of resistance to radiation Acinetobacter (Acinetobacter radioresistens) and its mutant as biocatalyst, can catalyze the asymmetric oxidation of series latent chiral 3-substituted cyclobutanone, preparation corresponding optical pure chiral butyrolactone.Compared with prior art, the application has the advantages of high enzyme reaction substrate concentration, mild reaction condition, environment-friendly, high space-time yield, high product optical purity, and has good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, and in particular relates to a Baeyer-Villiger monooxygenase derived from Acinetobacter radioresistens and its mutants, a recombinant expression vector containing the oxygenase gene and a recombinant expression transformant, and the application of the recombinant Baeyer-Villiger monooxygenase in catalyzing the asymmetric oxidation of prochiral 3-substituted cyclobutanone compounds to generate corresponding 3-substituted chiral butyrolactone compounds. Background Technology

[0002] Optically pure 3-substituted butyrolactones have a wide range of applications. They serve not only as precursors for polymer materials but also as key building blocks in the synthesis of many clinically used drugs, including the anticonvulsant (R)-Baclofen, the antiepileptic drug Brivaracetam, and the drug Pilocarpine for treating primary glaucoma. Furthermore, various 3-aryl-substituted butyrolactones are important chiral building blocks and active centers for the synthesis of lignans, a natural product. These compounds often possess anticancer, antitumor, and anti-inflammatory properties. Approved drugs include Podofilox for treating genital warts, Etoposide for treating lung cancer and leukemia, and Teniposide for treating lymphocytic leukemia. Many other structural analogs and derivatives are also considered excellent lead compounds for future drug discovery. Moreover, chiral 3-substituted butyrolactones can be further derivatized to synthesize chiral lactams, chiral isoprene, etc., and can be used in the synthesis of other important compounds, including the commercial fragrance Rosaphen, the side chain of Zaragozic acid C, and the side chain of vitamin E. These findings demonstrate the important role and wide application of 3-substituted chiral butyrolactones as chiral building blocks, highlighting their significant research value and potential commercial worth.

[0003] The asymmetric Baeyer-Villger oxidation process is currently the most efficient and direct method for synthesizing 3-substituted chiral butyrolactones. The chemically asymmetric Baeyer-Villger oxidation process can be divided into transition metal catalytic systems and organic molecular catalytic systems, depending on the type of catalyst. Compared to the traditional use of peroxyacids as oxidants, H₂O₂ and its derivatives, as well as O₂, are currently mainly used as green oxidants. Even so, chemical catalysis still suffers from insufficient stereoselectivity, stringent reaction conditions, and the need for expensive and complex chiral reagents.

[0004] Baeyer-Villiger monooxygenase-mediated enzymatic asymmetric oxidation has become one of the most promising alternatives due to its higher stereoselectivity, milder and greener reaction system, and the absence of the need for additional chiral reagents. European Patent EP1516046A2 and US Patent US2003124695A1 disclose a series of Baeyer-Villiger monooxygenases from different sources. Fraaije, Mihovilovic, and others have used these enzymes as catalytic platforms to study their asymmetric oxidation reactions of various 3-alkyl-substituted and 3-aryl-substituted cyclobutanones. However, in a 250 mL reaction system, the substrate concentrations for 3-alkyl-substituted (4.72-5.48 mM) and 3-aryl-substituted (1.04-3 mM) substrates were both low, and the highest space-time yield was only 1 g L. - 1 day -1 The results showed that the product optical purity was insufficient. To address these issues, Collado et al., in collaboration with Codexis, developed a series of BVMO mutants and coupled them with glucose dehydrogenase (GDH) for coenzyme regeneration. These mutants catalyzed various 3-substituted cyclobutanone substrates, generating two enantiomeric lactone products. In particular, they overcame the stereoselectivity loss associated with asymmetric aryl-substituted cyclobutanone oxidation. However, they still failed to solve the problems of low substrate loading (maximum only 10 mM) and low space-time yield (maximum only 2.25 g·L⁻¹). -1 ·day -1 This addresses the issues of low stereoselectivity. Chinese patent CN114480315A discloses a Baeyer-Villiger monooxygenase and its mutant catalyzing the production of (R)-3-propylbutyrolactone, an intermediate in the antiepileptic drug brivacertan. The product has an ee > 99%, and the highest substrate concentration of 3-propylcyclobutanone is 120 mM. This is currently the only reported example of good catalysis for the production of 3-substituted butyrolactones, but its limitation lies in the low substrate concentration and the fact that it only catalyzes a short-chain alkyl-substituted cyclobutanone.

[0005] In summary, enzymatic asymmetric oxidation synthesis of chiral butyrolactones offers numerous advantages over chemical catalysis. However, known Baeyer-Villiger monooxygenase (BVMO)-mediated catalytic reactions typically suffer from low substrate loading, particularly for aryl-substituted cyclobutanones, low space-time yields, insufficient product optical purity, and a lack of stereoselectivity and complementarity. Therefore, there is a need to develop more efficient and broad-spectrum enzyme catalysts to meet the industrial demands for high catalytic efficiency, high substrate concentration, simple operation, and high production efficiency. Summary of the Invention

[0006] The purpose of this invention is to address the shortcomings of the existing Baeyer-Villiger monooxygenase in catalyzing the reaction of 3-substituted cyclobutanone, and to provide a Baeyer-Villiger monooxygenase, a mutant, and its application in the preparation of chiral butyrolactone, that is, to prepare optically pure 3-substituted chiral butyrolactone with a high space-time yield by optimizing the reaction system.

[0007] The objective of this invention can be achieved through the following technical solutions:

[0008] One of the technical solutions of this invention is:

[0009] This invention provides a strain of Acinetobacter radioresistens, which was deposited on June 27, 2022 at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 25186.

[0010] Using 3-propylcyclobutanone as the sole carbon source, Baeyer-Villiger monooxygenase activity was screened for soil microorganisms. A strain of Acinetobacter radioresistens, namely the above-mentioned accession number CGMCC No.25186, was isolated from soil samples on the campus of East China University of Science and Technology in Shanghai.

