A method for improving drought resistance of tea plants

By pretreating tea cuttings with hydroponics and applying 0.1mM ethylamine solution exogenously, the problem of poor drought resistance in tea trees was solved, significantly improving the drought resistance of tea trees and reducing the damage of drought stress to tea trees.

CN115997608BActive Publication Date: 2026-07-24ANHUI AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ANHUI AGRICULTURAL UNIVERSITY
Filing Date
2023-02-28
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Tea trees have poor drought resistance, and drought stress seriously affects their growth and yield, leading to economic losses. Existing technologies have failed to effectively improve the drought resistance of tea trees.

Method used

After hydroponic pretreatment of tea tree cuttings, a 0.1 mM ethylamine aqueous solution was applied exogenously to simulate drought stress treatment, thereby enhancing the drought resistance of tea trees.

Benefits of technology

Under the condition of applying 0.1 mM ethylamine, the chlorophyll fluorescence value, relative water content and MDA value of tea leaves were closest to those of the control group without drought treatment, which significantly improved the drought resistance of tea trees.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115997608B_ABST
    Figure CN115997608B_ABST
Patent Text Reader

Abstract

The application provides a method for improving drought resistance of tea trees, and belongs to the technical field of tea tree cultivation, and the method is that 0.1-2 mL of 0.01-0.2 mM ethylamine aqueous solution is externally applied to 1-5 leaves of the tea tree, and after the treatment, the chlorophyll fluorescence value, water content and MDA value of the leaves of the tea tree after drought treatment are higher than those of the drought treatment group, so that it can be proved that the external application of ethylamine can significantly enhance the drought resistance of the tea tree. The method is simple, convenient to operate and low in cost, and has great economic value for tea tree planting.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of tea tree cultivation technology, specifically relating to a method for improving the drought resistance of tea trees. Background Technology

[0002] The tea tree is a shrub or small tree belonging to the genus *Camellia* in the family Theaceae. Its leaves are leathery, oblong or elliptical. Tea trees prefer a warm and humid climate and require a certain amount of rainfall annually, ideally 1500 mm. They are mainly distributed between 16°S and 30°N latitude. Tea trees thrive in warm, humid climates and have poor drought tolerance. Buds begin to sprout when the average temperature is above 10°C, with the optimal growth temperature being 20–25°C. They prefer light but can tolerate shade, thriving under diffused light.

[0003] Tea trees are subject to various biotic and abiotic stresses during their growth, including drought, flooding, chilling injury, high temperatures, and pests and diseases. Among these, drought is the most destructive stress-inducing factor, causing severe losses. Therefore, exploring how tea trees cope with drought stress is of significant importance. In my country's main tea-producing areas, high temperatures, high water evaporation, and low air humidity during summer and autumn easily lead to droughts in the summer and autumn. Studies have shown that drought stress severely affects tea tree growth, resulting in a 14%–33% decrease in tea garden yield and a 6%–19% increase in mortality, causing considerable economic losses.

[0004] When tea trees experience a prolonged water imbalance, it leads to water deficiency within the plant, affecting metabolic activity and inhibiting growth and development. In mild drought, young leaves are less affected, while some older leaves gradually lose water and green color, subsequently curling at the edges and turning brown at the tips. In moderate drought, young leaves begin to be affected, with new shoots becoming smaller and curled. As the drought continues, leaves wilt, wither, and fall off, while the terminal buds remain closed but not yet dead. In severe drought, leaves wither and fall off. As the drought continues, most of the branchlets die, though some parts of the main trunk remain. In extreme drought, the soil has virtually no usable water; all the leaves above ground dry up and fall off, and the root hairs below ground wither and die. At this point, the entire tea tree dies as the drought continues.

[0005] Drought resistance in tea trees involves numerous responses, with changes occurring in relative leaf water content, malondialdehyde (MDA) content, antioxidant enzyme activity, photosynthetic parameters, total chlorophyll content, and total carotenoid content, making it a complex issue. In recent years, research on the physiology of tea trees under drought stress has increased, focusing primarily on physiological changes following stress and reports on enhancing drought resistance in tea trees. Summary of the Invention

[0006] The purpose of this invention is to provide a method for improving the drought resistance of tea trees, specifically including the following steps:

[0007] (1) Pretreatment of cuttings in hydroponics: Select healthy and uniform one-year-old 'Longjing 43' cuttings, clean them carefully, and fix them in a 4-liter plastic container filled with hydroponic Xiaoxi Maoyi nutrient solution. Adjust the pH of the nutrient solution to 4.5-5.0 and connect it to an air pump. Pretreat in an artificial climate chamber for 4 weeks, including one week with 1 / 8 nutrient solution, one week with 1 / 4 nutrient solution, one week with 1 / 2 nutrient solution, and one week with full nutrient solution.

[0008] (2) Ethylamine application: Apply 0.1-2 mL of 0.01-0.2 mM ethylamine aqueous solution to the 1-5 leaves of the pretreated hydroponic cuttings.

[0009] Under the condition of applying 0.1 mM ethylamine, the chlorophyll fluorescence value, relative water content and MDA value of tea leaves in the drought-treated group were closest to those in the untreated control group, and the drought resistance of tea trees increased the most.

[0010] Beneficial effects

[0011] Previous research has suggested that alanine and acetaldehyde are both potential precursors to ethylamine in plant tissues. Subsequently, Takeo's research revealed that [U- 14 C]-alanine 14 The rate at which C enters theanine is compared to [1-2] 14 The faster reaction of C]-acetaldehyde suggests that alanine is closer to theanine in its biosynthetic pathway than acetaldehyde. This means that ethylamine in tea originates from the decarboxylation of alanine (Ala) catalyzed by CsAlaDC. Ethylamine is a unique substance found in tea plants; EA (ethylamine) is produced by the decarboxylation of Ala (alanine) catalyzed by CsAlaDC (alanine decarboxylase). The specific reaction formula is as follows:

[0012]

[0013] Experimental data show that under the condition of 0.1 mM ethylamine application, the chlorophyll fluorescence value, relative water content, and MDA value of tea leaves in the drought-treated group were closest to those of the untreated control group, indicating that the tea trees had the strongest drought resistance at this time. Conversely, the drought resistance was lower under the condition of 0.2 mM ethylamine application than under 0.1 mM. The specific reasons and mechanisms need further investigation, but it is possible that high concentrations of ethylamine have some impact on other physiological functions of tea trees. Data from Example 2 shows that reducing the ethylamine content of tea trees through oligonucleotide silencing significantly decreased their drought resistance. Tea trees normally containing ethylamine, after drought treatment, had higher chlorophyll fluorescence values ​​and water content than the ethylamine gene-silenced group, indicating that ethylamine can enhance the drought resistance of tea trees.

[0014] Similarly, the applicant also applied ethylamine to plants such as rice, wheat, alfalfa, and apple seedlings, and found that ethylamine did not improve the drought resistance of these annual and perennial plants. Therefore, the analysis showed that applying ethylamine is a unique metabolic pathway of tea trees, and the specific mechanism needs further in-depth research.

[0015] The method of applying ethylamine exogenously in this invention is simple, easy to operate, and low in cost, and has great economic value for tea tree cultivation. Attached Figure Description

[0016] Figure 1 This is a diagram showing the damage levels of Longjing 43 after drought stress, compared to the control group after applying ethylamine.

[0017] Figure 2 This is a phenotypic diagram of leaves after ethylamine silencing treatment. Detailed Implementation

[0018] The present invention will be described in detail below with reference to examples. All methods and techniques, unless otherwise specified, are conventional.

[0019] Example 1

[0020] This embodiment provides a method for improving the drought resistance of tea trees, the specific method is as follows:

[0021] (1) Pretreatment of cuttings for hydroponics:

[0022] Select healthy and uniform one-year-old 'Longjing 43' cuttings, clean them carefully, and fix them in a 4-liter plastic container of Xiaoxi Maoyi nutrient solution. Adjust the pH of the nutrient solution to 4.5-5.0 and connect it to an air pump. Pre-treat the cuttings in an artificial climate chamber for 4 weeks, including one week with 1 / 8 nutrient solution, one week with 1 / 4 nutrient solution, one week with 1 / 2 nutrient solution, and one week with full nutrient solution.