[0011] The radiation-resistant Acinetobacter CGMCC No. 25186 has the following characteristics:

[0012] The radiation-resistant Acinetobacter is a Gram-negative bacterium belonging to the genus Acinetobacter, measuring 1.0-1.5 μm in width and 1.5-2.5 μm in length. On solid culture media, they become more spherical, appearing in pairs or small clusters to form smooth, pale, moist colonies with regular edges.

[0013] The radiation-resistant Acinetobacter expressed BaeyerVilliger monooxygenase with the amino acid sequence shown in SEQ ID No. 2. The nucleotide sequence of BaeyerVilliger monooxygenase is shown in SEQ ID No. 1.

[0014] The second technical solution of the present invention is:

[0015] This invention provides a Baeyer Villiger monooxygenase, which is a protein of the following (a) or (b):

[0016] (a) A protein consisting of the amino acid sequence shown in SEQ ID No. 2;

[0017] (b) A protein derived from (a) having one or more amino acids substituted, deleted or added in the amino acid sequence shown in SEQ ID No. 2 and having Baeyer-Villiger monooxygenase activity.

[0018] Further, (b) the protein is a protein composed of a new amino acid sequence formed by replacing one or more amino acids at positions 141, 187, 247, 293, and 390 of the amino acid sequence shown in SEQ ID No. 2.

[0019] More preferably, (b) the protein is:

[0020] (1) A protein consisting of a new amino acid sequence formed by replacing the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No. 2 with a tyrosine residue;

[0021] (2) A protein consisting of a new amino acid sequence formed by replacing the leucine residue at position 247 of the amino acid sequence shown in SEQ ID No. 2 with a glutamine residue;

[0022] (3) A protein composed of a new amino acid sequence formed by replacing the leucine residue at position 293 of the amino acid sequence shown in SEQ ID No. 2 with a phenylalanine residue;

[0023] (4) A protein consisting of a new amino acid sequence formed by replacing the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No. 2 with a tyrosine residue and replacing the threonine residue at position 187 with a leucine residue.

[0024] (5) A protein consisting of a new amino acid sequence formed by replacing the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No.2 with a tyrosine residue and replacing the leucine residue at position 247 with a glutamine residue.

[0025] (6) A protein consisting of a new amino acid sequence formed by replacing the 247th leucine residue of the amino acid sequence shown in SEQ ID No.2 with a glutamine residue and replacing the 293rd leucine residue with a phenylalanine residue;

[0026] (7) A protein consisting of a new amino acid sequence formed by replacing the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No. 2 with a tyrosine residue and replacing the alanine residue at position 390 with a serine residue.

[0027] (8) A protein consisting of a new amino acid sequence formed by replacing the threonine residue at position 187 of the amino acid sequence shown in SEQ ID No. 2 with a leucine residue and replacing the alanine residue at position 390 with a serine residue.

[0028] (9) A protein composed of a new amino acid sequence formed by replacing the 247th leucine residue of the amino acid sequence shown in SEQ ID No.2 with a glutamine residue and replacing the 390th alanine residue with a serine residue;

[0029] (10) A protein consisting of a new amino acid sequence formed by replacing the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No.2 with a tyrosine glutamine residue, replacing the leucine residue at position 247 with a glutamine residue, and replacing the alanine residue at position 390 with a serine residue.

[0030] The Baeyer Villiger monooxygenase described in this invention was obtained from *Acinetobacter radioresistant* CGMCC No. 25186. The Baeyer Villiger monooxygenase gene of *Acinetobacter radioresistant* CGMCC No. 25186 was cloned to obtain a Baeyer Villiger monooxygenase with excellent catalytic performance, named ArBVMO, whose amino acid sequence is shown in SEQ ID No. 2.

[0031] Based on the screening and acquisition of Baeyer Villiger monooxygenase, the enzyme was subjected to directed evolution modification using site-directed saturation mutagenesis and combinatorial mutagenesis strategies, resulting in the identification of the ArBVMO mutant with significantly improved activity. Through repeated experiments, it was found that replacing single-site substitutions or simultaneous substitutions of multiple amino acid residues at positions 141 (phenylalanine), 187 (threonine), 247 (leucine), 293 (leucine), and 390 (alanine) in the amino acid sequence shown in SEQ ID No. 2 still maintained Baeyer Villiger monooxygenase activity. Based on this, the ArBVMO mutant with significantly improved enzyme activity was obtained. Furthermore, replacing other amino acid residues in the amino acid sequence shown in SEQ ID No. 2 with other amino acid residues that do not affect the catalytic performance of the ArBVMO mutant is also within the scope of this invention.

[0032] The third technical solution of the present invention is:

[0033] This invention provides a nucleic acid encoding the Baeyer Villiger monooxygenase as described in technical solution two, specifically, it is a nucleic acid with the following sequence:

[0034] (1) The nucleic acid shown in SEQ ID No. 1; or

[0035] (2) Encode the nucleic acid of Baeyer Villiger monooxygenase as described in technical solution 2.

[0036] The method for obtaining the encoding nucleic acid of Baeyer Villiger monooxygenase described in this invention is conventional in the art: preferably, it is isolated from Acinetobacter radioresistant strain CGMCC No. 25186 by genetic engineering technology; or it is obtained by artificial full-sequence synthesis.

[0037] The fourth technical solution of the present invention is:

[0038] The present invention provides a recombinant expression vector containing the Baeyer Villiger monooxygenase nucleic acid sequence.

[0039] The recombinant expression vector of the present invention can be constructed by linking the Baeyer Villiger monooxygenase nucleic acid to various expression vectors using conventional methods in the art. The expression vector can be a commercially available plasmid, preferably plasmid pET-28a(+).

[0040] Preferably, the recombinant expression vector of the present invention can be prepared by the following method: the DNA fragment of the Baeyer-Villiger monooxygenase gene sequence obtained by PCR amplification is digested with restriction endonucleases EcoRI and XhoI, and the empty vector plasmid pET-28a(+) is also digested with restriction endonucleases EcoRI and XhoI. The digested Baeyer-Villiger monooxygenase gene DNA fragment and the empty vector plasmid pET-28a(+) are recovered and ligated using T4 DNA ligase to construct a recombinant expression vector (pET28a-ArBVMO) containing the Baeyer-Villiger monooxygenase nucleic acid sequence.

[0041] The fifth technical solution of the present invention is:

[0042] The present invention provides a recombinant expression transformant comprising the Baeyer-Villiger monooxygenase nucleic acid sequence or a recombinant expression vector.

[0043] The recombinant expression transformant of this invention can be obtained by transforming the recombinant expression vector described in technical solution four into host cells. The host cell is a conventional host cell in the art, as long as it satisfies the requirement that the recombinant expression vector can stably replicate spontaneously and that the carried Baeyer-Villiger monooxygenase nucleic acid sequence can be effectively expressed. The host cell is preferably *Escherichia coli*, more preferably *E. coli* BL21(DE3). Transforming the recombinant expression vector into *E. coli* BL21(DE3) yields the preferred genetically engineered strain of this invention.

[0044] The sixth technical solution of the present invention is:

[0045] This invention provides a Baeyer-Villiger monooxygenase catalyst, wherein the Baeyer-Villiger monooxygenase catalyst is in any of the following forms:

[0046] (1) Cultivate the recombinant expression transformant as described in technical solution 5, and isolate the transformant cells containing the Baeyer-Villiger monooxygenase;

[0047] (2) Cultivate the recombinant expression transformant as described in technical solution 5, and separate the crude enzyme solution containing the Baeyer-Villiger monooxygenase;

[0048] (3) The crude enzyme powder is obtained by freeze-drying the crude enzyme solution of the Baeyer-Villiger monooxygenase.

[0049] A method for preparing the Baeyer-Villiger monooxygenase catalyst is provided, preferably comprising: culturing the recombinant expression transformant as described in technical solution five to obtain recombinant Baeyer-Villiger monooxygenase. The culture medium used for culturing the recombinant expression transformant is any culture medium in the art capable of enabling the transformant to grow and produce the recombinant Baeyer-Villiger monooxygenase of the present invention. The culture medium is preferably LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, pH 6.5-7.0. There are no special limitations on the culture method and conditions; appropriate selection can be made according to the host cell type and culture method, based on conventional knowledge in the art, as long as the transformant can grow and produce the Baeyer-Villiger monooxygenase. The specific operation of culturing the recombinant expression transformant can be performed according to conventional operations in the art. A preferred culture method is: inoculating the recombinant *Escherichia coli* of the present invention into LB medium containing kanamycin and culturing overnight at 37°C and 200 rpm with shaking. Inoculate 1-2% (v / v) into a 500mL Erlenmeyer flask containing 100mL of LB medium (containing kanamycin), and incubate at 37℃ and 180rpm on a shaker. When the OD of the culture medium... 600 When the β-hydroxyl content reaches 0.6-0.8, isopropyl-β-D-thiogalactoside (IPTG) at a final concentration of 0.1-0.6 mmol / L is added as an inducer. Induction is performed at 16-25°C for 12-24 hours. The culture medium is then centrifuged, the precipitate is collected, and the cells are washed twice with physiological saline to obtain recombinant expression-transformed somatic cells. The harvested recombinant cells are freeze-dried to obtain frozen stem cells containing the Baeyer-Villiger monooxygenase mutant. The harvested recombinant cells are suspended in 5-10 volumes (v / w) of buffer solution, sonicated, and the supernatant is collected by centrifugation to obtain the crude enzyme solution of the recombinant Baeyer-Villiger monooxygenase mutant. The collected crude enzyme solution is frozen at -80°C and then dried at low temperature using a vacuum freeze dryer to obtain lyophilized enzyme powder. The obtained lyophilized enzyme powder can be stored at 4°C for convenient use.

[0050] The method for determining the activity of Baeyer-Villiger monooxygenase described in this invention is as follows: A 1 mL reaction system (50–100 mmol / L sodium phosphate buffer, pH 7.0–9.0) containing 2 mmol / L 3-substituted cyclobutanone and 0.2 mmol / L NADPH is preheated to 30°C. Then, an appropriate amount of ArBVMO or a mutant is added, and the reaction is incubated at 30°C. The absorbance change of NADPH at 340 nm is detected on a spectrophotometer, and the absorbance change value within 1 minute is recorded.

[0051] Enzyme activity can be calculated using the following formula:

[0052] Enzyme activity (U) = EW × V × 10 3 / (6220×l)

[0053] In the formula, EW is the change in absorbance at 340 nm within 1 min; V is the volume of the reaction solution in mL; 6220 is the molar extinction coefficient of NADPH in L / (mol·cm); and l is the optical path distance in cm. One unit of enzyme activity (U) is defined as the amount of enzyme required to catalyze the oxidation of 1 μmol of NADPH per minute under the above conditions.

[0054] The seventh technical solution of the present invention is:

[0055] This invention provides an application of the Baeyer-Villiger monooxygenase in the synthesis of 3-substituted chiral butyrolactones, specifically a method for preparing various 3-substituted chiral butyrolactone compounds by using Baeyer-Villiger monooxygenase to catalyze the asymmetric reduction of prochiral 3-substituted cyclobutanone compounds. The dehydrogenase used for NADPH regeneration is any one of formate dehydrogenase FDH (Appl Biochem Biotechnol 2020, 192:530–543), glucose dehydrogenase GDH (ChemBioChem 2020, 21:2680-2688), or alcohol dehydrogenase ADH (Appl Environ Microb, 2022, 88:e00341-22).

[0056] The prochiral 3-substituted cyclobutanone may be selected from one or more of the following compounds:

[0057]

[0058] The Baeyer-Villiger monooxygenase and its mutant catalyst can catalyze the asymmetric oxidation of the above twelve compounds to generate the corresponding 3-substituted chiral butyrolactone compounds.