[0023] (2) Apply ethylamine topically:

[0024] After pretreatment, 1 mL of 0.1 mM and 0.2 mM ethylamine aqueous solutions were applied to the first to second leaves of the hydroponic cuttings. An equal volume of water was applied as a control group. The image shows the control. The term "first leaf" refers to the first leaf counted downwards from the terminal bud of the tea plant, and the second leaf is called the second leaf. For consistency, 1 mL was applied in this example; however, in actual practice, the amount of ethylamine aqueous solution applied can be 0.1–2 mL, and 1–5 leaves can be applied.

[0025] (3) Drought treatment:

[0026] Plants treated with ethylamine and control plants were placed in 5% (w / v) PEG tea nutrient solution to simulate drought stress for 5 days for further experiments or one-leaf and two-leaf liquid nitrogen samples were collected, stored at -80℃, and then analyzed.

[0027] Detection and analysis results

[0028] Drought was simulated using PEG. After 5 days of treatment, the wilting degree of leaves treated with exogenous 0.1 mM and 0.2 mM ethylamine on the first and second leaves of tea plants was significantly lower than that of the control group treated with water. Phenotypic observation confirmed that exogenous application of ethylamine can effectively alleviate the damage caused by drought stress to Longjing 43 tea. Figure 1 As shown in the table below, the results of various tests are as follows.

[0029] Table 1. Chlorophyll fluorescence values ​​of tea leaves after ethylamine coating experiment.

[0030]

[0031] Table 2. Raw data on the relative moisture content of tea leaves in the ethylamine coating experiment.

[0032]

[0033] Table 3. Raw data of MDA values ​​of tea leaves in the ethylamine coating experiment.

[0034]

[0035] The data in the table above show that under the condition of applying 0.1 mM ethylamine, the chlorophyll fluorescence value, relative water content, and MDA value of the tea leaves in the drought-treated group were closest to those of the untreated control group, indicating that the tea trees had the strongest drought resistance at this time. Conversely, under the condition of applying 0.2 mM ethylamine, the drought resistance was not as good as that under the condition of applying 0.1 mM. The specific reasons and mechanisms need further investigation, but it is possible that high concentrations of ethylamine have some impact on other physiological functions of the tea trees. Therefore, the applicant conducted a gradient experiment, applying 0.5 mL of 0.01–0.19 mM ethylamine exogenously to the one-leaf and two-leaf sections of pretreated hydroponic cuttings. The specific results are as follows.

[0036] Table 4. Raw data on the effect of exogenous ethylamine application on drought resistance of tea plants

[0037]

[0038] The above experiments show that, among the application concentrations of 0.01–0.19 mM ethylamine, the application concentration of 0.1 mM is optimal for all three indicators. As the application concentration increases, the relative water content and leaf MDA value decrease to some extent.

[0039] Example 2

[0040] This embodiment provides an experiment to observe the drought resistance of tea trees after gene silencing and drought stress treatment. The purpose of this experiment is to prove that ethylamine does have a drought-resistant effect in tea trees.

[0041] (1) Design antisense oligonucleotide primers:

[0042] Design antisense oligonucleotide primers for specific genes using the website http: / / sfold.wadsworth.org / cgi-bin / index.pl;

[0043] (2) Selecting specific primers for synthesis:

[0044] The specific sense and antisense oligonucleotide primer sequences for this gene were found by comparison with the tea plant genome database http: / / tpia.teaplant.org / index.html and sent to the company for synthesis; Primer sequence: sODN(UAGUUCAAAAGCGCGCGAAU)AsODN(ATTCGCGCGCTTTTGAACTA);

[0045] (3) Primer dilution: The final primer concentration was 40 μM, which was diluted with RNA-Free H2O;

[0046] (4) Select the sample to be silenced (healthy, intact plant);

[0047] (5) The method of silence:

[0048] Injection: Select healthy and uniform 6-month-old intact tea seedlings, immerse the roots of the seedlings in a primer solution diluted to 40 μM, and perform a 6-hour immersion silencing treatment. The control is a primer solution diluted with the same concentration of positive strand. After 6 hours of immersion, proceed to the next step or take liquid nitrogen samples from the roots and store them at -80℃ for further detection and analysis. This experiment should be repeated at least 3 times.