[0059] In the aforementioned application, the concentration of the prochiral 3-substituted cyclobutanone compound can be 10–200 mmol / L, and the amount of the Baeyer-Villiger monooxygenase mutant can be selected as 5–10 U / mmol of the prochiral 3-substituted cyclobutanone compound. The reaction solution contains NADPH or NADP. +The dosage is 0.05–0.2 mmol / L. Preferably, sodium formate is used as a co-substrate in the reaction process, and the NADPH coenzyme cycle in the reaction system is achieved through the sodium formate oxidation reaction catalyzed by formate dehydrogenase. The dosage of sodium formate dehydrogenase can be 7.5–30 U / mmol of the prochiral 3-substituted cyclobutanone compound, and the dosage of sodium formate can be 1.5–3.0 times the molar concentration of the prochiral 3-substituted cyclobutanone compound. The buffer required for the asymmetric oxidation process is a conventional phosphate buffer in the art, such as sodium phosphate buffer, with a preferred concentration of 10–100 mmol / L. Preferably, the asymmetric oxidation process is carried out in a two-phase reaction system consisting of a water-organic phase, wherein the organic phase is selected from toluene, n-hexane, n-heptane, n-dodecane, cyclohexane, methyl tert-butyl ether, and isopropyl ether, and the volume ratio of the organic phase to the water phase is 1:3–3:1. The asymmetric reduction reaction is carried out under shaking or stirring conditions. The temperature of the asymmetric reduction reaction is 25–35°C, preferably 30°C. The time of the asymmetric reduction reaction is determined by the time it takes for the substrate to be completely converted or for the reaction to terminate spontaneously, preferably less than 24 hours.

[0060] After the reduction reaction, the oxidation product 3-substituted chiral butyrolactone in the reaction solution was separated and extracted using conventional methods. The reaction solution was collected and centrifuged at 12000×g for 15 min to separate the upper organic phase. Preferably, dichloromethane was used to extract the aqueous phase, and the lower organic phase was collected. The combined organic phases were concentrated to remove the solvent, yielding crude 3-substituted chiral butyrolactone. Purification was then performed by silica gel column chromatography, preferably using n-hexane, petroleum ether, and ethyl acetate as the mobile phase, to obtain pure 3-substituted chiral butyrolactone product.

[0061] The reaction or detection conditions described in this invention can be combined or modified based on common knowledge in the field, and can be verified through experiments.

[0062] Unless otherwise specified, all raw materials or reagents used in this invention are commercially available.

[0063] Compared with the prior art, the innovation and improvement of this invention are as follows:

[0064] (1) This invention provides a Baeyer-Villiger monooxygenase mutant with better catalytic performance, which can efficiently catalyze the asymmetric oxidation of proximal chiral 3-substituted cyclobutanones with different substituent sizes, and prepare optically pure 3-substituted chiral butyrolactone compounds, such as (S)-3-propylbutyrolactone, (R)-3-phenylbutyrolactone, (S)-3-benzylbutyrolactone and (S)-3-piperylbutyrolactone.

[0065] (2) Baeyer-Villiger monooxygenase can catalyze the conversion of hydrophobic substrates 3-propylcyclobutanone, 3-phenylcyclobutanone, 3-benzylcyclobutanone and 3-piperylcyclobutanone at concentrations up to 200 mM, achieving a conversion rate of over 99% and space-time yields of 220 g L. -1 day -1 113g L -1 day -1 110g L -1 day -1 and 115gL -1 day -1 .

[0066] Compared to previously reported Baeyer-Villiger monooxygenases that catalyze this type of substrate, the Baeyer-Villiger monooxygenase mutant obtained in this invention has advantages such as tolerance to high substrate concentrations, high product optical purity, and high space-time yield, thus showing great promise for industrial applications.

[0067] Information on the preservation of biological materials

[0068] The radioresistant Acinetobacter radioresistens described in this invention was deposited on June 27, 2022, at the China General Microbiological Culture Collection Center (CGMCC), at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 25186 and classification name Acinetobacter radioresistens. Detailed Implementation

[0069] The present invention will now be described in detail with reference to specific embodiments, but this does not limit the invention to the scope of the embodiments described. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0070] The materials in the following embodiments are sourced from:

[0071] The empty plasmid vector pET-28a(+) was purchased from Novagen.

[0072] E. coli BL21(DE3) competent cells, 2×Taq PCR MasterMix, and agarose gel DNA recovery kit were all purchased from Beijing Tiangen Biotech Co., Ltd.

[0073] Both restriction endonucleases EcoRI and XhoI are commercially available products from New England Biolabs (NEB).

[0074] Example 1: Screening of Acinetobacter radioresistens CGMCC No. 25186

[0075] This invention involved collecting soil samples from various soil types at East China University of Science and Technology. The samples were cultured using different concentrations of cyclobutanone substrate to enrich and acclimate the bacterial strains in the soil. A strain capable of efficiently catalyzing the asymmetric oxidation of cyclobutanone to butyrolactone, *Acinetobacter radioresistens*, was screened. The screening medium was nutrient broth agar (10 g / L peptone, 3 g / L beef extract, 5 g / L NaCl, 15 g / L agar, pH 7.3), and cultured at 30°C for 24 h.

[0076] Example 2: Construction of recombinant plasmid pET28a-ArBVMO

[0077] The ArBVMO gene was constructed into the empty plasmid vector pET-28a(+) using PCR amplification and enzyme digestion ligation techniques, thus obtaining the recombinant plasmid pET28a-ArBVMO. The primers used for construction were:

[0078] Upstream primer sequence: CCGGAATTCATGGATAAACACATTGATG (shown in SEQ ID NO.3);

[0079] Downstream primer sequence: CCGCTCGAGTTATGAAACCAGTTTAGGCTTAC (SEQ ID NO.4).

[0080] The upstream primer contains the GAATTC sequence, which is the EcoRI restriction site, and the downstream primer contains the CTCGAG sequence, which is the XhoI restriction site.

[0081] Using the genome of Acinetobacter radioresistens CGMCC No.25186 as a template, the ArBVMO gene was amplified by PCR using Prime Star DNA polymerase.

[0082] The PCR system (20 μL) consisted of: 10 μL Prime Star DNA polymerase, 1 μL template, 1 μL upstream primer, 1 μL downstream primer, 1 μL DMSO, and sterile distilled water to a final volume of 20 μL. The PCR reaction procedure was as follows: (1) 95℃ pre-denaturation for 3 min; (2) 98℃ denaturation for 10 s; (3) 57℃ annealing for 15 s; (4) 72℃ extension for 1.5 min; steps (2) to (4) were performed for a total of 30 cycles; the final extension was performed at 72℃ for 10 min, and the product was stored at 4℃. After verification by agarose gel electrophoresis, the PCR product was purified and recovered by gel excision. The recovered ArBVMO gene DNA fragment and the empty vector plasmid pET-28a(+) were digested with restriction endonucleases EcoR I and Xho I at 37℃ for 6 h. The double enzyme digestion products were verified by agarose gel electrophoresis, purified, and recovered. The linearized pET-28a(+) plasmid was ligated with the purified ArBVMO gene DNA fragment at 16°C overnight using T4 DNA ligase. The ligation product was transformed into *E. coli* BL21(DE3) competent cells and evenly spread on LB agar plates containing 50 μg / mL kanamycin. The plates were incubated at 37°C for approximately 12 h. Transformants from the plates were then transferred using an inoculation loop into 4 mL of LB liquid medium containing 50 μg / mL kanamycin. After incubation at 37°C for 12 h, the cells were collected and sequenced. Transformants with correct sequencing were preserved.

[0083] Example 3: Semi-rational design to construct the Baeyer-Villiger monooxygenase ArBVMO mutant

[0084] Homology modeling and molecular docking were performed on the ArBVMO described in Example 1. Enzyme activity was further enhanced by site-directed saturation mutagenesis and combinatorial mutagenesis of amino acids near the substrate pocket. Using Uniprot, NCBI BLAST, and spatial structure modeling, the amino acid residues surrounding the binding site of the substrate 3-propylcyclobutanone in the Baeyer-Villiger monooxygenase, as shown in SEQ ID No. 2 of the sequence listing, include amino acids at positions 141, 187, 247, 293, and 390. Site-directed saturation mutagenesis was used to saturate these amino acid residues, and the primer design is shown in Table 1.

[0085] Table 1 Primer Table

[0086]

[0087] Using pET28a-ArBVMO as a template, PCR amplification was performed using PrimeStar HS Premix. The PCR system consisted of 10 μL of 2×PrimeStar HS premix, 1 μL each of forward and reverse primers, 40 ng of pETP28a-ArBVMO plasmid, 1 μL of DMSO, and sterile distilled water to a final volume of 20 μL. The PCR reaction procedure was as follows: (1) 95℃ pre-denaturation for 5 min; (2) 94℃ denaturation for 30 s; (3) 60℃ annealing for 30 s; (4) 72℃ extension for 7 min; steps (2) to (4) were performed for a total of 30 cycles; and the final extension was performed at 72℃ for 10 min. After the reaction, 1 μL of restriction endonuclease Dpn I was added to 20 μL of PCR product, and the mixture was incubated at 37°C for 2 h to allow for complete digestion and degradation of the template. The digested product was then transformed into E. coli BL21(DE3) competent cells and evenly spread on LB agar plates containing 50 μg / mL kanamycin. The plates were then incubated at 37°C for approximately 12 h. Transformants from the transformation plates were then transferred using an inoculation loop into 4 mL of LB liquid medium containing 50 μg / mL kanamycin. After incubation at 37°C for 12 h, the cells were collected and sequenced. Transformants with correct sequencing results were preserved.

[0088] The Baeyer-Villiger monooxygenase mutant amino acid sequence has one of the following sequences:

[0089] (1) Replace the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing with a tyrosine residue, and name it ArBVMO. M1 ;

[0090] (2) Replace the leucine residue at position 247 of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing with a glutamine residue, and name it ArBVMO. M2 ;

[0091] (3) Replace the leucine residue at position 293 of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing with a phenylalanine residue, and name it ArBVMO. M3 ;

[0092] (4) Replace the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing with a tyrosine residue and the threonine residue at position 187 with a leucine residue, and name it ArBVMO. M4 ;

[0093] (5) Replace the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing with a tyrosine residue and the leucine residue at position 247 with a glutamine residue, and name it ArBVMO. M5 ;

[0094] (6) Replace the 247th leucine residue in the amino acid sequence shown in SEQ ID No. 2 of the sequence listing with a glutamine residue and the 293rd leucine residue with a phenylalanine residue, and name it ArBVMO. M6 ;

[0095] (7) Replace the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing with a tyrosine residue and the alanine residue at position 390 with a serine residue, and name it ArBVMO. M7 ;

[0096] (8) Replace the threonine residue at position 187 of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing with a leucine residue and the alanine residue at position 390 with a serine residue, and name it ArBVMO. M8 ;

[0097] (9) Replace the 247th leucine residue with a glutamine residue and the 390th alanine residue with a serine residue in the amino acid sequence shown in SEQ ID No. 2 of the sequence listing, and name it ArBVMO. M9 ;

[0098] (10) Replace the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing with a tyrosine residue, the leucine residue at position 247 with a glutamine residue, and the alanine residue at position 390 with a serine residue, and name it ArBVMO. M10 .

[0099] In a 10 mL toluene-water two-phase system (1:1, v / v), add 10 mmol / L of the substrate 3-propylcyclobutanone, 3 g / L of whole cells of ArBVMO or mutant, 2.5 g / L of formate dehydrogenase, 15 mmol / L of sodium formate, and 0.2 mmol / L of NADP. + The aqueous phase consisted of 100 mM KBP at pH 8.0. The reaction was stopped at 6 h, and samples were taken. After drying with anhydrous sodium sulfate, the samples were analyzed by GC. The results are shown in Table 2.