[0049] (6) Drought stress treatment:

[0050] The control group plants and the treatment group plants that underwent root gene silencing were placed in 10% (w / v) PEG tea nutrient solution to simulate drought stress for 48 h for further experiments or one-leaf and two-leaf liquid nitrogen samples were taken, stored at -80°C, and then subjected to further detection and analysis.

[0051] The qPCR value of the CsAlaDC gene in the roots, the content of ethylamine, the chlorophyll fluorescence value in the leaves, the relative water content in the leaves, and the MDA value in the leaves of the gene-silenced group and the normal group of tea trees were detected respectively. The results are shown in Tables 5 to 9.

[0052] Table 5. Expression levels of CsAlaDC gene in the roots of tea plants during gene silencing experiments.

[0053]

[0054] Table 6. Ethylamine content in the roots of tea plants used in gene silencing experiments.

[0055]

[0056] Table 7. Chlorophyll fluorescence values ​​of tea tree leaves in gene silencing experiment

[0057]

[0058] Table 8. Relative water content of leaves in tea tree gene silencing experiment

[0059]

[0060] Table 9. MDA values ​​of tea plant leaves in gene silencing experiment

[0061]

[0062] The data above show that reducing the ethylamine content in the roots of tea trees significantly reduces their drought resistance. In contrast, the control group of tea trees treated with drought showed higher chlorophyll fluorescence and water content in their leaves than the ethylamine gene silencing group. This indicates that ethylamine can enhance the drought resistance of tea trees.

[0063] Comparison Example

[0064] Polyamines are a class of compounds containing two or more amino groups. Their synthesis primarily uses ornithine and arginine as raw materials, with ornithine decarboxylase and arginine decarboxylase being key enzymes. The most common and physiologically important polyamines are putrescine, spermidine, and spermine. Polyamines promote the growth of certain tissues and play an important role in maintaining normal membrane function. Their mechanisms of action are not yet fully understood. Their positively charged amino groups bind to negatively charged phosphate groups in DNA and RNA, promoting DNA transcription and RNA translation in plant and animal cells. They can also bind to proteins or phospholipids on membranes, maintaining membrane stability. Several documents have reported that polyamines can enhance the drought resistance of certain plants. The applicant used spermidine and spermine, the most common polyamines, in a control experiment. The experimental methods included a normal group, a drought-treated group, a drought-treated group treated with spermidine, and a drought-treated group treated with spermine. Other experimental and detection methods were the same as in Examples 1 and 2, with a treatment volume of 1 mL. The results are shown in Tables 10-12.

[0065] Table 10. Chlorophyll fluorescence values ​​of tea leaves in polyamine coating experiment

[0066]

[0067] Table 11. Raw data on the relative moisture content of tea leaves in the polyamine coating experiment.

[0068]

[0069] Table 12. Raw data of MDA values ​​of tea leaves in polyamine coating experiment

[0070]

[0071] The data from the three experiments above show that there was basically no difference in the relative water content of the leaves in the drought-affected group, the drought-affected group with spermidine, and the drought-affected group. There was also no significant difference in the MDA value and chlorophyll fluorescence value of the leaves. It can be seen that conventional drought-resistant spermidine and spermidine have no significant effect on the drought resistance of tea trees.

Claims

1. A method for improving the drought resistance of tea trees, characterized in that: The method for improving the drought resistance of tea trees specifically involves applying ethylamine at a concentration of 0.01~0.2mM to the leaves of the tea tree.

2. The method for improving the drought resistance of tea trees according to claim 1, characterized in that: The amount of ethylamine applied is 0.1~2 mL.

3. The method for improving the drought resistance of tea trees according to claim 1, characterized in that: The leaves specifically refer to the first to fifth leaves of the cuttings. The first leaf is counted from the terminal bud of the tea tree. The first leaf is called the first leaf, the second leaf is called the second leaf, the third leaf is called the third leaf, the fourth leaf is called the fourth leaf, and the fifth leaf is called the fifth leaf.

Citation Information

Patent Citations

  • Method for relieving oxidative stress poison resistance of heavy metal cadmium to plants by using theanine

    CN114847063A