[0100] Table 2 List of activities improved by Baeyer-Villiger monooxygenase mutants

[0101]

[0102] Examples 4-6: Expression and activity assays of recombinant Baeyer-Villiger monooxygenase mutants M7, M8, and M10

[0103] Recombinant *E. coli* BL21(DE3) / pET28a-ArBVMO corresponding to the Baeyer-Villiger monooxygenase mutants M7, M8, and M10 obtained in Example 2 were inoculated into LB medium containing 50 μg / mL kanamycin and cultured on a shaker at 37°C for 12 h. Then, at a 1% (v / v) inoculation rate, they were transferred to 250 mL Erlenmeyer flasks containing 50 mL of LB medium (containing 50 μg / mL kanamycin) and cultured on a shaker at 37°C and 200 rpm. 600 When the culture medium reaches 0.8-1.0, add IPTG to a final concentration of 0.2 mmol / L as an inducer, and continue incubation with shaking at 16-37℃ for 16-24 h. Centrifuge the culture medium at 14000×g for 3 min, collect the cells, and wash twice with physiological saline to obtain resting cells. Resuspend the cells obtained from 100 mL of culture medium in 10 mL of potassium phosphate buffer (100 mM, pH 8.0), and sonicate in an ice-water bath: 400 W, 4 s on, 6 s off, for 90 cycles, followed by centrifugation at 14000×g for 45 min at 4℃. Resuspend the precipitate in 10 mL of KPB buffer (100 mM, pH 8.0), and in a 1.5 mL Eppendorf tube, mix with 20 μL of 5×SDS PAGE Loading Buffer, and heat in a boiling water bath or 95℃ metal bath for 5 min. Perform SDS-PAGE analysis on the sample immediately. SDS-PAGE results showed that the recombinant expression transformants constructed in this invention expressed more than 60% of the total protein, and 90% of the target protein was soluble. Specifically, the crude enzyme solution in supernatant M7 had an activity of 0.61 U / mL. Furthermore, the harvested crude enzyme solution was freeze-dried to obtain lyophilized enzyme powder with an activity of 0.19 U / mg; the crude enzyme solution in supernatant M8 had an activity of 0.52 U / mL. Furthermore, the harvested crude enzyme solution was freeze-dried to obtain lyophilized enzyme powder with an activity of 0.13 U / mg; and the crude enzyme solution in supernatant M10 had an activity of 0.57 U / mL. Furthermore, the harvested crude enzyme solution was freeze-dried to obtain lyophilized enzyme powder with an activity of 0.16 U / mg.

[0104] Examples 7-18: Asymmetric oxidation of a series of prochiral substrates catalyzed by recombinant Baeyer-Villiger monooxygenase mutants.

[0105] The activity of the Baeyer-Villiger monooxygenase mutant was determined by spectrophotometry: a 1 mL reaction system (100 mmol / L sodium phosphate buffer, pH 8.0) containing 2 mmol / L substrate 1a-1l (dissolved in 5% methanol) and 0.2 mmol / L NADPH was preheated to 30 °C, and then an appropriate amount of the mutant pure enzyme was added. The reaction was incubated at 30 °C, and the absorbance change at 340 nm was detected on the spectrophotometer. The absorbance change value within 1 min was recorded, and the enzyme activity was calculated. The results are shown in Table 3.

[0106] Table 3. Asymmetric oxidation reactions of potential chiral substrates catalyzed by ArBVMO mutants.

[0107]

[0108]

[0109] The ee values ​​of the final products 3-substituted chiral butyrolactones oxidized by enzymatic methods with different prochiral substrates in Examples 7-18 are shown in Table 4.

[0110] Table 4 Analytical conditions for the ee values ​​of the final products obtained by ArBVMO catalysis of different prochiral substrates

[0111]

[0112]

[0113] Examples 19-24: Determination of kinetic parameters of recombinant ArBVMO mutants for different 3-substituted cyclobutanones

[0114] To compare ArBVMO with CHMO, which has been reported to have good catalytic effects on 3-substituted cyclobutanone. Brevi1 To assess the differences in catalytic performance, we determined relevant kinetic parameters. Under optimal temperature, pH, and co-solvent conditions, we measured the effect of substrate (1a, 1d, or 1k) concentrations within the range of 0.05–6 mM on the enzyme-catalyzed reaction rate. The concentration at which the reaction rate reached its maximum and remained constant with increasing substrate concentration was considered the substrate saturation concentration. Under this substrate concentration, we determined the NADPH consumption kinetics. Based on the Michaelis-Menten equation, we used Prism 9.0 software to fit the relevant kinetic curves and parameters, and determined the coenzyme saturation concentration based on these parameters. Substrate kinetics were then measured under the coenzyme saturation concentration. A 1 mL assay system contained 0.05–6 mM substrate, 0.005–0.2 mM NADPH, KPB (100 mM, pH 8.0 or 9.0), and an appropriate amount of purified enzyme solution. The kinetic parameter results are shown in Table 5.

[0115] Table 5 ArBVMO and CHMO Brevi1 Comparison of kinetic parameters of catalytically catalyzed substrates with different prochiral properties

[0116]

[0117]

[0118] As can be seen from Examples 19-21, the ArBVMO mutant exhibits low Kc values ​​for all substrates. M and better k cat Furthermore, no substrate inhibition was observed, indicating its potential for high-concentration, large-scale enzymatic reactions. From Examples 22-24, it is evident that although CHMO… Brevi1 Having a lower K M and higher k cat However, there is a severe substrate inhibition phenomenon, which applies to three different substrate inhibition constants K. i The concentrations are all less than 1 mM, which severely limits the enzyme's enzymatic reactions under high substrate concentration conditions and its application in industrial production.

[0119] Example 25 Recombinant ArBVMO M7 Catalytic synthesis of (S)-3-propylbutyrolactone

[0120] In a 250 mL two-phase system (n-heptane-water, 1:3, v / v), containing 200 mmol / L of substrate 3-propylcyclobutanone, 150 mmol / L of glucose, and 0.1 mmol / L of NADP, + 1000 U / L of recombinant ArBVMO obtained as in Example 3 M7 Crude enzyme solution and 3000 U / L glucose dehydrogenase were used, with the aqueous phase consisting of 100 mM KPB at pH 8.0. The reaction was carried out in a shaker at 250 rpm at 30 °C. Substrate conversion was monitored by TLC, and complete conversion was observed after 5.5 h. The reaction mixture was then collected and centrifuged to obtain the upper organic phase. An equal volume of dichloromethane was then extracted from the aqueous phase, and the lower organic phase was separated using a separatory funnel. The organic phases were combined. The organic phase was washed with saturated sodium bicarbonate solution and dried overnight with anhydrous Na₂SO₄. The organic phase was then concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography. The target product (S)-3-propylbutyrolactone was eluted with a mobile phase of n-hexane and petroleum ether (50:1). The product purity was 99.5%, ee value was 99.7% (S), and the space-time yield was 147 g / L. -1 day -1 .

[0121] Example 26 Recombinant ArBVMO M7Catalytic synthesis of (S)-3-propylbutyrolactone

[0122] In a 250 mL two-phase system (methyl tert-butyl ether-water, 1:2, v / v), containing 300 mmol / L of substrate 3-propylcyclobutanone, 150 mmol / L of glucose, and 0.1 mmol / L of NADP, + 1000 U / L of recombinant ArBVMO obtained as in Example 3 M7 Crude enzyme solution and 3000 U / L glucose dehydrogenase were used, with the aqueous phase consisting of 100 mM KPB at pH 8.0. The reaction was carried out in a shaker at 250 rpm at 30 °C. Substrate conversion was monitored by TLC, and complete conversion was observed after 5.5 h. The reaction mixture was then collected and centrifuged to obtain the upper organic phase. An equal volume of dichloromethane was then extracted from the aqueous phase, and the lower organic phase was separated using a separatory funnel. The organic phases were combined. The organic phase was washed with saturated sodium bicarbonate solution and dried overnight with anhydrous Na₂SO₄. The organic phase was then concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography. The target product (S)-3-propylbutyrolactone was eluted with a mobile phase of n-hexane and petroleum ether (50:1). The product purity was 99.5%, ee value was 99.7% (S), and the space-time yield was 220 g / L. -1 day -1 .

[0123] Example 27 Recombinant ArBVMO M8 Catalytic synthesis of (R)-3-phenylbutyrolactone

[0124] In a 250 mL two-phase system (isopropyl ether-water, 2:1, v / v), containing 180 mmol / L of the substrate 3-phenylcyclobutanone, 270 mmol / L of sodium formate, and 0.1 mmol / L of NADP, + 1000 U / L of recombinant ArBVMO obtained as in Example 3 M8 Crude enzyme solution and 3000 U / L formate dehydrogenase were used, with the aqueous phase consisting of 100 mM KPB at pH 8.0. The reaction was carried out in a shaker at 250 rpm at 30 °C. Substrate conversion was monitored by TLC, and complete conversion was observed after 6 hours. The reaction mixture was then collected and centrifuged to obtain the upper organic phase. An equal volume of dichloromethane was used to extract the aqueous phase, and the lower organic phase was separated using a separatory funnel. The organic phases were combined. The organic phase was washed with saturated sodium bicarbonate solution and dried overnight with anhydrous Na₂SO₄. The organic phase was then concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography. The target product (R)-3-phenylbutyrolactone was eluted with a mobile phase of ethyl acetate and petroleum ether (10:1). The product purity was 99.5%, ee value was 99.5%, and space-time yield was 110 g / L. -1 day -1 .

[0125] Example 28 Recombinant ArBVMO M8 Catalytic synthesis of (R)-3-phenylbutyrolactone

[0126] In a 250 mL two-phase system (n-hexane-water, 3:1, v / v), containing 180 mmol / L of the substrate 3-phenylcyclobutanone, 270 mmol / L of sodium formate, and 0.1 mmol / L of NADP, + 1000 U / L of recombinant ArBVMO obtained as in Example 3 M8 Crude enzyme solution and 3000 U / L formate dehydrogenase were used, with the aqueous phase consisting of 100 mM KPB at pH 8.0. The reaction was carried out in a shaker at 250 rpm at 30 °C. Substrate conversion was monitored by TLC, and complete conversion was observed after 6 hours. The reaction mixture was then collected and centrifuged to obtain the upper organic phase. An equal volume of dichloromethane was used to extract the aqueous phase, and the lower organic phase was separated using a separatory funnel. The organic phases were combined. The organic phase was washed with saturated sodium bicarbonate solution and dried overnight with anhydrous Na₂SO₄. The organic phase was then concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography. The target product (R)-3-phenylbutyrolactone was eluted with a mobile phase of ethyl acetate and petroleum ether (10:1). The product purity was 99.5%, ee value was 99.5%, and space-time yield was 113 g / L. -1 day -1 .

[0127] Example 29 Recombinant ArBVMO M8 Catalytic synthesis of (R)-3-phenylbutyrolactone

[0128] In a 250 mL two-phase system (cyclohexane-water, 1:1.5, v / v), containing 180 mmol / L of the substrate 3-phenylcyclobutanone, 270 mmol / L of isopropanol, and 0.1 mmol / L of NADP, + 1000 U / L of recombinant ArBVMO obtained as in Example 3 M8Crude enzyme solution and 3000 U / L alcohol dehydrogenase were used, with the aqueous phase consisting of 100 mM KPB at pH 8.0. The reaction was carried out in a shaker at 250 rpm at 30 °C. Substrate conversion was monitored by TLC, and complete conversion was observed after 6 hours. The reaction mixture was then collected and centrifuged to obtain the upper organic phase. An equal volume of dichloromethane was used to extract the aqueous phase, and the lower organic phase was separated using a separatory funnel. The organic phases were combined. The organic phase was washed with saturated sodium bicarbonate solution and dried overnight with anhydrous Na₂SO₄. The organic phase was then concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography. The target product (R)-3-phenylbutyrolactone was eluted with a mobile phase of ethyl acetate and petroleum ether (10:1). The product purity was 99.5%, ee value was 99.5%, and space-time yield was 121 g / L. -1 day -1 .

[0129] Example 30 Recombinant ArBVMO M10 Catalytic synthesis of (S)-3-benzylbutyrolactone

[0130] In a 250 mL two-phase system (n-dodecane-water, 1:1, v / v), containing 150 mmol / L of the substrate 3-benzylcyclobutanone, 225 mmol / L of isopropanol, and 0.1 mmol / L of NADP, + 1000 U / L of recombinant ArBVMO obtained as in Example 3 M10 Crude enzyme solution and 3000 U / L alcohol dehydrogenase were used, with the aqueous phase consisting of 100 mM KPB at pH 8.0. The reaction was carried out in a shaker at 250 rpm at 30 °C. Substrate conversion was monitored by TLC, and complete conversion was observed after 7.5 h. The reaction mixture was then collected and centrifuged to obtain the upper organic phase. An equal volume of dichloromethane was then extracted from the aqueous phase, and the lower organic phase was separated using a separatory funnel. The organic phases were combined. The organic phase was washed with saturated sodium bicarbonate solution and dried overnight with anhydrous Na₂SO₄. The organic phase was then concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography. The target product (S)-3-benzylbutyrolactone was eluted with a mobile phase of ethyl acetate and petroleum ether (4:1). The product purity was 99%, ee value was 99.5%, and space-time yield was 110 g / L. -1 day -1 .

[0131] Example 31 Recombinant ArBVMO M10 Catalytic synthesis of (S)-3-piperylbutyrolactone

[0132] In a 250 mL two-phase system (toluene-water, 1:2, v / v), 200 mmol / L of the substrate 3-piperylcyclobutanone, 300 mmol / L of glucose, 0.1 mmol / L of NADP+, 1000 U / L of the crude recombinant ArBVMOM10 enzyme solution obtained in Example 3, and 3000 U / L of glucose dehydrogenase were used. The aqueous phase was 100 mM KPB at pH 8.0. The reaction was carried out at 30 °C in a shaker at 250 rpm. The substrate conversion was monitored by TLC. Complete substrate conversion was observed after 8.5 h. The reaction solution was then collected and centrifuged to obtain the upper organic phase. The aqueous phase was then extracted with an equal volume of dichloromethane. The lower organic phase was separated using a separatory funnel and the organic phases were combined. The organic phase was washed with a saturated sodium bicarbonate aqueous solution and then dried overnight with anhydrous Na₂SO₄. The organic phase was then concentrated under reduced pressure, and the crude product was purified by silica gel chromatography. The target product (S)-3-piperylbutyrolactone was eluted with a mobile phase of ethyl acetate and petroleum ether (4:1). The product purity was 99%, ee value was 99.5%, and the space-time yield was 115 g / L. -1 day -1 .

[0133] Examples 25-31 provide examples of preparing optically pure 3-substituted chiral butyrolactone compounds. It can be seen that the recombinant Baeyer-Villiger monooxygenase preparation obtained by the method of the present invention can efficiently catalyze the asymmetric oxidation of 3-substituted cyclobutanones with different substituents. Such compounds can serve as key chiral building blocks for the synthesis of drugs and natural products and have great application value.

[0134] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. A Baeyer-Villiger monooxygenase, characterized in that, The Baeyer-Villiger monooxygenase is Acinetobacter radiation-resistant ( ) Acinetobacter radioresistens The protein obtained by expression is a new amino acid sequence formed by mutation of the amino acid sequence shown in SEQ ID No. 2 at the following sites: The protein has one of the following sequences: (1) A protein consisting of a new amino acid sequence formed by replacing the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No. 2 with a tyrosine residue and replacing the alanine residue at position 390 with a serine residue. (2) A protein consisting of a new amino acid sequence formed by replacing the threonine residue at position 187 of the amino acid sequence shown in SEQ ID No. 2 with a leucine residue and replacing the alanine residue at position 390 with a serine residue; (3) A protein composed of a new amino acid sequence formed by replacing the 247th leucine residue of the amino acid sequence shown in SEQ ID No. 2 with a glutamine residue and replacing the 390th alanine residue with a serine residue; (4) A protein consisting of a new amino acid sequence formed by replacing the phenylalanine residue at position 141 of the amino acid sequence shown in SEQ ID No. 2 with a tyrosine glutamine residue, replacing the leucine residue at position 247 with a glutamine residue, and replacing the alanine residue at position 390 with a serine residue.

2. An isolated nucleic acid, characterized in that, The nucleic acid encodes the Baeyer-Villiger monooxygenase as described in claim 1.

3. A recombinant expression vector, characterized in that, Includes the nucleic acids as described in claim 2.

4. A recombinant expression transformant, characterized in that, Includes the recombinant expression vector as described in claim 3.

5. A Baeyer-Villiger monooxygenase catalyst, characterized in that, The Baeyer-Villiger monooxygenase catalyst comprises any of the following forms: (1) Culture the recombinant expression transformant as described in claim 4, and isolate the transformant cells containing the Baeyer-Villiger monooxygenase; (2) Cultivate the recombinant expression transformant as described in claim 4, and separate the crude enzyme solution containing the Baeyer-Villiger monooxygenase; (3) Cultivate the recombinant expression transformant as described in claim 4, separate the crude enzyme solution containing the Baeyer-Villiger monooxygenase, and freeze-dry the crude enzyme powder obtained.

6. The application of the Baeyer-Villiger monooxygenase catalyst as described in claim 5, characterized in that, Application of the Baeyer-Villiger monooxygenase catalyst in the asymmetric oxidation of prochiral 3-substituted cyclobutanone compounds to the corresponding 3-substituted chiral butyrolactone compounds.

7. The application of the Baeyer-Villiger monooxygenase catalyst according to claim 6, characterized in that, The prochiral 3-substituted cyclobutanone compound is selected from the following compounds: .

Citation Information

Patent Citations

  • Baeyer-Villiger monooxygenase and application thereof in synthesis of briracetam

    CN114480315A

  • Genes encoding baeyer-villiger monooxygenases

    EP1516046A2

  • Genes encoding baeyer-villiger monooxygenases

    US20030124695A1